TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4493
miRNA Sequence: AGAAGGCCUUUCCAUCUCUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51137 ------
NM_000033chrX1941 ------
NM_000038chr531579 1291 176 1168 ----
NM_000044chrX2161 55 1284 ----
NM_000051chr1183226 2620 1353 1269 1151 1062 752 179 3199 58 37 ----
NM_000052chrX52943 2367 1220 904 609 22619 2166 1544 --
NM_000080chr172276 226 1963 ----
NM_000081chr141697 1171 617 500 11579 ----
NM_000084chrX76523 5880 5609 5555 2351 719 444 --25295 4628 15243
NM_000089chr71325 ------
NM_000090chr21667 ------
NM_000092chr223702 258 13450 --13328
NM_000093chr921739 539 --12363 1628
NM_000125chr653536 3206 2709 1555 180 --31566 696 123 --
NM_000129chr621309 392 11330 ----
NM_000138chr1542518 2412 1843 929 1329 ----
NM_000141chr101305 21240 587 11051 --
NM_000142chr41372 1564 2503 274 --
NM_000161chr142758 69 ------
NM_000163chr52361 134 ------
NM_000165chr651496 1203 518 432 293 ------
NM_000168chr752704 2537 2370 1226 200 13305 ----
NM_000176chr532644 631 498 13238 ----
NM_000177chr9269 40 ------
NM_000189chr222238 100 ------
NM_000190chr111225 ------
NM_000202chrX32611 2520 1192 13830 ----
NM_000208chr1944713 4306 1161 48 21339 587 ----
NM_000214chr2041664 1568 433 292 ------
NM_000217chr1254737 4298 3338 1271 764 21659 187 24683 3983 1800
NM_000222chr411942 11580 --1372
NM_000228chr1280 43 1285 ----
NM_000237chr831866 1698 684 --1403 --
NM_000242chr1032630 373 289 ------
NM_000248chr331081 880 267 --21187 586 --
NM_000252chrX1145 ------
NM_000259chr1596233 5214 4672 4158 4016 4003 1447 1380 651 1302 12482 --
NM_000264chr9----11243 --
NM_000267chr1752747 2391 2275 373 187 12470 ----
NM_000280chr113987 686 640 182 ----
NM_000304chr17--1869 ----
NM_000314chr1033008 2980 2253 ------
NM_000319chr121938 --1121 --
NM_000321chr1331611 1438 349 ------
NM_000329chr12896 294 ------
NM_000330chrX51836 1592 1395 413 160 --22055 1797 --
NM_000332chr696126 4618 2846 2492 1882 1740 1708 1237 287 26616 6333 26237 4754 --
NM_000333chr3190 ------
NM_000335chr341362 840 102 42 --2652 94 2495 319
NM_000337chr566507 5098 4825 4468 4132 52 --24791 43 14155
NM_000345chr43961 216 125 ------
NM_000346chr1751361 1222 754 712 608 ------
NM_000353chr16157 --11030 --
NM_000362chr2273419 2383 2347 2316 1290 881 720 --11276 --
NM_000368chr931904 374 78 --31646 1404 900 --
NM_000378chr11--159 ----
NM_000379chr241269 414 38 25 11517 --1434
NM_000390chrX63205 2389 2298 2187 519 317 ------
NM_000391chr1151663 1494 523 498 290 --21110 452 --
NM_000394chr212430 80 ------
NM_000399chr101123 ------
NM_000408chr242712 2471 2440 109 23423 2634 ----
NM_000411chr2132028 1214 1174 ------
NM_000428chr144953 738 264 60 1133 ----
NM_000430chr1733016 703 416 --13422 --
NM_000434chr6--248 34 ----
NM_000447chr1--1431 ----
NM_000449chr121043 196 ------
NM_000458chr171915 ------
NM_000461chr354336 3939 1665 987 454 14031 24071 3272 1448
NM_000462chr1531685 1300 369 31730 1528 730 ----
NM_000484chr213829 678 125 11069 --1754
NM_000486chr1231989 654 246 1884 22826 1000 --
NM_000489chrX23043 2406 13411 ----
NM_000503chr831810 1556 147 ------
NM_000523chr21833 1743 160 --
NM_000525chr1151302 1284 1077 1030 629 ------
NM_000530chr13887 756 266 --1379 --
NM_000533chrX31244 704 89 ------
NM_000539chr31300 11475 11008 --
NM_000555chrX65899 5892 5484 5136 4786 339 199 27683 3158 --
NM_000557chr20121 ------
NM_000559chr11--128 ----
NM_000587chr53979 274 223 ------
NM_000594chr62635 299 ------
NM_000595chr61126 1151 ----
NM_000598chr731534 492 418 1555 ----
NM_000601chr71334 ------
NM_000610chr1162638 2449 1112 1011 442 196 22295 797 1262 --
NM_000611chr11106129 4792 2710 1919 1900 1392 736 704 637 54 35851 4534 425 16120 11042
NM_000615chr1172801 2500 2215 1922 1144 1102 786 1152 12898 --
NM_000620chr1242020 1875 1710 1370 1543 12035 --
NM_000633chr1844881 1388 1358 375 23580 178 23417 451 --
NM_000701chr11239 ------
NM_000719chr1254977 2376 1076 788 24 21992 113 26561 2134 --
NM_000721chr152328 2219 1986 1651 292 12108 ----
NM_000726chr2--11368 ----
NM_000794chr52833 126 ------
NM_000800chr521261 170 ----11473
NM_000801chr2031126 989 706 --1718 --
NM_000806chr511518 ------
NM_000807chr41216 ------
NM_000809chr487410 6865 6603 3676 2524 1994 1179 1166 18244 13222 --
NM_000810chr152496 65 ------
NM_000811chr51282 ------
NM_000813chr565373 4394 3404 1947 1629 1230 11381 ----
NM_000826chr452587 2553 1656 665 587 ------
NM_000827chr532146 1789 627 22039 1849 12466 12435
NM_000831chr135526 5265 428 --24420 1693 --
NM_000833chr162555 542 11187 ----
NM_000836chr193696 265 225 ------
NM_000837chr83524 462 363 ------
NM_000838chr632754 1755 235 --1965 --
NM_000839chr31490 --1369 --
NM_000844chr31727 ------
NM_000859chr511298 11176 ----
NM_000860chr41278 21561 1301 ----
NM_000865chr61203 ------
NM_000870chr541285 1278 382 147 --21320 109 --
NM_000875chr1596619 2824 2381 2349 2194 1734 1456 1156 806 14916 15955 25127 241
NM_000876chr611229 1100 ----
NM_000883chr72647 274 ------
NM_000883chr72647 274 ------
NM_000891chr1733630 1417 1066 ------
NM_000895chr121107 ------
NM_000899chr1273796 3771 3691 3364 1542 1432 809 --11634 --
NM_000901chr431697 962 672 --1563 --
NM_000908chr51311 --1187 --
NM_000921chr12--1199 ----
NM_000933chr2021522 1194 ------
NM_000937chr171381 ------
NM_000944chr421602 232 --1360 --
NM_000945chr271853 1800 538 376 353 267 37 ------
NM_000950chrX73618 3009 2312 2251 888 486 231 12959 13270 --
NM_000956chr141283 --1230 --
NM_000958chr521205 137 ------
NM_000960chr192497 37 ------
NM_000961chr2063886 2999 1252 390 240 73 1322 1704 --
NM_000962chr952597 825 750 705 79 12384 ----
NM_000964chr173874 57 46 --11374 --
NM_000965chr331247 994 382 1482 ----
NM_000966chr122894 754 ------
NM_001001132chr2131442 537 134 1321 1274 --
NM_001001323chr1263149 2886 2602 2144 456 347 --12572 --
NM_001001330chr102353 327 --11187 --
NM_001001331chr3157 --12477 --
NM_001001389chr1162638 2449 1112 1011 442 196 22295 797 1262 --
NM_001001390chr1162638 2449 1112 1011 442 196 22295 797 1262 --
NM_001001391chr1162638 2449 1112 1011 442 196 22295 797 1262 --
NM_001001392chr1162684 2495 1158 1057 488 242 22341 843 1308 --
NM_001001395chr1242384 844 800 423 11873 ----
NM_001001419chr564682 4282 3783 1902 1760 1071 ------
NM_001001420chr564682 4282 3783 1902 1760 1071 ------
NM_001001433chr2011291 13003 ----
NM_001001438chr211133 1127 --147
NM_001001481chr81780 ------
NM_001001483chr11--1429 ----
NM_001001484chr1021665 145 --1624 --
NM_001001523chr13996 533 402 --1150 --
NM_001001549chr742615 2567 1059 623 1940 ----
NM_001001550chr742615 2567 1059 623 1940 ----
NM_001001555chr742615 2567 1059 623 1940 ----
NM_001001557chr851638 1447 360 332 169 1766 ----
NM_001001664chr273785 3175 2773 2669 2620 1141 209 ------
NM_001001669chr522455 852 ------
NM_001001852chr221148 --1285 --
NM_001001890chr2174245 3363 3296 3100 2977 1515 44 24048 1477 ----
NM_001001938chr9104052 3979 3673 3117 2612 1552 928 331 264 257 --13798 --
NM_001001995chrX1679 ------
NM_001002243chr21908 ------
NM_001002252chr12125 --163 --
NM_001002255chr61322 ------
NM_001002257chr253522 2346 1216 1111 270 13138 ----
NM_001002265chr102803 277 ------
NM_001002266chr102803 277 ------
NM_001002295chr101793 11115 ----
NM_001002838chrX21266 356 ------
NM_001002843chr152482 336 ------
NM_001002857chr15--1323 1164 --
NM_001002858chr15--1323 1164 --
NM_001002860chr1483757 3618 3289 3281 3056 1484 1370 687 24392 1230 22949 1666 --
NM_001002909chr1782117 1839 1649 1487 1431 1386 431 425 22024 170 ----
NM_001002926chr72632 138 2848 535 1476 --
NM_001003406chr2273015 2958 2932 2255 1199 1021 366 11286 ----
NM_001003652chr18138444 8376 7473 7206 6932 6141 5899 3431 2977 2363 2176 1830 554 28625 3266 38013 6896 1144 --
NM_001003674chr1855628 4684 2691 1653 132 16658 12747 --
NM_001003675chr1855628 4684 2691 1653 132 16658 12747 --
NM_001003678chr11189 ------
NM_001003688chr42989 436 ------
NM_001003694chr31106 ------
NM_001003698chr621633 1235 --11679 --
NM_001003699chr621633 1235 --11679 --
NM_001003712chr1243021 2748 1401 77 12792 --11021
NM_001003760chr61150 23174 2859 ----
NM_001003792chr31416 ----1188
NM_001003793chr31416 ----1188
NM_001003800chr963530 1219 1138 894 774 479 33612 2724 2284 1860 --
NM_001003805chr14164 148 ----
NM_001003891chr221111 ------
NM_001003937chr231677 1451 661 ------
NM_001003940chr15103802 3796 3636 2978 2713 1511 1245 1092 849 426 --33349 498 210 11536
NM_001003942chr15103802 3796 3636 2978 2713 1511 1245 1092 849 426 --33349 498 210 11536
NM_001003943chr15103806 3800 3640 2982 2717 1515 1249 1096 853 430 --33353 502 214 11540
NM_001003945chr92342 318 ------
NM_001003954chr8141 ------
NM_001004065chr953304 2930 2735 2714 1008 --13385 --
NM_001004106chr51675 --1241 --
NM_001004127chr132249 172 ------
NM_001004128chr14560 478 173 48 1438 ----
NM_001004196chr31503 ------
NM_001004304chr1233269 2164 836 1772 11013 --
NM_001004308chrX11486 ------
NM_001004317chr634428 3375 311 13363 ----
NM_001004342chr1106020 5796 5270 5019 4760 4521 4123 1863 1637 1612 24062 4024 35600 2043 960 --
NM_001004360chr232008 1767 1700 --11740 --
NM_001004419chr1244251 4158 857 358 13634 ----
NM_001004439chr152842 112 ------
NM_001004441chr551603 1473 1373 1072 670 ------
NM_001004720chr221032 60 ------
NM_001004722chr221201 229 ------
NM_001005158chr31395 ------
NM_001005159chr31395 ------
NM_001005242chr1231650 230 166 ------
NM_001005266chr15----1619 --
NM_001005267chr15----1619 --
NM_001005268chr15----1619 --
NM_001005269chr15----1619 --
NM_001005271chr171916 --1261 1409
NM_001005273chr171916 --1261 1409
NM_001005360chr193696 612 578 --1329 --
NM_001005361chr193696 612 578 --1329 --
NM_001005362chr193696 612 578 --1329 --
NM_001005366chr124749 649 47 22 ----172
NM_001005375chrY11536 --11370 --
NM_001005386chr221785 38 2475 351 1604 11873
NM_001005404chr1743345 2798 828 109 14424 ----
NM_001005463chr1012289 1660 --11029
NM_001005473chr546494 5415 4674 1104 26222 5930 ----
NM_001005474chr331373 1025 426 1263 ----
NM_001005502chr1264758 3438 3430 2043 1699 572 ------
NM_001005505chr321391 53 ------
NM_001005527chr3--1286 ----
NM_001005609chrX83846 3693 2565 1217 1125 1074 830 644 13431 ----
NM_001005611chrX1120 ------
NM_001005732chr21165 ------
NM_001005733chr21165 ------
NM_001005739chr23672 636 579 ------
NM_001005743chr1431281 1084 239 ------
NM_001005744chr1431281 1084 239 ------
NM_001005745chr1431281 1084 239 ------
NM_001005746chr2--11368 ----
NM_001005747chr2--11368 ----
NM_001005781chr21486 ------
NM_001005782chr21935 ------
NM_001005845chr821834 471 1418 132 --
NM_001005861chr33721 659 111 ------
NM_001005910chr32497 428 1272 ----
NM_001005911chr32497 428 1272 ----
NM_001006115chr342170 2123 1745 827 --1457 --
NM_001006600chr51478 ------
NM_001006610chr1631008 850 767 ------
NM_001006617chr931315 549 218 ------
NM_001006619chr931315 549 218 ------
NM_001006620chr931315 549 218 ------
NM_001006621chr931315 549 218 ------
NM_001006634chr16--199 2214 142 --
NM_001006641chr941778 1576 1240 587 ------
NM_001006642chr941778 1576 1240 587 ------
NM_001006643chr941778 1576 1240 587 ------
NM_001006657chr232737 497 457 ------
NM_001006665chr13751 291 164 --1803 --
NM_001006684chrX140 ------
NM_001006933chrX156 ------
NM_001006944chr112696 639 ------
NM_001006946chr221383 1293 ------
NM_001007024chr1723153 336 139 23731 3385 --
NM_001007025chr1723153 336 139 23731 3385 --
NM_001007067chr83970 437 82 ------
NM_001007068chr83970 437 82 ------
NM_001007069chr83970 437 82 ------
NM_001007070chr83970 437 82 ------
NM_001007072chr151102 ------
NM_001007156chr1521776 1445 --11580 --
NM_001007214chr13774 348 116 ------
NM_001007226chr1721376 1115 ------
NM_001007227chr1721376 1115 ------
NM_001007228chr1721376 1115 ------
NM_001007229chr1721376 1115 ------
NM_001007230chr1721376 1115 ------
NM_001007237chr142564 2436 2088 1933 1975 --12125
NM_001007246chr2121926 1192 ------
NM_001007250chr1--1814 132 --
NM_001007257chr11464 ------
NM_001007279chr222124 99 --2107 52 --
NM_001007464chr6--1131 ----
NM_001007466chr675026 4518 3950 3256 1223 1133 134 13275 2147 55 14248
NM_001007553chr121188 1057 ------
NM_001007559chr184795 696 176 153 --11872 --
NM_001007565chr31331 ------
NM_001008222chrX1122 ----1461
NM_001008225chr7------1184
NM_001008239chr1863734 3502 798 564 557 298 22741 2371 ----
NM_001008388chr4158 --1409 --
NM_001008392chr342878 2735 2591 405 --23164 1343 --
NM_001008393chr442780 2646 2280 1810 12162 ----
NM_001008397chr51151 1694 ----
NM_001008408chr775949 5804 5515 5333 4027 466 438 --35606 1501 1019 45779 4925 4859 2148
NM_001008410chr222078 845 12237 ----
NM_001008529chr1721323 93 11134 11054 --
NM_001008541chr101605 11866 12121 12143
NM_001008541chr101605 11866 12121 12143
NM_001008564chr1311876 --1414 --
NM_001008566chr221333 --1428 --
NM_001008701chr1952837 2730 2491 2152 358 --22827 1017 --
NM_001008703chr6143 ------
NM_001008704chr6143 ------
NM_001008707chr141330 ------
NM_001008726chr1421194 262 ----1158
NM_001008738chr542669 2017 1104 169 1630 ----
NM_001008925chr4----23123 236 --
NM_001009184chr83524 462 363 ------
NM_001009552chr8248 24 ------
NM_001009555chr421419 1096 11656 11735 --
NM_001009565chr23437 427 46 1595 ----
NM_001009566chr1133 ------
NM_001009880chr2294541 4248 3586 3263 3201 3137 1244 858 559 13950 21302 647 --
NM_001009894chr1211548 1576 ----
NM_001009899chr3115255 4993 4716 4591 4268 4208 4077 2520 2190 1544 893 36192 5863 546 25047 686 --
NM_001009955chr11443 ------
NM_001009955chr11443 ------
NM_001009958chr72462 233 ------
NM_001009959chr231633 496 479 2666 658 1531 --
NM_001009993chr274361 3673 2895 1765 1600 191 74 --13776 --
NM_001010000chr1852815 1282 742 481 190 33499 2905 447 ----
NM_001010852chr6----1144 --
NM_001010861chr121072 869 ------
NM_001010888chrX54236 4101 3610 1297 1176 14151 --13463
NM_001010891chr586260 5112 2715 990 662 437 423 294 11472 14985 --
NM_001010895chr9183 ------
NM_001010897chr131391 ------
NM_001010917chr1062172 2064 1469 636 226 48 --22004 599 --
NM_001010923chr6167 --11641 --
NM_001010932chr71334 ------
NM_001010971chr12315 277 1655 121 --
NM_001010986chrX42495 2450 833 224 1158 11978 --
NM_001010989chr16131 ------
NM_001010990chr16131 ------
NM_001011513chr433869 3327 984 12535 ----
NM_001011515chr41947 11040 ----
NM_001011516chr41947 11040 ----
NM_001011537chr332056 689 456 ----1382
NM_001011546chr20--1675 ----
NM_001011645chrX2161 55 1284 ----
NM_001011663chr101954 ------
NM_001011666chr766052 4752 4408 1261 1171 488 12114 --1124
NM_001011713chr1411066 31304 1031 603 1652 --
NM_001011885chr1521140 496 ------
NM_001012264chr143698 667 152 ------
NM_001012393chr1145003 3430 1732 886 34446 3686 1340 22041 1394 --
NM_001012418chr6124227 3954 3754 3723 3653 3206 2855 2703 1685 1324 1212 448 21381 908 ----
NM_001012420chr1532033 2002 569 12374 --1187
NM_001012423chr1532033 2002 569 12374 --1187
NM_001012426chr673373 3145 2851 2536 1042 465 210 12148 ----
NM_001012427chr673373 3145 2851 2536 1042 465 210 12148 ----
NM_001012512chr181207 ------
NM_001012513chr181218 ------
NM_001012732chr4265 44 11029 11151 --
NM_001012751chr1021812 1527 ------
NM_001012753chr192815 377 5900 462 276 194 110 --127
NM_001012755chrX21795 1776 24312 3629 --1249
NM_001012756chr1942986 2895 2677 2550 ------
NM_001012968chrX42768 2661 2196 888 ------
NM_001012980chrX2158 69 ------
NM_001013031chr1041101 1082 695 535 1759 ----
NM_001013398chr731534 492 418 1555 ----
NM_001013437chr18127 152 ----
NM_001013438chr31755 1915 ----
NM_001013439chr31601 1761 ----
NM_001013615chr121008 240 21126 168 ----
NM_001013635chr1211180 1906 ----
NM_001013693chr142238 924 617 233 --1427 1315
NM_001013693chr142238 924 617 233 --1427 1315
NM_001013699chr121411 ------
NM_001013703chr15--1503 ----
NM_001013839chr1732477 632 242 12600 12129 22577 2295
NM_001014434chr11248 ------
NM_001014442chr131107 --126 --
NM_001014797chr1057767 7317 5606 5136 2873 --22116 1328 --
NM_001014831chr19----1516 --
NM_001014832chr19----1516 --
NM_001014834chr19----1516 --
NM_001014835chr19----1516 --
NM_001014839chr13879 132 125 ------
NM_001014841chr13879 132 125 ------
NM_001015048chr1452683 2447 1275 461 325 33184 2771 69 22542 1035 1808
NM_001015049chr1452683 2447 1275 461 325 33184 2771 69 22542 1035 1808
NM_001015877chrX23041 1006 ------
NM_001015880chr1031274 1161 303 11550 ----
NM_001015881chrX21120 513 ------
NM_001015887chr311282 11537 ----
NM_001017368chr1762746 2181 1963 1834 305 161 22305 1065 2850 451 --
NM_001017369chr45956 401 342 300 97 --1713 --
NM_001017371chr231224 883 485 ------
NM_001017395chr353280 3138 1352 1022 886 11360 43074 3009 2545 529 13185
NM_001017396chr231375 807 675 ------
NM_001017402chr1280 43 1285 ----
NM_001017405chr42743 63 ------
NM_001017423chr10------141
NM_001017424chr141666 1211 451 247 ------
NM_001017425chr141666 1211 451 247 ------
NM_001017440chr7126874 2816 2328 1914 1639 1625 1612 1546 1450 1091 731 618 27583 209 36249 679 488 46040 2293 1177 582
NM_001017523chr1221893 60 11432 21318 303 --
NM_001017916chr1751598 633 251 143 38 165 1469 --
NM_001017917chr1751598 633 251 143 38 165 1469 --
NM_001017922chr11424 21069 622 --11514
NM_001017923chr14162 --1257 --
NM_001017926chr841665 1439 1427 1149 11334 ----
NM_001017928chr3----196 --
NM_001017930chrX2225 109 ------
NM_001017969chr91177 ------
NM_001017977chr11372 ------
NM_001017989chr1941056 947 826 22 --1806 1854
NM_001017995chr594466 4262 3676 1905 744 464 236 230 46 14343 13264 --
NM_001018003chr83476 281 139 ------
NM_001018005chr151143 ------
NM_001018054chr12906 380 --1898 --
NM_001018064chr941982 442 362 282 1627 ----
NM_001018065chr964991 3953 619 416 306 168 34475 3819 1625 15471 14658
NM_001018066chr964991 3953 619 416 306 168 34475 3819 1625 15471 14658
NM_001018072chr1221893 60 11432 21318 303 --
NM_001018074chr532644 631 498 13238 ----
NM_001018075chr532644 631 498 13238 ----
NM_001018076chr532644 631 498 13238 ----
NM_001018077chr532644 631 498 13238 ----
NM_001018078chr95672 471 444 129 78 --192 --
NM_001018100chr15--1639 ----
NM_001018108chr1561997 1550 1482 1418 901 725 2886 417 ----
NM_001018111chr743844 1389 430 139 11084 33587 1123 1054 --
NM_001020658chr131363 644 169 ------
NM_001020658chr131363 644 169 ------
NM_001020825chr51119 ------
NM_001023567chr152626 572 ------
NM_001023587chr33865 141 44 ------
NM_001024094chr532644 631 498 13238 ----
NM_001024218chr141667 ------
NM_001024226chr13933 351 162 11093 ----
NM_001024227chr13933 351 162 11093 ----
NM_001024228chr13933 351 162 11093 ----
NM_001024372chr841822 922 901 288 ----1596
NM_001024382chr111225 ------
NM_001024465chr6159 ------
NM_001024649chr532019 1976 910 22105 847 1779 --
NM_001024660chr331260 365 194 --11093 --
NM_001024666chrX2646 247 ------
NM_001024668chr122791 289 1684 ----
NM_001024680chr231465 1365 30 ------
NM_001024808chr1242489 1099 860 410 --22319 382 --
NM_001024809chr173874 57 46 --11374 --
NM_001024858chr1462402 1849 604 248 156 61 1530 11966 11840
NM_001024934chr6196 ------
NM_001024935chr6196 ------
NM_001024936chr6196 ------
NM_001024937chr173732 159 94 ------
NM_001024948chr133145 2232 224 22924 946 --11248
NM_001024956chr1165122 4733 2214 1719 1669 590 1346 ----
NM_001025068chr33522 487 274 21593 1464 ----
NM_001025069chr33522 487 274 21593 1464 ----
NM_001025070chr5--142 ----
NM_001025071chr5--142 ----
NM_001025076chr1096226 5225 4976 4242 4209 2210 2018 1254 39 25208 4675 12440 --
NM_001025077chr1087584 6583 6334 5600 5567 2612 1006 39 26566 6033 14774 --
NM_001025079chr353487 2646 2524 303 80 13445 ----
NM_001025201chr22708 190 ------
NM_001025232chr122142 45 ------
NM_001025233chr1222263 2032 1409 1908 --
NM_001025266chr3104711 4374 4273 4013 3929 3700 3654 3493 3253 1954 ----11774
NM_001025366chr6--1468 ----
NM_001025366chr6--1468 ----
NM_001025367chr6--1468 ----
NM_001025367chr6--1468 ----
NM_001025368chr6--1468 ----
NM_001025368chr6--1468 ----
NM_001025369chr6--1484 ----
NM_001025369chr6--1484 ----
NM_001025370chr6--1468 ----
NM_001025370chr6--1468 ----
NM_001025579chr1721069 817 ------
NM_001025580chrX54190 3478 1386 873 327 13363 13165 1591
NM_001025595chr431480 1469 644 ------
NM_001025596chr111463 1389 137 --
NM_001025603chr121043 196 ------
NM_001025616chr4--21528 338 ----
NM_001025780chr931495 1372 1128 1109 ----
NM_001029858chr63771 697 658 ------
NM_001029859chr1131643 676 59 ------
NM_001029863chr632624 2239 2037 ------
NM_001029875chr532407 551 525 12676 ----
NM_001029882chr1------149
NM_001029882chr1------149
NM_001030006chr1722688 285 1632 ----
NM_001030007chr1662928 2481 1281 1252 583 530 13134 ----
NM_001030055chr1463934 3764 2964 1149 790 385 23978 3559 ----
NM_001030287chr16948 468 290 232 185 87 ------
NM_001031623chr6134 1129 ----
NM_001031679chr1242582 2309 1231 420 --1429 2639 335
NM_001031690chr772390 2337 2238 991 830 375 25 ------
NM_001031695chr22115422 5382 5177 5073 4346 3570 1598 618 595 502 487 35236 1230 206 11420 12144
NM_001031702chr31344 136 ----
NM_001031717chr32906 629 ------
NM_001031732chr453228 2795 1105 1076 656 1552 11283 11298
NM_001031804chr1654164 2735 1431 1143 828 --13461 --
NM_001032280chr6--1584 ----
NM_001032283chr122871 253 ------
NM_001032284chr122871 253 ------
NM_001032288chr2021583 377 159 1640 11125
NM_001032293chr171593 ------
NM_001032296chr1342722 2466 2357 82 2574 160 ----
NM_001032363chr12475 204 --1246 --
NM_001032363chr12475 204 --1246 --
NM_001032380chr1011282 1319 --11979
NM_001032381chrX141 ------
NM_001032382chrX141 ------
NM_001032383chrX141 ------
NM_001032384chrX141 ------
NM_001032393chrX2700 494 ------
NM_001032999chr2044843 4081 1884 1449 --45090 4450 1784 243 15070
NM_001033057chr311582 ------
NM_001033059chr6290 61 --1373 11405
NM_001033087chr2052916 2729 2689 1016 342 23264 938 --22635 752
NM_001033088chr151325 ------
NM_001033117chr393587 3545 3399 3291 1687 1588 1140 97 61 13130 33881 1419 689 13869
NM_001033503chr51200 ------
NM_001033506chr111387 ------
NM_001033507chr121253 71 ------
NM_001033518chr742883 1999 1005 194 ------
NM_001033519chr742883 1999 1005 194 ------
NM_001033520chr742883 1999 1005 194 ------
NM_001033557chr21396 ------
NM_001033566chr171958 ------
NM_001033568chr171958 ------
NM_001033602chr1341820 1029 636 569 ------
NM_001033723chr862683 2537 2095 741 561 363 ------
NM_001033756chr6--1402 ----
NM_001033756chr6--1402 ----
NM_001033925chr1031616 176 163 11450 ----
NM_001034025chr123878 771 53 ------
NM_001034850chr5--11548 ----
NM_001034853chrX1960 11025 ----
NM_001034954chr1052452 2211 1986 791 261 12504 ----
NM_001034955chr1052452 2211 1986 791 261 12504 ----
NM_001034956chr1052452 2211 1986 791 261 12504 ----
NM_001034957chr1052452 2211 1986 791 261 12504 ----
NM_001035003chr4--1166 1538 1309
NM_001035004chr4--1166 1538 1309
NM_001035254chr962082 1902 1569 454 429 37 ------
NM_001035260chr104425 323 290 211 ------
NM_001037131chr211293 ------
NM_001037164chr741427 545 388 363 11534 --11289
NM_001037317chr121072 869 ------
NM_001037324chr31748 ------
NM_001037331chr18--1372 --131
NM_001037334chr1862212 791 669 558 324 285 ------
NM_001037339chr141418 1181 539 405 21689 486 1116 --
NM_001037340chr141418 1181 539 405 21689 486 1116 --
NM_001037341chr141418 1181 539 405 21689 486 1116 --
NM_001037341chr141418 1181 539 405 21689 486 1116 --
NM_001037582chr4153 11434 ----
NM_001037631chr22862 455 ------
NM_001037738chr53282 235 109 ------
NM_001037954chr1132374 2139 280 13371 ----
NM_001038493chr221358 1181 ------
NM_001038640chr152640 252 ------
NM_001038702chr532180 1066 137 12541 22782 961 12512
NM_001038707chr11418 12231 ----
NM_001038707chr11418 12231 ----
NM_001039029chr1231856 1765 1379 ------
NM_001039091chrX2392 211 ------
NM_001039350chr721507 677 ------
NM_001039465chr141213 --129 --
NM_001039490chr112474 147 --1557 --
NM_001039538chr252730 2723 980 337 214 22594 1070 ----
NM_001039547chr387790 7750 5003 2922 1805 1698 599 586 1946 27008 5871 15819
NM_001039550chr2153 --1692 --
NM_001039570chr2274489 4359 4180 4059 3825 3368 1144 ------
NM_001039571chr2274489 4359 4180 4059 3825 3368 1144 ------
NM_001039574chr11282 ------
NM_001039577chr154499 3504 1710 1464 1330 ------
NM_001039580chr431635 1591 558 23561 922 ----
NM_001039582chrX163 --1359 --
NM_001039590chrX73972 3545 3055 2940 2810 598 47 12851 ----
NM_001039591chrX73972 3545 3055 2940 2810 598 47 12851 ----
NM_001039618chr11105590 5108 4238 4034 3899 2292 2156 1648 794 563 ------
NM_001039690chr1671846 1832 1514 848 785 698 647 ------
NM_001039709chr2044843 4081 1884 1449 --45090 4450 1784 243 15070
NM_001039711chr13837 366 108 ------
NM_001039712chr13837 366 108 ------
NM_001039762chr1011639 2727 573 1146 --
NM_001039772chr113446 151 62 ------
NM_001039775chr1135 ------
NM_001039802chr111363 ------
NM_001039840chrX33888 1543 953 15332 ----
NM_001039877chr192287 178 --1601 --
NM_001039916chr123764 101 52 --1135 --
NM_001039917chr123764 101 52 --1135 --
NM_001039918chr123764 101 52 --1135 --
NM_001039919chr123764 101 52 --1135 --
NM_001039920chr123764 101 52 --1135 --
NM_001039937chr1353313 2635 1234 694 605 23582 951 ----
NM_001040057chr71537 ------
NM_001040092chr8--1352 ----
NM_001040100chr331052 139 81 ------
NM_001040113chr161877 --1813 --
NM_001040118chr112495 48 ------
NM_001040142chr211586 11804 ----
NM_001040143chr211586 11804 ----
NM_001040144chr1671846 1832 1514 848 785 698 647 ------
NM_001040146chr1671846 1832 1514 848 785 698 647 ------
NM_001040152chr733887 1930 1652 21889 1736 --13220
NM_001040153chr131929 ------
NM_001040158chr51136 ------
NM_001040159chr41405 ------
NM_001040167chr72882 375 ------
NM_001040172chr541285 1278 382 147 --21320 109 --
NM_001040173chr541285 1278 382 147 --21320 109 --
NM_001040181chr341008 959 930 766 ------
NM_001040182chr341008 959 930 766 ------
NM_001040183chr341008 959 930 766 ------
NM_001040199chr341008 959 930 766 ------
NM_001040200chr341008 959 930 766 ------
NM_001040260chr431145 789 192 --1386 --
NM_001040261chr431145 789 192 --1386 --
NM_001040272chr9178 ------
NM_001040284chr1685960 5080 4120 1621 1507 1241 313 26 15608 --14387
NM_001040402chr431042 972 832 22531 949 ----
NM_001040409chr22744 315 ------
NM_001040429chr1333131 2294 121 12896 --12923
NM_001040439chr1621435 485 1124 1539 --
NM_001040440chr52646 156 ------
NM_001040441chr143347 3330 1276 141 ------
NM_001040455chr111251 11047 2840 271 --
NM_001040619chr131398 635 537 ------
NM_001040624chr842361 1859 372 132 1148 ----
NM_001040625chr842361 1859 372 132 1148 ----
NM_001040626chr842361 1859 372 132 1148 ----
NM_001040627chr842361 1859 372 132 1148 ----
NM_001040628chr842361 1859 372 132 1148 ----
NM_001040629chr842361 1859 372 132 1148 ----
NM_001040630chr842361 1859 372 132 1148 ----
NM_001040708chr8----11016 --
NM_001040709chr15547 537 424 266 114 --2969 643 12021
NM_001040712chr913334 12777 ----
NM_001040875chr832330 2281 441 ------
NM_001042355chr1644473 4256 752 366 14873 11603 --
NM_001042357chr103585 111 89 ----11464
NM_001042358chr103585 111 89 ----11464
NM_001042360chr103585 111 89 ----11464
NM_001042363chr103585 111 89 ----11464
NM_001042388chr183350 272 87 ------
NM_001042389chr103585 111 89 ----11464
NM_001042390chr103585 111 89 ----11464
NM_001042392chr103585 111 89 ----11464
NM_001042395chr103585 111 89 ----11464
NM_001042404chr131376 238 123 --11894 --
NM_001042412chr1644473 4256 752 366 14873 11603 --
NM_001042414chr13--154 ----
NM_001042424chr463286 2381 2144 826 394 366 --12739 --
NM_001042425chr6--1584 ----
NM_001042453chrX31127 347 99 ------
NM_001042481chr1412695 2955 277 ----
NM_001042486chr202317 158 --1511 --
NM_001042492chr1752747 2391 2275 373 187 12470 ----
NM_001042498chrX1120 --1292 --
NM_001042510chr811405 12004 ----
NM_001042511chr811405 12004 ----
NM_001042533chr353067 3055 2569 755 308 --1638 --
NM_001042537chrX2927 468 11966 ----
NM_001042555chr1254243 3109 483 394 335 1561 ----
NM_001042599chr267823 7685 7159 6344 6185 704 26292 3096 178 --
NM_001042601chr31835 ------
NM_001042603chr12125145 4767 4657 4021 3511 3453 3395 3337 1823 740 342 204 ----1116
NM_001042632chr2021939 599 --1182 --
NM_001042633chr2021939 599 --1182 --
NM_001042669chr4--21528 338 ----
NM_001042683chr621273 716 21458 1167 --1411
NM_001042728chr122894 754 ------
NM_001042749chrX1259 ----11464
NM_001042750chrX1259 ----11464
NM_001042751chrX1259 ----11464
NM_001042762chr73355 177 42 ------
NM_001043318chr1483918 3795 3242 3163 2828 1117 702 157 23401 1531 13472 --
NM_001043351chr12775 117 --11807 --
NM_001044305chr611517 ------
NM_001044385chr223705 3282 33874 1268 400 ----
NM_001046chr52462 337 2405 321 ----
NM_001048183chr153770 3493 3375 2888 502 ------
NM_001049chr1432225 597 156 --21597 744 1230
NM_001065chr12150 ----1494
NM_001068chr3157 ------
NM_001071775chr1311484 11207 ----
NM_001077628chr12262 205 ------
NM_001083620chr452585 2551 1655 664 586 ------
NM_001084chr7142 ------
NM_001092chr1731733 635 473 --2528 388 --
NM_001099678chr334331 2127 2112 --12252 --
NM_001100108chr188327 8318 7138 3080 2946 2274 1017 833 16534 11415 --
NM_001106chr3198747 8427 7868 7801 7638 7209 6329 6163 3770 3433 2865 2799 2517 2429 2107 1716 1547 870 338 --23789 3074 16786
NM_001109977chr41716 --1174 --
NM_001113490chrX53549 3373 2905 2583 801 2727 615 ----
NM_001116chr1642289 1959 314 76 1257 ----
NM_001117chr1832077 2067 640 ------
NM_001121chr101196 --1295 --
NM_001122631chr111562 ------
NM_001126chr11191 1927 ----
NM_001127chr222959 29 ------
NM_001128chr1662928 2481 1281 1252 583 530 13134 ----
NM_001130chr192886 175 ------
NM_001131chr62337 309 ------
NM_001135chr151280 ------
NM_001143chrY--150 ----
NM_001144chr162896 131 ------
NM_001146chr821573 247 ------
NM_001148chr411691 --11940 --
NM_001157chr102201 133 ------
NM_001167chrX86704 5901 4600 4580 2455 1939 1337 366 --1824 --
NM_001173chr1463934 3764 2964 1149 790 385 23978 3559 ----
NM_001174chrX1308 ------
NM_001186chr2152521 1272 579 552 533 --12607 --
NM_001191chr201404 --1943 --
NM_001198chr652340 2188 976 789 308 --12038 --
NM_001201chr443748 3622 1196 1100 43381 1306 1248 948 ----
NM_001204chr267069 6744 4725 2029 1843 540 25300 1038 --16572
NM_001206chr952838 2444 2370 2283 2137 ------
NM_001212chr17141 ------
NM_001219chr732023 1812 863 --11741 --
NM_001221chr4----130 --
NM_001222chr1031737 1409 369 ------
NM_001233chr742327 932 826 155 ------
NM_001235chr111637 ------
NM_001237chr42824 353 ------
NM_001237chr42824 353 ------
NM_001238chr191466 ------
NM_001241chr231863 742 457 1836 12034 --
NM_001241chr231863 742 457 1836 12034 --
NM_001253chr6------1261
NM_001254chr1721133 177 2966 61 ----
NM_001256chr1732888 2487 2178 12781 ----
NM_001257chr1631410 1368 1264 11400 ----
NM_001259chr7106357 6230 5011 4707 3953 2201 1736 1048 576 124 45474 1215 894 734 25497 110 --
NM_001265chr133970 871 219 ----1311
NM_001268chr132149 30 ------
NM_001275chr141259 ------
NM_001278chr10--1292 ----
NM_001280chr192697 445 ------
NM_001282chr1722688 285 1632 ----
NM_001283chr72275 261 1671 1603 1487
NM_001286chr182901 2646 2495 2309 2217 822 734 595 ------
NM_001289chrX1599 ----1184
NM_001290chr4------1217
NM_001293chr111450 ------
NM_001304chr1763251 2486 2459 2435 1079 341 23713 1509 1578 --
NM_001308chr10136 ------
NM_001310chr1232995 2450 2096 1470 ----
NM_001315chr622058 1694 1730 21448 52 --
NM_001319chr1911104 ------
NM_001329chr10193 ------
NM_001331chr1172828 1934 1784 1120 1080 1061 146 --1316 --
NM_001332chr51477 ------
NM_001343chr53319 209 50 ----11077
NM_001351chr331510 1158 525 --11344 --
NM_001356chrX1516 1317 ----
NM_001357chr1--1254 1280 --
NM_001358chr4------1103
NM_001364chr1173773 1440 1086 1039 390 218 79 12986 32931 2896 266 --
NM_001365chr173760 617 556 ------
NM_001386chr842012 1801 1708 397 2657 322 ----
NM_001387chr512121 1728 12921 --
NM_001389chr21----1476 --
NM_001390chr1831184 1012 992 --13089 11079
NM_001396chr2142614 836 817 323 --1956 --
NM_001397chr122306 1967 1326 ----
NM_001399chrX83846 3693 2565 1217 1125 1074 830 644 13431 ----
NM_001402chr611661 ----11798
NM_001408chr131493 1467 147 ------
NM_001412chrX23375 953 --13142 --
NM_001417chr1211629 1173 ----
NM_001418chr111499 ------
NM_001418chr111499 ------
NM_001419chr1974410 4027 3744 3518 3212 3162 1379 --14580 --
NM_001421chrX21765 469 ----1200
NM_001424chr16--1733 ----
NM_001426chr21471 ------
NM_001427chr731909 1603 522 ------
NM_001429chr222900 230 ------
NM_001430chr22639 446 11678 1157 --
NM_001431chr621143 851 --1441 --
NM_001433chr17185 1846 2730 350 1808
NM_001438chr163645 2999 2957 963 851 335 1152 121 12266
NM_001440chr842772 1921 527 465 1158 ----
NM_001448chrX--11520 ----
NM_001451chr1621276 75 ----11339
NM_001453chr63462 380 350 ------
NM_001454chr172620 264 ------
NM_001458chr71669 --1643 --
NM_001460chr133321 394 214 33262 2942 2236 3606 168 148 --
NM_001465chr522133 821 11885 ----
NM_001489chr9------1212
NM_001497chr931902 1694 223 22769 1852 22516 139 22645 2579
NM_001518chr721152 924 ------
NM_001523chr191246 ----135
NM_001542chr142564 2436 2088 1933 1975 --12125
NM_001543chr573897 3749 2963 1945 1937 865 646 --33956 3575 3020 --
NM_001546chr611241 ------
NM_001555chrX126 ------
NM_001567chr112683 202 1731 ----
NM_001584chr1131011 890 283 ----11215
NM_001604chr113987 686 640 182 ----
NM_001614chr171112 ------
NM_001614chr171112 ------
NM_001616chr222702 2579 ------
NM_001621chr732963 2576 522 22956 2896 ----
NM_001621chr732963 2576 522 22956 2896 ----
NM_001634chr6290 61 --1373 11405
NM_001635chr72874 295 1887 ----
NM_001642chr112924 430 1477 ----
NM_001643chr1121 ------
NM_001650chr1863334 3014 2545 1520 1339 1012 12805 12812 --
NM_001654chrX1333 --1455 --
NM_001655chr1121879 1645 ------
NM_001656chr521858 429 ------
NM_001658chr13933 351 162 11093 ----
NM_001659chr1242553 2537 1068 398 ------
NM_001660chr31644 ------
NM_001663chr1422029 220 --1539 --
NM_001664chr31404 --180 --
NM_001665chr114499 181 146 130 ------
NM_001668chr172265 1960 1733 1483 1399 453 209 ------
NM_001670chr222628 327 1729 ----
NM_001674chr16948 468 290 232 185 87 ------
NM_001677chr11134 ------
NM_001678chr1741305 1204 267 189 11486 2632 556 --
NM_001679chr31269 148 ----
NM_001682chr1262863 2600 2316 1858 170 61 --12286 --
NM_001683chr3157 --12477 --
NM_001690chr32701 160 ------
NM_001693chr841043 928 803 457 ------
NM_001694chr162159 113 ------
NM_001695chr843923 3859 2895 868 24173 3689 --1939
NM_001701chr911050 --21354 258 --
NM_001704chr61552 ------
NM_001706chr32837 22 ------
NM_001716chr1111248 21599 1363 1521 --
NM_001729chr41319 ------
NM_001730chr1321255 224 11128 ----
NM_001730chr1321255 224 11128 ----
NM_001731chr121606 ------
NM_001735chr92401 102 --1343 --
NM_001742chr721394 714 --1540 --
NM_001743chr2154 ------
NM_001746chr532019 1976 910 22105 847 1779 --
NM_001753chr751699 1517 1432 662 562 ------
NM_001754chr2174245 3363 3296 3100 2977 1515 44 24048 1477 ----
NM_001755chr1632120 1605 623 --11963 --
NM_001759chr1295215 5204 4524 3770 3465 3272 3218 1531 875 ------
NM_001760chr64996 913 372 240 ------
NM_001777chr353487 2646 2524 303 80 13445 ----
NM_001781chr122197 89 1670 ----
NM_001789chr33564 409 300 ----11696
NM_001791chr111363 ------
NM_001792chr184290 246 121 81 ------
NM_001794chr20--1243 181 --
NM_001806chr1932786 2437 2148 --11173 12907
NM_001810chr201545 ------
NM_001822chr22708 190 ------
NM_001826chr1187 ------
NM_001829chr41902 ------
NM_001830chrX73778 3408 3175 2907 2502 1265 988 1917 ----
NM_001838chr171866 ------
NM_001839chr12182 87 ------
NM_001845chr131332 1204 11235 --
NM_001854chr12574 146 ------
NM_001858chr645115 4246 3500 3346 --1370 --
NM_001859chr933441 851 24 ----12773
NM_001873chr4163 ------
NM_001874chr1264758 3438 3430 2043 1699 572 ------
NM_001882chr5192 ------
NM_001893chr17166 ------
NM_001894chr22--140 ----
NM_001895chr202988 774 ------
NM_001901chr62675 264 ----1921
NM_001904chr331008 828 303 ------
NM_001907chr16176 ------
NM_001913chr71629 --1804 --
NM_001914chr182413 329 ------
NM_001915chr1751598 633 251 143 38 165 1469 --
NM_001921chr4265 44 11029 11151 --
NM_001923chr113608 81 43 --1100 --
NM_001930chr19125 ------
NM_001932chr171650 1622 ----
NM_001933chr1451175 1004 278 160 54 11339 ----
NM_001935chr21293 21027 179 ----
NM_001936chr721507 677 ------
NM_001938chr111715 ------
NM_001939chrX63826 3438 2675 1311 889 59 171 11129 --
NM_001945chr521299 1047 1174 ----
NM_001946chr122340 79 1389 ----
NM_001949chr62617 425 12880 ----
NM_001951chr81500 ------
NM_001956chr12445 105 ------
NM_001962chr52450 44 ------
NM_001964chr52878 776 ------
NM_001967chr31185 1386 --1422
NM_001968chr41155 ------
NM_001969chr1493496 3471 3157 2619 2449 1278 1037 991 954 ------
NM_001970chr172570 218 ------
NM_001977chr42584 331 1150 ----
NM_001978chr81865 --1721 --
NM_001981chr132157 864 316 ------
NM_001982chr124360 244 145 67 152 ----
NM_001987chr1244270 3265 682 549 13115 ----
NM_001991chr1741967 723 711 378 --152 --
NM_001995chr41970 ----166
NM_002006chr441501 696 618 285 23635 3580 24152 1432 --
NM_002009chr1552769 2540 2503 854 498 12583 ----
NM_002014chr122515 134 ------
NM_002015chr1321176 668 1324 ----
NM_002023chr141262 177 129 69 21644 1224 ----
NM_002024chrX2682 551 21928 412 ----
NM_002025chrX119104 8868 8847 8348 7875 6971 6964 6757 3217 2954 372 22889 1560 11786 15946
NM_002036chr1145 ------
NM_002037chr62317 26 2362 64 ----
NM_002040chr2111025 22940 2851 --11953
NM_002051chr101793 11115 ----
NM_002054chr2--1443 ----
NM_002063chrX31125 376 350 ------
NM_002069chr731685 635 362 ------
NM_002070chr3------1925
NM_002076chr1242483 2020 253 119 185 1886 --
NM_002077chr951670 1516 782 689 470 --11914 --
NM_002080chr162924 375 142 ----
NM_002082chr51638 1405 1204 --
NM_002083chr14--173 --1226
NM_002084chr51850 1664 ----
NM_002086chr1742032 1788 529 482 --11911 11589
NM_002088chr191137 ------
NM_002089chr41144 ------
NM_002090chr41102 ------
NM_002091chr181207 ------
NM_002092chr474588 3926 1265 1147 738 637 266 ------
NM_002094chr162156 71 ------
NM_002103chr194814 712 345 201 21017 332 ----
NM_002106chr41108 ------
NM_002107chr11479 ------
NM_002114chr61197 ------
NM_002126chr173956 546 25 23268 580 13260 --
NM_002131chr62439 358 ------
NM_002135chr122376 363 2179 60 ----
NM_002136chr121478 ------
NM_002137chr741810 1754 293 246 32005 1954 1764 ----
NM_002139chrX2566 446 ------
NM_002146chr171179 ------
NM_002147chr172920 145 --1153 --
NM_002148chr21606 ------
NM_002156chr21373 1283 ----
NM_002158chr233575 2870 782 11494 33211 3084 728 --
NM_002167chr1----1343 --
NM_002168chr15----1105 --
NM_002190chr61255 21077 895 ----
NM_002193chr22523 402 ------
NM_002196chr202903 37 ------
NM_002196chr202903 37 ------
NM_002198chr51286 --1664 --
NM_002199chr4142 ------
NM_002202chr51990 ------
NM_002204chr1711354 ----11177
NM_002205chr121279 ------
NM_002207chr3151 ------
NM_002210chr2198 ------
NM_002211chr103941 839 243 11103 ----
NM_002214chr745471 3519 2061 1893 1657 ----
NM_002222chr31234 ----11298
NM_002223chr1241086 901 647 30 ------
NM_002225chr15----271 43 --
NM_002226chr14--2806 731 ----
NM_002230chr174849 440 165 39 --1979 --
NM_002235chr1241645 1333 1139 326 11428 ----
NM_002239chr2--1394 ----
NM_002241chr143104 2969 2210 2083 1464 11015 --
NM_002247chr101906 1562 1643 --
NM_002253chr43444 203 153 11418 ----
NM_002264chr394736 4445 4229 1295 962 772 644 516 253 23581 630 14208 --
NM_002265chr171854 --1428 --
NM_002267chr1311851 2964 957 ----
NM_002268chr321620 444 ------
NM_002270chr5114364 3954 2189 1909 1850 1398 1227 1100 571 507 222 --14600 14390
NM_002271chr1362468 2181 2160 1641 1577 573 ------
NM_002282chr122244 93 1220 ----
NM_002293chr121732 940 22669 2147 ----
NM_002310chr555658 4552 1879 1814 715 25040 1253 ----
NM_002314chr731070 166 135 ------
NM_002332chr121311 1224 ----
NM_002334chr111638 1140 ----
NM_002336chr1233206 538 360 24795 454 ----
NM_002355chr1241055 253 164 119 1426 11235 --
NM_002356chr642697 2355 1000 735 ----11821
NM_002359chr17114172 3889 3783 3531 3512 3043 2987 2912 1612 1534 27 13859 ----
NM_002374chr252730 2723 980 337 214 22594 1070 ----
NM_002375chr351826 1640 380 290 24 ------
NM_002376chr14----1159 --
NM_002382chr141894 ------
NM_002383chr162790 326 ------
NM_002387chr573864 3602 3299 3225 3129 1475 503 35060 4030 279 --24118 1221
NM_002390chr172393 102 ------
NM_002395chr62196 39 ------
NM_002398chr211381 ------
NM_002399chr1511072 ------
NM_002401chr1731986 1961 873 --1853 --
NM_002408chr14129 ------
NM_002430chr2242560 888 418 288 31828 1708 699 11616 --
NM_002442chr121353 ------
NM_002444chrX51662 1434 1243 524 390 21575 672 ----
NM_002457chr111128 ------
NM_002465chr121224 ------
NM_002473chr2211041 --1382 --
NM_002480chr1231339 527 469 --11284 --
NM_002481chr1127548 7268 7214 6975 6285 5779 5576 5363 5292 2745 1378 76 21719 1418 37851 5195 3074 15672
NM_002482chr11118 1483 2279 204 --
NM_002486chr92787 85 ------
NM_002499chr1562444 2083 1764 1522 767 173 --12412 --
NM_002500chr21154 ------
NM_002501chr1931311 1195 351 --1377 11448
NM_002505chr631508 1321 190 ------
NM_002509chr202853 690 ----1788
NM_002519chr1121387 1101 ----11329
NM_002521chr1273 49 ------
NM_002522chr1753813 3128 2927 1329 400 --1359 --
NM_002537chr152683 251 --1393 1706
NM_002545chr1145003 3430 1732 886 34446 3686 1340 22041 1394 --
NM_002546chr8------185
NM_002547chrX83705 3323 1642 1366 1337 1169 923 413 1209 23078 655 --
NM_002556chr1141930 1621 819 95 ------
NM_002569chr1511294 ------
NM_002570chr152280 228 ------
NM_002572chr111399 --1348 --
NM_002576chr112290 37 ------
NM_002577chr393964 3885 3693 3503 2807 864 791 242 52 23950 3085 ----
NM_002578chrX1143 ------
NM_002581chr934860 3950 1255 1134 14445 --
NM_002583chr121243 ------
NM_002588chr521761 668 ------
NM_002594chr2051708 1618 1585 307 115 ------
NM_002595chr122384 38 --1214 --
NM_002600chr141418 1181 539 405 21689 486 1116 --
NM_002603chr82212 62 ------
NM_002607chr72879 121 ------
NM_002608chr2211523 --11578 --
NM_002609chr531185 746 129 ------
NM_002613chr16105259 3993 3957 2064 1876 1714 1311 1193 1154 614 --11258 13690
NM_002616chr17----143 --
NM_002628chr321085 384 135 ----
NM_002633chr11452 ------
NM_002641chrX11733 ------
NM_002645chr1132331 2156 576 22740 387 ----
NM_002646chr132077 1737 796 --2723 665 --
NM_002648chr621197 448 1832 ----
NM_002655chr855333 4717 3912 3682 1486 1609 24255 3738 1801
NM_002656chr611077 ------
NM_002657chr2043788 3679 2473 2441 22597 94 11143 1508
NM_002667chr62925 201 ----1435
NM_002668chrX1147 1128 ----
NM_002674chr121159 ------
NM_002677chr82794 28 12213 ----
NM_002693chr15------175
NM_002698chr1922509 1052 ------
NM_002699chr11527 ------
NM_002706chr2----1148 --
NM_002709chr232843 1278 833 --13199 --
NM_002710chr122956 736 ------
NM_002713chr1--1188 21014 261 --
NM_002714chr641047 937 831 720 ------
NM_002715chr51276 ------
NM_002716chr1163281 3000 2924 2826 2308 192 12522 --127
NM_002717chr81526 ------
NM_002718chr321843 237 21887 1660 1618 --
NM_002719chr1452337 1756 512 430 104 1953 ----
NM_002721chr92377 122 ------
NM_002730chr192972 330 ------
NM_002731chr11128 21161 391 ----
NM_002734chr1732119 1920 699 ------
NM_002736chr72512 170 ------
NM_002740chr332421 2029 1004 --22625 2155 --
NM_002741chr19----162 --
NM_002745chr2294453 4370 4021 3599 3519 1690 1394 293 158 1168 ----
NM_002747chr1861845 1812 1579 530 506 278 1179 ----
NM_002750chr101217 153 ----
NM_002755chr151214 ------
NM_002758chr172490 167 ------
NM_002760chrY75476 5440 5290 5148 1905 1702 275 24431 1995 ----
NM_002763chr1--1208 ----
NM_002764chrX6855 729 656 232 110 21 ------
NM_002765chrX2392 211 ------
NM_002773chr16----170 --
NM_002791chr141158 ------
NM_002814chrX--1288 ----
NM_002821chr64827 654 545 218 --1152 1300
NM_002822chr1211807 ------
NM_002826chr13864 782 352 1742 ----
NM_002827chr2041479 1409 554 502 ------
NM_002829chr931234 430 268 --1925 --
NM_002833chr153409 150 36 ------
NM_002834chr1263893 3368 3010 1571 647 351 --11104 11466
NM_002836chr20--139 ----
NM_002839chr913334 12777 ----
NM_002840chr121014 516 --11150 --
NM_002841chr32556 468 1711 165 --
NM_002843chr111524 --11134 --
NM_002844chr631283 988 873 21112 1023 ----
NM_002845chr181470 ------
NM_002847chr7183 ------
NM_002849chr12--2977 896 ----
NM_002850chr192785 442 1217 ----
NM_002851chr72620 169 ------
NM_002852chr3--1232 ----
NM_002854chr22----125 --
NM_002855chr1163605 3118 826 609 236 175 --11407 --
NM_002859chr1261815 1676 1494 1308 1252 583 1172 ----
NM_002860chr10------141
NM_002865chr81102 ------
NM_002866chr19137 ------
NM_002867chr1----1468 --
NM_002868chr1292402 2262 2232 2206 2103 2071 1844 804 601 --12061 1924
NM_002869chr1132145 2066 1406 1190 1594 --
NM_002871chr141978 1319 412 93 ----166
NM_002874chr962240 2230 1830 940 433 251 ------
NM_002881chr211421 ------
NM_002886chr334666 3704 930 34639 1215 1051 14974 --
NM_002892chr141605 1312 ----
NM_002893chrX2360 252 ------
NM_002894chr18--1180 ----
NM_002895chr203910 845 217 ------
NM_002897chr23765 726 550 ------
NM_002902chr151148 ------
NM_002906chr1122322 729 12427 164 --
NM_002911chr19----11444 1517
NM_002918chr193884 391 301 ------
NM_002923chr11638 ------
NM_002924chr12482 198 ------
NM_002931chr61210 ------
NM_002938chr431381 1264 344 --11335 --
NM_002941chr31206 11271 ----
NM_002945chr171848 1261 ----
NM_002953chr13751 291 164 --1803 --
NM_002955chr621633 1235 --11679 --
NM_002956chr1221258 1178 1535 ----
NM_002958chr33721 659 111 ------
NM_002959chr1104171 3679 3120 2964 2924 2884 1401 953 497 277 --23204 1109 13471
NM_002968chr16----1238 --
NM_002970chrX166 ------
NM_002971chr321018 72 ------
NM_002977chr242802 930 713 427 11095 ----
NM_002997chr221383 1293 ------
NM_002998chr852015 1932 902 451 371 --11450 --
NM_003009chr193263 152 98 ------
NM_003010chr1731885 1563 466 ------
NM_003013chr41136 ------
NM_003016chr1721785 69 11412 ----
NM_003022chrX21257 1216 ------
NM_003026chr91463 21127 412 ----
NM_003028chr963052 2935 2745 2501 1212 282 --23766 2495 --
NM_003031chr1631008 850 767 ------
NM_003036chr111157 11217 ----
NM_003043chr343991 3231 1514 1174 22892 261 22868 32 --
NM_003045chr1334583 4211 617 11514 33767 1554 361 --
NM_003048chr222388 430 22049 272 12323 --
NM_003060chr521199 1008 --199 --
NM_003068chr81850 ------
NM_003069chrX2577 298 ------
NM_003070chr92856 771 ------
NM_003071chr3199 ----1474
NM_003076chr1231413 389 85 ----1335
NM_003079chr172322 125 ------
NM_003081chr201244 ------
NM_003088chr721084 113 ------
NM_003099chr1595775 5687 5073 4784 4096 2616 1186 752 42 15784 ----
NM_003106chr31711 ------
NM_003107chr642415 2034 892 653 ------
NM_003108chr277027 5665 4408 2046 1149 674 465 ------
NM_003110chr171963 1711 ----
NM_003111chr231224 883 485 ------
NM_003112chr742177 1985 1295 1280 11996 ----
NM_003113chr2--1166 ----
NM_003128chr221890 583 ------
NM_003130chr721209 72 ------
NM_003131chr652262 2037 1480 664 61 11588 21764 344 11799
NM_003133chr1--1192 ----
NM_003137chr662017 1416 904 746 428 210 --11723 --
NM_003139chr112799 34 196 ----
NM_003142chr22243 64 ------
NM_003144chr62256 28 ------
NM_003149chr321622 1210 ------
NM_003155chr832794 1926 529 11842 1917 --
NM_003156chr1121293 366 ------
NM_003161chr1733202 2893 1260 1952 11246 --
NM_003162chr2--1254 ----
NM_003174chr102309 285 ------
NM_003178chr331985 1442 495 ------
NM_003182chr7--1492 ----
NM_003182chr7--1492 ----
NM_003185chr20149 --21104 240 --
NM_003188chr61536 ------
NM_003189chr182767 2575 2542 750 692 671 553 169 2393 149 23100 247 --
NM_003193chr11195 ------
NM_003199chr1843903 1325 1096 792 --13815 13649
NM_003200chr1951775 1583 1474 827 586 136 --11740
NM_003202chr5--11736 ----
NM_003204chr1731360 693 101 ------
NM_003211chr1221750 602 ------
NM_003216chr2233254 912 412 --12459 --
NM_003220chr6--1584 ----
NM_003221chr673636 3491 3458 3000 2893 1450 93 13187 ----
NM_003223chr162832 695 --1760 --
NM_003234chr362430 2419 956 853 607 456 --12451 --
NM_003236chr253034 1249 777 326 137 --23183 1293 1149
NM_003244chr181436 1143 ----
NM_003253chr2131543 585 242 ------
NM_003255chr1732193 2050 985 12081 11054 12168
NM_003262chr364328 4172 4047 3676 3307 321 ------
NM_003269chr621006 351 1119 --2530 422
NM_003270chrX31126 992 952 --1379 --
NM_003274chr2141833 1014 405 387 ------
NM_003275chr931182 320 26 ------
NM_003286chr201962 ------
NM_003298chr3116008 5604 5161 4961 4500 3921 2500 2187 2129 1024 206 36100 5189 2262 25306 1055 --
NM_003300chr14--168 ----
NM_003304chr321271 202 ------
NM_003314chr51470 ------
NM_003319chr21776 ------
NM_003320chr1154121 3917 2768 1499 1424 24068 3672 23567 97 --
NM_003337chr5--21133 551 ----
NM_003338chr1011951 ------
NM_003339chr541403 1392 602 87 --1649 --
NM_003340chr41443 1297 ----
NM_003342chr1742653 2566 1142 339 --22866 910 12988
NM_003345chr161205 ------
NM_003347chr221477 22107 1739 22311 2047 --
NM_003348chr1221208 456 11312 ----
NM_003349chr2021583 377 159 1640 11125
NM_003352chr21935 ------
NM_003363chr31551 ------
NM_003370chr19161 ------
NM_003373chr101470 11664 --11571
NM_003374chr51774 ------
NM_003375chr10281 48 ------
NM_003376chr6--1468 ----
NM_003376chr6--1468 ----
NM_003380chr10188 179 ----
NM_003387chr262700 1958 1899 1143 295 257 ------
NM_003390chr113344 240 202 1408 --1179
NM_003392chr333141 540 479 ------
NM_003394chr123197 175 54 ------
NM_003400chr21795 1701 ----
NM_003404chr2031360 1319 590 ------
NM_003406chr811495 31724 1432 629 ----
NM_003409chr1821248 1066 ------
NM_003410chrX31999 567 38 --1629 --
NM_003411chrY31326 1237 35 11831 11821 --
NM_003412chr332454 1113 457 1197 ----
NM_003413chrX1577 ------
NM_003420chr31315 --1259 --
NM_003430chr19--1400 --1243
NM_003432chr5----1493 --
NM_003442chr111787 ------
NM_003445chr191699 ------
NM_003452chr92662 356 ------
NM_003453chr13----1694 --
NM_003455chr1141585 1443 497 178 131 --11213
NM_003457chr171593 ------
NM_003458chr353810 3371 2627 490 381 13792 13194 --
NM_003463chr632958 1058 803 23303 687 ----
NM_003466chr222344 1659 ------
NM_003468chr253405 1566 1108 316 222 --1171 --
NM_003470chr1681649 1586 1558 1552 1177 661 563 353 195 ----
NM_003472chr6----11485 11153
NM_003474chr1051611 1541 1465 368 355 --1957 1519
NM_003478chr1133120 2852 2737 ------
NM_003482chr1212486 ------
NM_003483chr1252796 2153 2138 2062 96 --12387 --
NM_003485chr1411031 21215 44 1351 --
NM_003487chr17173 ------
NM_003489chr2133133 2831 843 1343 ----
NM_003505chr731764 1210 380 ------
NM_003507chr222009 618 21265 612 ----
NM_003557chr141531 520 353 198 11148 ----
NM_003558chr92591 262 1507 ----
NM_003559chr1763395 3190 2876 1376 1335 123 13200 ----
NM_003563chr1721376 1115 ------
NM_003566chr1242384 1068 497 72 2897 235 ----
NM_003567chr11283 ------
NM_003574chr1895131 5110 5052 3883 2050 1955 1489 1148 133 1140 15317 --
NM_003576chr1342722 2466 2357 82 2574 160 ----
NM_003581chr221032 60 ------
NM_003583chr1253051 2946 2820 2387 848 ------
NM_003586chr161613 ------
NM_003590chr243700 3252 2627 188 22461 142 12706 1352
NM_003595chr221333 --1428 --
NM_003597chr262198 1852 1657 923 441 103 --1538 --
NM_003600chr20--1299 ----
NM_003601chr4------162
NM_003607chr133670 3627 2737 2350 257 --11226
NM_003615chr383955 3827 3718 3659 3099 3042 2888 755 1280 ----
NM_003617chr114312 23201 3080 34243 1049 191 --
NM_003618chr21988 1103 ----
NM_003620chr173754 149 51 ------
NM_003626chr1141371 1123 996 370 ------
NM_003629chr163453 2940 2770 2515 1393 1336 12739 ----
NM_003630chr6--1130 ----
NM_003632chr17----1707 --
NM_003633chr521639 1013 1719 ----
NM_003637chr141358 489 275 176 1605 11495 --
NM_003644chr17154814 4746 4553 4413 4273 4231 2294 2063 1635 1556 1163 1054 809 597 383 11315 35760 5593 543 24444 1745
NM_003651chr121531 ------
NM_003658chr112580 152 ------
NM_003659chr211074 1788 ----
NM_003662chrX123 ------
NM_003663chr322546 2497 1740 12617 --
NM_003664chr5169 ------
NM_003670chr351390 541 406 296 31 21206 486 1437 --
NM_003671chr952517 1362 1068 1029 554 --12921 1347
NM_003672chr12736 109 ------
NM_003677chr1211498 --169 --
NM_003679chr132477 818 319 ------
NM_003685chr192948 378 ------
NM_003692chr9189 1206 ----
NM_003701chr1321049 808 ------
NM_003705chr21792 1825 ----
NM_003711chr52296 214 1101 ----
NM_003713chr11568 --1154 --
NM_003714chr542680 2649 566 264 --12539 1776
NM_003718chr71132 1489 ----
NM_003722chr352686 2663 2200 188 81 1197 ----
NM_003726chr171266 138 ----
NM_003735chr521761 668 ------
NM_003736chr521761 668 ------
NM_003741chr31104 ------
NM_003743chr23422 323 210 ------
NM_003744chr1431281 1084 239 ------
NM_003749chr1382312 2137 1593 1529 933 878 782 554 --1304 --
NM_003750chr101749 ------
NM_003759chr444229 3507 3369 3230 --1975 --
NM_003760chr1168 ------
NM_003763chr2011291 13003 ----
NM_003766chr17137 ------
NM_003768chr131848 1682 1284 ------
NM_003774chr1222551 736 21087 1049 1601 --
NM_003783chr11278 ------
NM_003787chr182616 88 ------
NM_003791chr161623 141 ----
NM_003794chr31125 ------
NM_003795chr61199 1107 ----
NM_003796chr19--2426 244 ----
NM_003797chr111170 ------
NM_003800chr662363 2278 2085 1843 1577 309 ------
NM_003816chr821448 85 2547 32 ----
NM_003822chr132512 2413 852 128 ----
NM_003825chr1521024 190 1295 ----
NM_003827chr19130 ------
NM_003829chr91160 ----1104
NM_003860chr112240 130 --1373 --
NM_003861chr1442850 2324 2217 910 ----1536
NM_003864chr41166 ------
NM_003870chr1522097 1890 ------
NM_003872chr273037 2787 2489 865 537 476 431 1633 ----
NM_003873chr1031941 755 123 ------
NM_003877chr123835 304 106 ------
NM_003888chr1531441 1262 55 1373 ----
NM_003895chr2131736 867 302 11895 ----
NM_003908chr2011102 ------
NM_003909chr842285 1905 742 689 12791 --12139
NM_003913chr634049 1635 350 42844 1499 1323 749 ----
NM_003916chrX--21428 1126 ----
NM_003924chr421300 115 ------
NM_003927chr183768 146 81 ------
NM_003931chr6196 ------
NM_003932chr2211360 --11529 --
NM_003939chr1063893 3713 1490 632 238 142 14002 23425 819 --
NM_003940chr3142 ------
NM_003941chr742368 2341 2303 124 11911 ----
NM_003942chr112696 639 ------
NM_003947chr31130 ------
NM_003948chr412582 --1145 --
NM_003951chrX2284 38 ------
NM_003953chr162693 2198 2063 1985 1856 1157 12257 1383 1475
NM_003956chr10146 ------
NM_003957chr1111094 --1253 --
NM_003958chr633619 494 158 11315 ----
NM_003961chr161186 ----165
NM_003977chr11------1100
NM_003980chr631323 343 235 ------
NM_003983chr1621167 101 ------
NM_003994chr1273796 3771 3691 3364 1542 1432 809 --11634 --
NM_003996chr6--127 ----
NM_004024chr141307 591 544 446 ------
NM_004028chr1863334 3014 2545 1520 1339 1012 12805 12812 --
NM_004035chr1764911 4521 3841 1073 1046 412 14059 ----
NM_004036chr23687 663 210 1130 ----
NM_004039chr15--1323 1164 --
NM_004050chr142738 708 ------
NM_004067chr721154 218 ------
NM_004077chr12------181
NM_004081chrY11536 --11370 --
NM_004085chrX------1594
NM_004087chr32763 592 11413 ----
NM_004089chrX21120 513 ------
NM_004090chr1763063 3018 2671 2301 639 489 12496 ----
NM_004093chr1342857 2075 184 28 ------
NM_004098chr1011190 ------
NM_004099chr941615 1372 81 23 21635 56 ----
NM_004100chr622281 200 ------
NM_004103chr8131 --185 --
NM_004114chrX1926 ------
NM_004117chr6----2657 57 --
NM_004136chr1543009 2360 708 49 12837 ----
NM_004153chr1262 32 ------
NM_004156chr8248 24 ------
NM_004161chr22347 259 11044 ----
NM_004162chr341123 801 383 32 ------
NM_004170chr92325 158 11503 1400 --
NM_004171chr11139539 9530 9509 9267 7813 7358 6362 5843 1853 1680 1178 1165 76 49524 6982 2508 843 ----
NM_004180chr21600 ------
NM_004183chr112808 181 2614 173 --1729
NM_004185chr11266 ------
NM_004187chrX21130 211 ------
NM_004202chrY150 ------
NM_004209chr161947 --1286 --
NM_004215chr82462 455 ------
NM_004229chrX21525 1516 21550 68 ----
NM_004232chr1842521 756 702 662 13221 ----
NM_004235chr92579 71 ------
NM_004238chr21102 ------
NM_004239chr141121 ------
NM_004263chr261697 1536 1164 1144 341 220 --11402 --
NM_004274chr1422724 2041 43139 1155 906 785 ----
NM_004279chr722110 346 12177 ----
NM_004288chr21928 ------
NM_004290chr511140 ------
NM_004293chr953458 2763 878 623 311 1664 --13590
NM_004295chr1741087 986 914 198 ----11042
NM_004301chr31266 1253 ----
NM_004302chr1242599 918 663 474 ------
NM_004306chr8141 ------
NM_004311chr102331 73 12129 1846 --
NM_004316chr1231097 1074 80 ----1222
NM_004321chr232701 2509 777 11226 ----
NM_004326chr13970 907 396 ------
NM_004329chr103403 343 241 ------
NM_004331chr821789 917 1992 ----
NM_004337chr821740 669 1239 ----
NM_004338chr1855628 4684 2691 1653 132 16658 12747 --
NM_004342chr71202 ------
NM_004356chr111124 2472 441 ----
NM_004357chr112474 147 --1557 --
NM_004367chr631756 1750 266 ------
NM_004370chr611558 11627 ----
NM_004380chr1632334 723 318 ------
NM_004385chr52526 63 ------
NM_004386chr1972211 2100 2017 1894 550 324 54 21822 630 ----
NM_004392chr13--1675 11642 --
NM_004393chr352222 2073 1826 1626 1467 1378 12084 1837
NM_004395chr51671 --1226 --
NM_004396chr17----1278 --
NM_004397chr1152925 2725 2633 842 569 13462 14166 --
NM_004411chr72264 173 ------
NM_004416chr1221079 925 --1709 --
NM_004419chr101293 1916 ----
NM_004420chr111340 ----22175 2065
NM_004428chr1123 1270 ----
NM_004429chrX3466 207 128 ------
NM_004430chr841720 1042 873 205 --1695 --
NM_004431chr12330 284 --1541 --
NM_004432chr92354 254 11769 ----
NM_004433chr131709 676 668 --1722 --
NM_004434chr141330 ------
NM_004438chr253251 2137 1218 469 91 ------
NM_004440chr611500 11382 --159
NM_004442chr131634 1063 664 ------
NM_004447chr1221102 730 ------
NM_004449chr2141271 1016 584 304 --11049 --
NM_004454chr321833 1778 1380 ----
NM_004456chr71169 ------
NM_004457chr22605 405 ------
NM_004458chrX61701 1052 771 457 378 73 ------
NM_004463chrX2178 140 1425 ----
NM_004468chr11540 --126 --
NM_004472chr51173 ------
NM_004481chr162453 2242 2158 1728 960 527 1268 21815 757 --
NM_004482chr21656 ------
NM_004491chr1974342 4104 3443 1738 1345 653 63 --21288 364 --
NM_004500chr14----11521 --
NM_004501chr152708 2675 2521 1147 760 13950 ----
NM_004504chr222523 676 1663 12135 --
NM_004506chr6--1173 ----
NM_004514chr1732347 458 141 ------
NM_004515chr1168 ------
NM_004516chr195864 502 451 190 117 ------
NM_004529chr911031 ------
NM_004550chr1----1138 --
NM_004559chr11393 1259 ----
NM_004560chr94905 847 417 311 ------
NM_004566chr1032534 2057 806 22518 217 ----
NM_004571chr2133352 2110 1303 --13089 --
NM_004575chr421661 1197 ------
NM_004576chr5------178
NM_004586chrX53645 3588 2143 498 150 ----13670
NM_004588chr1173671 3363 1025 974 916 833 435 --22732 403 --
NM_004593chr31615 ------
NM_004596chr191201 ------
NM_004598chr533089 2558 1072 ------
NM_004600chr121424 577 ------
NM_004602chr202558 329 11036 1434 --
NM_004603chr731138 1098 1057 1311 ----
NM_004606chrX2130 31 ------
NM_004612chr984732 4621 4546 4102 4081 1592 825 291 1621 34575 1520 1170 --
NM_004622chr251919 1823 1665 704 24 2753 182 ----
NM_004630chr1131138 249 240 ------
NM_004631chr12906 380 --1898 --
NM_004634chr31106 ------
NM_004635chr33397 316 309 --11038 --
NM_004637chr32426 418 ----160
NM_004639chr6197 ------
NM_004643chr141734 ------
NM_004654chrY146 ------
NM_004655chr1731252 1205 856 11390 1147 --
NM_004661chr521215 1169 1894 1255 --
NM_004663chr1521242 333 ------
NM_004666chr62524 213 ------
NM_004667chr15----2614 221 --
NM_004670chr1031274 1161 303 11550 ----
NM_004687chr1731951 1808 1481 1502 ----
NM_004690chr61683 ------
NM_004698chr1137 ------
NM_004703chr1732210 1759 292 11710 12469 --
NM_004705chr11----123 --
NM_004708chr19194 ------
NM_004713chr14149 1760 ----
NM_004714chr192360 325 ------
NM_004723chr12347 234 1821 ----
NM_004726chrX115515 4968 4713 4001 3797 2169 1692 1444 1397 650 293 35385 5330 3616 ----
NM_004730chr522112 1730 ------
NM_004731chr1261745 1324 1289 1201 299 282 ------
NM_004734chr1322704 2155 --22372 487 --
NM_004737chr222936 323 --1985 174
NM_004738chr2062033 1777 1003 465 313 116 31833 475 123 12486 --
NM_004742chr331621 1255 420 ------
NM_004744chr431332 1216 670 11033 1178 --
NM_004747chr1061619 1086 1073 1018 608 329 1443 ----
NM_004748chr1513870 13088 1867 --
NM_004762chr1731612 228 35 1354 ----
NM_004765chr16146 ------
NM_004768chr11470 ------
NM_004769chr7--177 ----
NM_004772chr541517 1291 329 279 ----1252
NM_004774chr1743016 983 213 127 22160 768 ----
NM_004775chr1841489 617 608 584 ------
NM_004776chr2052673 2408 2096 2027 641 22465 170 22391 233 1405
NM_004779chr541214 527 489 214 ------
NM_004781chr13708 388 147 1210 1243 --
NM_004781chr13708 388 147 1210 1243 --
NM_004783chr161457 ------
NM_004788chr1132232 2050 1891 12540 --11063
NM_004789chr9186 ------
NM_004795chr1321946 706 11722 ----
NM_004796chr1452203 2182 1897 915 603 11978 ----
NM_004798chr2073378 1470 926 688 598 302 43 11110 --12763
NM_004800chr13--1176 ----
NM_004801chr23626 549 417 21074 42 ----
NM_004808chr1032490 2296 2273 ------
NM_004821chr51654 ------
NM_004824chr61481 11332 ----
NM_004834chr232724 2417 2248 23028 41 12528 --
NM_004839chr152473 186 ------
NM_004840chrX2794 93 2349 34 22358 468 22116 338
NM_004841chr13876 759 740 ------
NM_004842chr621514 319 ------
NM_004845chrX41585 1571 873 145 13726 ----
NM_004857chr1423980 1695 ----11777
NM_004859chr171243 ------
NM_004862chr162518 128 21083 438 1355 --
NM_004863chr1495300 3517 3484 3417 3319 943 614 549 437 --23337 58 --
NM_004871chr1723153 336 139 23731 3385 --
NM_004873chr1452683 2447 1275 461 325 33184 2771 69 22542 1035 1808
NM_004874chr82471 118 1429 ----
NM_004888chr91404 ------
NM_004893chr51136 ------
NM_004896chr104340 238 205 126 --1620 --
NM_004898chr412292 ------
NM_004902chr202288 224 ------
NM_004904chr766052 4752 4408 1261 1171 488 12114 --1124
NM_004905chr11764 1185 ----
NM_004906chr6193 ------
NM_004925chr92558 40 ------
NM_004926chr1421771 297 --11505 --
NM_004929chr821485 510 21492 266 ----
NM_004943chr1921153 1004 ------
NM_004945chr193696 612 578 --1329 --
NM_004947chr31274 1937 ----
NM_004952chr13776 222 62 --1924 --
NM_004955chr62539 118 1575 ----
NM_004956chr734438 3907 133 23549 3049 ----
NM_004957chr95672 471 444 129 78 --192 --
NM_004958chr1142 --1710 --
NM_004961chrX3410 399 196 ------
NM_004962chr103162 57 46 ------
NM_004965chr211708 ------
NM_004969chr102443 49 ------
NM_004973chr661585 1155 491 473 342 289 ------
NM_004976chr1133461 1407 385 2696 661 15027 --
NM_004985chr1224321 267 11028 ----
NM_004992chrX95870 5693 5393 3372 3124 1557 1483 1425 1239 1994 15718 --
NM_004992chrX95870 5693 5393 3372 3124 1557 1483 1425 1239 1994 15718 --
NM_004993chr141342 ----2959 412
NM_004998chr153917 646 640 1385 --1658
NM_004999chr654468 4186 3054 136 34 21614 1371 1957 --
NM_005003chr16121 ------
NM_005006chr21837 11020 ----
NM_005017chr31252 ------
NM_005020chr71213 --1159 --
NM_005026chr151885 1360 523 273 126 11317 21443 790 --
NM_005028chr1032203 1677 1552 1846 ----
NM_005030chr161277 ------
NM_005032chrX1397 ------
NM_005045chr7--1206 ----
NM_005054chr221164 406 11290 ----
NM_005056chr12125389 5011 4901 4265 3755 3697 3639 3581 2067 984 586 448 ----1360
NM_005060chr13996 533 402 --1150 --
NM_005063chr1043736 2368 480 362 1173 12449 --
NM_005067chr31336 190 ----
NM_005070chr21211 ------
NM_005072chr162190 36 ------
NM_005077chr91504 ------
NM_005078chr1531459 1143 565 ------
NM_005080chr221942 1203 ----
NM_005087chr31601 1761 ----
NM_005093chr2044843 4081 1884 1449 --45090 4450 1784 243 15070
NM_005094chr92214 162 --1183 --
NM_005095chr12662 525 --11551 --
NM_005096chrX5471 414 338 159 141 --1203 --
NM_005097chr101105 ------
NM_005103chr11--1257 ----
NM_005105chr141979 1667 675 456 ------
NM_005116chr2043866 3193 2779 1072 --2372 340 --
NM_005119chr141205 1179 1092 242 ------
NM_005121chr1753862 3367 1345 794 529 13004 ----
NM_005124chr62868 308 153 ----
NM_005126chr332025 1586 688 ------
NM_005134chr183350 272 87 ------
NM_005151chr1862212 791 669 558 324 285 ------
NM_005154chr152576 535 ------
NM_005156chr935382 4073 3793 25140 4245 34552 3367 956 14773
NM_005160chr2296350 6304 5905 5502 2605 2276 1745 1106 53 25854 5100 ----
NM_005161chr1172224 2201 771 563 429 341 60 --21780 48 --
NM_005168chr251614 1370 623 583 569 ------
NM_005174chr10150 ------
NM_005180chr1041548 1216 112 73 ------
NM_005186chr113475 263 102 --1559 --
NM_005188chr11317985 7606 7532 7193 7006 6896 6722 6187 5969 5928 5786 5583 5575 5548 5471 5436 5351 5220 5064 2854 2830 2683 2656 2544 2238 1916 1682 1640 1340 583 204 47888 6248 5945 1177 17688 22842 910
NM_005189chr1782392 2323 1848 1811 1621 1581 624 29 2691 444 ----
NM_005194chr201477 ------
NM_005197chr1466194 5375 4080 1926 1482 903 --14171 --
NM_005204chr10--1846 ----
NM_005207chr2263547 3380 3164 643 486 116 1821 22319 289 23566 1012
NM_005208chr17--197 ----
NM_005214chr22825 418 ------
NM_005219chr531651 1502 1394 11258 1363 --
NM_005220chr1751463 1449 1049 971 296 ------
NM_005222chr72959 245 ------
NM_005224chr191715 ------
NM_005225chr201483 ------
NM_005227chr11456 --1407 --
NM_005233chr31353 ------
NM_005235chr267823 7685 7159 6344 6185 704 26292 3096 178 --
NM_005238chr1112839 --31395 1252 249 --
NM_005239chr2151910 1610 1263 366 134 ----22032 1544
NM_005241chr321350 943 ------
NM_005245chr41730 ------
NM_005249chr14--1649 ----
NM_005252chr141711 ------
NM_005254chr151871 ------
NM_005256chr111839 ------
NM_005257chr1841189 1155 881 279 1121 11266 --
NM_005259chr211125 ------
NM_005264chr101223 --1877 --
NM_005273chr72295 114 ------
NM_005277chr441795 1328 731 225 ------
NM_005279chr2134 163 ----
NM_005311chr742615 2567 1059 623 1940 ----
NM_005316chr11--1352 ----
NM_005324chr1721585 411 ------
NM_005329chr1631716 1537 733 12213 --12177
NM_005339chr431427 1119 564 23991 3518 11613 --
NM_005347chr921648 593 ------
NM_005359chr18106023 5377 5243 5100 4836 4829 4104 2293 1732 319 24874 4227 36470 5678 5597 --
NM_005373chr111039 11471 --11669
NM_005375chr61162 ------
NM_005376chr131122 341 287 ------
NM_005380chr121299 856 ----1228
NM_005381chr22411 84 ------
NM_005387chr111140 ------
NM_005388chr981440 1299 556 489 303 216 86 79 1317 ----
NM_005392chr931550 558 105 1286 ----
NM_005397chr743844 1389 430 139 11084 33587 1123 1054 --
NM_005398chr103199 85 25 1290 ----
NM_005399chr1103763 3546 3478 3294 2997 1767 1097 1051 1021 1010 ------
NM_005400chr242315 2256 1935 83 --12359 --
NM_005402chr711505 --1387 --
NM_005406chr1821330 279 ------
NM_005407chr142247 133 ------
NM_005409chr41196 1313 ----
NM_005410chr51581 ------
NM_005415chr21745 ------
NM_005417chr2031748 556 418 --11409 --
NM_005418chr113556 257 185 1140 ----
NM_005430chr122992 833 ------
NM_005433chr1842568 2232 1102 526 12510 12165 --
NM_005436chr1073933 3832 2973 2806 2745 1518 330 12871 12602 1490
NM_005439chr12--1516 ----
NM_005440chr1722409 561 ------
NM_005442chr34558 431 103 70 ------
NM_005447chr12--130 ----
NM_005450chr171159 ------
NM_005453chr62105 31 --1387 --
NM_005455chr151669 1508 1293 528 222 ------
NM_005458chr962160 1943 1787 1715 531 246 ------
NM_005461chr20----1354 --
NM_005471chr5148 ----11113
NM_005475chr1253025 2983 2880 2856 2048 12241 1202 --
NM_005488chr222736 476 ------
NM_005493chr62607 307 ------
NM_005494chr71601 ------
NM_005497chr1796132 5941 4201 4123 3766 2319 1313 462 241 ------
NM_005499chr191266 ------
NM_005501chr1711167 ----1990
NM_005502chr92978 192 ------
NM_005503chr1521035 259 ------
NM_005509chr51102 ------
NM_005520chr52692 665 ------
NM_005523chr721379 483 ------
NM_005530chr1521328 1184 --1128 --
NM_005541chr231187 989 115 ----11012
NM_005544chr21913 ------
NM_005561chr131367 --1854 --
NM_005563chr11214 ------
NM_005573chr52135 69 ------
NM_005574chr111506 170 ----
NM_005578chr374773 4394 3890 3590 2061 947 327 14544 1212 --
NM_005595chr11204 ------
NM_005596chr965553 4912 4775 4746 675 354 35836 1332 629 13945 14367
NM_005602chr321225 1143 ------
NM_005604chr6------12051
NM_005607chr82880 55 ------
NM_005617chr5--142 ----
NM_005625chr83970 437 82 ------
NM_005627chr63623 360 63 ------
NM_005637chr184795 696 176 153 --11872 --
NM_005639chr1221770 529 21907 1851 ----
NM_005642chr52436 60 129 ----
NM_005644chr11300 ------
NM_005647chrX73347 2521 1199 951 820 762 670 --21142 598 --
NM_005650chr2211251 11100 ----
NM_005659chr222437 59 ------
NM_005664chr1531059 410 232 189 ----
NM_005665chr154925 4382 3987 166 63 31807 1123 892 11830 13621
NM_005667chr2151 ------
NM_005668chr534345 2801 533 --13063 --
NM_005685chr7----1140 --
NM_005688chr3197 ------
NM_005707chr151138 ------
NM_005710chrX141 ------
NM_005715chr642412 264 209 26 11792 11965 --
NM_005717chr11116 1934 ----
NM_005721chr2--1963 ----
NM_005722chr221785 38 2475 351 1604 11873
NM_005723chr4146 ------
NM_005724chr153609 136 31 ------
NM_005725chr132064 667 640 2337 38 ----
NM_005730chr1273456 2626 1236 1082 681 591 469 42919 1299 1127 60 2642 420 --
NM_005734chr111281 ------
NM_005735chr22154 73 158 ----
NM_005736chr1021146 58 11358 --11321
NM_005738chr741427 545 388 363 11534 --11289
NM_005740chr224893 612 339 107 --136 --
NM_005742chr2----2682 107 --
NM_005746chr731866 525 493 ------
NM_005748chr1263447 3379 2977 2912 2427 1253 13204 13242 --
NM_005754chr53980 803 70 ------
NM_005759chr243757 3680 3141 526 11824 145 --
NM_005766chr1321089 36 11002 ----
NM_005768chr12--1152 ----
NM_005775chr83476 281 139 ------
NM_005786chr182987 424 ------
NM_005789chr1731913 1418 1336 12079 --1576
NM_005795chr212118 23025 125 1574 --
NM_005808chr342878 2735 2591 405 --23164 1343 --
NM_005813chr231014 878 302 ------
NM_005822chr622163 1828 2942 83 ----
NM_005828chr1784277 3879 3796 3527 1677 1099 635 35 ------
NM_005840chrX127391 7294 6889 6458 5009 4697 2708 2684 1623 1432 394 384 37141 2314 234 37483 6047 1294 12784
NM_005842chr13--1513 ----
NM_005843chr2--2235 32 ----
NM_005851chr11------172
NM_005852chr171916 --1261 1409
NM_005853chr162512 51 ------
NM_005857chr141454 1436 1252 429 11304 ----
NM_005859chr511352 ------
NM_005862chr31428 ------
NM_005863chr10--11003 1308 --
NM_005864chr143158 76 58 1654 ----
NM_005868chr71169 ------
NM_005870chr13--194 ----
NM_005871chr10137 --11019 --
NM_005880chr1621643 473 ------
NM_005882chr42743 63 ------
NM_005884chr19----1516 --
NM_005895chr1263753 3551 3073 2734 913 465 1118 ----
NM_005896chr21152 ------
NM_005898chr1132127 675 161 --12435 --
NM_005900chr42989 436 ------
NM_005901chr18138444 8376 7473 7206 6932 6141 5899 3431 2977 2363 2176 1830 554 28625 3266 38013 6896 1144 --
NM_005903chr564682 4282 3783 1902 1760 1071 ------
NM_005907chr621660 538 ------
NM_005909chr564057 3463 3282 1668 1310 1174 12680 ----
NM_005910chr1734061 2649 157 --23546 3044 --
NM_005911chr231415 994 481 155 ----
NM_005920chr153790 3049 2865 2511 1042 23166 2395 33448 2714 346 1941
NM_005922chr6193 ------
NM_005927chr531167 1041 870 1153 1921 --
NM_005928chr152658 34 --126 --
NM_005933chr1162794 2477 2279 2226 756 626 1743 2221 69 --
NM_005935chr475082 4809 4752 3822 3479 2055 1534 24007 1222 13630 --
NM_005937chr1731472 1042 1018 13838 21346 673 --
NM_005938chrX4562 359 347 298 --1274 --
NM_005941chr853963 2813 2570 1311 1060 11038 2891 252 13655
NM_005944chr31503 ------
NM_005955chr185236 3870 3351 1316 1024 884 757 374 24290 1709 14963 --
NM_005962chr101605 11866 12121 12143
NM_005962chr101605 11866 12121 12143
NM_005966chr221649 950 ------
NM_005969chr112987 919 --1341 --
NM_005977chr131796 ------
NM_005986chr1362385 2008 1783 1103 729 91 ------
NM_005999chr12225 96 --11140 --
NM_006007chr92653 336 11356 13329 --
NM_006011chr1554011 4005 2796 1140 1049 13411 11166 --
NM_006015chr11197 --1353 --
NM_006016chr632054 1407 862 ------
NM_006022chr131303 ------
NM_006030chr321391 53 ------
NM_006035chr14----21194 501 --
NM_006037chr284145 3758 3139 3118 2974 1797 677 149 11475 ----
NM_006042chr17--1467 ----
NM_006043chr161275 1711 ----
NM_006047chr2032944 1102 766 11147 --1950
NM_006062chr23936 234 107 ------
NM_006064chrX1304 ------
NM_006068chr41279 1108 ----
NM_006070chr31331 ------
NM_006079chr61262 1704 ----
NM_006080chr73771 606 181 ------
NM_006089chrX31540 1484 1250 1641 11817 --
NM_006091chr151632 1584 21770 1625 --
NM_006095chr431464 1004 713 11488 24453 273 --
NM_006106chr1133020 1235 1002 12940 ----
NM_006107chr171433 ------
NM_006110chr16--1130 ----
NM_006135chr121250 1210 ----1108
NM_006136chr711360 --1233 --
NM_006141chr1632762 2447 1075 22259 799 ----
NM_006148chr1762647 2462 1191 959 715 155 126 22677 2441 1882
NM_006153chr3--1577 1212 --
NM_006154chr1562387 1107 742 653 263 104 21808 900 ----
NM_006157chr111160 ------
NM_006158chr811402 --2733 209 --
NM_006160chr1731391 207 37 ------
NM_006161chr5----1234 --
NM_006166chr1242549 1945 1856 1660 31056 884 436 ----
NM_006167chr841965 1517 459 42 ------
NM_006176chr111685 ------
NM_006178chr1711415 ------
NM_006180chr941982 442 362 282 1627 ----
NM_006185chr112179 86 1528 ----
NM_006191chr123711 297 186 1277 1852 --
NM_006195chr931396 1085 322 11446 ----
NM_006197chr81455 1865 --1236
NM_006201chrX1437 --1474 --
NM_006202chr1951399 617 468 408 347 --21524 187 12005
NM_006203chr595470 5127 4232 3553 3449 1959 1334 503 24 14975 14838 --
NM_006206chr412708 ------
NM_006209chr8--1352 ----
NM_006212chr175005 4496 1548 863 782 599 483 21661 350 --13807
NM_006216chr21433 ------
NM_006224chr1742507 1647 922 357 --12321 --
NM_006226chr22921 446 21170 180 ----
NM_006237chr1342111 1892 905 170 --164 --
NM_006242chr2051966 1591 1524 590 163 ----11772
NM_006243chr13933 868 818 --1761 --
NM_006246chr14------1269
NM_006252chr187459 6173 5439 2688 2512 2345 1621 402 34621 777 693 ----
NM_006256chr142266 1852 647 615 ------
NM_006258chr102243 115 ------
NM_006259chr42830 365 ------
NM_006265chr81122 1593 ----
NM_006268chr1121103 138 ----11014
NM_006270chr192176 51 ------
NM_006275chr2051953 1894 1641 441 406 12421 11998 --
NM_006279chr11124 2843 77 1568 --
NM_006282chr2043250 1491 742 41 42970 2883 1722 329 24225 725 --
NM_006292chr111160 ------
NM_006296chr21111 ------
NM_006298chr652984 1289 992 491 67 ------
NM_006306chrX25913 983 21364 523 14609 12208
NM_006307chrX1132 ------
NM_006310chr173913 508 98 --1882 --
NM_006313chr1221743 1534 11275 ----
NM_006315chr441347 618 331 323 23751 475 21598 1445 --
NM_006320chr411105 ----132
NM_006321chr341374 832 500 85 11839 1660 --
NM_006323chr41135 ------
NM_006329chr142747 682 ----2659 276
NM_006330chr81607 179 ----
NM_006336chr951224 1211 1086 987 423 1302 11329 --
NM_006350chr52380 319 ------
NM_006352chr111761 1285 ----
NM_006353chr641376 1032 403 98 --21419 449 --
NM_006357chr2--174 ----
NM_006359chrX2927 468 11966 ----
NM_006361chr1741631 765 609 413 21671 356 ----
NM_006366chr631274 1156 201 ------
NM_006367chr11907 2809 140 ----
NM_006369chr13334 308 158 ------
NM_006372chr6--1328 ----
NM_006375chrX41675 1219 563 507 ------
NM_006379chr71360 150 11491 --
NM_006380chr1743800 3559 3205 764 --12729 --
NM_006386chr2222289 84 11762 --11594
NM_006410chr11--1486 ----
NM_006411chr61843 --1346 --
NM_006420chr2022483 759 ------
NM_006421chr81263 ------
NM_006434chr1052452 2211 1986 791 261 12504 ----
NM_006451chr521031 342 1408 1722 --
NM_006454chr412703 --11076 1759
NM_006457chr433869 3327 984 12535 ----
NM_006458chr11--1409 ----
NM_006459chr1041543 1530 747 185 21749 478 ----
NM_006460chr1761438 1419 1362 623 170 131 ----11723
NM_006465chr1562122 1696 850 840 775 390 1472 ----
NM_006469chr11528 1618 ----
NM_006482chr1253051 2946 2820 2387 848 ------
NM_006483chr192360 325 ------
NM_006484chr192360 325 ------
NM_006496chr151686 1567 1276 1255 1238 ------
NM_006509chr191378 ------
NM_006517chrX11510 --2257 212 --
NM_006519chr6----124 --
NM_006524chr7--31001 325 73 ----
NM_006526chr20128 ----11879
NM_006532chr1921734 318 11990 --2702 121
NM_006534chr202760 639 1449 1558 --
NM_006544chr1465243 2440 2205 1332 1270 668 --25357 2132 --
NM_006546chr1786033 5118 4782 4422 4306 4211 2511 1908 25877 5372 ----
NM_006547chr721957 768 1362 11806 --
NM_006548chr331632 1488 560 --11515 --
NM_006549chr1232939 2660 2594 11125 22578 2560 --
NM_006557chr921766 533 --11301 11472
NM_006560chr111463 1389 137 --
NM_006561chr1096226 5225 4976 4242 4209 2210 2018 1254 39 25208 4675 12440 --
NM_006565chr16192 --1357 --
NM_006566chr181365 --1389 --
NM_006570chr9299 41 1295 ----
NM_006572chr1742615 741 292 213 33338 2653 532 1153 --
NM_006584chr171127 ------
NM_006587chr411336 --153 --
NM_006595chr111577 21453 159 ----
NM_006599chr1688050 6753 5728 5289 5039 2450 1247 420 45264 5243 2294 1070 12434 18103
NM_006602chr202698 63 ------
NM_006603chrX1259 ----11464
NM_006609chr232350 1927 694 --12585 --
NM_006614chr353461 3048 2848 2547 1103 ------
NM_006618chr131531 1151 1109 21171 1061 ----
NM_006621chr111660 11547 ----
NM_006624chr1031827 1434 1373 1113 ----
NM_006625chr11421 ------
NM_006625chr11421 ------
NM_006625chr11421 ------
NM_006628chr1554394 4218 1330 968 518 13030 13945 1317
NM_006633chr51158 1636 ----
NM_006636chr22744 315 ------
NM_006640chr171353 2699 634 11840 --
NM_006644chr131235 --1448 --
NM_006646chr1342183 401 261 151 1531 --11110
NM_006654chr1254243 3109 483 394 335 1561 ----
NM_006660chr15--1128 ----
NM_006662chr16----2122 27 --
NM_006667chrX2999 733 1858 ----
NM_006675chr1263385 2959 2717 2385 2309 485 ------
NM_006690chr2052344 1901 1506 733 221 ------
NM_006694chr12257 29 ------
NM_006698chr203211 124 21 ------
NM_006699chr132648 1968 80 --22287 372 --
NM_006703chr61176 ------
NM_006708chr63990 319 279 --11082 11008
NM_006713chr5168 1784 1263 --
NM_006717chr941158 1055 373 76 12239 23200 2531 --
NM_006718chr611077 ------
NM_006722chr331081 880 267 --21187 586 --
NM_006724chr6193 ------
NM_006726chr411224 ------
NM_006729chrX85372 4822 4786 4597 4064 2154 1877 1588 24885 4496 13610 1312
NM_006734chr621411 247 ------
NM_006735chr7164 ------
NM_006736chr21100 1577 21702 308 --
NM_006738chr15103935 3745 3411 2900 1830 1535 1470 1280 1180 366 --23460 1329 11433
NM_006742chr1671545 1409 1291 1277 754 613 587 21509 147 11893 21915 309
NM_006744chr101170 154 ----
NM_006745chr45956 401 342 300 97 --1713 --
NM_006749chr831033 458 401 --1884 --
NM_006750chr16107851 7630 7043 6440 6389 5547 2162 860 672 108 37737 7209 2402 ----
NM_006754chr74888 278 158 100 ------
NM_006761chr171262 ------
NM_006763chr141889 1740 646 213 ------
NM_006764chr32457 448 ------
NM_006766chr852577 2309 1003 988 841 ------
NM_006769chr11491 273 32 ----
NM_006775chr652946 2372 1100 573 86 ------
NM_006777chrX1352 --12800 22262 628
NM_006783chr133643 606 48 1733 ----
NM_006788chr1841456 463 204 110 --1737 --
NM_006790chr51354 ------
NM_006795chr1121442 519 --21382 308 --
NM_006800chrX2568 86 ------
NM_006802chr11267 ------
NM_006805chr541738 1722 1514 102 ------
NM_006807chr171356 --1265 --
NM_006809chr206920 881 746 643 317 156 1909 1785 --
NM_006815chr122966 156 --1896 --
NM_006826chr211033 --1185 --
NM_006827chr1453196 3140 2866 2259 113 ------
NM_006828chr61198 --1181 --
NM_006836chr122568 435 ------
NM_006838chr121189 11913 ----
NM_006851chr123924 453 53 1321 ----
NM_006852chr1792861 2490 2472 2453 2123 2107 1107 688 204 ------
NM_006854chr741980 1580 1437 756 --11420 --
NM_006856chr123805 761 149 --1263 --
NM_006861chr125693 659 534 344 337 ----11559
NM_006870chr20--1675 ----
NM_006874chr4----1821 --
NM_006876chr111182 1548 ----
NM_006885chr1643949 3110 1337 663 11147 12756 --
NM_006888chr1453542 2799 2772 2444 2252 --1350 --
NM_006892chr2021253 291 ------
NM_006892chr2021253 291 ------
NM_006908chr741100 1066 255 107 ------
NM_006918chr1165122 4733 2214 1719 1669 590 1346 ----
NM_006922chr22764 591 12290 ----
NM_006924chr1714229 ----13438
NM_006925chr141213 --129 --
NM_006931chr1221680 177 ------
NM_006939chr1421056 359 1897 11150 --
NM_006941chr221366 --1138 --
NM_006951chr101770 ------
NM_006981chr932827 2639 2198 ------
NM_006987chr171159 1939 11225 --
NM_006990chr192479 2133 1789 982 633 537 358 126 51 11997 --11630
NM_007005chr921258 1054 --1310 --
NM_007007chr1234785 3527 1807 144 ----
NM_007010chr1741176 235 212 185 --1649 --
NM_007011chr1584440 4247 2673 2348 1395 1254 1145 353 26228 4694 16304 --
NM_007017chr5--1171 ----
NM_007033chr162305 2062 1565 748 371 65 ------
NM_007034chr11838 ------
NM_007038chr2135865 5305 4667 21026 923 ----
NM_007042chr32793 460 ----1262
NM_007050chr20147378 6585 6415 6021 5829 5808 5802 3178 2998 2055 1261 843 631 277 --36615 2821 1001 --
NM_007054chr523782 3628 23903 950 ----
NM_007064chr331260 365 194 --11093 --
NM_007067chr1721356 344 11310 21512 1168 --
NM_007069chr11150 ------
NM_007074chr161101 ------
NM_007078chr1052943 2010 829 615 301 --2847 491 --
NM_007084chr1311409 --1356 --
NM_007106chr1312649 ----1797
NM_007118chr53863 611 583 --1692 --
NM_007122chr1121 --1585 --
NM_007124chr611765 --1328 --
NM_007129chr132396 336 ------
NM_007137chrX44093 3789 1259 273 45175 4212 3611 1608 24083 3626 13842
NM_007146chr1722445 1863 ------
NM_007150chrX--21976 1363 2564 314 --
NM_007158chr121188 1057 ------
NM_007170chr11366 --1187 --
NM_007173chr1121632 168 ----137
NM_007174chr12122318 2029 1936 1741 1506 1479 827 779 682 673 627 521 11519 ----
NM_007175chr853318 2327 979 553 102 ------
NM_007178chr122367 69 ------
NM_007185chr131022 288 95 --2313 241 --
NM_007191chr12147 ------
NM_007195chr1843619 2793 2783 915 ------
NM_007197chr122753 342 ------
NM_007200chr15103935 3745 3411 2900 1830 1535 1470 1280 1180 366 --23460 1329 11433
NM_007202chr171540 ------
NM_007203chr953304 2930 2735 2714 1008 --13385 --
NM_007207chr1--1659 ----
NM_007217chr3--154 ----
NM_007219chr203862 347 169 ------
NM_007221chr11174 ----1393
NM_007222chr841665 1439 1427 1149 11334 ----
NM_007235chr12189 ------
NM_007236chr1571689 958 766 740 443 372 161 ------
NM_007246chr41189 3278 138 47 1912 --
NM_007260chr14731 538 216 176 --2552 164 --
NM_007269chr12227 114 ------
NM_007271chr631445 1269 1154 ------
NM_007275chr33803 391 325 ------
NM_007276chr72204 55 ------
NM_007278chr17----1138 --
NM_007292chr1764911 4521 3841 1073 1046 412 14059 ----
NM_007294chr1721132 989 --21275 62 --
NM_007295chr1721132 989 --21275 62 --
NM_007296chr1721132 989 --21275 62 --
NM_007297chr1721132 989 --21275 62 --
NM_007298chr1721132 989 --21275 62 --
NM_007299chr1721132 989 --21275 62 --
NM_007300chr1721132 989 --21275 62 --
NM_007302chr1721132 989 --21275 62 --
NM_007303chr1721132 989 --21275 62 --
NM_007304chr1721132 989 --21275 62 --
NM_007305chr1721132 989 --21275 62 --
NM_007308chr42216 125 ------
NM_007322chr191406 ------
NM_007331chr421929 488 12541 11038 --
NM_007346chr201220 --1326 --
NM_007347chr151430 --1881 --
NM_007349chr71109 ------
NM_007350chr1234458 1730 1460 174 1837 --
NM_007358chr131681 736 78 ------
NM_007363chrX11089 ------
NM_007365chr121684 72 --31914 1578 552 --
NM_007368chr13158 --21228 471 --
NM_007372chr171725 --1282 --
NM_007373chr1011796 ------
NM_007375chr142032 1781 921 629 22542 524 12652 12636
NM_012064chr121988 ----1391
NM_012081chr543693 3343 2939 2327 13385 ----
NM_012084chrX--1572 1412 --
NM_012086chr2156 ------
NM_012090chr12978 496 ------
NM_012095chr1023404 2968 --12669 --
NM_012104chr1143223 2424 1219 997 11335 22671 2415 --
NM_012104chr1143223 2424 1219 997 11335 22671 2415 --
NM_012115chr61528 1585 ----
NM_012120chr652631 2452 1833 402 200 12747 ----
NM_012129chr752103 1986 1639 943 913 1229 12338 --
NM_012137chr162859 2612 987 536 488 345 ------
NM_012141chr1353313 2635 1234 694 605 23582 951 ----
NM_012154chr82308 151 ------
NM_012156chr2023110 2657 12874 --23139 68
NM_012158chr1311507 --11462 1393
NM_012164chr976307 6020 5689 5393 2421 548 393 16028 --22874 1407
NM_012180chr41489 ------
NM_012183chr11238 ------
NM_012193chr11114984 4964 4537 3952 3563 1965 1434 681 599 426 23 21445 1133 25191 1552 1230
NM_012197chr921463 55 --11109 --
NM_012199chr184076 4051 3321 2920 1771 780 748 41 --24010 1053 --
NM_012207chr1011024 1273 ----
NM_012214chr224194 4174 46354 6225 4629 1659 ----
NM_012215chr1041841 1783 1496 1438 21848 289 --170
NM_012218chr1952594 2238 823 797 381 1204 22913 2222 --
NM_012223chr22332 105 --11061 --
NM_012234chr323587 816 ------
NM_012238chr101687 ------
NM_012247chr104749 647 295 166 2361 310 1894 --
NM_012249chr243593 610 423 329 12610 ----
NM_012250chr1121058 451 1934 ----
NM_012252chr753716 3554 1363 457 419 --13643 --
NM_012255chr201167 ------
NM_012257chr72941 168 ------
NM_012262chr184420 4243 4129 3919 3855 1995 1979 1648 43691 1125 395 51 14008 --
NM_012264chr2221542 348 21709 114 --1188
NM_012264chr2221542 348 21709 114 --1188
NM_012281chr712196 1528 ----
NM_012287chr344104 3788 1540 451 3841 507 384 ----
NM_012288chr6104978 4245 3949 3756 1803 1227 766 637 270 155 15606 23725 861 11906
NM_012290chr21571 11648 ----
NM_012294chr783905 3696 3351 2788 1195 1165 1150 75 --13396 13251
NM_012297chr472479 2465 900 712 412 98 79 12031 11854 --
NM_012300chr511775 --12100 1456
NM_012301chr72890 227 ------
NM_012302chr12838 399 ------
NM_012307chr182818 354 11003 ----
NM_012308chr1132438 1996 1717 1849 1870 --
NM_012309chr1174953 3838 3737 1762 1164 697 400 14683 21375 441 1170
NM_012316chr145289 5260 3556 1075 --11082 24151 807
NM_012323chr2241575 1138 262 147 --1483 --
NM_012325chr2031615 568 533 --11557 --
NM_012327chr1821572 1091 1446 11049 --
NM_012329chr1721404 1042 11293 ----
NM_012330chr101729 1406 ----
NM_012333chr12611 184 11063 1650 --
NM_012334chr584421 1795 1759 1463 1237 1138 528 356 1169 1112 --
NM_012341chr10--1429 ----
NM_012342chr10----146 --
NM_012347chr642896 2415 803 366 --21941 561 --
NM_012382chr554268 3675 2842 772 230 ------
NM_012388chr1562952 815 673 418 381 144 ------
NM_012399chr2221340 484 11410 ----
NM_012402chr111492 1900 ----
NM_012410chr162446 142 ------
NM_012419chr62403 137 ------
NM_012425chr1052156 1007 419 281 191 --2105 27 --
NM_012431chr712625 ------
NM_012432chr1----158 --
NM_012434chr62608 68 21515 1366 ----
NM_012446chr51644 1567 ----
NM_012448chr1762550 909 644 627 539 444 --1943 --
NM_012465chr1033241 2909 393 13192 12272 --
NM_012470chr72456 167 ----1122
NM_012471chrX41873 1361 347 198 ------
NM_012477chr21175 ------
NM_012479chr732587 667 533 12328 11927 --
NM_012482chr1----131 --
NM_012486chr1--1431 ----
NM_013227chr151280 ------
NM_013230chrY2598 25 ----1100
NM_013231chr1453791 3779 3405 1527 1142 --1664 --
NM_013232chr51375 ------
NM_013233chr21349 ------
NM_013236chr222477 218 1847 ----
NM_013243chr1531142 528 160 ------
NM_013254chr12--175 ----
NM_013261chr441351 1172 675 626 33386 3139 2740 13669 --
NM_013262chr61946 11379 ----
NM_013264chr112157 89 ------
NM_013267chr122419 142 ------
NM_013269chr1244178 4085 784 285 13561 ----
NM_013279chr1121599 946 1150 1227 --
NM_013281chr2011398 ------
NM_013282chr1921288 133 ------
NM_013309chr1542176 988 825 445 ------
NM_013316chr72693 247 ------
NM_013323chr1731210 904 110 ------
NM_013336chr321617 1300 --1598 --
NM_013351chr17--1723 ----
NM_013354chr82213 134 11011 ----
NM_013357chr81804 ------
NM_013363chr32394 43 ------
NM_013364chrX21364 145 1541 ----
NM_013372chr1553384 2918 2524 2406 1209 ----12655
NM_013374chr332980 2409 2206 ------
NM_013381chr1232335 2158 2094 1748 ----
NM_013390chr92477 353 11275 ----
NM_013396chr212317 60 11039 ----
NM_013400chr721016 991 ------
NM_013403chr192287 178 --1601 --
NM_013409chr5135 ------
NM_013433chr1951909 1672 1353 1307 139 --1532 --
NM_013434chr251844 1838 1720 572 409 ------
NM_013434chr251844 1838 1720 572 409 ------
NM_013449chr122770 695 --1819 --
NM_013450chr21888 ------
NM_013451chr101150 ------
NM_013951chr222344 1659 ------
NM_013952chr222421 1736 --165 --
NM_013953chr222421 1736 --165 --
NM_013958chr8126 ------
NM_013959chr8126 ------
NM_013960chr83568 516 147 ------
NM_013961chr8126 ------
NM_013962chr8126 ------
NM_013992chr222421 1736 --165 --
NM_013995chrX32155 880 592 ------
NM_013996chr7--1492 ----
NM_013996chr7--1492 ----
NM_013997chr7--1492 ----
NM_013997chr7--1492 ----
NM_013998chr7--1492 ----
NM_013998chr7--1492 ----
NM_014000chr101470 11664 --11571
NM_014001chr1711462 ------
NM_014007chr91788 --1834 --
NM_014010chr91495 ------
NM_014011chr252601 2119 565 479 93 141 ----
NM_014016chr3294 75 21294 107 ----
NM_014021chr153030 2342 965 525 136 1375 ----
NM_014023chr1062274 1179 1115 927 398 62 12773 ----
NM_014034chr6--11231 1367 --
NM_014038chr71422 ------
NM_014041chr3--157 1378 --
NM_014048chr1665106 3568 3455 1707 1220 971 15072 1216 13241
NM_014057chr91363 ----1374
NM_014059chr132343 271 ------
NM_014079chr35760 265 257 249 164 1750 1241 --
NM_014089chr1311876 --1414 --
NM_014106chr1542230 867 576 391 ------
NM_014109chr811055 1481 ----
NM_014110chr1--1188 21014 261 --
NM_014112chr844032 3899 1192 527 --12092 --
NM_014117chr1622261 2103 --1189 --
NM_014153chr162729 622 ------
NM_014155chr11126960 6866 6671 5757 5743 5715 4651 2443 1465 755 325 256 --26649 2947 17440
NM_014157chr1663467 3301 2842 2583 863 741 --11432 --
NM_014159chr3----173 --
NM_014170chr32324 149 ------
NM_014181chr262790 2504 2293 1131 778 521 ------
NM_014182chr122630 92 ------
NM_014191chr121740 ------
NM_014212chr122385 84 ------
NM_014213chr21225 ------
NM_014214chr181342 --1156 --
NM_014217chr141666 1211 451 247 ------
NM_014231chr1231870 733 471 ------
NM_014232chr172572 272 --1397 --
NM_014232chr172572 272 --1397 --
NM_014243chr41764 1163 12067 --
NM_014252chr132300 124 ------
NM_014253chrX3949 425 131 22407 499 ----
NM_014264chr41103 193 ----
NM_014267chr11--1141 ----
NM_014271chrX1135 ------
NM_014275chr5----2910 780 --
NM_014278chr41493 ------
NM_014283chr121306 371 ------
NM_014284chr13879 132 125 ------
NM_014286chr973644 2590 2383 2358 1227 1133 99 11381 32557 2531 1282 --
NM_014289chrX31255 481 67 11424 ----
NM_014294chr8146 1215 ----
NM_014299chr1961646 816 735 638 263 189 11580 --135
NM_014309chr22115412 5372 5167 5063 4336 3560 1588 608 585 492 477 35226 1220 196 11410 12134
NM_014319chr1271752 1640 1278 654 571 68 60 ------
NM_014320chr63228 141 95 ------
NM_014323chr221171 ------
NM_014326chr1531242 348 186 --1242 --
NM_014330chr19176 ------
NM_014331chr425183 1205 25286 878 15632 16605
NM_014333chr1132818 1014 491 --11925 --
NM_014338chr222409 57 ------
NM_014342chr1131020 322 143 --11147 --
NM_014345chr61343 --1795 --
NM_014351chr2241381 1067 911 299 1188 ----
NM_014361chr11------1366
NM_014368chr921776 1342 --2350 160 1386
NM_014372chr11538 ------
NM_014374chr721016 991 ------
NM_014382chr31215 --1389 --
NM_014393chr83312 279 268 1335 22307 1738 --
NM_014394chr102163 88 2919 911 ----
NM_014397chr931420 399 60 --11319 --
NM_014399chr7----1267 --
NM_014415chr321407 390 ------
NM_014423chr545179 4720 4292 4055 --11510 12179
NM_014432chr621058 23 ------
NM_014445chr332430 1719 1547 ------
NM_014447chr431479 1468 644 ------
NM_014452chr63981 309 237 11195 ----
NM_014456chr1021256 537 ------
NM_014469chr112613 255 ------
NM_014472chr10--2170 57 ----
NM_014491chr72890 286 11085 ----
NM_014494chr1642315 1547 859 282 --22044 710 --
NM_014496chrX156 ------
NM_014498chr31361 ------
NM_014504chr721828 313 1540 ----
NM_014517chr351639 784 694 391 307 ------
NM_014521chr251751 1451 622 548 218 ------
NM_014552chr231177 594 409 ------
NM_014562chr23628 98 87 ------
NM_014569chr711041 31490 302 142 ----
NM_014570chr221183 ------
NM_014572chr132572 204 1195 ----
NM_014573chr1731833 1817 1273 21722 93 ----
NM_014574chr1421359 990 ------
NM_014575chr3----1145 --
NM_014577chr22125 --1760 --
NM_014586chr21104647 4502 4115 4024 3812 3475 3206 2933 471 314 21522 1411 14354 --
NM_014587chr162394 364 21519 1310 ----
NM_014600chr241402 1193 582 529 11661 ----
NM_014604chr171571 --2191 145 --
NM_014608chr152404 41 ------
NM_014612chr92449 438 21110 298 ----
NM_014613chr552650 2076 1904 1123 1016 --22165 991 --
NM_014614chr221319 1059 ------
NM_014615chr1631356 1265 585 ------
NM_014630chr15113605 3274 2932 2675 1179 969 749 729 540 228 49 2429 369 11039 --
NM_014635chr231301 1127 370 11253 ----
NM_014636chr943190 1090 399 324 ------
NM_014646chr1851053 1000 754 146 93 1413 22055 886 --
NM_014647chr162683 410 ------
NM_014653chr1252070 2054 1596 683 549 1135 ----
NM_014660chr72822 162 ------
NM_014665chr872889 2617 2525 2433 2298 1240 160 --33289 359 61 187
NM_014666chr5--1266 ----
NM_014667chr331524 678 322 --11648 --
NM_014670chr211200 --1295 1120
NM_014671chr731407 506 322 ------
NM_014676chr131363 644 169 ------
NM_014677chr821192 105 ------
NM_014679chr1131174 1014 147 ------
NM_014682chr832200 1434 791 --1895 --
NM_014683chr1742036 1549 1460 51 ------
NM_014685chr16131 ------
NM_014686chr1922587 964 1170 1691 1240
NM_014690chr772390 2337 2238 991 830 375 25 ------
NM_014693chr31748 ------
NM_014699chr161315 ------
NM_014701chr1542806 2389 2247 1352 1587 ----
NM_014702chr643333 2222 2118 757 1130 ----
NM_014707chr732271 243 130 ------
NM_014709chr21254 ------
NM_014711chr1631701 1365 426 ------
NM_014717chr191748 ------
NM_014718chr122734 276 ------
NM_014720chr1011779 11172 ----
NM_014721chr687286 7189 7067 6726 6308 5644 5356 5071 26408 793 ----
NM_014723chr2022332 880 1340 32322 2077 696 --
NM_014726chr1731094 452 295 ------
NM_014729chr81644 11656 11574 --
NM_014730chr12145140 4671 4529 4337 3877 3784 3642 3285 1069 1021 996 891 566 234 --25188 3945 --
NM_014730chr12145140 4671 4529 4337 3877 3784 3642 3285 1069 1021 996 891 566 234 --25188 3945 --
NM_014731chr201544 ------
NM_014733chr531460 578 467 ------
NM_014735chrX71818 1802 1504 763 512 279 36 11976 ----
NM_014738chr173703 382 155 ------
NM_014739chr654008 3999 1130 755 690 24092 145 13336 13779
NM_014742chr2011774 ------
NM_014743chr432162 467 414 12992 --12137
NM_014746chr274260 4001 3660 2790 768 552 283 24020 927 --12703
NM_014747chr1125632 5281 5119 4651 4114 3830 3757 1681 1300 1233 745 79 ------
NM_014752chr1131821 640 444 ------
NM_014754chr81806 --1203 --
NM_014755chr284148 4096 3650 2873 1450 1297 1271 96 22932 167 33210 1666 474 --
NM_014757chr552044 1976 1756 1539 558 1585 2930 700 --
NM_014761chr1641139 1072 987 175 ------
NM_014764chr124505 457 391 302 ------
NM_014770chr1221197 155 ------
NM_014771chr161789 1776 ----
NM_014772chr1853599 2889 2731 1097 1016 --23398 557 --
NM_014776chr1263027 2935 2095 2047 967 38 12269 ----
NM_014779chr32343 284 --1119 --
NM_014781chr81908 ------
NM_014786chr1141215 1032 806 138 144 1819 --
NM_014787chr122091 446 --12807 1511
NM_014798chr1751276 1180 750 709 581 11764 ----
NM_014802chr121208 ------
NM_014803chr101917 22384 2197 32881 2575 2561 --
NM_014807chr114739 730 713 656 ------
NM_014810chr183411 3049 2479 1382 1197 608 180 174 --151 --
NM_014812chr131376 238 123 --11894 --
NM_014813chr15498 483 424 395 157 ------
NM_014819chr531927 736 313 ------
NM_014820chr311480 1453 --11328
NM_014824chr1141977 1597 417 179 ------
NM_014826chr133670 3627 2737 2350 257 --11226
NM_014827chr12663 341 ------
NM_014836chr1011282 1319 --11979
NM_014838chr222650 350 32313 2279 1060 ----
NM_014839chr151864 1819 1677 869 668 ------
NM_014841chr6----11334 --
NM_014850chr393587 3545 3399 3291 1687 1588 1140 97 61 13130 33881 1419 689 13869
NM_014857chr1----180 --
NM_014859chr1731046 416 239 --1221 --
NM_014862chr1554195 3869 1419 1262 1152 --23052 1105 --
NM_014864chr194051 3688 3652 1494 1437 1161 583 213 127 1982 ----
NM_014871chr121570 --1502 --
NM_014877chr1797801 7366 6638 6546 5257 2687 1739 1643 1292 13090 --12163
NM_014893chrY2767 455 1717 ----
NM_014897chr1712053 1843 1983 13123
NM_014898chr191165 ------
NM_014899chr532195 919 169 --22757 636 1212
NM_014902chr202317 158 --1511 --
NM_014903chr1251680 781 765 754 683 ------
NM_014904chr1033785 1094 1087 21356 923 ----
NM_014905chr211910 21533 390 1277 --
NM_014906chr1723913 3396 1327 ----
NM_014909chr1443270 3139 2864 991 1616 ----
NM_014912chr1043251 3138 2168 132 1553 12879 --
NM_014914chr211293 ------
NM_014918chr153510 175 145 1499 ----
NM_014920chr643596 3221 2391 197 --1510 --
NM_014921chr1952837 2730 2491 2152 358 --22827 1017 --
NM_014923chr132701 266 --21622 226 --
NM_014925chr122775 697 ------
NM_014926chr321150 236 --1450 --
NM_014931chr192611 532 --1456 --
NM_014932chr31484 ----172
NM_014936chr622341 283 1740 ----
NM_014937chr10131 ------
NM_014944chr1133 ------
NM_014945chr521978 1718 ------
NM_014946chr263049 2536 2388 1135 387 207 1751 21240 275 --
NM_014947chr122934 255 12485 12544 --
NM_014949chr12996 318 1687 ----
NM_014950chr142330 109 ------
NM_014952chr1531816 346 274 --41371 582 570 470 --
NM_014956chr1151026 946 798 315 75 ------
NM_014961chr432171 1933 1640 1339 ----
NM_014964chr1772057 1947 967 352 254 173 110 ------
NM_014969chr12328 185 1179 ----
NM_014974chr1051784 1757 1159 557 307 1232 1603 --
NM_014977chr141102 ------
NM_014978chr1011366 21315 1226 --11358
NM_014982chr1474287 4092 3911 3274 997 833 647 13740 13684 15233
NM_014988chr412183 1884 1441 --
NM_014989chr611284 1675 ----
NM_014990chr14----1907 1247
NM_014991chr432077 595 373 --1444 --
NM_014994chr153251 244 133 ----1448
NM_014996chr32700 81 1855 --1786
NM_014997chr792352 2266 2252 1189 1124 1006 604 138 112 ------
NM_014999chr1221278 1146 21262 625 1562 --
NM_015000chr121322 ------
NM_015001chr11353 ------
NM_015002chr1221619 860 1287 ----
NM_015005chr1431707 1637 51 --1563 --
NM_015008chr353280 3138 1352 1022 886 11360 43074 3009 2545 529 13185
NM_015009chr3------1108
NM_015011chr1341125 1044 1026 74 ------
NM_015015chr1931642 681 440 ------
NM_015017chr111250 ------
NM_015020chr1623107 778 13465 13522 --
NM_015023chr141799 1645 675 89 2345 270 1173 1470
NM_015024chr81972 ------
NM_015025chr2--12161 ----
NM_015026chr1273010 1606 1450 1070 470 209 65 54022 3075 1705 873 639 ----
NM_015027chr1651821 1737 1584 1237 437 --1155 --
NM_015032chr1342755 2675 323 89 --1702 --
NM_015033chr932969 369 33 ------
NM_015039chr174165 3536 3413 1664 1361 1174 436 13422 ----
NM_015042chr15124311 4242 3885 3530 3430 3213 3063 1465 1431 903 877 686 --13173 1591
NM_015045chr1021433 1423 ------
NM_015046chr942394 1822 1789 257 1189 12176 --
NM_015051chr953277 2848 2668 1117 28 --12957 --
NM_015052chr72414 168 ----1399
NM_015059chr1573340 3033 2945 2619 983 574 324 1909 22737 2428 --
NM_015060chr7129 --1192 --
NM_015061chr91236 1217 1627 --
NM_015063chr193367 184 147 --11141 --
NM_015064chr1253371 1442 1035 818 542 32931 2528 1006 12893 --
NM_015068chr732739 782 504 31413 741 588 ----
NM_015071chr596395 5721 4962 2284 2184 1962 1882 1770 619 25898 5889 36475 5271 4489 --
NM_015074chr1114596 4532 3775 1992 1737 1655 1554 1548 721 666 31 33041 1504 1429 24716 523 --
NM_015076chr653809 3313 3046 2951 2740 --23522 3274 --
NM_015082chr512302 1343 12043 --
NM_015090chr142366 901 625 579 11551 45084 4740 4225 2185 15419
NM_015091chr14----1777 --
NM_015092chr1634501 4132 3527 ------
NM_015093chr651716 1618 723 522 510 1392 ----
NM_015097chr331711 906 291 --11472 --
NM_015100chr161890 1782 1776 1317 681 552 --11336 11493
NM_015101chr142886 1859 742 504 --22590 1883 --
NM_015102chr1197 ------
NM_015107chrX51555 697 206 121 45 --22335 1879 --
NM_015110chr932385 1783 196 --1976 1550
NM_015115chr431042 972 832 22531 949 ----
NM_015116chr1321219 75 1108 ----
NM_015129chrX71706 1606 1482 1135 717 74 40 --1291 --
NM_015130chr41386 ------
NM_015132chr721798 1572 11662 ----
NM_015133chr1621435 485 1124 1539 --
NM_015137chr842106 2020 476 235 2332 66 ----
NM_015138chr1542524 1729 274 244 ------
NM_015143chr41325 ------
NM_015144chr1653699 3188 1524 1280 839 11367 --13317
NM_015155chr1022522 450 ----12733
NM_015156chr1442567 1250 855 717 21477 725 33134 1080 443 --
NM_015157chr1141194 351 142 38 1731 ----
NM_015172chr141613 1399 1034 189 ------
NM_015173chr431412 1326 48 31650 1237 588 ----
NM_015176chr111164 ----1110
NM_015178chr811059 2524 51 ----
NM_015185chrX22670 2228 1326 ----
NM_015186chr93382 350 327 ------
NM_015191chr1132655 1045 69 1636 ----
NM_015192chr2022846 311 23011 2472 ----
NM_015193chr831469 1382 50 11305 --11059
NM_015199chr332287 1951 616 1936 12170 --
NM_015206chr1542608 2537 1218 1002 --11070 --
NM_015208chr1873653 2750 2735 1118 963 504 72 195 ----
NM_015215chr143028 2776 2093 866 ------
NM_015219chr1732477 632 242 12600 12129 22577 2295
NM_015221chr103271 220 35 142 ----
NM_015225chr922901 645 1956 1582 --
NM_015231chr112907 22 1938 ----
NM_015233chr1341820 1029 636 569 ------
NM_015236chr421330 295 ------
NM_015238chr5----1733 --
NM_015242chr112495 48 ------
NM_015246chr164737 700 592 232 ------
NM_015247chr1644473 4256 752 366 14873 11603 --
NM_015250chr911832 21914 586 ----
NM_015251chr1632071 236 140 11512 ----
NM_015252chr21603 ------
NM_015260chr1921263 58 --11051 --
NM_015263chr15174 ------
NM_015264chr2294541 4248 3586 3263 3201 3137 1244 858 559 13950 21302 647 --
NM_015265chr262503 2379 2308 2151 562 115 31714 313 54 ----
NM_015267chr1211993 ------
NM_015268chr33665 546 90 ------
NM_015271chr432756 1353 34 11382 21635 1372 --
NM_015272chr1631815 1806 1497 ------
NM_015278chr642938 2595 2467 572 13046 ----
NM_015282chr232921 2612 1867 22164 206 1556 1618
NM_015284chr151866 480 398 363 132 --11343 1407
NM_015288chr542658 2595 1150 929 --12458 --
NM_015291chr152713 2230 1411 1402 814 1805 ----
NM_015292chr123667 43 35 --2291 149 1198
NM_015296chr132183 112 ------
NM_015299chr1432640 1269 579 13607 ----
NM_015305chr1451899 1614 1386 1286 1197 2395 348 ----
NM_015310chr8107994 6189 5981 5865 5495 5200 3276 2977 1781 707 27014 436 38024 6561 982 --
NM_015314chr71487 12423 --1125
NM_015315chr523389 3249 --1125 --
NM_015316chr1431084 100 28 ------
NM_015317chr252857 2689 2369 1112 1001 --12338 --
NM_015326chr152583 2479 2296 2117 654 2440 385 1725 11967
NM_015328chr782614 2460 2316 969 951 547 504 50 ------
NM_015329chr1931810 539 396 --1921 --
NM_015335chr1221907 298 --11733 --
NM_015338chr203389 176 122 --11374 --
NM_015339chr202284 76 ------
NM_015346chr1471804 1642 1560 1222 555 480 148 ------
NM_015347chr1242839 2794 2187 1052 12854 --32300 1839 1045
NM_015349chr642856 2798 2064 1101 12160 ----
NM_015353chr1772440 1982 1928 1888 840 827 297 1229 22715 2556 --
NM_015355chr1731603 1375 1323 21503 1337 --1429
NM_015358chr21--157 1997 --
NM_015361chr21944 127 ----
NM_015365chrX54190 3478 1386 873 327 13363 13165 1591
NM_015367chr2211629 ----11237
NM_015379chr7--1230 123 --
NM_015382chr142129 109 ------
NM_015385chr1052452 2211 1986 791 261 12504 ----
NM_015387chr231526 1500 136 ------
NM_015393chr423613 2396 33606 3015 2989 13451 --
NM_015397chr92736 238 ------
NM_015401chr123916 779 86 1909 ----
NM_015416chr122791 289 1684 ----
NM_015429chr3--1759 ----
NM_015435chr851325 976 368 299 194 ------
NM_015436chr411273 --22942 55 --
NM_015441chr11335 ------
NM_015443chr171956 --1379 --
NM_015444chr33638 144 53 ------
NM_015446chr131169 1133 1124 --11268 1131
NM_015455chr554100 3891 3708 3636 1074 1449 ----
NM_015460chr331609 769 192 ------
NM_015461chr181237 ------
NM_015463chr22775 71 1742 ----
NM_015475chr2--1257 --1143
NM_015477chr152982 93 ------
NM_015481chr122763 222 --11009 --
NM_015488chr221504 1471 ------
NM_015497chr1531113 347 68 1830 ----
NM_015511chr2031176 860 227 ----1843
NM_015516chr1151402 1186 570 295 152 11164 ----
NM_015517chr11--199 ----
NM_015528chr173131 65 53 ----1169
NM_015530chr22916 646 ------
NM_015534chr12802 94 1382 ----
NM_015535chr253508 2652 1360 205 184 1562 1995 --
NM_015542chr1011042 --1217 --
NM_015549chr143459 415 396 ------
NM_015550chr743177 3106 2969 51 13336 ----
NM_015554chr1521989 149 ----11836
NM_015555chr6134 1129 ----
NM_015556chr141175 ------
NM_015564chr522769 2575 ------
NM_015567chr132447 254 ------
NM_015568chr2084224 3604 3201 1632 1466 1433 1253 1081 13000 ----
NM_015569chr164714 4666 4567 4090 2950 212 --11013 --
NM_015570chr731829 657 624 11695 11448 --
NM_015575chr283480 3287 2806 2467 2450 1061 349 133 ------
NM_015576chr332459 1997 1847 1612 ----
NM_015577chr541713 1515 421 320 ----1429
NM_015601chr10--1801 ----
NM_015602chr121481 1360 ------
NM_015609chr142363 2120 1050 766 12429 11083 --
NM_015610chr742883 1999 1005 194 ------
NM_015626chr1711156 ------
NM_015627chr131375 1176 678 --11765 --
NM_015630chr21811 ------
NM_015635chr922102 1898 1741 ----
NM_015651chr961954 1692 761 712 319 73 ------
NM_015652chr10195 ------
NM_015686chrX72471 2278 2138 1989 1675 969 745 11561 ----
NM_015691chrX62845 2815 2543 2198 2032 672 ----12785
NM_015695chr632031 596 529 1843 1129 --
NM_015704chr222117 38 ------
NM_015711chr191682 --1650 --
NM_015716chr173732 159 94 ------
NM_015723chr72480 200 ------
NM_015836chr151543 407 129 69 29 ------
NM_015853chr11----1136 --
NM_015866chr11464 ------
NM_015872chr111267 --11723 --
NM_015878chr811867 1160 ----
NM_015879chr1898462 8324 7236 6099 5922 5586 5500 2751 1400 27161 67 12885 --
NM_015885chr11------1124
NM_015888chr132066 494 290 ----13029
NM_015889chr221111 ------
NM_015898chr1961826 1622 874 760 430 182 --11683 --
NM_015902chr82902 328 ------
NM_015906chr143357 1605 881 563 --23259 1802 --
NM_015932chr133565 230 148 ------
NM_015952chr6--1131 ----
NM_015955chr2--2356 69 ----
NM_015959chr11179 --1698 1475
NM_015975chrX1276 ------
NM_015989chr12273 26 ------
NM_015995chr1535429 4729 3966 1688 45118 1346 887 54 1651
NM_016003chr742883 1999 1005 194 ------
NM_016006chr31175 --1191 --
NM_016009chr194463 4253 4078 3854 3809 3260 1934 1804 427 2487 192 24725 135 --
NM_016018chr832417 1752 463 1906 135 --
NM_016019chr71333 ------
NM_016021chr662994 2744 2555 2247 1892 710 33010 1216 1128 ----
NM_016023chr832032 855 179 --11490 1885
NM_016025chr1621974 1907 123 ----
NM_016027chr81204 138 ----
NM_016032chrX1122 ----1461
NM_016037chr11245 ------
NM_016041chr171304 ------
NM_016061chr211605 ------
NM_016072chr1212195 ------
NM_016073chr151187 ------
NM_016076chr143015 2226 877 470 2648 352 13006 --
NM_016083chr61330 22456 1015 13341 --
NM_016087chr721405 693 11642 ----
NM_016096chr811405 12004 ----
NM_016098chr6126 ------
NM_016100chr201109 ------
NM_016103chr51200 ------
NM_016104chr6--1131 ----
NM_016131chr242248 1453 945 707 ------
NM_016132chr1532938 2635 2280 ------
NM_016133chr221342 482 ------
NM_016141chr32742 61 ------
NM_016144chr53682 291 106 ------
NM_016152chr331247 994 382 1482 ----
NM_016156chr1152248 1547 646 422 74 ------
NM_016179chr13--1200 ----
NM_016201chr342151 831 510 238 ------
NM_016205chr4------1225
NM_016206chr396959 6200 3551 3325 3136 2875 1234 578 223 12323 1149 16851
NM_016221chr532076 447 86 ------
NM_016224chr65838 738 523 183 37 11360 ----
NM_016227chr121306 371 ------
NM_016230chr6--1115 1168 --
NM_016231chr17142 ------
NM_016233chr11147 --1937 --
NM_016235chr16--11413 ----
NM_016252chr21638 ------
NM_016258chr12772 257 ------
NM_016260chr245934 2704 1142 1132 --25970 5071 15293
NM_016271chr1811636 ------
NM_016272chr2212823 --2765 525 --
NM_016275chr342707 1814 232 120 12538 --1713
NM_016277chr621387 1330 ------
NM_016281chr1221083 778 ------
NM_016284chr163934 386 288 ------
NM_016287chr121490 311 ------
NM_016289chr241975 1905 1836 617 --1202 --
NM_016300chr3--1208 146 --
NM_016308chr121843 288 --12090 --
NM_016315chr221597 1451 ------
NM_016322chr943135 377 336 81 --13061 12592
NM_016328chr7----1140 --
NM_016329chr31395 ------
NM_016338chr51969 ------
NM_016352chr731091 473 233 ------
NM_016357chr1231218 1152 24 --11028 --
NM_016374chr14629 618 474 270 --1248 --
NM_016374chr14629 618 474 270 --1248 --
NM_016376chr1761655 1343 619 436 368 103 14262 ----
NM_016377chr621514 319 ------
NM_016396chr1542972 2515 1968 948 11182 12169 --
NM_016410chr91178 --1451 --
NM_016413chr13--1445 ----
NM_016418chr2242860 2504 843 312 --145 13697
NM_016422chr1152772 1252 759 728 172 ------
NM_016424chr1731938 1383 68 --11493 --
NM_016436chr202637 533 1610 11712 --
NM_016448chr151898 1568 1222 123 107 1272 ----
NM_016486chr11182 ------
NM_016506chr113449 272 162 ------
NM_016507chr1721962 500 --12080 --
NM_016513chr643596 3221 2391 197 --1510 --
NM_016516chr23672 636 579 ------
NM_016519chr4--1175 ----
NM_016522chr1131429 1328 1189 ------
NM_016529chr132865 126 --11009 --
NM_016530chr1573824 3812 2546 1323 1178 500 311 22970 1435 ----
NM_016531chr421470 614 ------
NM_016539chr192432 28 ------
NM_016542chrX31127 347 99 ------
NM_016544chr223365 1068 12727 1715 --
NM_016559chr32995 424 ------
NM_016578chr111551 ------
NM_016587chr72204 55 ------
NM_016588chr6--2721 251 ----
NM_016596chr123916 779 86 1909 ----
NM_016603chr521561 415 ------
NM_016604chr52814 39 --2285 249 --
NM_016605chr511716 --1793 --
NM_016620chr111438 ------
NM_016621chr1164333 4151 3436 3206 2812 1708 --31639 1291 455 --
NM_016623chr81407 1663 ----
NM_016626chr182429 112 ----11687
NM_016628chr101320 ------
NM_016631chr212941 390 --1882 --
NM_016641chr162664 584 11347 11516 --
NM_016645chr151325 ------
NM_016651chr14--2392 174 ----
NM_016654chr151871 ------
NM_016656chrX1304 ------
NM_016824chr101196 --1295 --
NM_016831chr151821 1800 1506 949 238 ----1593
NM_016834chr1734061 2649 157 --23546 3044 --
NM_016835chr1734061 2649 157 --23546 3044 --
NM_016836chr23765 726 550 ------
NM_016839chr23765 726 550 ------
NM_016841chr1734061 2649 157 --23546 3044 --
NM_016930chr41760 161 ----
NM_016932chr23366 315 29 --1661 --
NM_016936chr1622138 220 1754 11488 --
NM_016937chrX21006 344 1202 --1359
NM_016946chr141212 1019 525 103 --11383 11354
NM_016950chr41405 ------
NM_016952chr1194038 3573 3180 2884 2728 1483 935 822 413 23489 1550 ----
NM_017409chr121577 ------
NM_017410chr1221167 406 ------
NM_017412chr821429 62 1103 ----
NM_017413chrX42530 2476 1006 852 --21808 350 --
NM_017415chr5144296 4080 3351 3192 2968 1728 1313 1283 1225 1209 755 486 257 228 1736 13549 --
NM_017420chr1443111 1376 988 194 --11004 13524
NM_017423chr42830 312 1273 1491 --
NM_017432chr192453 145 ------
NM_017437chr142332 286 ----1197
NM_017447chr2131611 583 174 13184 ----
NM_017449chr131634 1063 664 ------
NM_017450chr173236 131 48 ------
NM_017452chr202558 329 11036 1434 --
NM_017453chr202558 329 11036 1434 --
NM_017454chr202558 329 11036 1434 --
NM_017456chr1731612 228 35 1354 ----
NM_017481chr11142 ------
NM_017482chr231612 1538 1524 ------
NM_017522chr12906 380 --1898 --
NM_017525chr111223 ------
NM_017540chr562999 2560 2345 2018 494 276 23135 2927 13065 --
NM_017544chrX--2756 621 ----
NM_017546chr22876 140 ------
NM_017548chr311757 1320 1824 --
NM_017550chr192102 74 --1841 --
NM_017551chr1052250 2227 2080 750 714 12671 1324 --
NM_017553chr1531220 395 65 1476 ----
NM_017577chr31177 21247 514 1589 --
NM_017580chr101954 11678 1896 --
NM_017582chr121792 467 --11720 --
NM_017588chr941972 1701 1448 1321 --1740 --
NM_017590chr2232689 2384 538 1675 ----
NM_017596chr1114394 3660 3453 3414 3161 1827 1577 1561 1488 1445 1079 23538 254 34201 902 724 --
NM_017602chrX1655 ------
NM_017610chr1521864 342 ------
NM_017617chr93189 93 43 ------
NM_017626chr1031684 1411 362 11183 11356 --
NM_017628chr455141 4828 4648 4501 1785 54549 4061 3848 3236 392 24600 4317 21397 759
NM_017629chr111761 1514 1106 --
NM_017632chr4------183
NM_017633chr632509 833 532 --13617 --
NM_017635chr112451 204 --1536 --
NM_017637chr9108625 8461 7964 7504 7066 6796 6086 3685 2705 710 --48848 6179 3156 368 --
NM_017640chr62153 23 1278 1230 1770
NM_017644chr374848 4080 3691 3592 3432 172 131 45048 5026 4032 327 2720 232 --
NM_017646chr11186 --121 --
NM_017650chr735978 5721 1557 11850 --1957
NM_017657chr21908 ------
NM_017658chr1453212 3130 2880 677 98 ------
NM_017660chr1932942 983 474 21137 268 1246 --
NM_017661chr152482 336 ------
NM_017666chrX3704 338 246 2278 150 --1576
NM_017668chr16145 --1697 --
NM_017672chr151415 ------
NM_017686chr151065 809 725 697 106 ------
NM_017694chr231937 719 702 ------
NM_017709chr184168 3016 2796 1427 1233 1184 852 93 --1964 --
NM_017712chr19116242 6020 5369 5303 4984 1790 645 553 537 401 348 --45956 5145 2226 505 --
NM_017714chr20----1175 --
NM_017715chr75743 660 479 270 242 ------
NM_017719chr31161 12232 ----
NM_017724chr32553 314 ------
NM_017728chr1711141 ----194
NM_017730chr33611 580 119 ------
NM_017737chr131854 372 345 11633 ----
NM_017740chr1631726 1407 1266 --11343 --
NM_017744chr142207 728 243 216 ------
NM_017747chr51104 ------
NM_017749chr112702 355 ------
NM_017752chrX92142 1613 1486 1386 786 744 602 563 169 ------
NM_017753chr92883 678 ------
NM_017754chr684664 4440 4075 1044 918 571 266 151 ----14296
NM_017755chr53518 171 150 ------
NM_017758chr1741306 1226 942 415 1375 --11122
NM_017762chr152745 653 12017 ----
NM_017772chr621231 135 134 ----
NM_017778chr821290 1170 --11217 --
NM_017779chr122276 728 ------
NM_017780chr81665 ------
NM_017784chr341189 1178 797 23 11018 ----
NM_017798chr2021104 120 ------
NM_017799chr1461692 1494 1394 1328 453 247 ------
NM_017801chr342581 2244 998 538 --1948 --
NM_017810chr16154 --1269 --
NM_017813chr855722 3625 3543 1616 943 --23657 1630 --
NM_017824chr1032057 1708 1054 22152 1790 ----
NM_017830chr4--195 ----
NM_017831chr1854382 4260 3324 1873 1074 14534 14267 --
NM_017848chrX24482 1693 11877 1655 11454
NM_017851chr1571084 1064 1044 512 383 269 156 1947 1954 1973
NM_017857chr113677 617 549 ------
NM_017866chr82954 67 11070 ----
NM_017905chr132533 149 ------
NM_017907chr111483 --1194 --
NM_017911chr2221039 40 ------
NM_017919chr9105169 4800 4707 4043 3921 1313 1123 1029 704 432 25429 2311 ----
NM_017921chr171360 --11709 --
NM_017922chr141109 1634 ----
NM_017925chr911492 ------
NM_017929chr2231354 1203 838 --1397 1957
NM_017938chrX21741 39 ------
NM_017955chr1441154 1106 856 229 ----1826
NM_017964chr22668 202 ------
NM_017966chr111135 11083 1187 --
NM_017987chr1021656 279 --197 --
NM_017998chr921023 521 ------
NM_018009chr122160 119 ------
NM_018018chr122693 439 ------
NM_018024chr81584 ------
NM_018046chr51694 ------
NM_018047chr52870 152 1835 --1812
NM_018054chr16--199 2214 142 --
NM_018061chr131182 1176 151 ------
NM_018062chr22416 403 ------
NM_018063chr102370 343 ------
NM_018064chr61120 ------
NM_018070chr11443 ------
NM_018078chr41421 ------
NM_018084chr2--22549 75 --11296
NM_018085chr1128100 7042 6952 6941 6025 5371 3220 2589 2200 951 528 70 17110 ----
NM_018086chr211745 --11786 --
NM_018087chr11195 ------
NM_018092chr1621245 616 ------
NM_018094chrX1150 ------
NM_018095chr113449 272 162 ------
NM_018111chr19149 131 ----
NM_018113chr121443 ------
NM_018115chr42768 663 1748 1523 --
NM_018121chr1032633 2490 53 22696 2672 --12095
NM_018133chr332085 1730 1540 1430 ----
NM_018155chr363037 2957 1388 730 699 308 2882 225 2396 173 --
NM_018157chr1243248 2361 2151 1230 22304 2210 ----
NM_018167chr143894 616 369 ------
NM_018179chr123615 203 51 ------
NM_018180chr101113 ------
NM_018181chr1851899 1398 773 581 418 1588 ----
NM_018184chr361851 1586 1496 659 329 112 ------
NM_018191chr1321906 170 --1285 --
NM_018200chr1561937 1033 928 683 560 453 ----1255
NM_018202chr12681 281 ------
NM_018205chr101421 1533 22223 2165 --
NM_018206chr16187 ------
NM_018208chr1----21128 954 --
NM_018214chr6134 ------
NM_018222chr1121754 1178 ------
NM_018223chr121263 127 ----
NM_018234chr222078 845 12237 ----
NM_018237chr10--1187 ----
NM_018239chr101421 1533 22223 2165 --
NM_018240chr13867 696 109 1590 --151
NM_018246chr812222 11903 ----
NM_018247chr622123 65 12894 ----
NM_018254chr122260 430 ------
NM_018256chr2196 ------
NM_018266chr311017 ------
NM_018272chr12--1207 ----
NM_018293chr352565 812 327 113 96 ------
NM_018298chr12940 262 ------
NM_018299chr81780 ------
NM_018300chr192577 182 1100 ----
NM_018307chr171958 ------
NM_018312chr112851 805 ------
NM_018313chr31566 21622 1069 --12424
NM_018318chr121945 ------
NM_018320chr112341 197 --11160 --
NM_018323chr411540 11597 21236 375 11365
NM_018325chr921384 362 1452 ----
NM_018327chr20--11384 ----
NM_018351chr1273921 3479 3334 3313 1703 1007 731 14198 23978 1714 --
NM_018361chr82936 165 ------
NM_018362chr1122503 1243 12979 1245 --
NM_018363chr101325 174 ----
NM_018364chr163926 3871 3852 3238 2817 2570 13400 23654 1220 --
NM_018367chr112285 190 ------
NM_018368chr61224 197 ----
NM_018371chr821048 155 ------
NM_018373chr14106396 5877 5631 2510 2418 2040 1834 1622 1603 297 --11884 24314 420
NM_018374chr744494 3826 1619 751 21957 1507 11693 --
NM_018383chr211945 ----1151
NM_018387chr9283 70 ------
NM_018403chr383663 3619 1586 1530 1501 1228 570 426 1328 ----
NM_018416chr1252632 2120 1911 1777 888 --1565 --
NM_018424chr921706 1598 ------
NM_018426chr6--1118 ----
NM_018431chr201600 1634 ----
NM_018439chr1852366 2126 946 408 318 12263 1969 --
NM_018440chr835618 556 437 18317 1505 --
NM_018442chr11372 ------
NM_018444chr822391 2145 ------
NM_018448chr12----1147 --
NM_018452chr6_random63484 2424 1404 1361 909 410 1790 23796 2668 --
NM_018462chr3--174 1144 --
NM_018469chr1731375 494 282 --1427 --
NM_018476chrX148 ------
NM_018482chr82829 310 2174 55 1938 --
NM_018509chr1721514 283 --21371 602 --
NM_018553chr1721210 244 ------
NM_018557chr211345 --11089 11542
NM_018566chr164308 4146 3883 2051 1267 846 --13441 --
NM_018569chr441558 1093 199 84 ------
NM_018571chr21472 ------
NM_018602chr153308 150 88 ------
NM_018638chr1285615 5595 4969 4491 3542 1938 1931 1205 13570 ----
NM_018640chr1242384 844 800 423 11873 ----
NM_018644chr111896 22222 2005 147 --
NM_018649chr101520 ------
NM_018650chr111558 2848 454 ----
NM_018652chr152640 252 ------
NM_018657chr31177 ------
NM_018660chr863020 3004 2501 2374 866 385 1933 ----
NM_018683chr2031704 644 201 ------
NM_018686chr12139 1271 ----
NM_018691chr541078 1032 470 298 1150 ----
NM_018695chr51478 ------
NM_018700chr51181 21214 163 ----
NM_018708chr1951231 675 595 391 173 --1303 --
NM_018710chr81218 ------
NM_018711chr1231495 1178 27 --1453 --
NM_018712chr112377 115 ------
NM_018713chr12974 75 11083 ----
NM_018715chr131859 597 189 --12160 --
NM_018717chr442731 1061 887 534 1906 ----
NM_018718chr731799 1744 1719 1700 11960 --
NM_018719chr721232 1119 ------
NM_018840chr202390 334 ------
NM_018841chr173909 3235 2446 1273 1025 472 233 --33604 1455 273 --
NM_018890chr741100 1066 255 107 ------
NM_018898chr532286 2201 632 ------
NM_018899chr532286 2201 632 ------
NM_018900chr532286 2201 632 ------
NM_018901chr532286 2201 632 ------
NM_018902chr532286 2201 632 ------
NM_018903chr532286 2201 632 ------
NM_018904chr532286 2201 632 ------
NM_018905chr532286 2201 632 ------
NM_018906chr532286 2201 632 ------
NM_018907chr532286 2201 632 ------
NM_018908chr532286 2201 632 ------
NM_018909chr532286 2201 632 ------
NM_018910chr532286 2201 632 ------
NM_018911chr532286 2201 632 ------
NM_018912chr521761 668 ------
NM_018913chr521761 668 ------
NM_018914chr521761 668 ------
NM_018915chr521761 668 ------
NM_018916chr521761 668 ------
NM_018917chr521761 668 ------
NM_018918chr521761 668 ------
NM_018919chr521761 668 ------
NM_018920chr521761 668 ------
NM_018921chr521761 668 ------
NM_018922chr521761 668 ------
NM_018923chr521761 668 ------
NM_018924chr521761 668 ------
NM_018925chr521761 668 ------
NM_018926chr521761 668 ------
NM_018927chr521761 668 ------
NM_018928chr521761 668 ------
NM_018929chr521761 668 ------
NM_018945chr673469 2514 2421 2292 1037 964 438 13441 ----
NM_018948chr12985 495 1125 1504 --
NM_018951chr72952 334 162 ----
NM_018957chr221105 ------
NM_018959chr193687 490 132 1249 ----
NM_018970chr7------12806
NM_018972chr832330 2281 441 ------
NM_018976chr1252437 2280 1870 966 593 32234 1856 824 ----
NM_018981chr221155 969 1909 ----
NM_018993chr2061393 1363 1282 1140 410 57 1466 ----
NM_018994chr12566 34 --1394 --
NM_018999chr1064544 4055 3049 1261 704 102 ------
NM_019000chr5--11548 ----
NM_019004chr7----1380 --
NM_019005chr7142 ------
NM_019006chr151256 ------
NM_019008chr2263581 2792 1061 917 454 403 --1571 --
NM_019015chr71134 ------
NM_019027chr442614 1790 948 862 1237 --11884
NM_019028chr11--1429 ----
NM_019035chr411948 ------
NM_019042chr731154 1094 967 --11055 --
NM_019045chrX5840 735 691 314 216 ------
NM_019049chr12763 526 ------
NM_019050chr421585 893 32159 1817 736 1766 --
NM_019053chr1021017 376 ------
NM_019058chr101636 --1730 --
NM_019063chr22627 550 3888 842 722 ----
NM_019071chr7--1496 ----
NM_019072chr512676 24264 3385 ----
NM_019074chr151394 ----2871 283
NM_019083chr121439 31 ------
NM_019084chr1032463 2389 2118 ------
NM_019088chr19182 ------
NM_019094chr1243799 3747 3685 2907 23617 151 1962 --
NM_019114chr962384 2245 900 65 51 40 --12007 --
NM_019116chr1673541 3391 3297 3223 2810 2751 1127 11199 23456 2957 11386
NM_019555chr341806 1576 1529 415 11647 ----
NM_019556chrX21271 63 ------
NM_019557chr12660 60 ------
NM_019591chr12--1154 ----
NM_019592chr92699 240 --1603 --
NM_019593chr2053046 2834 2040 1075 89 --12019 --
NM_019597chrX2700 494 ------
NM_019605chr11645 ------
NM_019606chr7184 ------
NM_019610chr11575 --11515 --
NM_019613chr171147 143 ----
NM_019624chr124857 708 272 257 1216 ----
NM_019625chr124857 708 272 257 1216 ----
NM_019843chr22187 ------
NM_019848chrX--1121 ----
NM_019860chr102610 474 ------
NM_019895chr341008 959 930 766 ------
NM_019896chr21197 3122 44 31 ----
NM_019903chr101196 --1295 --
NM_020066chr11858 ------
NM_020116chr421481 633 1581 ----
NM_020122chr265295 5034 1780 1094 1000 473 12044 1736 15076
NM_020135chr61436 ------
NM_020144chr71845 1286 21591 1431 --
NM_020148chr1853084 2996 2840 1083 259 --13119 1695
NM_020151chr221486 609 ------
NM_020152chr211710 ------
NM_020159chr4--21500 489 ----
NM_020166chr3137 ------
NM_020177chr512502 ------
NM_020178chr1741190 829 409 322 ------
NM_020179chr113164 137 128 ----177
NM_020180chr181389 ------
NM_020182chr2043487 2539 961 758 23405 896 22956 779 --
NM_020192chr7--1142 ----
NM_020193chr1131069 1024 894 --1258 --
NM_020198chr1741531 1454 1288 998 ------
NM_020204chr11248 ------
NM_020205chr132809 2802 2485 ----12501
NM_020226chr42490 22 ------
NM_020228chr1141942 1925 635 277 ----12060
NM_020235chr32267 254 1307 ----
NM_020239chr11418 12231 ----
NM_020240chr532180 1066 137 12541 22782 961 12512
NM_020245chr674932 4424 3856 3162 1129 1039 40 13181 153 14154
NM_020309chr192347 280 ------
NM_020310chr1731037 515 354 --2441 408 --
NM_020336chr2082665 2629 2560 1257 698 482 300 284 --22716 501 12914
NM_020337chr422880 171 ------
NM_020341chr2042071 1458 551 221 11364 ----
NM_020342chr22818 184 ------
NM_020348chr1062807 2323 2119 821 246 117 21954 737 --12587
NM_020353chr342046 1615 1462 341 1460 ----
NM_020354chr10----1168 --
NM_020357chr321347 642 1663 ----
NM_020362chr13808 618 235 ------
NM_020363chrY11536 --11370 --
NM_020374chr1211617 ------
NM_020381chr621705 147 173 ----
NM_020382chr1261459 1036 554 542 203 143 ------
NM_020384chrX41696 1574 452 217 ------
NM_020390chr334605 3842 1135 189 --14209
NM_020416chr452171 2012 686 329 172 --1613 11083
NM_020420chrY11536 --11370 --
NM_020423chr12229 76 ------
NM_020429chr742816 2506 265 259 32580 1973 1176 12754 --
NM_020432chr711712 12175 ----
NM_020438chr921215 124 ------
NM_020440chr133027 1257 513 ------
NM_020443chr1106351 5064 4880 4335 4251 2769 2519 1447 968 277 1746 36916 1281 318 --
NM_020452chr142165 1345 849 537 ------
NM_020453chr461616 1593 1458 1451 1370 491 1656 21295 595 --
NM_020458chr262087 734 666 563 392 229 --2859 172 --
NM_020463chr24546 212 84 34 ------
NM_020466chr633989 3076 1630 14045 ----
NM_020473chrX11733 ------
NM_020474chr1851889 799 313 180 101 12009 ----
NM_020526chr111649 --1189 11299
NM_020630chr101682 ------
NM_020640chr331627 1443 196 21768 350 ----
NM_020642chr113556 467 118 ------
NM_020647chr82867 212 ------
NM_020649chr17----193 --
NM_020651chr22270 207 ------
NM_020655chr1641171 919 450 164 --1534 --
NM_020673chr20117409 7316 7278 6594 6534 5959 1293 1238 1099 237 107 --36547 5357 2174 --
NM_020676chr3--1263 ----
NM_020697chr841312 980 231 198 1506 ----
NM_020698chr1213093 1728 --1662
NM_020699chr154093 1878 1360 833 229 14702 35138 4158 1870 --
NM_020708chr2042479 1895 1002 323 12345 1229 --
NM_020711chr231633 496 479 2666 658 1531 --
NM_020715chr143751 644 436 21528 149 22155 325 --
NM_020717chrX64102 4022 3591 1805 1291 1100 31978 300 55 1860 --
NM_020718chr1695511 5334 4141 1979 1410 1150 1053 701 508 --16111 --
NM_020727chr2153460 2490 1323 1284 1077 --13143 --
NM_020734chr1222938 927 --11299 --
NM_020738chr22576 201 ------
NM_020739chr1513870 13088 1867 --
NM_020747chr51920 ------
NM_020748chr1731862 1552 295 1332 ----
NM_020750chr61263 1967 132 --
NM_020752chr1032757 1158 697 22816 982 ----
NM_020753chr173520 326 46 ------
NM_020760chr2153 1530 ----
NM_020762chr1231038 928 121 ------
NM_020766chrX84230 3685 3533 1581 1268 820 634 231 ------
NM_020769chrX1831 2886 104 1712 --
NM_020771chr621502 1403 ------
NM_020772chr17118416 8145 8037 7585 5934 5924 5376 2458 1637 1503 70 28550 5538 ----
NM_020773chr42938 136 22048 1764 --11722
NM_020774chr1895114 4814 4697 2484 1566 1051 975 774 61 35643 5353 1040 ----
NM_020778chr1584868 4851 4106 4037 4001 1529 1440 172 13612 24539 620 --
NM_020779chr232737 497 457 ------
NM_020782chr12104507 4004 3866 3761 3490 3383 3278 1940 952 641 54854 4732 4193 3789 869 13285 --
NM_020783chr181731 21658 946 ----
NM_020792chr342829 2073 997 491 1319 12472 --
NM_020794chr1--1383 ----
NM_020795chr1771706 1674 1539 1315 293 250 84 --1203 --
NM_020796chr542823 2817 2386 599 12269 12741 --
NM_020800chr311139 ------
NM_020801chr541844 930 780 248 1631 --11861
NM_020805chr1831841 1764 643 11430 ----
NM_020806chr141667 ------
NM_020808chr11392 186 ----
NM_020809chr1121887 213 ------
NM_020810chr1433198 2238 795 --11347 --
NM_020813chr1932028 1798 196 128 1414 --
NM_020818chr141165 ------
NM_020819chr6----1309 --
NM_020820chr2011457 11261 2288 77 --
NM_020825chr1683688 2600 2499 1376 1218 1109 942 435 --11528 --
NM_020830chr233130 1095 1064 11998 1388 --
NM_020832chr11499 ------
NM_020834chr14--11839 ----
NM_020839chr321530 449 11223 ----
NM_020841chr1243021 2748 1401 77 12792 --11021
NM_020844chr886930 6756 4798 2857 2581 2479 2391 506 15572 26146 2414 --
NM_020845chr1252284 2201 2026 782 118 12374 ----
NM_020850chr1693191 2925 2751 2505 2005 1115 1061 977 256 --22720 129 --
NM_020854chr182500 79 --11225 --
NM_020856chr1911270 11157 ----
NM_020858chr1521512 30 --1367 --
NM_020859chr443611 3402 1557 153 --1356 --
NM_020860chr4----1117 1719
NM_020861chr62364 163 ------
NM_020865chr3--1122 ----
NM_020868chr232008 1767 1700 --11740 --
NM_020870chr411677 11865 ----
NM_020871chrX2506 464 21818 1023 ----
NM_020872chr311111 160 ----
NM_020873chr3--1566 ----
NM_020888chr141492 693 245 198 --2658 138 --
NM_020896chr113986 781 228 1851 1211 --
NM_020899chr1761728 1567 600 519 413 214 ------
NM_020918chr1053181 2601 1237 750 142 --1978 --
NM_020919chr23964 480 65 ------
NM_020921chr1463651 2890 2639 1069 925 684 --1725 --
NM_020922chrX21266 356 ------
NM_020927chr1642329 1943 1791 1485 11599 ----
NM_020940chr102195 97 ------
NM_020946chr91640 1586 ----
NM_020947chr1641960 1573 1491 678 ------
NM_020948chr132971 677 156 1810 ----
NM_020956chr1964626 3685 3399 1221 1003 418 --11401 --
NM_020958chr141380 ------
NM_020962chr1531548 624 393 --12260 --
NM_020967chr202844 476 --1397 --
NM_020971chr192888 633 ------
NM_020977chr411691 --11940 --
NM_020988chr1641262 1251 891 108 1204 2451 90 --
NM_020993chr1242489 1099 860 410 --22319 382 --
NM_021007chr211586 11804 ----
NM_021019chr12179 ------
NM_021020chr852611 2582 2526 1415 527 --53329 849 290 229 153 --
NM_021025chr51353 ------
NM_021033chr1373237 2811 2321 1158 774 672 389 21032 990 --21382 719
NM_021035chr202928 23 ------
NM_021038chr342630 2279 1315 633 13166 ----
NM_021047chr191736 151 1489 --
NM_021072chr542522 2248 1833 234 2668 525 --11690
NM_021079chr1783262 3047 2933 2601 1067 574 395 129 --12801 12484
NM_021083chrX23581 548 22856 483 23208 262 --
NM_021088chr231375 807 675 ------
NM_021090chr2254405 4344 1218 1067 770 33442 1018 217 --14518
NM_021096chr2273015 2958 2932 2255 1199 1021 366 11286 ----
NM_021097chr22337 275 1543 ----
NM_021100chr203762 371 216 ------
NM_021101chr342320 2273 2017 509 ------
NM_021106chr91705 --1618 --
NM_021109chrX150 ------
NM_021109chrX150 ------
NM_021111chr921335 950 11291 ----
NM_021116chr7128247 8241 7696 7353 7250 6821 6766 3528 3234 2372 1945 1717 27876 7864 26106 698 1661
NM_021120chrX52797 1259 1119 1020 799 12939 12297 --
NM_021132chr101434 --1981 --
NM_021133chr121088 1078 --177 --
NM_021137chr1752001 1862 1734 1728 733 ------
NM_021141chr22845 257 21013 872 ----
NM_021145chr72977 969 ----1415
NM_021158chr202101 64 ------
NM_021159chr421676 1323 ------
NM_021165chr11269 ------
NM_021174chr82661 588 ------
NM_021183chrX51960 833 387 263 166 ----1175
NM_021190chr1--11055 ----
NM_021198chr251462 1304 1249 1096 434 1215 21446 76 --
NM_021202chr2042812 2632 2327 1138 11122 22097 1942 11245
NM_021213chr1741044 1007 258 134 2327 154 ----
NM_021215chr2032112 1785 337 22319 1835 1460 --
NM_021227chr4--1452 ----
NM_021229chr123431 325 134 ------
NM_021238chr1241955 803 741 291 --11405 --
NM_021240chr91208 ------
NM_021242chrX1294 ------
NM_021249chr142400 37 --11135 --
NM_021253chr651112 951 909 304 82 ------
NM_021260chr141392 ------
NM_021269chr19--1101 ----
NM_021627chr3--1803 ----
NM_021629chr345075 4716 4537 188 43627 1059 606 135 ----
NM_021638chr494960 4489 4439 4214 4110 1770 1439 1153 1141 33066 314 192 24446 3363 --
NM_021643chr231393 1340 233 ------
NM_021644chr1011024 1273 ----
NM_021705chr631508 1321 190 ------
NM_021728chr142349 156 ------
NM_021729chr111270 ------
NM_021738chr102309 285 ------
NM_021809chr2021595 1554 11781 --1133
NM_021813chr665047 4082 2185 1841 1620 127 21463 268 25374 1390 --
NM_021814chr61607 11574 ----
NM_021905chr661662 620 614 134 47 34 ----1189
NM_021907chr2----181 --
NM_021911chr565373 4394 3404 1947 1629 1230 11381 ----
NM_021914chr142649 223 ------
NM_021940chr611517 ------
NM_021943chr62704 400 --1430 --
NM_021946chrX2431 351 ------
NM_021959chr62709 253 1364 ----
NM_021960chr11503 --11882 --
NM_021961chr11157456 7425 7179 6975 6443 5678 5359 5097 5007 4943 4690 2748 2725 2553 2440 36770 4764 386 16652 --
NM_021962chr1731733 635 473 --2528 388 --
NM_021964chr356482 5358 4960 4047 1898 15694 12270 26134 5793
NM_021965chr9167 --11095 1208
NM_021966chr142285 111 ----1308
NM_021970chr42635 194 ------
NM_021979chr14136 ------
NM_021984chrX3410 399 196 ------
NM_021987chrX3410 399 196 ------
NM_021988chr2021583 377 159 1640 11125
NM_021990chrX3410 399 196 ------
NM_021991chr172552 143 --1682 --
NM_021998chrX21290 459 ------
NM_021999chr132118 91 ------
NM_022041chr1632713 796 105 ------
NM_022044chr22199 ------
NM_022048chr15116362 6021 5530 5258 4570 4328 4131 1835 1302 565 405 11920 ----
NM_022060chr142541 203 --2370 334 --
NM_022062chr11----1393 161
NM_022075chr12969 352 1156 ----
NM_022079chr10--1801 ----
NM_022114chr164058 3503 1873 1341 1039 215 14030 13391 1864
NM_022116chr73355 177 42 ------
NM_022118chr132501 484 ------
NM_022123chr142234 110 1197 ----
NM_022129chr10--179 ----
NM_022130chr51135 --1181 21342 408
NM_022133chr821756 1275 ------
NM_022140chr531585 657 337 12347 ----
NM_022156chr17169 ------
NM_022166chr16126311 5730 5438 5129 4891 3865 2458 2101 1839 745 275 184 26366 1674 14844 --
NM_022170chr741424 1221 368 182 11588 ----
NM_022336chr22162 100 --2843 690 --
NM_022337chr113632 620 174 ------
NM_022340chr383681 3667 3386 3298 3255 2482 1331 420 ------
NM_022351chr813245 ------
NM_022353chr21176 --1361 --
NM_022366chr11372 ------
NM_022373chr7----1238 --
NM_022442chr2021583 377 159 1640 11125
NM_022459chr13105659 2481 1923 1658 726 709 693 677 600 314 1513 15221 --
NM_022461chr321446 274 ----1116
NM_022465chr1262454 2424 2111 1122 840 280 ------
NM_022474chr1442599 2442 2103 206 1249 ----
NM_022477chr2031667 1646 378 ------
NM_022484chr711247 ------
NM_022552chr22914 168 21180 872 ----
NM_022553chr6--2205 138 1185 --
NM_022572chr221504 1471 ------
NM_022574chr711894 --12030 --
NM_022648chr294642 3141 2936 2862 1839 1734 1299 1132 982 1626 43422 3321 1846 1802 --
NM_022652chr122340 79 1389 ----
NM_022659chr81409 ------
NM_022720chr223598 149 135 ----1326
NM_022733chr121179 1085 ------
NM_022735chr131847 1695 437 11565 ----
NM_022744chr1641281 1271 952 301 ------
NM_022745chr152793 2258 1856 1088 421 21127 550 ----
NM_022748chr732768 1124 986 --3581 474 184 --
NM_022749chr821411 1070 --2229 203 --
NM_022750chr7----261 25 --
NM_022753chr152624 2589 2229 775 750 ------
NM_022755chr932036 1799 825 12582 ----
NM_022756chr12501 191 11489 ----
NM_022758chr632854 2167 1995 ------
NM_022763chr33935 323 255 1974 22701 2145 --
NM_022765chr6123 ------
NM_022771chr121196 --1376 --
NM_022776chr3----11342 11224
NM_022780chr22663 191 ----1210
NM_022781chr922686 708 2384 172 23000 2654 --
NM_022782chr12--199 ----
NM_022802chr10193 ------
NM_022810chrX2284 38 ------
NM_022817chr232297 2129 390 ------
NM_022821chr11169 --1336 --
NM_022823chr21457 ------
NM_022824chr551460 1353 638 521 192 --1362 --
NM_022826chr211191 ------
NM_022841chr1521778 435 ------
NM_022843chr13--1266 11015 --
NM_022844chr161877 --1813 --
NM_022845chr1632074 1559 577 --11917 --
NM_022893chr253095 3072 2224 661 312 --12889 --
NM_022894chr22623 530 1118 ----
NM_022897chr521112 817 2382 35 ----
NM_022898chr1464358 4293 3975 3685 3504 207 --24018 721 1743
NM_022912chr252829 2719 529 522 303 12133 22751 189 --
NM_022918chr111520 ------
NM_022965chr41372 1564 2503 274 --
NM_022970chr101305 21240 587 11051 --
NM_022977chrX61701 1052 771 457 378 73 ------
NM_023000chr141605 1312 ----
NM_023001chr141605 1312 ----
NM_023009chr12576 91 ------
NM_023034chr82226 92 ------
NM_023037chr132130 74 ----184
NM_023076chr1662192 1830 952 436 374 177 ------
NM_023079chr172728 509 1465 1276 --
NM_023923chr153770 3493 3375 2888 502 ------
NM_023927chr521171 336 ------
NM_023929chr832583 2090 495 ------
NM_023934chrX3838 580 102 21492 428 ----
NM_023943chr31202 ------
NM_024007chr522870 531 12733 1100 --
NM_024015chr171240 --1801 --
NM_024019chr44765 172 136 32 ------
NM_024034chr2041012 991 670 268 ------
NM_024046chr33449 406 242 ------
NM_024050chr192629 474 --1434 --
NM_024052chr1752863 2542 2433 1095 199 22829 563 --1233
NM_024060chr111276 ------
NM_024061chr72462 233 ------
NM_024085chr22970 898 --1737 --
NM_024087chrX1600 ------
NM_024090chr421895 531 ------
NM_024094chr82278 105 ------
NM_024107chr17132 1526 ----
NM_024117chr931315 549 218 ------
NM_024294chr632854 2167 1995 ------
NM_024295chr831306 834 262 ------
NM_024312chr1231235 597 392 ------
NM_024329chr141488 1369 561 150 --1544 --
NM_024336chr161276 ------
NM_024345chr985832 5165 4998 4753 4630 4236 2052 1134 --1513 --
NM_024408chr183529 2702 2673 2475 1469 1240 1142 591 1462 --1819
NM_024416chr91363 ----1374
NM_024423chr1854166 1622 1504 239 151 23963 3071 11528 --
NM_024424chr11--159 ----
NM_024425chr11--159 ----
NM_024426chr11--159 ----
NM_024493chr62429 95 ------
NM_024494chr11266 ------
NM_024496chr14--1542 ----
NM_024523chr741167 1033 1018 911 1130 ----
NM_024524chr342650 2216 859 681 ------
NM_024529chr11193 ------
NM_024539chrX11097 1262 ----
NM_024551chr122670 122 --12432 --
NM_024551chr122670 122 --12432 --
NM_024556chr111421 ------
NM_024561chr131956 ------
NM_024563chr521570 727 ------
NM_024567chr84702 695 165 131 ------
NM_024569chr152770 2275 2140 2062 1933 12334 1460 1552
NM_024581chr6----180 --
NM_024582chr421119 338 ------
NM_024586chr12551 251 ------
NM_024590chr421576 479 ------
NM_024607chr894289 3966 3173 3126 3115 2923 833 819 228 23571 3348 1451 --
NM_024612chr171283 --1407 --
NM_024613chr83470 206 170 ------
NM_024615chr5137 ------
NM_024616chr331352 934 446 1980 ----
NM_024624chr221330 524 --11227 --
NM_024626chr121580 1500 ------
NM_024635chr92216 39 ------
NM_024636chr732932 1814 428 12021 ----
NM_024638chr352350 1776 735 701 489 --12464 --
NM_024639chr632678 1176 312 1379 ----
NM_024645chr811573 ------
NM_024646chr163875 3576 3264 3070 431 222 ------
NM_024664chr1------180
NM_024665chr3--14072 11700 --
NM_024674chr133099 1031 936 12587 12813 --
NM_024686chr11405 ------
NM_024689chrX162 21253 1137 1350 --
NM_024692chr221447 577 ------
NM_024704chr20139 --1247 --
NM_024713chr1511133 ------
NM_024719chr13184 ------
NM_024721chr812054 ------
NM_024722chr173506 114 59 1554 ----
NM_024740chr1164109 4015 3738 3546 3244 3144 11061 23984 104 --
NM_024769chr113720 46 29 1225 ----
NM_024779chr1221276 348 --11148 --
NM_024785chr221145 313 1370 11319 --
NM_024786chr5----138 --
NM_024812chr851716 828 816 795 182 ----1490
NM_024814chr71126 ------
NM_024816chr164405 91 81 43 ------
NM_024824chr1421492 602 1111 ----
NM_024828chr921586 84 ------
NM_024835chr17156 ------
NM_024837chr1541420 1199 766 441 1488 ----
NM_024850chr51283 --1316 --
NM_024859chrX3400 347 237 ------
NM_024896chr932220 663 126 11903 ----
NM_024911chr11159 --1713 --
NM_024913chr71494 ------
NM_024915chr832377 1049 572 --1796 --
NM_024920chr431403 1290 983 ------
NM_024926chr71241 ------
NM_024944chr21--1847 --11281
NM_024947chr378829 8702 7419 3600 3430 1737 1194 ----12290
NM_024948chr101706 1235 ----
NM_024953chr1232000 1004 769 12092 21954 494 --
NM_024954chr104672 202 141 67 ------
NM_024956chr15--1209 ----
NM_024969chr21799 ------
NM_024989chr288169 6866 6477 6310 2992 2648 552 507 28126 2829 --12712
NM_024991chr1052452 2211 1986 791 261 12504 ----
NM_024997chr1621034 905 ------
NM_025027chr191962 1179 1948 --
NM_025054chr823395 2837 23282 1077 ----
NM_025073chr133287 3265 56 23722 557 1932 --
NM_025076chr2162 ------
NM_025083chr1541657 806 420 403 21921 709 31881 529 271 --
NM_025126chr122575 225 ------
NM_025133chr2--1369 ----
NM_025134chr1622485 949 1142 ----
NM_025146chr311875 32524 478 321 --1786
NM_025152chr141391 1132 ----
NM_025160chr1--12979 ----
NM_025164chr1151481 874 761 637 126 2817 455 ----
NM_025179chr154689 4456 3479 1230 896 --14138 14558
NM_025187chr1641223 1172 900 391 ------
NM_025191chr162171 1384 548 397 375 101 1472 2797 87 --
NM_025201chr1582080 2062 1712 1680 1486 1417 513 310 --21593 1366 --
NM_025202chr231054 682 668 1147 1833 --
NM_025212chr4----1131 --
NM_025219chr2042324 2109 629 112 --1209 --
NM_025221chr4--1166 1538 1309
NM_025222chr332047 1985 926 2959 185 1127 --
NM_025230chr142690 526 --1432 21262 385
NM_025248chr1753242 1251 737 537 376 ------
NM_025250chr732969 2327 732 ------
NM_025251chr83370 289 155 --11158 --
NM_030567chr5158 ------
NM_030576chr1722296 313 ------
NM_030594chr151470 ------
NM_030621chr1444023 2973 2825 984 ------
NM_030625chr1022006 28 ------
NM_030627chr52977 459 ------
NM_030629chr1631328 399 328 ------
NM_030640chr122624 569 ------
NM_030647chr755397 4542 4070 1793 868 --11016 --
NM_030648chr433569 511 475 25289 2011 24391 1484 --
NM_030650chr253872 2809 2641 875 293 22611 22 13545 --
NM_030660chr141342 ----2959 412
NM_030661chr711644 --21278 650 --
NM_030664chr1021665 145 --1624 --
NM_030674chr1265553 4845 4512 4156 3941 3661 24727 890 --11739
NM_030753chr17----1245 --
NM_030758chr2251471 1255 464 451 85 ------
NM_030761chr13912 769 381 --1204 --
NM_030762chr1241978 1347 585 102 ------
NM_030763chrX2897 101 1229 ----
NM_030766chr125918 682 282 204 92 ------
NM_030767chr942102 1886 1124 160 32718 2053 965 22729 586 --
NM_030791chr14192 ------
NM_030796chr73854 490 61 --3153 53 42 --
NM_030802chr172279 196 1570 1108 --
NM_030805chr241028 980 474 237 --1413 --
NM_030806chr1168463 8018 7939 7695 7432 6983 6521 6318 6085 2901 2539 2506 2089 2050 781 675 --11814 12993
NM_030808chr172983 731 ------
NM_030809chr1281881 1669 1526 810 773 549 252 120 --12213 --
NM_030820chr6151 1784 ----
NM_030877chr20179 ------
NM_030881chr2222289 84 11762 --11594
NM_030884chr351826 1640 380 290 24 ------
NM_030885chr312167 ------
NM_030906chr111107 ------
NM_030912chr102161 129 ------
NM_030914chr94971 311 171 103 1384 ----
NM_030915chr282405 1964 1928 1903 1897 1474 350 172 2569 529 21803 930 --
NM_030918chr1114002 3977 3431 2131 1850 1812 1722 1701 821 739 499 1546 24272 1670 --
NM_030927chr1041335 1031 1024 52 ------
NM_030935chr7243 27 ------
NM_030938chr171785 --1267 --
NM_030939chr6----1340 --
NM_030948chr6--135 ----
NM_030952chr131152 368 73 1199 --11110
NM_030958chr82188 72 ------
NM_030962chr111241 ------
NM_030963chr61574 ------
NM_030964chr583476 3370 3356 2980 1187 486 343 206 12447 13029 --
NM_030965chr11301 ------
NM_030981chr111111 ------
NM_031157chr121478 ------
NM_031216chr1831832 1427 397 21857 1600 1237 1157
NM_031231chr202163 58 ------
NM_031232chr202163 58 ------
NM_031243chr741810 1754 293 246 32005 1954 1764 ----
NM_031267chr71132 1489 ----
NM_031268chr16105259 3993 3957 2064 1876 1714 1311 1193 1154 614 --11258 13690
NM_031283chr21179 1570 ----
NM_031296chr441959 1087 475 452 12416 1557 --
NM_031305chr4--21528 338 ----
NM_031309chr85872 519 407 160 62 --31812 386 243 --
NM_031314chr14----11521 --
NM_031371chr14629 618 474 270 --1248 --
NM_031371chr14629 618 474 270 --1248 --
NM_031372chr421689 580 --175 --
NM_031409chr631756 1750 266 ------
NM_031411chr532286 2201 632 ------
NM_031412chr121235 ------
NM_031417chr1942743 2498 1804 620 1321 22527 230 --
NM_031419chr331373 1025 426 1263 ----
NM_031426chr962693 2248 1872 1838 940 27 ------
NM_031427chr1425499 1931 31969 444 244 ----
NM_031431chr1321550 545 ------
NM_031435chr121902 12332 ----
NM_031439chr831407 138 89 11208 1486 --
NM_031442chrX1139 11205 ----
NM_031445chr262896 2687 2170 1193 930 217 ----13339
NM_031452chr15167 ------
NM_031453chr1032405 371 58 ------
NM_031459chr131636 1186 421 --1339 --
NM_031468chr7126874 2816 2328 1914 1639 1625 1612 1546 1450 1091 731 618 27583 209 36249 679 488 46040 2293 1177 582
NM_031483chr2022407 1068 23389 1208 12208 --
NM_031492chr112386 203 ------
NM_031844chr152708 2675 2521 1147 760 13950 ----
NM_031845chr252730 2723 980 337 214 22594 1070 ----
NM_031847chr252730 2723 980 337 214 22594 1070 ----
NM_031849chr532286 2201 632 ------
NM_031857chr532286 2201 632 ------
NM_031860chr532286 2201 632 ------
NM_031890chr2242680 2140 329 57 1794 ----
NM_031892chrX3933 646 247 1764 ----
NM_031900chr51404 ------
NM_031924chr61254 ------
NM_031935chr11138 ------
NM_031942chr23952 417 27 ------
NM_031992chr741424 1221 368 182 11588 ----
NM_032012chr923246 133 23493 1063 --1456
NM_032013chr2031667 1646 378 ------
NM_032017chr121859 1654 --2760 340 --
NM_032023chr102998 926 1481 ----
NM_032041chr842361 1859 372 132 1148 ----
NM_032042chr532696 1052 976 --12575 --
NM_032050chr221171 ------
NM_032051chr222611 231 1502 ----
NM_032088chr521761 668 -----