TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4495
miRNA Sequence: AAUGUAAACAGGCUUUUUGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX83483 3436 2666 2575 2533 1037 257 111 --33099 2809 2768 12117
NM_000081chr131718 1285 400 ----21860 381
NM_000084chrX86954 5903 4564 2232 1739 663 265 215 25929 4830 25159 4803 --
NM_000091chr272892 2870 2821 2686 1091 1018 268 1784 32813 1824 1783 --
NM_000092chr2134568 4516 4460 4105 3995 3772 1664 1617 1368 1283 1208 412 322 14585 14158 --
NM_000108chr741633 1580 631 163 21179 602 21868 344 1177
NM_000109chrX142563 2420 2127 2103 2031 1793 1007 437 420 379 265 164 123 96 1716 32210 521 347 1573
NM_000112chr575336 4746 4703 1402 1122 611 88 --21131 370 13599
NM_000115chr13132433 2400 2291 2084 2072 2064 1786 1004 745 534 242 179 103 22466 2377 31975 754 37 12164
NM_000138chr1592145 2123 1903 1767 941 632 574 447 355 ----12082
NM_000167chrX31796 1767 112 --21506 703 144
NM_000176chr563906 2476 955 502 466 152 2811 573 21528 538 --
NM_000202chrX81417 1357 1258 1139 1126 645 447 197 --12995 --
NM_000210chr262119 1756 1551 853 458 364 1343 12022 --
NM_000217chr1295335 3720 2096 1565 1530 893 478 435 152 --44450 4109 3649 982 --
NM_000222chr471909 1893 1879 1653 1314 592 87 --11872 12022
NM_000232chr493232 2174 2132 1982 1214 715 543 192 74 --32940 723 32 1509
NM_000233chr25881 658 334 237 196 ----1301
NM_000248chr361983 1085 1018 529 463 189 11208 12152 --
NM_000259chr15126301 5454 2237 2208 2161 1877 1555 1450 884 743 709 204 21730 1528 11854 1247
NM_000264chr943179 2985 2358 2305 --42701 2627 2486 1258 1459
NM_000267chr1773228 1340 1189 615 424 358 113 21175 863 1979 --
NM_000276chrX102166 2120 817 556 452 416 265 242 192 120 ------
NM_000297chr441874 1729 1367 1303 21998 1905 21678 81 1153
NM_000304chr1751090 807 754 194 181 --21076 290 1208
NM_000314chr1092609 2346 2257 1226 1218 577 440 416 300 22397 2388 22066 1293 --
NM_000328chrX6418 395 386 349 335 327 ------
NM_000332chr6156810 6256 5267 4846 4644 4632 2553 2233 2036 1674 1549 1534 1011 900 623 26009 5391 22202 90 24976 1812
NM_000337chr534531 1801 1717 11098 12261 26224 4727
NM_000340chr321298 279 --184 1368
NM_000362chr2243618 3536 3149 1050 13602 13568 11016
NM_000368chr974883 4553 4457 3297 967 593 428 132 33892 507 493 --
NM_000390chrX53280 2104 1076 1031 572 ----33010 2586 632
NM_000393chr271949 1921 1424 1361 859 804 266 12042 11984 --
NM_000408chr283467 3379 3321 3149 3081 2645 2619 1070 --32894 575 256 22382 918
NM_000430chr1753704 3395 2699 2462 1371 1911 11094 1197
NM_000441chr782299 2212 2049 2043 1595 807 686 150 2893 561 1920 --
NM_000448chr11133086 2762 2358 2209 2082 1153 608 561 537 466 405 56 32 22404 596 23241 2970 1476
NM_000452chr1351935 1737 1588 507 38 --31450 1444 1381 2524 217
NM_000461chr3124444 4419 3999 3976 3829 3753 2954 836 817 599 505 185 ----24574 4201
NM_000489chrX73442 3129 2742 1252 1132 955 729 12799 23222 2165 43431 2846 389 374
NM_000492chr741503 1195 1093 261 --21217 1079 1452
NM_000544chr6_cox_hap152118 824 704 601 287 13268 --23075 1211
NM_000555chrX177862 7228 6522 6506 5856 4790 3124 2516 1413 1241 1204 1006 955 930 816 681 307 --36663 6015 5557 27183 363
NM_000596chr73549 121 57 1461 --181
NM_000600chr71398 --1366 1378
NM_000615chr1181953 881 864 728 649 603 469 202 --23003 680 --
NM_000618chr12156610 6529 6391 6264 6183 6107 5616 5214 4935 4428 4208 926 458 423 183 --45864 4488 2280 513 16195
NM_000618chr12156610 6529 6391 6264 6183 6107 5616 5214 4935 4428 4208 926 458 423 183 --45864 4488 2280 513 16195
NM_000627chr23924 710 701 --1604 1361
NM_000633chr18104862 4842 4401 3861 3660 2068 1723 1476 762 493 11729 35131 3426 236 1587
NM_000686chrX91272 1042 626 548 526 515 402 394 221 --1339 --
NM_000719chr1286666 5178 2501 1903 1809 1543 820 378 16014 11376 24885 1885
NM_000726chr251479 1181 528 361 157 --21418 226 --
NM_000782chr2041142 1046 167 102 1942 21182 286 --
NM_000809chr4209267 9209 9098 8924 8734 8294 8150 8117 7667 7634 7209 6536 6224 3354 3030 2625 2446 1650 1469 851 17933 57822 6918 6752 5958 2875 35685 2743 2309
NM_000813chr595442 5300 4481 2013 1902 1262 1202 924 227 12025 25238 4453 14203
NM_000814chr1552714 1617 264 202 74 ----11015
NM_000826chr482424 2394 2118 2103 1759 1678 520 122 ----12339
NM_000866chr381603 1525 1448 1432 1374 1176 699 393 --2315 137 --
NM_000868chrX112504 2381 2140 1960 1838 1727 386 351 195 147 132 12463 1457 1122
NM_000875chr15146256 5898 5818 5705 5687 5661 5635 2436 2342 1461 1228 1217 1043 536 16821 12642 36966 6869 1190
NM_000877chr263004 2904 2820 2410 2396 842 --42876 2130 2058 1029 12996
NM_000882chr34384 369 114 36 ----1332
NM_000891chr1783368 2472 2441 1076 1053 847 739 35 1601 --13673
NM_000899chr12114375 4352 3921 3833 3589 3350 1325 1080 847 568 229 --3871 336 150 14201
NM_000901chr4102538 2211 2059 2038 1590 996 931 689 675 404 12031 12507 --
NM_000902chr352850 2796 2072 465 456 1523 32959 2422 753 1728
NM_000944chr462382 2084 1936 752 418 149 --21508 774 12064
NM_000945chr261564 1393 806 629 595 294 --11581 41625 1616 473 335
NM_000950chrX63604 3184 3148 3052 2923 444 --63570 3288 3240 3014 2722 1062 1992
NM_000963chr172280 1610 1518 700 351 277 225 --42289 859 72 31 12195
NM_001001323chr1283069 3014 2539 2203 2125 2013 739 718 12748 12825 --
NM_001001395chr1242464 702 380 129 12006 12813 12311
NM_001001396chr134241 2735 657 11150 44325 4315 4277 3234 12838
NM_001001419chr5184818 4289 4012 3908 3811 3798 3657 3537 3347 979 971 930 850 748 689 475 86 26 --1601 15213
NM_001001420chr5184818 4289 4012 3908 3811 3798 3657 3537 3347 979 971 930 850 748 689 475 86 26 --1601 15213
NM_001001433chr205951 714 534 339 310 1894 32973 1984 134 --
NM_001001484chr1042171 757 661 568 1733 22157 2090 --
NM_001001557chr842167 2120 1933 1383 --21975 498 --
NM_001001664chr2154018 3830 3793 3653 3640 3362 2905 1561 1300 759 743 665 393 372 141 12706 34106 3889 1504 --
NM_001001890chr2153490 3301 1170 830 373 --33346 963 530 31293 564 554
NM_001001974chr10102163 2026 2007 1956 1820 1799 1578 493 406 133 --32360 1564 816 1565
NM_001002233chr832032 1959 1689 1449 --12198
NM_001002243chr23756 681 377 --1191 1171
NM_001002257chr273121 3065 2616 2282 892 744 136 --23112 83 --
NM_001002258chr22765 714 --21905 1560 1297
NM_001002860chr14104490 4221 3384 3007 1809 1620 712 297 277 196 --2390 332 --
NM_001003652chr18178564 7760 7124 6712 6222 6162 3167 2827 2724 2555 2255 2102 1247 1128 1064 806 419 16102 27948 1510 48594 6469 371 354
NM_001003674chr18175999 5904 5882 5638 5448 5410 5286 5151 4549 2028 2016 1657 1590 609 376 345 162 76888 4789 4765 2621 1608 754 410 2790 626 --
NM_001003675chr18175999 5904 5882 5638 5448 5410 5286 5151 4549 2028 2016 1657 1590 609 376 345 162 76888 4789 4765 2621 1608 754 410 2790 626 --
NM_001003679chr131842 1432 509 1338 32159 2136 79 --
NM_001003681chr2222127 530 --22036 113 11864
NM_001003712chr1284006 3672 3245 2938 2853 854 683 514 --53649 3345 3288 2676 1251 43485 2901 1240 622
NM_001003760chr693073 2697 2559 2474 2392 1340 1240 984 754 --21025 800 --
NM_001003800chr993575 3471 3434 3129 3106 2570 482 390 145 ----1994
NM_001004317chr684311 3542 3390 3344 3180 1738 1249 162 23873 464 44450 4218 3975 458 2322 281
NM_001004419chr1254449 2896 1512 447 308 23864 2854 23279 1821 --
NM_001004441chr551586 1263 1231 643 514 --139 11107
NM_001004720chr25978 945 889 867 809 11053 1963 --
NM_001004722chr251147 1114 1058 1036 978 11222 11132 --
NM_001005386chr242394 2348 2073 660 11769 --2977 393
NM_001005404chr1794322 3780 3632 3432 3084 1415 1262 1089 795 14050 23245 1044 --
NM_001005473chr5116429 4597 4209 4060 2512 2488 2337 1905 1582 609 447 25689 4298 ----
NM_001005474chr361473 1116 645 510 151 86 1140 --21283 199
NM_001005527chr381239 1217 1014 856 537 463 340 84 ----11153
NM_001005746chr251479 1181 528 361 157 --21418 226 --
NM_001005747chr251479 1181 528 361 157 --21418 226 --
NM_001006600chr592322 2280 2249 1660 1623 916 887 692 668 ----21868 88
NM_001006657chr2123042 2066 1022 939 758 673 634 548 408 272 135 121 22907 980 --1873
NM_001006945chr11576 --2240 185 1591
NM_001007075chr421091 799 21051 762 31031 814 715 --
NM_001007102chr641654 1274 623 531 --31567 1505 133 1406
NM_001007214chr141475 1408 642 243 ----2409 110
NM_001007257chr141305 1165 1054 49 --21522 1176 --
NM_001007466chr675218 4718 4565 676 585 517 58 15037 55091 4709 2006 1922 1689 --
NM_001008226chr1561649 1570 1425 1337 311 71 --21784 109 --
NM_001008239chr1863137 2860 1100 688 630 536 13767 23692 2695 --
NM_001008405chr751547 498 342 249 90 31848 613 455 11510 --
NM_001008495chr881917 1522 738 589 560 402 329 280 --21569 832 12103
NM_001008564chr1361503 820 507 245 102 87 22048 1764 42143 2134 2113 323 21957 1678
NM_001008660chr1181531 1468 1301 1272 519 509 198 173 --11504 1570
NM_001008707chr1491897 1755 1579 1560 1541 716 545 525 480 11867 21658 248 --
NM_001008738chr552522 1004 789 776 451 12549 12601 22794 826
NM_001008801chr1952143 2113 1919 1887 131 --11878 1284
NM_001008895chr1311469 --11083 21188 1091
NM_001008925chr483515 3335 3190 2866 720 705 591 478 13478 ----
NM_001009554chr4154768 4350 4256 3931 3135 3111 1893 1863 1845 1670 1170 879 606 459 423 --23688 3089 13129
NM_001009554chr4154768 4350 4256 3931 3135 3111 1893 1863 1845 1670 1170 879 606 459 423 --23688 3089 13129
NM_001009881chr13473 199 94 ----1412
NM_001009882chr13473 199 94 ----1412
NM_001009899chr3116395 6275 6127 5519 4951 4139 3975 3964 1775 1659 763 --86553 6545 2146 1044 912 817 770 239 --
NM_001009909chr1173705 3610 2947 2751 1187 1153 125 13905 23147 2551 --
NM_001010000chr1883526 3340 2780 2493 568 395 210 35 23350 588 21320 866 --
NM_001010844chr6258 49 1256 168 --
NM_001010853chr6113144 3084 2952 2702 2573 2345 2322 995 400 321 181 13157 --33123 2538 1099
NM_001010861chr1112722 2256 2162 1081 1014 1001 994 584 574 119 97 1940 22560 977 --
NM_001010888chrX134394 3839 3388 3000 2927 1213 1153 967 874 291 173 101 26 13006 23173 118 11031
NM_001010895chr942030 1923 1526 274 11316 21967 515 32084 831 550
NM_001010986chrX72409 2290 1899 1819 908 837 187 1802 12434 11706
NM_001011513chr4113909 3766 3465 3386 3154 2698 2636 2545 1601 914 240 --33398 2794 88 --
NM_001011658chrX41897 1800 1730 219 12119 21792 142 --
NM_001011666chr7196449 5756 5739 5713 4994 4949 4830 4820 4765 4058 2251 1928 1910 1100 1024 693 263 159 132 1171 26521 4667 25461 2035
NM_001011708chr232858 637 376 11985 12077 12535
NM_001012393chr1195127 4690 4121 3567 3537 1561 1313 1031 685 ------
NM_001012751chr1071948 1919 1880 1816 1655 326 194 --1654 --
NM_001012755chrX134911 4896 4705 4659 4504 4145 4101 3691 3631 3200 673 565 124 34266 946 822 35053 4170 1903 --
NM_001012761chr552616 1989 1879 236 216 22728 660 --1283
NM_001012968chrX82387 2186 2152 1964 1948 1714 860 253 ----1722
NM_001013406chr741366 1117 578 431 --11380 1485
NM_001013620chr12148446 7937 7400 7367 7032 6231 6024 5276 3221 2390 1117 623 468 122 28351 1274 27411 6262 47562 5856 5832 5494
NM_001013629chr1082122 1718 1710 1691 1663 1655 1632 470 21978 1340 22140 273 --
NM_001013699chr123515 154 96 --2568 89 1531
NM_001014797chr1067835 6599 2989 1441 333 205 --55083 3063 2136 1209 992 12124
NM_001015048chr1452205 990 675 84 35 1357 12752 13103
NM_001015049chr1452205 990 675 84 35 1357 12752 13103
NM_001015877chrX53034 2511 2261 389 215 33096 1891 202 12379 1905
NM_001015887chr361837 1763 1353 1305 750 107 1460 21233 539 --
NM_001017371chr231214 192 39 2474 248 21180 1100 --
NM_001017415chr13796 285 67 --1579 1132
NM_001017416chr13796 285 67 --1579 1132
NM_001017434chr13632 43 29 --3217 211 201 --
NM_001017923chr1471469 1372 1071 1042 1033 595 294 --41139 274 215 195 31352 396 158
NM_001017926chr851743 1577 1519 1342 442 ----1588
NM_001018065chr9135900 5339 4642 4488 4439 4060 3785 2351 1832 1216 1174 943 385 --15088 --
NM_001018066chr9135900 5339 4642 4488 4439 4060 3785 2351 1832 1216 1174 943 385 --15088 --
NM_001018067chr195188 5170 4619 4325 4132 3410 1877 848 682 1597 31726 716 60 35258 618 448
NM_001018068chr195188 5170 4619 4325 4132 3410 1877 848 682 1597 31726 716 60 35258 618 448
NM_001018069chr195188 5170 4619 4325 4132 3410 1877 848 682 1597 31726 716 60 35258 618 448
NM_001018074chr563906 2476 955 502 466 152 2811 573 21528 538 --
NM_001018075chr563906 2476 955 502 466 152 2811 573 21528 538 --
NM_001018076chr563906 2476 955 502 466 152 2811 573 21528 538 --
NM_001018077chr563906 2476 955 502 466 152 2811 573 21528 538 --
NM_001018089chr1542944 2505 2479 355 --1267 1461
NM_001018090chr15102460 2361 2253 1873 1054 1026 353 226 106 46 22859 2367 32836 1815 470 22289 1781
NM_001018091chr15102570 2471 2363 1983 1164 1136 463 336 216 156 22969 2477 32946 1925 580 22399 1891
NM_001018102chr15102460 2361 2253 1873 1054 1026 353 226 106 46 22859 2367 32836 1815 470 22289 1781
NM_001024094chr563906 2476 955 502 466 152 2811 573 21528 538 --
NM_001024647chr12137669 7025 6862 6104 5521 5041 4991 4669 2389 2210 1093 232 118 1988 26821 668 --
NM_001024649chr562260 2127 1863 1006 481 412 12736 22140 749 12662
NM_001024688chr862224 1722 1600 1454 203 71 11919 31937 1929 1547 --
NM_001024847chr361721 1672 1567 582 270 251 --22411 524 22463 316
NM_001024934chr61184 2654 567 --1521
NM_001024935chr61184 2654 567 --1521
NM_001024936chr61184 2654 567 --1521
NM_001024947chr551059 971 813 224 160 1931 1109 1173
NM_001024948chr152977 2585 1403 1336 699 1823 13505 13031
NM_001025076chr1066216 4237 4172 3991 1478 737 16057 2526 206 --
NM_001025077chr10117574 5595 5530 5349 5003 4828 2836 2095 1106 867 133 17415 31884 1564 1314 --
NM_001025079chr3114081 3816 3788 3630 3296 3060 2548 1548 1409 1084 146 13965 13850 23746 2728
NM_001025108chr274201 4150 1640 1325 1249 606 143 13644 11298 --
NM_001025356chr1273001 2959 2733 1177 880 737 256 --12545 --
NM_001025366chr6--1379 11654 31224 410 364
NM_001025366chr6--1379 11654 31224 410 364
NM_001025367chr6--1379 11654 31224 410 364
NM_001025367chr6--1379 11654 31224 410 364
NM_001025368chr6--1379 11654 31224 410 364
NM_001025368chr6--1379 11654 31224 410 364
NM_001025369chr6--1395 11670 31240 426 380
NM_001025369chr6--1395 11670 31240 426 380
NM_001025370chr6--1379 11654 31224 410 364
NM_001025370chr6--1379 11654 31224 410 364
NM_001025580chrX44193 762 749 229 --34175 3925 1067 23723 2958
NM_001025595chr44483 469 296 40 11454 31631 402 373 --
NM_001025780chr92333 89 1568 21318 215 1316
NM_001029858chr683166 3052 2462 2421 2254 1095 452 103 --33342 2218 664 12873
NM_001029863chr641987 1097 875 522 --12213 2423 290
NM_001029875chr53808 600 161 --2918 542 12347
NM_001029884chr672572 2415 2307 953 461 443 137 ----12636
NM_001030007chr1663779 3558 2588 1555 275 225 11508 23961 3318 13076
NM_001030055chr14122994 1823 1764 1605 1317 1153 631 481 303 210 158 118 1899 34014 1089 434 13857
NM_001031695chr22105425 5386 5041 4896 4753 4084 3722 3626 633 156 34690 3859 3392 ----
NM_001031712chr63331 270 167 --1406 1114
NM_001031732chr463050 1336 1300 1001 932 70 --11384 --
NM_001031804chr1684376 4173 3477 3247 1643 1494 965 328 --21420 1162 --
NM_001031812chr571888 1541 938 682 374 156 37 21803 355 32245 2010 1815 --
NM_001032380chr1071830 729 655 647 615 406 295 1475 1354 --
NM_001033045chr233879 2992 2980 2955 332 44326 3671 1084 175 1681
NM_001033057chr362027 1984 1951 1923 1431 591 --41827 1647 1405 623 --
NM_001033059chr672059 1561 1434 632 286 192 170 --21490 445 2716 596
NM_001033578chr832133 1716 312 --32148 200 110 --
NM_001033756chr6--1313 11588 31158 344 298
NM_001033756chr6--1313 11588 31158 344 298
NM_001033910chr13592 578 435 --41720 232 224 166 11380
NM_001033925chr1072188 1954 1909 1710 1684 1620 581 11628 31948 767 697 --
NM_001034841chr16145486 5027 4411 3940 3892 3835 1757 1719 1442 1393 1185 753 731 488 33595 3534 1992 1683 12019
NM_001037172chr361388 1276 1240 1230 964 303 ----11254
NM_001037174chr252121 2110 1728 595 92 --11673 12231
NM_001037317chr1112722 2256 2162 1081 1014 1001 994 584 574 119 97 1940 22560 977 --
NM_001037535chrX81547 1440 1279 1255 1240 265 257 230 ----11531
NM_001037536chrX81547 1440 1279 1255 1240 265 257 230 ----11531
NM_001037540chrX81547 1440 1279 1255 1240 265 257 230 ----11531
NM_001037631chr25889 866 418 398 190 ----1405
NM_001037872chr28725 266 252 232 217 169 96 63 ------
NM_001037954chr1173541 3406 3358 3333 3162 3036 942 --13046 21410 1233
NM_001039538chr293692 3658 3363 1121 551 288 195 91 79 --2261 218 12306
NM_001039580chr4154973 4906 4815 4800 3972 3697 3186 1927 1144 1123 866 858 641 487 81 24317 1185 13855 13824
NM_001039585chr153729 3300 2852 1538 1236 1171 --13813
NM_001039590chrX94048 3976 3848 3818 3798 3722 3362 1422 403 2883 835 --12459
NM_001039591chrX94048 3976 3848 3818 3798 3722 3362 1422 403 2883 835 --12459
NM_001039618chr1165882 5579 5486 5111 2346 2231 45830 5613 3628 1822 --23977 1030
NM_001039693chr294016 3104 2605 1601 1491 1224 1047 753 97 13783 23835 460 12679
NM_001039840chrX145886 5208 4176 4003 3699 2379 1790 1653 1235 1184 673 198 161 108 25895 4720 21634 1355 3648 607 576
NM_001039937chr1383973 3545 1376 1343 1046 671 154 78 21546 679 32904 2563 1095 --
NM_001040020chr761534 1452 1407 1046 976 477 ------
NM_001040057chr721241 398 --11350 11359
NM_001040100chr3101270 1200 1121 1041 929 467 438 404 182 130 133 140 --
NM_001040108chr1482303 2272 2087 2005 1303 909 844 766 11054 21186 223 --
NM_001040110chr73159 60 52 --11612 31657 1589 345
NM_001040142chr282102 2042 1939 865 453 393 114 42 ----1760
NM_001040143chr282102 2042 1939 865 453 393 114 42 ----1760
NM_001040152chr755114 4575 3466 1871 1527 --14051 14164
NM_001040157chr442743 2380 1885 71 --2352 141 22220 2162
NM_001040159chr451514 1431 603 441 46 21338 1136 2548 196 11467
NM_001040202chr462287 1863 1694 533 177 126 --22440 2395 --
NM_001040214chr642180 1830 960 817 --32384 2322 1631 --
NM_001040284chr16115888 5880 3801 2230 2109 2040 1701 1227 1192 937 913 14629 45206 4390 4088 1051 65287 3912 1640 1593 568 478
NM_001040402chr472835 2746 2705 2246 901 209 196 12292 23097 798 12392
NM_001040429chr1392845 2804 2654 2611 2430 2209 1344 1137 86 --11006 --
NM_001040441chr165431 4198 3362 1190 1137 135 23603 673 44892 3585 1493 43 55445 4930 4881 4848 1572
NM_001040446chr592766 2714 2642 2597 2581 2223 2163 1808 1706 --12374 12432
NM_001040450chr1542503 2156 421 330 22235 665 11849 --
NM_001040453chr1542503 2156 421 330 22235 665 11849 --
NM_001040624chr832683 914 630 ----21740 947
NM_001040625chr832683 914 630 ----21740 947
NM_001040626chr832683 914 630 ----21740 947
NM_001040627chr832683 914 630 ----21740 947
NM_001040628chr832683 914 630 ----21740 947
NM_001040629chr832683 914 630 ----21740 947
NM_001040630chr832683 914 630 ----21740 947
NM_001040653chr352357 730 722 688 100 --32557 671 531 --
NM_001040665chr7144633 4360 4284 4276 3243 1717 1624 1512 1018 829 609 565 333 242 --33973 3822 270 --
NM_001040712chr993533 3493 3361 3002 2445 915 771 713 251 1611 22946 1400 --
NM_001040876chr42499 305 --1687 21733 752
NM_001042355chr16185416 5041 5008 4885 4204 4183 4157 1976 1828 1463 1451 1378 1298 1259 824 525 194 53 --23296 1906 13934
NM_001042403chr123811 143 112 --2243 122 2321 38
NM_001042404chr191986 1953 1862 1843 1784 1509 1451 630 608 --1460 1573
NM_001042412chr16185416 5041 5008 4885 4204 4183 4157 1976 1828 1463 1451 1378 1298 1259 824 525 194 53 --23296 1906 13934
NM_001042413chr994138 3354 2960 2829 2646 777 731 641 170 33910 3531 3008 44074 1119 619 592 12624
NM_001042453chrX101666 1654 1631 1575 1543 1363 1265 1097 606 111 --2653 171 11382
NM_001042473chr1092049 2030 859 848 646 635 380 160 102 --21820 467 --
NM_001042481chr1472330 2236 982 756 725 331 122 22459 2343 12541 174
NM_001042492chr1773228 1340 1189 615 424 358 113 21175 863 1979 --
NM_001042494chr1543137 3062 2877 2430 --23092 541 13817
NM_001042495chr1543137 3062 2877 2430 --23092 541 13817
NM_001042496chr1543137 3062 2877 2430 --23092 541 13817
NM_001042497chr1543137 3062 2877 2430 --23092 541 13817
NM_001042533chr363255 3073 2525 2075 731 405 --2668 35 --
NM_001042550chr91327 11626 11839 3259 131 82
NM_001042555chr12124618 4454 4223 3953 3871 3744 3706 2962 1054 349 97 26 1197 54057 3784 3680 3528 969 24292 1435
NM_001042599chr2147832 7246 7219 6210 5396 5244 4988 3152 2906 2890 2677 2272 1429 1084 12108 57668 1406 873 731 682 25860 1574
NM_001042601chr353281 3237 3187 3126 2238 --13216 1856
NM_001042603chr1274731 4325 4209 4128 3876 1425 170 14199 34405 152 78 --
NM_001042604chr3144760 4723 4578 4110 3742 3412 3382 1709 1286 1211 411 388 263 53 11811 34691 1269 1081 11169
NM_001042681chr12884 771 1674 1530 2121 69
NM_001042682chr12884 771 1674 1530 2121 69
NM_001042682chr12884 771 1674 1530 2121 69
NM_001042683chr671624 1430 1313 530 515 476 215 11792 31471 1402 362 --
NM_001042749chrX82053 2007 1957 1645 1337 815 573 352 --32028 1966 406 11793
NM_001042750chrX82053 2007 1957 1645 1337 815 573 352 --32028 1966 406 11793
NM_001042751chrX82053 2007 1957 1645 1337 815 573 352 --32028 1966 406 11793
NM_001044722chr571888 1541 938 682 374 156 37 21803 355 32245 2010 1815 --
NM_001044723chr571888 1541 938 682 374 156 37 21803 355 32245 2010 1815 --
NM_001046chr542782 2168 976 376 12844 42826 2815 811 615 --
NM_001071775chr1371807 1658 1626 1309 274 149 60 --51378 783 739 450 197 --
NM_001079874chr171965 1898 1655 1340 849 679 662 --1606 --
NM_001083620chr482422 2392 2116 2101 1757 1677 519 122 ----12337
NM_001099678chr3116409 6058 5445 4426 2213 1822 1005 891 548 461 241 25378 2169 56383 6102 998 603 262 36427 5777 2257
NM_001106chr399569 8796 8712 8688 7081 7065 6008 5990 5947 38850 1494 446 46261 6117 3678 1596 19391
NM_001128chr1663779 3558 2588 1555 275 225 11508 23961 3318 13076
NM_001160chr1272781 2698 2641 2145 466 115 86 --22729 2094 --
NM_001167chrX106557 6484 6372 5495 4933 4734 2244 1744 868 815 12271 36537 4998 1653 15143
NM_001173chr14122994 1823 1764 1605 1317 1153 631 481 303 210 158 118 1899 34014 1089 434 13857
NM_001174chrX82260 2057 1999 1862 1820 1558 1468 205 ----21838 1633
NM_001177chr12112443 2313 2281 2054 1758 1751 957 891 874 590 580 1613 ----
NM_001198chr6112389 2260 2208 1947 1940 1553 1524 1512 1471 414 243 1231 1889 22379 302
NM_001201chr473570 3101 2575 1586 637 625 88 --23219 3183 --
NM_001204chr2197438 7143 6768 6604 6260 5832 5416 5021 3025 2834 2505 2279 1582 1110 647 522 263 236 208 24700 1647 65592 5428 5396 2651 1403 39 15710
NM_001206chr973014 2922 2410 2254 984 893 701 --12589 --
NM_001219chr752232 746 537 226 45 --32304 2254 463 --
NM_001233chr752057 2025 1661 680 289 ----1432
NM_001241chr272429 2250 1967 1893 1748 560 494 11868 1514 1914
NM_001241chr272429 2250 1967 1893 1748 560 494 11868 1514 1914
NM_001256chr1772963 2417 2298 2182 1875 458 23 --22863 2215 --
NM_001259chr775794 4684 4090 1880 1419 1412 665 --24381 1634 25777 3893
NM_001270chr52814 76 11150 1178 1358
NM_001271chr1562870 2825 2506 2486 2365 1115 --13151 13207
NM_001310chr1272882 2678 2120 1917 716 599 306 22918 2904 1342 --
NM_001331chr1142686 1972 384 32 12861 12197 22117 255
NM_001364chr11134794 4746 4549 4113 2924 2889 1224 708 671 583 431 108 95 ------
NM_001390chr18103583 3369 3139 3118 3071 1237 931 469 445 418 1848 ----
NM_001396chr2152204 2096 905 680 40 --12024 22384 375
NM_001401chr941420 1141 1112 1054 1507 --21025 375
NM_001412chrX83554 3297 2891 2864 2689 878 797 514 --121 --
NM_001419chr1994623 4603 4081 3467 1623 1492 1477 787 141 --34649 4244 1175 14193
NM_001427chr772112 2041 2006 1984 1966 308 156 --11795 --
NM_001432chr4103935 3855 3725 3637 3128 2900 2577 880 604 224 21558 1330 1274 --
NM_001438chr143401 2547 1399 774 --23561 3200 12649
NM_001455chr664552 1941 1723 1359 998 115 1577 --11493
NM_001490chr973443 3007 2947 2584 2536 2396 459 --22959 514 12342
NM_001527chr673739 3666 1649 966 515 493 93 --44681 3364 814 786 --
NM_001530chr1431147 398 238 --2155 68 1421
NM_001546chr661386 1120 1065 951 241 192 1502 21457 435 11027
NM_001584chr1161040 484 465 381 88 71 --11218 1753
NM_001587chrX102166 2120 817 556 452 416 265 242 192 120 ------
NM_001609chr10134380 4364 4164 3905 3731 3677 3348 3131 3038 2959 1505 1323 739 24452 711 53493 3474 1290 663 566 --
NM_001616chr283144 2971 2407 2384 2314 1388 857 437 ----21022 878
NM_001621chr733027 1132 500 42990 2513 764 195 22485 1913 1595
NM_001621chr733027 1132 500 42990 2513 764 195 22485 1913 1595
NM_001634chr672059 1561 1434 632 286 192 170 --21490 445 2716 596
NM_001650chr1884116 3979 3680 3447 3429 3072 858 159 --1564 --
NM_001656chr532035 2012 50 11959 --21891 595
NM_001663chr1462623 2596 2481 2297 2085 1083 --3593 528 446 --
NM_001682chr1272783 2728 2253 1917 1839 453 432 12462 12539 --
NM_001684chr133958 1581 374 1867 44042 4032 3994 2951 12555
NM_001689chr22765 714 --21905 1560 1297
NM_001695chr873691 3185 1139 1038 631 368 246 --43254 1267 1058 743 --
NM_001701chr941500 1106 1017 461 11447 31584 1461 234 --
NM_001709chr115686 300 223 130 30 --1404 22774 2245
NM_001730chr1321456 574 1513 11042 11608
NM_001730chr1321456 574 1513 11042 11608
NM_001742chr761607 1477 1288 1192 648 341 11447 --11833
NM_001746chr562260 2127 1863 1006 481 412 12736 22140 749 12662
NM_001754chr2153490 3301 1170 830 373 --33346 963 530 31293 564 554
NM_001755chr1682200 2192 1794 1541 637 581 536 209 21734 1652 1573 185
NM_001777chr3114081 3816 3788 3630 3296 3060 2548 1548 1409 1084 146 13965 13850 23746 2728
NM_001781chr126871 733 682 672 383 119 --1289 1968
NM_001792chr183834 389 215 --2808 800 1967
NM_001821chr184520 4442 4321 3260 1573 667 606 393 34709 3428 103 34246 4060 571 23162 467
NM_001858chr6175033 4951 4851 4237 4062 3928 3885 3878 3826 3698 3503 3251 576 519 502 305 222 --33902 2012 253 --
NM_001918chr1149131 9074 8790 8419 7269 7217 6842 6537 2310 2293 997 903 213 83 18783 43551 1320 837 91 1702
NM_001942chr1851583 1416 469 204 82 31698 1436 1404 ----
NM_001955chr62983 950 --1961 1898
NM_001957chr442327 2129 1788 549 --1308 1213
NM_001966chr321297 1281 ----11549
NM_001969chr1463836 2998 744 269 217 119 --22690 996 --
NM_001977chr441395 1357 245 74 --2341 133 --
NM_001980chr1262136 2018 1991 1947 818 744 12271 12186 1863
NM_001981chr172298 2194 1785 917 546 401 64 21997 1925 12312 --
NM_001987chr1264344 4323 4211 3689 3011 432 1419 13125 22754 2634
NM_001992chr561372 691 505 325 283 39 22045 124 1685 --
NM_002006chr4135405 5080 4806 4790 4697 3914 3672 1833 1319 1292 792 491 458 24776 3878 44626 4192 1170 206 --
NM_002009chr1542022 1707 970 765 22183 407 12586 --
NM_002024chrX62030 1421 665 581 184 23 21439 702 1558 --
NM_002025chrX148396 8373 7283 7154 5834 5613 3346 2577 2474 2328 2071 1916 935 920 22339 377 39108 3446 3147 --
NM_002033chr1194030 3472 3308 3087 2822 2522 928 781 195 33951 3935 3641 13970 33481 2918 677
NM_002040chr2183162 2450 2426 2309 1118 901 563 131 32024 1218 1073 1517 43138 3041 557 425
NM_002063chrX2861 168 1834 31247 814 75 --
NM_002092chr484752 4476 3849 3498 3383 3286 1718 52 --33697 2034 276 --
NM_002158chr2103846 3778 2653 2614 2557 1341 1248 1069 752 44 23829 580 13401 23222 258
NM_002182chr362299 2199 1883 769 745 236 12127 22273 295 --
NM_002203chr594175 3882 3586 3455 2709 1521 1123 1114 567 13826 3289 277 228 --
NM_002210chr2123564 3097 2623 1238 1051 1001 931 854 664 536 487 145 --32902 1350 640 22431 296
NM_002211chr1051126 876 763 403 387 ----1747
NM_002214chr7185192 4749 4554 4543 4518 4459 4351 4325 3976 3875 3844 3817 3477 2035 1914 678 616 308 --65252 5064 4474 4359 4031 3892 --
NM_002222chr371155 494 351 268 128 92 36 --11119 --
NM_002223chr1284014 3965 3596 3092 905 577 554 159 11060 12527 12605
NM_002239chr22972 744 --2291 252 1277
NM_002242chr272014 1979 1886 1730 587 499 266 --1709 --
NM_002247chr1042156 2119 447 116 32042 2020 778 21977 921 22001 128
NM_002264chr353631 3270 414 271 235 13950 34008 3452 534 --
NM_002270chr5165276 5003 4516 4305 4092 3847 3569 2231 2192 2063 1968 1618 1283 1090 935 97 54666 4636 3674 1687 1241 75643 3493 1989 1936 1915 772 516 14570
NM_002285chr274201 4150 1640 1325 1249 606 143 13644 11298 --
NM_002293chr172774 2473 1972 1820 1696 634 82 --12660 --
NM_002296chr121757 53 1471 21100 233 11376
NM_002310chr5176628 6021 5997 5956 5913 5892 5355 5305 5122 5042 4460 2603 2590 1512 784 708 395 --56409 5018 5007 4917 852 --
NM_002336chr1284899 4770 4393 4153 4069 1673 976 261 23663 3646 23629 3285 54600 1981 1088 903 180
NM_002349chr261462 1405 1216 1106 1051 27 --31448 1114 1034 11506
NM_002351chrX41580 363 273 235 21557 62 11673 --
NM_002356chr63963 856 554 12498 1321 1313
NM_002374chr293692 3658 3363 1121 551 288 195 91 79 --2261 218 12306
NM_002381chr24935 744 383 68 2864 738 2962 325 1998
NM_002449chr53466 438 297 --11077 21066 344
NM_002480chr1241268 1175 1008 286 11082 21363 1099 --
NM_002481chr177978 7487 6952 5623 2873 2793 939 27896 5653 32544 705 388 --
NM_002485chr862224 1722 1600 1454 203 71 11919 31937 1929 1547 --
NM_002500chr271166 1001 949 903 524 477 67 --21089 935 --
NM_002526chr661743 1625 1504 1449 660 105 --1243 1337
NM_002527chr12144 --2261 74 186
NM_002545chr1195127 4690 4121 3567 3537 1561 1313 1031 685 ------
NM_002547chrX74284 4269 2786 2583 1298 1138 667 13853 33034 706 188 --
NM_002577chr373847 3465 2461 1307 729 696 569 --43345 2812 289 184 --
NM_002581chr985005 3953 3860 1917 1708 1317 751 476 24920 235 45463 4283 3927 2176 14938
NM_002594chr2062444 2367 2163 2058 982 974 22108 412 12287 --
NM_002595chr1251861 1663 599 535 391 11244 2784 165 --
NM_002612chr762117 1766 844 706 439 25 --31822 1581 249 --
NM_002613chr1655242 4728 3906 3820 1608 35267 5084 585 13742 --
NM_002623chr203597 494 215 1488 2724 166 2525 205
NM_002641chrX81924 1859 1756 1647 508 418 386 290 --1432 --
NM_002645chr1183048 2565 2431 2161 2005 525 380 114 --42743 1101 631 326 22364 1130
NM_002655chr8184970 4810 4720 4599 4565 4430 3881 3863 3799 3656 3211 2069 2034 1464 1118 1030 648 289 24362 2109 13891 --
NM_002657chr20103911 3890 3881 3299 3080 1308 1198 749 662 584 ----13793
NM_002670chr341517 639 335 55 1117 21587 1469 1539
NM_002706chr23215 189 117 --2521 514 2153 74
NM_002709chr2113630 3344 3270 3229 2952 2293 690 664 566 482 249 --43446 3021 2572 2383 --
NM_002734chr1721779 1458 11910 31752 1642 633 21437 127
NM_002736chr771915 1881 1601 867 745 574 437 11776 31655 567 123 --
NM_002737chr17106560 6355 6076 5441 4463 2477 1338 1259 1226 248 --46636 6118 1510 1252 --
NM_002740chr382549 2517 2472 2458 945 345 322 155 --2442 92 22648 1902
NM_002745chr2254313 3704 3427 3116 477 11590 23788 3224 23151 1803
NM_002822chr1261823 1801 1720 1456 1329 281 --31837 545 527 11784
NM_002833chr1531518 1476 474 1438 --11623
NM_002837chr12104120 4028 3753 3597 2986 1624 1568 1159 878 829 ----31443 243 147
NM_002839chr993533 3493 3361 3002 2445 915 771 713 251 1611 22946 1400 --
NM_002858chr121245 1124 3974 496 177 11041 11225
NM_002869chr1152080 1917 1593 520 206 --1200 --
NM_002874chr962262 1859 800 769 398 245 --42318 1527 706 345 --
NM_002892chr1451669 1501 1373 669 616 --11219 11346
NM_002902chr153589 91 40 --1560 1569
NM_002906chr1152368 2207 2113 834 67 11999 21659 1484 --
NM_002940chr42499 305 --1687 21733 752
NM_002941chr341348 603 372 356 --1321 11609
NM_002942chr341417 1217 879 435 --1895 11179
NM_002959chr164259 3827 3738 1074 264 195 --11778 13861
NM_002977chr2123422 3411 3358 3061 2980 2523 1121 1060 566 430 179 27 12124 52346 2184 1359 582 298 33346 2337 855
NM_002994chr441898 1469 466 354 31888 1809 1785 1730 21793 1778
NM_003013chr46826 718 664 563 535 140 --2847 149 --
NM_003022chrX3286 216 55 ----11130
NM_003034chr12138161 7164 7144 5553 5429 5358 5042 4983 3230 2493 1270 225 207 --46725 1586 781 97 35158 2477 617
NM_003043chr354213 4074 1408 988 75 13875 23804 86 1325
NM_003048chr231952 1127 345 --32702 2458 2011 22658 1745
NM_003069chrX2748 290 1274 2513 322 1283
NM_003071chr331865 1772 340 21980 207 2490 120 --
NM_003095chr121100 --1240 129
NM_003099chr15136422 6338 6253 5786 5744 2474 2453 2163 1919 1891 1786 1519 47 32539 1625 827 36514 2316 1854 36452 6440 1534
NM_003100chr53329 313 115 ----1128
NM_003108chr2127297 7273 6363 5866 5792 5380 5080 5069 4946 4556 1138 809 1306 36903 6607 4839 --
NM_003111chr231214 192 39 2474 248 21180 1100 --
NM_003112chr7103208 3032 2902 2531 2044 1134 818 327 264 44 22254 1971 2865 398 1882
NM_003155chr8102837 2761 2677 2589 2571 2164 1981 923 622 138 1819 22577 2519 1656
NM_003161chr1762800 2760 2705 1355 1148 1084 23081 116 23483 491 1520
NM_003184chr83802 384 163 1879 21029 963 --
NM_003185chr2041254 967 98 37 --1115 21323 31
NM_003199chr18125576 5297 5090 4960 4581 4041 2131 1947 1723 1627 1517 491 11866 44617 3486 1955 1108 --
NM_003201chr103974 339 297 1641 2671 113 1872
NM_003211chr1271754 1532 1439 1266 1247 372 324 --21403 1136 1239
NM_003221chr664134 3655 3419 1393 866 106 1660 --14197
NM_003242chr361721 1672 1567 582 270 251 --22411 524 22463 316
NM_003246chr1551868 1748 1360 519 125 11510 22093 2018 11859
NM_003253chr2161863 1434 1428 1409 1275 746 11852 11456 1622
NM_003262chr3155273 5239 4225 4166 3955 2109 1890 1780 1591 1451 1155 742 227 159 141 --31169 1009 290 --
NM_003274chr2172665 2302 2291 2064 2051 1973 1139 1775 2860 822 --
NM_003298chr3116240 6000 5957 5755 5494 4867 1930 1921 1849 1434 296 --56121 6084 5590 4063 646 --
NM_003304chr331547 207 135 31452 1199 62 41498 1371 638 619 --
NM_003337chr551744 532 509 393 181 ----1381
NM_003338chr1091663 1395 1351 1219 784 770 602 413 372 --2458 332 --
NM_003359chr441293 1078 515 450 21362 1087 31257 1162 993 1507
NM_003368chr13796 285 67 --1579 1132
NM_003376chr6--1379 11654 31224 410 364
NM_003376chr6--1379 11654 31224 410 364
NM_003387chr282453 2438 2349 2337 2160 1796 696 285 --42705 2518 652 562 22678 2194
NM_003392chr394264 4075 3650 2994 1499 1366 644 565 49 --14282 13448
NM_003410chrX62844 2110 973 916 829 460 22598 863 52586 645 358 287 272 1910
NM_003411chrY41833 1154 695 481 --61692 1411 1247 608 496 145 1288
NM_003412chr342234 1962 1251 415 --53111 2604 2318 1198 462 --
NM_003413chrX61727 1717 1419 767 233 222 11950 --11499
NM_003419chr1951210 969 493 259 134 ----1864
NM_003423chr1931644 706 392 12619 4605 476 91 54 --
NM_003454chr1681416 1409 1377 1337 1163 1022 594 250 11460 11436 --
NM_003463chr683363 3238 2362 2246 2197 1159 721 705 13371 43039 1052 597 509 12069
NM_003466chr222437 95 ----21641 1624
NM_003468chr294234 1512 1445 1268 775 655 547 319 282 13802 22650 251 --
NM_003471chr341981 1528 907 236 --12237 1562
NM_003472chr65381 239 213 181 54 --21339 1108 1273
NM_003478chr1163110 3000 2925 2077 739 233 1105 22917 2749 21154 879
NM_003483chr1242734 2647 1989 1822 ----32614 1912 1814
NM_003489chr2183299 2733 2220 1204 953 754 512 277 ----12678
NM_003505chr731900 1818 1580 --11952 11838
NM_003506chr8101081 927 884 538 498 418 395 111 98 86 ------
NM_003566chr1283479 2768 1237 1026 658 531 508 442 --22324 1035 32775 2728 957
NM_003574chr18125805 5401 5364 4084 4052 2265 2118 1738 1562 1452 1151 699 24565 1791 35067 4812 3549 --
NM_003581chr25978 945 889 867 809 11053 1963 --
NM_003583chr12103252 3161 2518 1565 835 738 362 315 200 167 11526 23214 3084 --
NM_003589chr1311469 --11083 21188 1091
NM_003590chr283676 3474 2989 2896 935 887 221 191 34049 3073 3036 23494 3084 13620
NM_003597chr261959 1939 435 367 316 299 --22327 392 --
NM_003603chr432137 785 500 --3798 676 436 11406
NM_003615chr3133831 3631 3145 2829 2604 2590 2462 1425 1012 734 696 357 253 11080 63908 3263 1239 1212 1182 350 23774 1335
NM_003617chr1155019 4859 4565 3937 3817 3581 3358 1838 1458 1188 1085 752 664 621 484 ----14465
NM_003622chr1272620 1821 1709 394 357 263 249 --1970 1493
NM_003626chr113480 209 116 --21026 439 1240
NM_003632chr17------2883 809
NM_003663chr392961 2487 2445 2119 1389 1218 686 485 120 11308 ----
NM_003671chr963579 3404 3308 3023 613 424 ----13517
NM_003672chr151799 1290 371 325 305 21330 331 2723 311 --
NM_003675chr101461 ----2425 410
NM_003713chr111605 11416 11524 11403
NM_003714chr543083 2652 2594 743 --1690 11176
NM_003759chr464302 4213 2831 1700 1564 1011 1288 24287 3570 --
NM_003762chr181293 1186 501 482 446 408 353 345 --3994 945 937 --
NM_003763chr205951 714 534 339 310 1894 32973 1984 134 --
NM_003772chr1171231 866 839 816 473 224 53 --1449 --
NM_003774chr1272964 2638 2500 2480 2458 2097 1295 1435 22656 651 1225
NM_003778chr32742 47 ----2752 254
NM_003799chr1894500 4124 1289 1110 1000 911 812 559 347 23796 425 1179 --
NM_003800chr682355 1960 1878 1751 1662 853 627 343 --21494 563 1318
NM_003816chr851396 1340 1277 206 22 --1955 --
NM_003821chr81475 --148 175
NM_003831chr1861695 1635 1597 621 372 357 --21673 1500 --
NM_003861chr1442424 1924 1099 733 --21943 430 11991
NM_003884chr351863 1784 1263 500 72 --11815 1513
NM_003887chr282272 1901 1710 1661 1540 584 530 175 1689 42048 1997 764 319 1157
NM_003895chr2152141 2126 1565 871 524 --22087 1629 21358 516
NM_003909chr8112966 2662 2312 2290 1095 1089 961 555 448 370 130 --43037 2384 2150 221 --
NM_003913chr664303 3488 3407 3101 3031 187 11167 34092 3737 384 1808
NM_003930chr762290 2008 1690 512 298 234 --12241 22481 1652
NM_003931chr61184 2654 567 --1521
NM_003955chr1751612 1566 1460 1432 1239 --21583 1577 --
NM_003958chr673191 2877 2785 2607 2524 1525 1517 13004 21547 853 11568
NM_003966chr5157782 7531 7224 7186 5673 5405 5337 4735 3018 3000 2916 2191 1824 1750 297 --37068 6538 6332 --
NM_003972chr1041099 391 177 43 --1223 2900 543
NM_003994chr12114375 4352 3921 3833 3589 3350 1325 1080 847 568 229 --3871 336 150 14201
NM_004006chrX142563 2420 2127 2103 2031 1793 1007 437 420 379 265 164 123 96 1716 32210 521 347 1573
NM_004007chrX142563 2420 2127 2103 2031 1793 1007 437 420 379 265 164 123 96 1716 32210 521 347 1573
NM_004009chrX142563 2420 2127 2103 2031 1793 1007 437 420 379 265 164 123 96 1716 32210 521 347 1573
NM_004010chrX142563 2420 2127 2103 2031 1793 1007 437 420 379 265 164 123 96 1716 32210 521 347 1573
NM_004011chrX142563 2420 2127 2103 2031 1793 1007 437 420 379 265 164 123 96 1716 32210 521 347 1573
NM_004012chrX142563 2420 2127 2103 2031 1793 1007 437 420 379 265 164 123 96 1716 32210 521 347 1573
NM_004013chrX142563 2420 2127 2103 2031 1793 1007 437 420 379 265 164 123 96 1716 32210 521 347 1573
NM_004014chrX142563 2420 2127 2103 2031 1793 1007 437 420 379 265 164 123 96 1716 32210 521 347 1573
NM_004015chrX142563 2420 2127 2103 2031 1793 1007 437 420 379 265 164 123 96 1716 32210 521 347 1573
NM_004016chrX132477 2334 2041 2017 1945 1707 921 351 334 293 179 78 37 1630 32124 435 261 1487
NM_004017chrX142563 2420 2127 2103 2031 1793 1007 437 420 379 265 164 123 96 1716 32210 521 347 1573
NM_004018chrX132477 2334 2041 2017 1945 1707 921 351 334 293 179 78 37 1630 32124 435 261 1487
NM_004020chrX142563 2420 2127 2103 2031 1793 1007 437 420 379 265 164 123 96 1716 32210 521 347 1573
NM_004021chrX132477 2334 2041 2017 1945 1707 921 351 334 293 179 78 37 1630 32124 435 261 1487
NM_004022chrX132477 2334 2041 2017 1945 1707 921 351 334 293 179 78 37 1630 32124 435 261 1487
NM_004023chrX132477 2334 2041 2017 1945 1707 921 351 334 293 179 78 37 1630 32124 435 261 1487
NM_004028chr1884116 3979 3680 3447 3429 3072 858 159 --1564 --
NM_004087chr331742 767 166 ----32048 2034 333
NM_004109chr1192376 2330 2286 1939 1830 757 491 188 47 2246 136 ----
NM_004113chr351886 1730 1653 500 490 1397 11440 --
NM_004124chr14113532 3080 2539 1312 1104 969 835 740 299 247 203 --22225 1387 --
NM_004133chr862605 2585 2427 2418 977 145 ----32524 2436 226
NM_004136chr1583063 2626 2511 2322 765 456 352 320 12209 ----
NM_004161chr241156 433 230 39 --1317 11234
NM_004171chr11229151 8949 8194 7632 7071 6959 6943 6918 6877 6606 6082 6062 3838 3012 2928 2253 1630 1591 1568 1376 641 201 17888 --49601 3744 3019 745
NM_004172chr5--11243 12062 21729 318
NM_004229chrX82248 2229 1876 1869 895 631 459 275 --22023 419 --
NM_004232chr1893715 3512 3243 2852 2429 1347 999 706 64 --33639 2525 1057 1477
NM_004274chr1472621 2397 2114 1241 1054 962 133 ----12513
NM_004293chr942830 2552 1490 573 1492 33880 3724 590 --
NM_004329chr1031467 1035 1016 --21273 990 21050 203
NM_004330chr152798 178 --51179 324 281 238 231 1266
NM_004331chr862657 2357 2347 829 633 253 12648 1870 1119
NM_004337chr852132 1475 603 433 64 --21972 169 --
NM_004338chr18175999 5904 5882 5638 5448 5410 5286 5151 4549 2028 2016 1657 1590 609 376 345 162 76888 4789 4765 2621 1608 754 410 2790 626 --
NM_004342chr772204 2144 1840 759 585 419 205 21975 1433 1838 --
NM_004354chr44855 831 742 345 --2732 29 1589
NM_004365chr52285 48 1130 --1223
NM_004384chr571888 1541 938 682 374 156 37 21803 355 32245 2010 1815 --
NM_004392chr1331727 522 45 12005 22549 1960 1637
NM_004430chr862789 2699 2527 2102 2072 1806 11055 12325 --
NM_004432chr982258 1800 1572 1511 787 667 242 70 --2488 437 2319 29
NM_004434chr1491897 1755 1579 1560 1541 716 545 525 480 11867 21658 248 --
NM_004438chr233256 2384 720 --23306 1144 12283
NM_004449chr2151399 1381 1302 1204 411 11189 --11178
NM_004454chr372279 2094 2048 1827 1702 795 402 ----1384
NM_004457chr231536 1295 1172 --1313 1613
NM_004458chrX72657 2141 1990 1878 1628 981 356 22171 562 11038 1183
NM_004464chr4123720 3450 3432 3106 2924 1701 1403 1343 1193 851 533 320 13196 53849 2850 1493 636 563 --
NM_004485chr143313 1752 381 230 --22713 312 14185
NM_004501chr173279 1530 1520 1341 1043 673 451 14059 22970 934 21378 1110
NM_004504chr271197 917 859 739 599 522 50 --22538 902 12562
NM_004525chr26496 464 214 177 58 43 --11062 --
NM_004571chr2183344 2787 1012 877 871 612 54 38 --181 --
NM_004580chr1551511 1276 384 370 287 ----11671
NM_004586chrX85142 4267 4040 3713 3582 1224 825 326 35204 5127 887 35038 1833 416 15466
NM_004612chr9124335 3943 1773 1758 1681 1596 1526 1476 1385 1130 614 118 11868 24010 928 --
NM_004619chr13592 578 435 --41720 232 224 166 11380
NM_004626chr111510 ----2568 559
NM_004660chrY52141 1681 1507 531 269 ----11542
NM_004685chr13122885 2689 2612 2540 2235 2055 1206 1067 759 524 254 179 ----2815 427
NM_004744chr453047 2738 1310 1267 366 1966 33942 1085 51 23981 2991
NM_004745chr875642 4423 1576 1569 878 355 334 36931 6881 2590 11090 --
NM_004748chr15114183 3926 3909 3812 3701 3648 2784 1595 1352 1249 1117 --43417 2945 560 268 --
NM_004760chr782270 2232 2106 1919 1632 1557 547 363 ------
NM_004775chr1862135 881 741 433 279 136 22413 2035 41937 475 451 401 12126
NM_004781chr141780 549 212 199 --1570 1222
NM_004781chr141780 549 212 199 --1570 1222
NM_004796chr1432244 2137 1909 --22411 1680 21584 920
NM_004815chr1114783 4077 1955 1418 1196 1077 804 695 605 476 401 1684 33213 3172 630 34284 761 568
NM_004824chr651433 1271 1042 929 227 1235 11363 --
NM_004827chr441966 1894 1679 724 ----11366
NM_004834chr263357 3135 3118 2876 1282 563 22954 166 22233 1005 --
NM_004842chr651756 1546 1362 1108 518 1657 31490 719 347 11403
NM_004850chr261370 1319 1103 694 645 536 --21433 612 11465
NM_004857chr14144818 4633 3950 3924 3502 3325 3140 2997 1807 537 499 429 161 55 14627 33239 1831 1436 11844
NM_004859chr17102887 2542 2340 2330 2320 1956 1229 1061 310 71 --1984 --
NM_004866chr573829 3454 3213 3186 1875 614 217 13954 64038 3275 1973 1597 594 418 33439 1815 750
NM_004873chr1452205 990 675 84 35 1357 12752 13103
NM_004904chr7196449 5756 5739 5713 4994 4949 4830 4820 4765 4058 2251 1928 1910 1100 1024 693 263 159 132 1171 26521 4667 25461 2035
NM_004912chr741366 1117 578 431 --11380 1485
NM_004921chr132358 1990 373 1583 --22410 2334
NM_004949chr1851603 1404 501 472 358 11822 --22028 403
NM_004956chr7104486 4353 3177 2930 1362 1165 719 560 529 144 --11515 44447 4258 3815 592
NM_004972chr93422 338 39 299 84 21049 55 --
NM_004973chr651284 1270 1212 95 52 ----130
NM_004985chr1284451 3645 3558 2854 1630 1315 791 595 23421 1366 54196 3851 1767 1646 774 11658
NM_004992chrX118017 7245 7112 6194 5762 5336 2076 2060 1193 980 244 18533 --15482
NM_004992chrX118017 7245 7112 6194 5762 5336 2076 2060 1193 980 244 18533 --15482
NM_005011chr73159 60 52 --11612 31657 1589 345
NM_005054chr251532 1336 1297 616 82 --21684 143 1150
NM_005056chr1284975 4569 4453 4372 4120 1669 414 132 14443 34649 396 322 --
NM_005065chr1485213 5130 5044 4214 1798 1428 950 64 --32018 1145 939 11582
NM_005121chr17183792 3231 3165 3112 3058 2837 2565 1536 1141 1024 969 900 822 772 718 521 498 480 23202 2692 --1809
NM_005126chr322043 1912 11608 32172 1892 67 12031
NM_005135chr1543137 3062 2877 2430 --23092 541 13817
NM_005156chr984036 3615 2007 1693 883 858 568 482 11335 44935 4724 4649 1310 15090
NM_005160chr22146763 6639 6354 5951 5425 5415 5394 4516 2133 1617 1498 1248 1064 701 12727 35581 4936 1300 --
NM_005164chr1292576 2462 2456 1939 1730 904 897 508 120 --1918 --
NM_005171chr1261052 1039 1010 906 835 69 1393 41170 1136 1115 358 11097
NM_005180chr1041194 590 537 358 1506 --21526 47
NM_005188chr1187455 6027 3338 2582 1205 1166 558 258 27118 883 48102 2083 1858 1560 --
NM_005197chr14116223 5876 5764 5388 5356 4881 4668 4022 1190 1165 248 14312 36090 4761 3773 --
NM_005214chr26852 829 446 381 361 153 ----1368
NM_005233chr342624 2597 2211 461 1801 12590 22399 399
NM_005235chr2147832 7246 7219 6210 5396 5244 4988 3152 2906 2890 2677 2272 1429 1084 12108 57668 1406 873 731 682 25860 1574
NM_005238chr1163273 2992 2708 2411 2294 1202 1780 23317 953 23530 714
NM_005259chr281528 1499 1393 1159 1091 1019 367 248 1412 31185 1175 450 1953
NM_005324chr1791973 1936 1337 758 679 516 324 99 88 1688 1569 1532
NM_005339chr4113868 3575 3414 3310 3154 1707 1242 957 843 448 390 11653 11201 --
NM_005358chr1351464 1214 706 409 191 31631 1527 143 11679 --
NM_005359chr1882545 1936 1687 1359 701 571 563 67 15455 25855 1144 --
NM_005385chr341061 281 208 23 3794 436 317 21697 145 1425
NM_005392chr911278 --11466 21698 1497
NM_005402chr751834 1378 1169 630 53 1495 21534 364 --
NM_005433chr1882619 2291 1935 1043 901 756 463 296 12379 2534 21 12126
NM_005436chr1042749 1161 572 105 --1367 21284 1276
NM_005475chr1262779 1997 914 903 704 217 ----12954
NM_005487chr2222127 530 --22036 113 11864
NM_005493chr63691 143 29 --1127 1724
NM_005497chr1746017 3990 3972 1087 14622 31492 383 231 --
NM_005502chr993115 3088 2965 2127 2101 2095 1229 724 57 --33231 2562 2417 11171
NM_005504chr12136583 5567 5094 4651 2170 1838 1465 1452 851 736 413 341 69 15520 12178 12644
NM_005509chr52718 188 --41865 1826 1573 114 --
NM_005542chr751861 1796 1592 1506 1275 11566 31932 1283 590 --
NM_005570chr1841210 1121 857 135 --3907 795 789 1948
NM_005578chr394971 4914 4464 4194 1582 1204 602 496 239 21164 573 13560 --
NM_005585chr151152 ----2325 146
NM_005587chr152863 312 1173 3817 766 97 2904 126
NM_005596chr9216356 6098 5861 5588 5351 4925 4392 4262 2095 1991 1836 1691 1484 1459 1322 1243 1143 887 575 481 361 --55160 5050 4729 896 440 --
NM_005599chr141203 1192 1014 553 --1968 31567 1479 1069
NM_005607chr83841 808 266 ----1801
NM_005665chr1114956 4523 4196 3935 3052 1729 1716 1398 1053 909 151 --34759 3238 1089 14474
NM_005668chr554449 4206 3311 979 261 34027 3962 1305 21541 1299 11428
NM_005715chr642195 1747 1729 983 ----12552
NM_005722chr242394 2348 2073 660 11769 --2977 393
NM_005725chr131723 724 242 1287 32256 2125 132 1539
NM_005737chr262959 2919 2009 1857 914 530 ----22457 2164
NM_005739chr1542059 1631 1612 85 1780 12425 11924
NM_005746chr762554 2416 2126 1718 996 486 1688 42656 2432 752 354 2325 293
NM_005748chr1272257 1168 1064 834 712 410 351 --11157 1125
NM_005795chr282935 2272 2242 2197 1912 952 642 330 ----1857
NM_005807chr14699 476 239 186 1663 --1109
NM_005813chr262662 2411 2167 1017 881 217 12154 12043 2784 319
NM_005828chr1794837 4385 3487 1876 1703 1145 568 416 115 14737 13420 --
NM_005832chr351337 1086 1080 1058 122 ------
NM_005840chrX136846 6503 6260 5868 3075 2372 2275 1935 1584 1200 1037 884 214 25368 2903 25833 4746 25818 2829
NM_005843chr251841 1460 1339 1262 603 11792 --21911 1371
NM_005863chr1061129 400 358 331 98 45 --3581 545 475 --
NM_005880chr1651659 1534 1074 521 476 --31319 1146 186 --
NM_005896chr22208 146 1162 160 1763
NM_005901chr18178564 7760 7124 6712 6222 6162 3167 2827 2724 2555 2255 2102 1247 1128 1064 806 419 16102 27948 1510 48594 6469 371 354
NM_005902chr1574492 1543 1444 1228 1153 954 700 --34520 4014 1534 11003
NM_005903chr5184818 4289 4012 3908 3811 3798 3657 3537 3347 979 971 930 850 748 689 475 86 26 --1601 15213
NM_005930chr141607 1233 --1256
NM_005935chr494781 4285 3768 2025 1621 1484 912 609 43 24797 4775 11101 --
NM_005941chr8114063 2772 2573 1470 1440 1360 1195 1173 976 719 32 --1763 --
NM_005955chr184921 4896 4569 4316 4160 3537 1580 1300 --14068 11066
NM_005966chr252020 1634 1605 646 326 --2937 255 --
NM_005977chr131377 1111 1764 2997 167
NM_005999chr131119 382 180 21056 388 --3216 202 102
NM_006007chr984400 3335 3244 2818 1646 1076 760 322 12800 34085 1570 112 24439 1213
NM_006033chr1842203 2172 1962 526 ----21862 1471
NM_006037chr2104294 3783 3717 3672 3473 3419 3131 1504 1226 1215 --44308 3700 3179 1590 --
NM_006047chr2093522 3137 2908 2162 1349 986 312 154 21 23166 111 12325 --
NM_006080chr782920 2648 2407 2187 2175 2091 1201 111 1964 --12305
NM_006089chrX61893 1786 1624 1548 719 305 --1361 11877
NM_006095chr474398 3876 3069 2772 1303 1220 655 --64168 3710 3135 2968 1491 942 11764
NM_006106chr1183415 2790 2774 2387 2288 1320 956 473 33404 2296 2194 33293 2817 1065 1927
NM_006108chr1182070 2022 2008 1795 1647 907 693 111 --22261 1572 --
NM_006113chr171965 1898 1655 1340 849 679 662 --1606 --
NM_006154chr1572770 967 949 916 717 191 45 --11001 --
NM_006166chr1272650 2566 2406 863 722 648 472 --21747 975 --
NM_006197chr831740 650 332 21821 38 11876 2740 365
NM_006203chr5145387 5226 4614 4185 4174 3728 3590 1785 1451 1287 1241 993 624 358 35031 4009 482 55144 4558 3544 2108 891 35409 4061 806
NM_006206chr462815 2295 1930 1091 658 327 --52944 2783 2716 2270 785 --
NM_006246chr145998 510 414 220 94 --11271 11345
NM_006251chr593008 2617 871 402 351 337 151 128 28 2989 345 33063 2700 277 2896 314
NM_006252chr1207511 7301 6600 6438 6391 6006 5774 5659 5609 5311 5273 4741 2629 2604 2520 2099 1624 1313 758 48 47471 7391 7253 5643 66678 6468 6291 5700 1792 823 1749
NM_006256chr162302 2152 2069 574 388 322 --31704 1077 608 --
NM_006264chr43370 206 177 ----1497
NM_006267chr261598 1444 1251 533 173 112 11436 1636 --
NM_006282chr2074378 4133 3640 1675 1494 714 552 11833 2299 223 --
NM_006283chr8104500 4094 3720 3665 1925 1513 1436 534 466 95 24241 194 44900 4876 1995 1919 11205
NM_006287chr262661 2571 2278 870 477 360 --32670 771 45 --
NM_006298chr663395 3200 3059 2442 506 476 12104 11128 --
NM_006300chr1962391 2322 1642 1609 1578 392 --31897 1625 899 --
NM_006313chr123627 222 208 --31690 1543 1088 11716
NM_006315chr453980 2738 777 179 122 24044 502 13840 --
NM_006322chr13--1945 3607 599 311 1858
NM_006330chr851409 513 308 115 97 ----1456
NM_006333chr21219 1213 --1258
NM_006364chr1461262 1230 1171 976 885 249 1958 21060 845 11099
NM_006375chrX61751 1628 1408 1251 677 568 --2396 71 --
NM_006379chr751939 1446 682 303 134 --2705 245 1423
NM_006380chr1794082 3220 3081 1684 1658 518 355 292 188 13751 34176 462 97 --
NM_006393chr1084489 2984 1626 1619 1381 770 520 101 --2958 643 24188 3694
NM_006420chr2053062 2519 2148 961 593 33388 281 197 13209 --
NM_006457chr4113909 3766 3465 3386 3154 2698 2636 2545 1601 914 240 --33398 2794 88 --
NM_006467chr562275 2233 2131 2043 2002 763 12149 1461 2890 158
NM_006469chr161257 1121 625 533 494 315 1132 1544 1125
NM_006482chr12103252 3161 2518 1565 835 738 362 315 200 167 11526 23214 3084 --
NM_006496chr171632 1435 1403 1365 1258 658 416 11761 11412 --
NM_006504chr1062831 2781 2569 2483 1080 552 --1527 --
NM_006526chr2052183 1688 1659 1651 1386 1238 12006 1320
NM_006534chr2083090 3059 2830 2767 2380 1047 805 642 --23314 2473 12439
NM_006538chr244192 4097 692 679 --1296 1671
NM_006544chr14165864 5788 5738 5652 5326 5057 4938 4694 4284 4213 2444 2363 2289 2075 1014 40 25985 1233 34838 3752 2047 23938 2429
NM_006546chr1746691 1727 478 459 --1898 11747
NM_006547chr71632 --11917 1625
NM_006561chr1066216 4237 4172 3991 1478 737 16057 2526 206 --
NM_006572chr1792721 2590 2337 2263 2177 1349 1249 516 83 23345 420 --33256 2969 623
NM_006575chr1451405 1184 555 204 114 --2428 362 --
NM_006577chr231246 1203 381 ----2860 26
NM_006587chr441420 1221 478 220 1548 31115 625 139 1666
NM_006599chr16178083 7626 7384 7267 7194 5942 5554 5051 3074 2971 2533 2458 1814 1660 1295 1250 1200 27429 2797 78171 6844 6605 5009 3138 1930 208 35247 2042 852
NM_006603chrX82053 2007 1957 1645 1337 815 573 352 --32028 1966 406 11793
NM_006609chr282665 2593 2186 2022 835 517 236 82 12678 1183 --
NM_006614chr3103582 3493 3230 3093 2947 2487 2341 917 754 206 1876 13082 43338 1229 860 334
NM_006626chr942704 574 302 110 3263 216 24 32455 2390 1812 22713 2621
NM_006628chr1541465 869 738 114 --11588 21256 1064
NM_006654chr12124618 4454 4223 3953 3871 3744 3706 2962 1054 349 97 26 1197 54057 3784 3680 3528 969 24292 1435
NM_006699chr152566 2516 1030 512 181 --22527 44 1435
NM_006714chr62285 251 ----2244 70
NM_006717chr993359 3278 2689 2413 2151 2111 845 821 749 --32643 1286 1020 --
NM_006722chr361983 1085 1018 529 463 189 11208 12152 --
NM_006729chrX115426 5010 3844 3463 2231 1840 1410 1193 992 850 767 23918 2089 24117 781 25441 1559
NM_006731chr975548 4427 4361 3659 1430 1329 904 13641 21661 890 --
NM_006734chr651634 1591 265 138 85 1124 21247 430 --
NM_006746chrX81547 1440 1279 1255 1240 265 257 230 ----11531
NM_006750chr16148101 7781 7551 6332 6091 6079 6043 5723 5551 5148 2932 2512 2476 2404 38068 6713 2731 12855 --
NM_006754chr751272 1078 849 334 291 1444 21186 483 1144
NM_006766chr862078 824 674 383 223 57 1416 12495 21668 311
NM_006775chr693013 2920 2906 2776 2756 2422 2208 995 728 12814 43123 2802 2238 580 13005
NM_006777chrX32245 760 672 11160 --2944 213
NM_006805chr551683 1475 1194 1159 287 --31579 604 499 --
NM_006838chr1231928 1856 1328 --1316 11187
NM_006851chr1282881 2553 2447 2034 1915 794 687 200 1636 22729 350 11958
NM_006873chr272957 2176 1395 1142 1122 916 802 13175 13236 13374
NM_006885chr1673952 3619 3279 2852 1179 870 247 --1186 1547
NM_006888chr1453503 2906 2829 1099 222 --22896 828 12617
NM_006914chr941340 1333 608 291 1503 21160 336 --
NM_006915chrX102553 2477 2458 2441 2367 1697 1622 1609 503 148 22091 485 22532 2513 --
NM_006916chr251326 1187 1110 447 252 1916 1925 --
NM_006920chr292074 1912 1692 1617 1413 1285 439 113 41 11901 41723 1317 563 360 --
NM_006922chr292389 2138 2011 1896 1863 1021 364 324 39 22614 2415 32467 2128 450 11724
NM_006924chr1743657 1042 662 122 34281 1120 567 13252 --
NM_006930chr551452 1409 1241 763 604 11551 21715 1652 --
NM_006947chr451750 1541 1337 1288 1189 ----1610
NM_006948chr21102488 2436 2112 1994 961 843 773 688 463 318 1533 2895 545 21749 143
NM_006981chr963012 2727 2508 2275 1052 861 --22256 214 11967
NM_006988chr2161254 1216 1180 1103 1093 279 ------
NM_007006chr1693490 3451 3419 2953 2826 2423 2404 574 552 --13498 --
NM_007007chr1294397 4366 3182 3070 2993 1040 657 469 250 43853 3532 1232 270 34043 3223 362 --
NM_007038chr21175612 5579 5364 5258 4986 4979 4618 4338 4064 4052 4035 2257 2126 1808 1722 1562 1420 35632 5521 3920 45446 1611 890 420 15755
NM_007043chr1291695 1376 1332 1321 651 573 183 155 147 ----21918 1312
NM_007049chr62969 937 1957 2987 951 --
NM_007054chr563880 3470 3256 1571 524 385 23288 431 13671 --
NM_007073chr694178 4123 4111 4048 3740 3727 2866 1644 1046 13197 33357 3145 3092 --
NM_007078chr1062909 2875 2862 2846 2521 2079 --23023 2412 1175
NM_007106chr1332224 1117 403 32294 2160 434 21898 362 1984
NM_007114chr3123059 2820 2748 2649 2330 2283 1194 758 747 162 143 86 22393 2378 12623 1371
NM_007124chr641629 1537 485 189 31998 606 372 2403 395 21575 774
NM_007125chrY41208 1132 893 498 11186 2990 904 --
NM_007139chr761122 975 912 812 805 216 --2259 134 1766
NM_007147chr1951175 922 359 336 90 1496 11058 1951
NM_007157chrX113004 2317 2056 1975 1958 1891 865 636 409 230 105 --12612 22119 571
NM_007159chr361731 1644 1425 1410 486 311 1151 --1480
NM_007166chr1181531 1468 1301 1272 519 509 198 173 --11504 1570
NM_007173chr1131910 391 309 --32164 553 354 2707 238
NM_007175chr873525 2996 2799 2726 2691 1281 592 --1211 22892 2550
NM_007195chr1893559 3455 2955 2440 1063 1054 996 976 476 22468 969 2515 226 23367 305
NM_007212chr182151 1734 1528 865 816 438 135 38 ----11608
NM_007222chr851743 1577 1519 1342 442 ----1588
NM_007231chrX82138 2075 2001 927 622 338 263 194 1962 12393 --
NM_007249chr13198779 8693 8200 8030 7988 7723 7203 5882 3640 3553 3151 3121 3033 1748 1711 1542 1128 562 424 --25738 3728 18995
NM_007276chr72994 368 --21136 163 234 24
NM_007287chr352850 2796 2072 465 456 1523 32959 2422 753 1728
NM_007288chr352850 2796 2072 465 456 1523 32959 2422 753 1728
NM_007289chr352850 2796 2072 465 456 1523 32959 2422 753 1728
NM_007315chr251501 1393 590 527 442 ----31467 1250 518
NM_007331chr462445 2394 2292 1988 1904 196 12042 12240 11818
NM_007347chr1543017 2056 1084 316 --42399 2198 2066 126 3721 261 47
NM_007350chr1284530 4474 4442 3844 3790 3465 1594 973 --23681 1454 --
NM_007373chr1061817 1655 1527 482 116 106 31473 1266 189 1579 --
NM_007375chr142597 2286 199 186 12295 42450 1745 978 333 --
NM_012081chr593772 3144 3045 2961 2631 2391 2316 1404 486 23205 2444 13080 11062
NM_012089chr171587 1504 1495 1412 1296 1055 444 --21569 545 --
NM_012092chr261739 1715 1603 1568 687 328 ----1718
NM_012096chr391433 1390 1086 533 508 468 446 313 265 --42814 1042 171 109 11376
NM_012097chr252121 2110 1728 595 92 --11673 12231
NM_012102chr12884 771 1674 1530 2121 69
NM_012120chr672985 2849 2555 1132 1058 900 356 12761 1577 1162
NM_012129chr752243 1644 1616 1601 174 --1125 11719
NM_012141chr1383973 3545 1376 1343 1046 671 154 78 21546 679 32904 2563 1095 --
NM_012158chr1341828 1797 344 274 11770 21202 1176 --
NM_012164chr9137010 6438 5849 5204 4639 2973 2943 2906 2147 1828 990 604 508 --56811 5733 5260 5104 2377 --
NM_012193chr1171663 1215 1111 939 897 765 494 --44706 4248 1328 996 --
NM_012199chr154665 4236 1623 1265 1000 --34511 1325 919 13911
NM_012214chr2115315 5257 5219 4996 4767 3994 1226 852 654 389 295 2408 327 1950 --
NM_012234chr383328 2656 880 770 637 271 240 76 2904 499 33782 3611 217 --
NM_012249chr252944 2512 1126 973 83 21398 1058 --12808
NM_012259chr621083 998 --11399 21437 931
NM_012262chr1135282 4219 4023 4011 3396 3291 2105 2026 1885 1866 1024 935 914 1970 55194 4969 3794 3441 1717 --
NM_012287chr3164449 4332 4225 3898 3891 3638 3284 3027 2901 1755 1709 1596 1112 1082 871 147 14082 21166 895 24272 4027
NM_012290chr271632 1418 678 644 526 329 114 ------
NM_012294chr763741 2917 1543 777 679 618 34023 2697 2666 13984 23616 2907
NM_012297chr432539 1970 200 11887 22301 54 12259
NM_012301chr772179 1941 1737 1431 825 775 453 --1357 --
NM_012309chr1153362 3333 1904 1713 328 --1620 13076
NM_012316chr155425 4353 4018 575 326 24508 1776 11172 15580
NM_012327chr1851594 1188 511 211 190 --11001 11029
NM_012328chr751453 1424 1043 401 372 ----11362
NM_012329chr1761458 1210 1151 564 289 261 --31051 277 114 --
NM_012334chr584601 4546 3874 3831 3736 1168 892 733 13638 21256 820 --
NM_012347chr692979 2967 2871 2657 2564 2554 2419 2274 453 --2808 33 --
NM_012382chr5114214 3803 1776 1747 1467 1192 1081 988 847 776 510 12813 1196 --
NM_012388chr1573169 3099 3019 2967 901 251 172 1837 1190 --
NM_012395chr762654 2342 2103 754 591 480 23343 2908 12480 1632
NM_012420chr1041998 1902 529 389 1319 22290 153 --
NM_012431chr75994 956 886 787 625 --31144 86 39 22240 179
NM_012464chr441900 1795 637 94 11870 22936 2778 --
NM_012465chr1043345 2861 2233 911 --13385 21325 1174
NM_013229chr1272781 2698 2641 2145 466 115 86 --22729 2094 --
NM_013230chrY51750 1623 1474 1320 1175 --41789 1300 543 444 --
NM_013255chr7158388 7688 7436 7183 6681 6619 6609 6423 3299 1973 1261 990 715 622 587 38895 5924 1727 47960 3048 2905 2734 12463
NM_013257chr832133 1716 312 --32148 200 110 --
NM_013261chr483330 2941 2594 1485 1084 1000 697 109 11281 1185 --
NM_013269chr1254376 2823 1439 374 235 23791 2781 23206 1748 --
NM_013302chr1684717 4527 4511 4328 1869 1337 1266 1121 --2460 131 --
NM_013309chr1551720 1018 589 453 226 12480 32604 367 337 --
NM_013322chr741606 1296 278 226 --21737 621 --
NM_013341chr232858 637 376 11985 12077 12535
NM_013374chr3143084 2952 2811 2663 2649 2642 2599 2506 2499 2196 1040 840 626 235 --13002 1432
NM_013377chr122234 112 ----193
NM_013386chr171472 1178 1136 584 461 413 164 --31437 375 355 1396
NM_013423chrX61222 1019 961 824 520 430 ----1800
NM_013427chrX61222 1019 961 824 520 430 ----1800
NM_013438chr981819 1524 1431 1282 448 427 372 258 ------
NM_013943chr183205 3105 3020 2879 2479 823 783 98 ----1853
NM_013951chr222437 95 ----21641 1624
NM_013995chrX92379 2314 2271 1907 1887 1866 994 474 215 --12352 12367
NM_014011chr262491 2307 2100 994 552 536 11659 12270 --
NM_014021chr1103237 2800 2596 2242 1345 1138 1050 725 631 602 --23516 2471 --
NM_014023chr1092860 2709 977 740 635 589 346 312 151 ------
NM_014028chr6133282 3086 2776 2691 2491 2106 783 762 736 710 637 586 282 1461 2750 652 --
NM_014039chr1151039 525 519 500 436 ----1384
NM_014043chr351436 665 277 93 75 --41602 1590 1418 259 --
NM_014048chr1675169 5122 4485 4292 1598 1148 90 11255 45296 5209 2131 628 11237
NM_014057chr931563 1154 243 1155 --1277
NM_014089chr1361503 820 507 245 102 87 22048 1764 42143 2134 2113 323 21957 1678
NM_014106chr1562720 2661 1960 1946 479 418 12503 42446 2012 1176 434 --
NM_014109chr821220 793 --31152 817 30 1783
NM_014112chr895489 4367 3708 3605 2010 1511 1063 442 321 --52202 2024 1992 1624 1351 1365
NM_014141chr795329 5007 4923 2094 1960 1445 1332 917 196 14352 --2851 487
NM_014155chr11167446 7311 7114 6563 6235 6120 6005 5346 5257 5084 5044 2640 2434 2354 1654 879 36845 1601 1102 --27087 1158
NM_014181chr252927 2901 753 540 487 1640 21059 814 2889 420
NM_014220chr33821 255 122 ----156
NM_014243chr461646 1501 1353 548 465 373 11370 11781 --
NM_014250chr2222127 530 --22036 113 11864
NM_014253chrX62508 2435 2424 2269 2245 1929 ----1821
NM_014294chr871189 904 569 546 492 351 300 ------
NM_014296chr341035 426 238 30 11052 31121 523 209 --
NM_014309chr22105415 5376 5031 4886 4743 4074 3712 3616 623 146 34680 3849 3382 ----
NM_014331chr4317786 7322 7298 7060 6953 6946 6771 6664 6530 6396 6347 5556 5296 5288 5267 5227 4932 3085 3028 2755 2366 2132 2085 1805 1363 1163 1046 1008 886 494 385 11641 67743 7716 5636 2490 1056 483 67858 5093 2845 2729 2715 1732
NM_014333chr1152774 2053 1797 1772 1745 ----1902
NM_014342chr1111075 --1946 21415 1206
NM_014363chr1341208 1071 991 976 11266 --31104 823 273
NM_014372chr161715 1546 629 599 492 451 --32048 1750 1473 --
NM_014381chr1482303 2272 2087 2005 1303 909 844 766 11054 21186 223 --
NM_014393chr872047 1789 1725 1543 550 421 110 11760 1440 21822 383
NM_014415chr381540 1127 624 606 504 293 231 67 11449 31456 365 335 1100
NM_014421chr462077 2004 1929 1788 804 501 ------
NM_014423chr5115436 5144 4790 3849 2138 1864 1812 1476 1462 745 575 55398 5270 5024 3837 3440 25212 1169 23526 423
NM_014426chr203727 624 535 ----1526
NM_014429chr32639 177 1519 1608 1615
NM_014445chr382439 2226 2079 2002 1979 1815 982 782 --21862 649 21802 415
NM_014447chr44483 469 296 40 11453 31630 402 373 --
NM_014458chr131332 1219 1052 --11316 11377
NM_014504chr732075 422 400 22016 1935 1494 11598
NM_014506chr971669 1621 1527 1043 640 380 105 ----11484
NM_014563chrX41897 1800 1730 219 12119 21792 142 --
NM_014572chr1321683 1482 --31614 1416 281 1579
NM_014574chr1431420 1083 591 --21194 995 1605
NM_014577chr228747 726 686 639 613 595 361 320 --2927 918 --
NM_014584chr1441596 1418 1337 135 --21449 522 31572 1509 107
NM_014585chr241088 956 902 866 2291 39 31131 515 417 --
NM_014606chr431508 1475 1185 ----11350
NM_014616chr353498 2861 615 457 308 13142 1833 12391
NM_014630chr1553531 3523 2654 2513 1292 23678 3612 --13549
NM_014636chr954314 3055 2964 1300 404 14027 13230 13242
NM_014674chr3123959 3866 3784 2881 2716 2500 1570 1120 720 596 392 308 --1841 13763
NM_014682chr862293 566 375 306 117 110 11977 --12069
NM_014701chr15123410 3377 3227 2826 2347 1302 1052 980 876 829 765 81 --22843 2181 23267 2424
NM_014702chr642857 2349 497 73 --43372 3366 2825 456 21191 732
NM_014705chr731738 1626 44 --11369 21568 290
NM_014707chr732205 2024 389 --51813 1564 1452 859 55 --
NM_014711chr16102073 1928 1679 779 769 739 439 309 206 73 --1248 12009
NM_014720chr1041798 1570 1394 332 --11835 11647
NM_014721chr6167467 7433 7169 6545 6126 5854 5591 5309 2501 2314 2264 1966 1893 1415 723 334 --11311 --
NM_014729chr832211 2113 2085 11649 1356 1858
NM_014733chr552229 738 711 262 214 41573 615 600 24 22245 757 --
NM_014739chr6114149 3456 3347 2839 2763 2644 1610 1413 407 262 112 43187 3172 934 213 23569 1661 --
NM_014743chr453028 2504 2252 755 334 --52928 2744 1258 1249 295 --
NM_014752chr1131431 548 225 11525 31831 1660 596 21546 308
NM_014755chr2104174 3765 2934 1425 938 694 611 509 333 120 --74281 2772 1162 1144 713 553 515 --
NM_014765chr142124 1958 954 733 22470 274 2878 864 --
NM_014774chr153072 2231 2086 392 232 --1355 13239
NM_014795chr22923 270 --3995 944 354 11109
NM_014803chr1062639 2330 1962 1088 801 781 12241 ----
NM_014810chr173708 3570 3403 3260 3150 3060 1120 --23253 2669 --
NM_014812chr191986 1953 1862 1843 1784 1509 1451 630 608 --1460 1573
NM_014820chr3102097 1572 1544 1434 1414 1388 766 385 183 134 --31874 1860 436 --
NM_014829chr561627 707 616 570 438 70 --32205 1547 607 1786
NM_014836chr1071830 729 655 647 615 406 295 1475 1354 --
NM_014839chr161624 987 818 423 348 261 1412 12221 22043 810
NM_014873chr1124608 4580 4497 4029 3862 1900 1113 1021 719 617 485 361 --44474 4330 3837 72 1650
NM_014877chr17147788 7643 7483 7009 6890 6878 6422 5502 5166 4803 2771 2610 637 565 66360 5126 2792 2567 2304 257 127224 6921 6819 5326 2944 2257 2251 1353 993 376 266 185 24981 4870
NM_014888chr761534 1452 1407 1046 976 477 ------
NM_014897chr17122783 2438 2274 1298 1010 968 955 755 693 287 254 236 22262 2104 1325 12352
NM_014900chr25441 433 265 176 169 1917 3958 837 359 --
NM_014901chr542010 1746 1558 1530 22161 1957 1767 11941
NM_014903chr1272429 2194 1557 904 722 658 339 12417 22238 217 --
NM_014904chr1073949 3886 3542 2775 1468 1149 957 42730 1442 1062 109 21270 450 24037 458
NM_014906chr17124009 3339 3214 3124 2921 1484 1212 1155 885 618 602 432 ------
NM_014912chr1073482 2772 2357 2189 269 225 157 11175 1905 33211 1345 1196
NM_014920chr6133678 3431 3339 2972 2786 2663 2345 1169 856 748 607 290 116 23463 613 13371 12939
NM_014923chr1351522 404 146 76 32 22347 902 11670 11815
NM_014932chr311553 1272 31519 1412 632 1443
NM_014934chr1364024 3993 3828 1116 1007 948 12895 31366 1000 419 1768
NM_014936chr672762 2662 2237 2135 1987 1949 898 --42704 2628 2563 472 22057 390
NM_014946chr262982 2921 1056 966 502 98 33095 2901 120 12939 --
NM_014947chr143168 2423 2375 1237 ----2342 262
NM_014950chr1431739 1202 1171 --2644 308 1398
NM_014953chr1343657 2798 980 766 13705 24135 3411 14004
NM_014961chr452064 1573 880 648 341 31727 1454 513 ----
NM_014982chr14155387 5278 4701 4659 4274 4194 2070 1913 1864 1336 1296 1208 1179 1102 569 14736 33871 3818 242 1614
NM_014988chr4102840 2823 2295 2089 2047 2000 1923 1785 715 389 --52274 2263 2015 1931 205 --
NM_014989chr651840 1612 1528 682 200 --31260 823 786 --
NM_014991chr493101 2948 2792 1312 1165 405 327 315 95 1969 1941 --
NM_014999chr1261565 1549 1501 1463 1281 131 1668 1632 1569
NM_015000chr1242369 633 573 228 42404 2094 995 761 1689 --
NM_015026chr1284702 4043 3475 3136 2949 1470 617 389 --54518 1630 1581 935 897 24086 3943
NM_015027chr1621431 1309 1640 --11320
NM_015032chr1392438 2388 2242 2086 1844 1084 1073 1036 665 --12127 --
NM_015040chr272912 2851 2748 2619 1315 480 175 1750 13347 --
NM_015042chr1533985 1375 501 --1618 23485 1143
NM_015049chr282972 2240 1167 1041 860 709 489 27 ----1944
NM_015055chr1152756 2607 2251 1870 59 22767 2430 22930 2481 --
NM_015068chr743966 3427 723 379 --12903 13016
NM_015071chr576481 5891 5459 4943 4258 2393 444 1974 66158 5831 1730 772 517 34 1551
NM_015074chr154734 3595 1894 671 644 13409 --14181
NM_015076chr684510 1766 1649 1544 687 638 547 413 34045 1012 134 44526 4325 3480 1324 14204
NM_015079chr1563220 2652 1022 809 376 284 --23186 2645 12700
NM_015087chr13112676 2616 2416 2010 1958 645 441 404 255 211 185 22140 1034 32106 888 325 11910
NM_015092chr1674366 4086 4048 1392 1315 1186 737 --24646 1092 13733
NM_015097chr342151 2143 1573 1561 12371 22285 791 --
NM_015100chr142040 1451 780 119 1520 --1566
NM_015110chr992267 2070 1698 826 808 794 423 327 52 12216 42540 1787 883 801 11711
NM_015115chr472835 2746 2705 2246 901 209 196 12292 23097 798 12392
NM_015130chr431329 1172 944 ----11063
NM_015137chr882591 2326 1969 1904 1897 1818 1017 755 --2911 734 --
NM_015141chr342741 2370 2218 129 11737 --22718 1781
NM_015156chr1453757 3648 3620 2909 604 22722 2602 22469 1452 --
NM_015172chr141254 539 192 151 ----21407 258
NM_015192chr20142768 2584 2366 2330 2265 2069 2003 1909 1188 1172 759 511 492 30 --22668 2308 --
NM_015199chr372994 2454 2296 703 675 263 172 --1661 --
NM_015200chr4122349 2247 2105 2044 1744 1677 1605 860 735 679 625 391 ----12472
NM_015208chr18142919 2632 2625 2558 1495 1323 1292 1282 1121 774 526 239 152 97 --21089 218 13319
NM_015215chr183005 2541 2348 2312 1067 653 383 196 --13174 --
NM_015225chr992946 2743 2463 1275 949 712 627 392 102 --22644 1069 23024 2265
NM_015247chr16185416 5041 5008 4885 4204 4183 4157 1976 1828 1463 1451 1378 1298 1259 824 525 194 53 --23296 1906 13934
NM_015265chr272337 2259 2042 2024 471 454 341 ----21811 436
NM_015269chr13473 199 94 ----1412
NM_015271chr484040 3567 1727 1696 1461 462 360 289 21156 408 23939 237 --
NM_015275chr1231544 1534 619 --41520 1496 872 631 1339
NM_015291chr183385 3241 3085 3034 2818 2419 1128 1089 13102 12206 --
NM_015310chr8218324 8305 8279 8103 7730 7573 7375 6876 6494 6029 5795 5520 5447 5368 5251 2981 2037 1685 1300 296 200 --38097 7624 439 12383
NM_015313chr11104718 4629 4009 3369 3351 1808 1682 1449 1156 896 --14856 --
NM_015314chr7102595 2402 1879 1679 937 724 690 401 286 83 --22434 502 --
NM_015317chr272570 1046 803 624 476 420 200 2978 700 ----
NM_015323chr62617 530 31658 1332 282 21576 1158 21130 400
NM_015326chr152428 1146 925 483 466 --22232 2021 1449
NM_015335chr1252654 2461 2069 884 333 ----22479 945
NM_015336chr12102567 2171 2009 1945 1876 741 687 664 418 132 12657 12553 11702
NM_015347chr1262999 2820 2773 1907 340 212 --1255 21176 320
NM_015355chr1791850 1744 1347 683 593 503 487 181 42 1580 31977 574 331 --
NM_015361chr27971 912 837 817 651 376 265 --2745 282 --
NM_015365chrX44193 762 749 229 --34175 3925 1067 23723 2958
NM_015387chr261803 1416 843 496 256 231 22120 1723 21637 798 --
NM_015435chr81595 1523 21425 477 2994 309
NM_015436chr483334 3154 3009 2685 539 524 410 297 13297 ----
NM_015446chr131057 422 408 11664 2322 193 41680 1635 215 94
NM_015455chr583692 3474 1658 1486 1427 620 224 196 13406 34038 4012 1009 23699 687
NM_015458chr854818 4327 3761 1015 83 --44221 915 647 251 --
NM_015520chr352725 2682 2649 2621 2129 --32525 2345 2103 --
NM_015525chr62967 859 1809 --2204 31
NM_015532chr15102460 2361 2253 1873 1054 1026 353 226 106 46 22859 2367 32836 1815 470 22289 1781
NM_015535chr254178 3530 3020 1227 223 22756 1365 33033 2692 1047 11442
NM_015553chr694913 4586 3259 3235 1653 1602 1033 71 29 11078 34189 981 837 --
NM_015554chr1582929 2860 2803 2754 2262 1981 543 163 22722 638 1392 22838 1826
NM_015564chr543510 656 291 211 21168 269 23031 844 150
NM_015565chr2141973 1867 1605 210 1225 1422 11848
NM_015571chr682512 1781 1775 1070 872 587 307 207 21001 666 41756 971 491 420 --
NM_015575chr263518 3081 1457 1248 565 539 13610 13572 13538
NM_015602chr151832 1659 1616 434 238 21674 127 31344 1288 681 --
NM_015640chr195188 5170 4619 4325 4132 3410 1877 848 682 1597 31726 716 60 35258 618 448
NM_015713chr893591 3322 2724 2543 2462 2442 2209 1174 1103 23310 2654 32861 2854 148 22831 155
NM_015866chr141305 1165 1054 49 --21522 1176 --
NM_015878chr841502 665 501 344 --11783 22256 325
NM_015879chr1888163 8002 7721 7135 6733 589 229 140 11768 25226 2756 1446
NM_015886chr8104906 4646 4258 3701 1959 1712 747 293 277 80 2651 479 --25544 380
NM_015888chr142700 2577 2185 1323 --1420 22415 627
NM_015891chr66682 261 196 183 163 94 --2738 56 --
NM_015892chr1051892 1777 965 863 60 ----12094
NM_015906chr164548 3739 3475 3163 213 144 13859 43925 3362 1257 516 34059 3940 3445
NM_015938chr33964 897 780 --4386 375 267 237 --
NM_015990chr421091 799 21051 762 31031 814 715 --
NM_016009chr184747 4614 4071 3990 3906 1786 1623 153 ----148
NM_016018chr842312 380 308 230 1783 22065 2003 11910
NM_016021chr692765 2066 2035 1952 855 842 237 179 81 --12572 --
NM_016023chr882176 2116 1831 1807 1594 1536 1372 108 12025 21392 827 --
NM_016037chr131145 1128 739 ----1213
NM_016040chr182745 2174 1904 1886 628 566 280 213 12047 --1498
NM_016072chr1292385 2221 1914 1804 1584 748 111 86 46 --12093 11753
NM_016075chr1363154 2881 2426 345 322 300 --12236 1546
NM_016076chr1113239 2051 1268 995 933 692 310 300 278 253 142 11155 23140 1127 --
NM_016078chr1731142 132 29 --21118 339 3798 401 319
NM_016081chr452147 1971 1745 877 725 --42137 1807 1564 738 --
NM_016083chr673852 2924 2762 2440 397 198 86 --13494 --
NM_016087chr741449 1363 1279 1121 11546 21157 225 --
NM_016090chr1151018 173 121 101 28 --1670 --
NM_016132chr1572941 2866 2706 2580 1085 788 369 ------
NM_016133chr231543 1369 1031 ----1215
NM_016138chr1641308 1301 479 60 --1292 1274
NM_016195chr107648 321 189 176 125 57 34 ------
NM_016206chr3218496 8474 7913 7697 6662 6598 6203 5802 5756 3610 3499 3447 3113 2702 2055 2013 1939 1865 1571 716 561 67288 6636 6224 5941 1337 917 66717 5999 5692 3403 1774 662 --
NM_016217chr662965 2937 2840 2262 1392 64 155 ----
NM_016224chr652229 1611 748 470 355 1348 1322 1306
NM_016248chr1383948 2953 2846 2777 2540 1609 1470 394 --13352 --
NM_016255chr693243 2987 2835 2310 2176 977 617 423 235 23054 859 --2985 947
NM_016260chr2167491 7239 6774 6513 6180 6013 5786 5606 5522 5277 2692 1569 1499 726 595 578 16652 36747 5955 4915 12785
NM_016275chr3112540 2424 2280 2222 944 798 715 521 512 469 418 --2400 33 --
NM_016277chr651433 1267 1154 1119 32 11112 1219 1629
NM_016289chr252116 2033 875 738 345 11580 --12204
NM_016316chr28725 266 252 232 217 169 96 63 ------
NM_016356chr6102944 2850 2489 2230 1159 740 714 655 255 200 --22299 1975 --
NM_016376chr1774127 1639 1562 1499 803 638 528 --34265 3830 1454 --
NM_016377chr651756 1546 1362 1108 518 1657 31490 719 347 11403
NM_016396chr1542466 2043 474 272 --62935 2870 1008 696 486 94 12010
NM_016422chr1153144 2490 2179 680 325 12026 33071 3049 827 12037
NM_016472chr1431258 1099 339 2563 71 31226 1074 525 1321
NM_016513chr6133678 3431 3339 2972 2786 2663 2345 1169 856 748 607 290 116 23463 613 13371 12939
NM_016530chr15124114 3837 3723 3434 3294 3182 3146 2834 2574 410 346 294 --1836 --
NM_016531chr453514 3449 3340 3290 1104 33750 2761 2559 33305 134 88 --
NM_016542chrX101666 1654 1631 1575 1543 1363 1265 1097 606 111 --2653 171 11382
NM_016587chr72994 368 --21136 163 234 24
NM_016599chr491458 1389 1254 1247 1143 1041 618 543 84 --1314 11396
NM_016603chr562242 1949 1916 1834 1429 598 11486 --11853
NM_016613chr462720 2575 2411 1761 918 558 --31968 690 219 --
NM_016620chr171260 1076 1039 581 397 331 88 1378 1965 1183
NM_016626chr1851471 1292 1274 475 435 11719 --1248
NM_016950chr451514 1431 603 441 46 21338 1136 2548 196 11467
NM_016952chr1173136 3094 1474 1027 1018 811 783 --33990 3468 170 1241
NM_017415chr594151 3932 3812 3646 3024 2973 1626 1344 976 14409 23731 3093 14277
NM_017420chr1473553 3377 3216 3068 1358 971 107 33585 2796 2376 33859 3052 2413 --
NM_017423chr472092 1796 1724 1640 192 161 48 12188 2448 229 --
NM_017437chr1472451 1603 922 376 260 162 122 --21742 350 11798
NM_017444chr861677 1239 546 452 432 328 --11247 --
NM_017447chr2174418 4331 4236 3792 3682 3068 458 --33501 495 418 34360 3047 2881
NM_017594chr983284 3197 2883 2437 1126 1014 489 112 23322 2667 23243 3214 --
NM_017599chr124677 452 121 44 11784 --11277
NM_017610chr1582078 1557 1521 1475 710 270 261 187 --31639 1571 244 21624 357
NM_017617chr981605 1526 1507 1217 339 311 173 113 --2585 199 --
NM_017628chr4115167 4614 4492 3934 3393 3292 2070 1082 458 106 53 --35127 3851 482 1655
NM_017633chr683912 3596 3120 2602 2388 1425 1032 793 12789 32670 1374 1072 11060
NM_017634chr871887 1640 1519 576 477 396 301 ----11433
NM_017637chr9168409 7707 6947 6561 3365 2709 2581 2516 2341 1691 1139 1001 762 609 602 216 22884 1167 49465 9071 8159 1938 39367 8372 5812
NM_017643chr1773129 2792 2428 2153 193 56 41 --22867 654 --
NM_017644chr3135228 5116 4995 4770 4742 4676 3343 1973 1482 1364 830 612 392 15143 44343 4330 4122 3611 14417
NM_017650chr775389 2279 2240 2218 2155 1811 1161 15109 45836 5600 4298 4165 15018
NM_017651chr661044 1000 389 274 263 248 --11036 --
NM_017657chr23756 681 377 --1191 1171
NM_017658chr14114559 4106 3613 3237 2887 1848 1738 1621 1481 1187 944 --44197 4156 2870 1018 23023 864
NM_017666chrX52167 2001 1891 361 289 --11659 --
NM_017694chr242097 1776 1577 1326 11319 1615 1591
NM_017709chr121341 429 --1642 24162 3956
NM_017719chr362164 2089 1808 1651 993 681 12243 21944 222 --
NM_017737chr151686 454 320 112 45 --22214 534 11740
NM_017740chr1641678 486 288 150 --21852 1170 2447 144
NM_017745chrX--199 2610 555 1122
NM_017752chrX52155 2022 1950 1799 1652 12075 21672 274 1381
NM_017753chr96821 806 799 770 327 102 --1781 --
NM_017754chr643583 1739 1714 1420 24874 1369 13622 1997
NM_017762chr1551957 1847 1644 1618 124 1730 199 --
NM_017768chr14981 925 788 668 --1187 1884
NM_017769chr14113275 3262 2890 2758 2617 2557 2365 2328 2307 2149 1305 41074 609 458 355 23201 558 22915 2067
NM_017813chr8155665 5501 5125 4842 4388 4177 4080 4060 2322 1735 1510 927 757 672 406 14639 23799 626 14046
NM_017824chr1072598 2517 2353 1866 884 847 821 21660 437 11073 1648
NM_017831chr18104351 4285 4271 3238 1284 1146 962 922 295 249 23259 862 34634 1374 189 --
NM_017848chrX104026 3934 3750 3253 1800 1660 1597 627 402 375 --13079 21000 963
NM_017890chr841800 692 612 507 11728 1268 11711
NM_017919chr995807 5337 5050 4947 4905 4424 3884 3777 1998 --35301 4400 1692 12159
NM_017935chr45767 503 493 248 223 ----1536
NM_017938chrX101981 1919 1859 1615 1510 760 647 397 266 111 --11726 --
NM_017945chr351227 1036 464 258 21 11343 21086 385 1121
NM_018003chr1592165 885 873 659 615 601 549 471 212 1841 ----
NM_018017chr1052407 736 460 298 148 22590 704 12568 --
NM_018018chr1241858 1235 1195 280 11436 31633 1530 381 --
NM_018027chr1083286 2900 2495 2380 2372 2149 1147 576 --13280 13038
NM_018030chr182891 307 1773 1696 1237
NM_018046chr551735 1630 395 268 142 11941 41958 1718 1382 620 --
NM_018084chr262912 2212 1005 955 663 613 --21143 437 --
NM_018085chr1138007 7591 7522 6475 5261 5116 2664 1415 919 902 865 611 55 16693 27166 381 --
NM_018092chr1631124 436 242 21627 470 1395 --
NM_018105chr83981 400 290 1103 31216 1009 192 11115
NM_018120chr83557 529 84 11204 31516 317 305 --
NM_018126chr431227 1026 979 --1358 2119 110
NM_018155chr353379 3261 2196 937 383 --12969 2834 336
NM_018181chr1861836 1359 1211 238 225 72 --11263 11904
NM_018211chr151941 1856 623 423 108 11691 3880 813 764 --
NM_018222chr1151557 1453 651 636 452 --21938 665 --
NM_018227chr473166 2631 2297 1091 687 582 247 ----12754
NM_018247chr663020 2547 2166 1977 761 343 --1729 11023
NM_018254chr172336 2158 1864 1755 954 908 188 32433 1843 639 32051 967 334 32272 2140 772
NM_018257chr2062271 1877 1781 1749 1031 827 1220 --1196
NM_018290chr451274 1190 514 118 28 --21045 436 31037 1028 305
NM_018293chr3102893 2270 2229 2145 1152 1139 806 389 282 237 12601 32887 2620 1120 22186 2120
NM_018313chr372690 909 849 778 424 182 110 --42607 2347 1648 472 4373 222 142 26
NM_018323chr491855 1711 1645 1348 1154 541 361 268 151 --11679 --
NM_018325chr951340 1287 366 234 181 11642 21521 334 --
NM_018351chr1284748 4704 4283 3137 897 699 621 345 13819 44215 3963 3662 3063 11890
NM_018361chr893935 3464 3376 3293 2727 2478 640 338 303 23404 2695 43902 3280 1174 595 --
NM_018362chr11123801 3766 3681 3567 2628 2606 1553 746 633 442 238 134 --1322 --
NM_018364chr153353 3178 1270 157 64 21612 1475 23389 1339 13877
NM_018367chr1172488 1803 1796 957 766 355 231 ----22439 994
NM_018372chr11576 --2240 185 1591
NM_018373chr1486494 6048 5960 2171 2002 1888 1639 1606 46228 4258 4203 236 36128 5974 2115 15726
NM_018374chr7194874 4531 4366 3987 3810 3750 3513 3284 2004 1166 1124 976 755 610 513 464 447 381 112 25001 4819 55050 4104 4044 1797 1242 24578 3740
NM_018388chrX31127 410 281 ----21084 503
NM_018394chr331220 549 303 1534 --2495 146
NM_018403chr354104 4060 4042 4023 3625 23173 1482 34097 3122 550 --
NM_018409chr493049 2656 1127 1096 904 167 119 86 62 1661 13226 --
NM_018416chr1252661 2074 739 579 237 21686 262 32626 2566 934 --
NM_018429chr562865 2559 1005 208 152 60 12897 22933 264 --
NM_018439chr1882529 2382 2238 1682 988 927 512 152 22463 43 ----
NM_018440chr8178647 7477 6871 6634 6115 5243 3356 2946 2431 2400 2287 2119 2010 1571 1487 1160 1072 --28731 8604 --
NM_018452chr6_random63452 2860 2710 543 346 318 13321 13768 --
NM_018477chr143945 869 372 --3991 219 135 1926
NM_018482chr8122073 2040 1913 1898 1670 1008 833 645 604 494 313 250 12281 ----
NM_018490chr1161702 1670 1636 580 313 50 --11535 11525
NM_018557chr271718 1544 1472 1294 1186 694 227 --2610 319 --
NM_018566chr1104680 4569 4555 4432 3955 3494 3355 1056 672 180 --23531 605 --
NM_018569chr451635 1607 1058 561 267 --21402 575 --
NM_018590chr1051592 1185 667 321 305 11129 --11522
NM_018638chr12104587 4200 3556 1801 1722 1395 1089 979 795 119 44608 4169 1626 1106 45663 5412 3944 3527 13981
NM_018640chr1242464 702 380 129 12006 12813 12311
NM_018650chr152273 2170 1932 620 456 --22012 369 12183
NM_018695chr592322 2280 2249 1660 1623 916 887 692 668 ----21868 88
NM_018698chrX1309 2517 207 1197 1490
NM_018710chr871365 1127 958 932 351 274 169 --4863 387 381 234 --
NM_018841chr1103293 3093 3002 2762 2683 1555 1063 765 406 398 23043 292 13718 12797
NM_018844chr751789 740 584 491 332 22090 697 11752 1238
NM_018847chr92449 23 2475 249 --21966 1479
NM_018939chr52399 63 ----2221 115
NM_018945chr643107 952 729 418 12441 32500 774 533 --
NM_018948chr141431 1326 1280 530 2278 33 --1263
NM_018970chr793093 2503 2178 2021 1226 1161 728 451 141 12301 32879 1065 722 --
NM_018981chr251196 1082 212 194 78 --11004 1960
NM_018993chr2051463 1259 497 455 223 ----1478
NM_018999chr1093986 3352 3226 3039 1707 1408 321 232 55 33132 1386 1371 54474 1651 1397 889 664 13918
NM_019001chr3144760 4723 4578 4110 3742 3412 3382 1709 1286 1211 411 388 263 53 11811 34691 1269 1081 11169
NM_019004chr772302 2258 2206 1918 1592 927 595 --11998 22341 770
NM_019018chr5----1645 2580 552
NM_019022chr1893061 2623 2537 2499 2093 2035 596 585 88 --52224 2017 1269 421 265 2810 521
NM_019027chr442577 2417 2153 866 11003 12541 32134 1018 144
NM_019050chr442243 2149 1767 669 130 32125 1620 876 --
NM_019067chrX64637 4477 4122 3418 3347 552 24464 1922 23605 1807 13326
NM_019071chr72731 498 ----2124 53
NM_019072chr574183 3978 3892 3656 1294 1188 242 --13426 --
NM_019080chr1331511 1320 207 1479 21251 549 1242
NM_019083chr141104 438 222 57 --21631 65 --
NM_019084chr102929 795 --32155 2088 1691 2905 607
NM_019091chr24914 869 186 107 --21164 727 1175
NM_019094chr1263485 2949 2519 1109 813 472 --42865 2819 2379 133 --
NM_019114chr962011 1943 1628 843 661 447 1533 --2928 790
NM_019117chrX42354 1021 618 521 1192 23202 2161 12616
NM_019555chr361840 1523 1350 1182 593 565 --157 1324
NM_019556chrX41229 1148 1015 184 --31006 922 244 --
NM_019593chr2083109 2564 2044 1245 806 444 331 205 1711 43156 2495 636 502 --
NM_019600chr154638 544 265 45 --3808 729 523 --
NM_020116chr471845 1548 1377 455 180 72 38 --194 --
NM_020119chr743157 2570 721 52 --21599 90 12686
NM_020122chr296002 5260 4571 2198 1996 1677 1344 385 116 15944 21896 931 --
NM_020123chr1041429 1306 1075 380 --11058 1502
NM_020141chr172366 2269 2120 2061 2015 1886 904 22219 287 1803 --
NM_020143chr271130 857 385 371 353 331 56 1274 1340 --
NM_020159chr461668 1280 241 123 108 98 1482 2387 66 --
NM_020177chr5153395 3115 3042 2983 2788 2296 2234 2200 2099 2067 1198 503 349 325 150 12045 ----
NM_020182chr2053646 3441 3105 616 364 2846 399 1148 1599
NM_020193chr114996 499 437 237 --21340 474 21206 952
NM_020198chr1761478 1462 1103 353 242 163 11437 ----
NM_020245chr665124 4624 4471 582 491 423 14943 54997 4615 1912 1828 1595 --
NM_020337chr4123165 3030 2845 2589 2547 2492 2101 2005 1219 1170 611 439 12145 11970 12279
NM_020342chr242352 1957 1900 1879 --22053 53 21715 608
NM_020357chr351486 1473 1295 1019 545 1285 --1182
NM_020390chr344289 3195 597 146 1434 64786 4332 3104 3076 1372 833 13673
NM_020432chr772316 2049 1825 1776 685 400 148 1550 4754 195 177 122 --
NM_020440chr183319 3297 2970 2615 2085 517 320 294 ----12729
NM_020443chr186642 6079 5035 4492 4339 1643 1468 1058 15606 16755 --
NM_020452chr162170 2134 2073 1939 1884 1351 32010 1988 406 ----
NM_020466chr694678 3982 3452 3348 3315 3080 1704 1558 51 23157 840 198 --
NM_020473chrX81924 1859 1756 1647 508 418 386 290 --1432 --
NM_020640chr342114 405 252 223 --11600 22043 715
NM_020647chr882272 2056 2037 2011 1554 1482 1471 723 --32122 1776 1524 --
NM_020654chr361144 519 440 324 235 111 21417 1081 31646 1362 1220 --
NM_020673chr20177798 7723 7652 7567 7507 7321 6411 5909 5751 4784 3030 2864 2672 2140 1881 1498 505 --15810 --
NM_020718chr16106233 5070 4794 4674 4468 4166 1324 1261 960 857 26564 1106 56526 6518 6128 5374 4598 --
NM_020727chr2183849 3321 2934 2830 780 729 622 447 --22879 461 1969
NM_020728chr762968 985 666 364 131 91 1737 1374 1321
NM_020734chr1243401 2062 1080 184 22316 1058 21065 636 12843
NM_020739chr15114183 3926 3909 3812 3701 3648 2784 1595 1352 1249 1117 --43417 2945 560 268 --
NM_020747chr53930 817 56 ----1188
NM_020751chr1341268 1258 1229 318 21373 1306 ----
NM_020752chr10102624 2575 2559 2421 2305 2060 854 831 572 358 --22951 483 1759
NM_020760chr271728 1722 1678 1640 691 586 578 ------
NM_020766chrX94354 3548 1807 1781 1516 892 801 353 134 11179 13689 1299
NM_020768chr523200 2999 1269 2508 472 12545
NM_020771chr671523 1481 1463 1336 1270 377 126 --2426 408 1602
NM_020772chr17168139 7982 7436 7124 7100 6831 6618 6452 6356 5637 2667 2216 1936 1786 1279 1164 37298 5370 748 48523 6437 5728 591 11487
NM_020774chr18185716 5546 4932 4802 4726 2432 2326 2077 1681 1569 1488 1365 1075 933 790 781 382 295 14837 1610 11379
NM_020779chr2123042 2066 1022 939 758 673 634 548 408 272 135 121 22907 980 --1873
NM_020782chr1264181 4170 1587 1531 647 530 31868 711 611 24563 1823 --
NM_020794chr141384 1292 573 62 11425 21442 622 21409 387
NM_020801chr582512 2504 2146 1728 660 614 343 325 12205 ----
NM_020802chr1173393 3353 3328 703 575 341 334 --12094 --
NM_020803chr482023 1997 1912 1869 827 708 685 208 1726 1534 --
NM_020810chr1493519 2935 2883 2412 2229 493 212 123 38 --1703 2651 345
NM_020819chr661123 821 338 323 105 66 --3966 132 116 --
NM_020830chr253041 2623 2492 2269 974 --22498 2107 --
NM_020841chr1284006 3672 3245 2938 2853 854 683 514 --53649 3345 3288 2676 1251 43485 2901 1240 622
NM_020844chr8157611 7341 6867 6473 6113 5265 5043 5023 1822 1369 1014 897 566 379 107 25586 4896 47367 6967 6479 80 --
NM_020854chr1841388 1345 142 108 11096 --21579 268
NM_020858chr1572321 1960 1886 1831 1598 1478 644 --1671 --
NM_020859chr463106 2609 1181 777 647 564 11576 22576 481 11536
NM_020871chrX62435 2335 1869 627 439 136 1609 4986 575 510 338 --
NM_020872chr351824 1485 1443 1321 582 1223 21430 336 1216
NM_020909chr2104049 3942 3406 3271 2815 1636 1621 1259 528 236 --34118 4034 634 --
NM_020917chr193580 401 331 --22788 103 23145 2678
NM_020921chr1483640 2519 2482 2399 2380 1467 1262 1004 42880 2512 998 427 13559 --
NM_020935chr274597 3801 3728 3443 2874 1437 586 1752 23139 682 --
NM_020940chr1082810 2717 2657 1967 863 850 439 337 --42948 2104 1047 964 --
NM_020948chr183460 3106 2691 2448 2299 1470 691 160 13046 33213 1115 1013 21437 549
NM_020951chr1961994 1940 890 597 429 263 --11496 --
NM_020964chr1863027 1500 1457 1304 843 705 --2232 46 14784
NM_021007chr282102 2042 1939 865 453 393 114 42 ----1760
NM_021032chr351886 1730 1653 500 490 1397 11440 --
NM_021033chr1362721 2526 1360 917 898 778 22865 1187 11321 --
NM_021069chr432137 785 500 --3798 676 436 11406
NM_021072chr53829 498 228 22349 2108 12138 32314 2180 2043
NM_021083chrX63390 3089 2782 2439 1314 136 --12623 --
NM_021097chr252761 2684 2544 2336 222 --1923 130
NM_021111chr951217 876 422 408 181 --41405 1194 550 260 11055
NM_021116chr799064 8541 8283 6824 5647 3433 2747 1720 1082 28192 5699 1911 --
NM_021120chrX12544 1542 --2519 494
NM_021127chr1841285 1239 1078 470 21117 1071 ----
NM_021140chrX1771 1920 1299 1931
NM_021148chr762491 2426 2389 2371 514 122 21966 1598 41684 1678 711 415 22030 562
NM_021163chr793691 3144 2565 2510 2338 1215 703 392 240 13795 --43820 3664 281 224
NM_021183chrX82274 2028 1877 1735 757 257 83 57 --21614 530 --
NM_021191chr1252401 2236 1793 193 180 1291 2975 368 --
NM_021252chr10112015 1555 1460 1442 1422 1336 541 235 191 134 98 127 31731 261 114 11393
NM_021255chr1464096 3771 3226 2658 344 183 --24031 1429 --
NM_021572chr651113 908 419 299 100 1122 --125
NM_021622chr10102163 2026 2007 1956 1820 1799 1578 493 406 133 --32360 1564 816 1565
NM_021629chr3104782 4727 4650 4420 3719 2017 1339 1097 943 86 14394 44513 4280 1683 327 11020
NM_021645chr1372212 2039 1933 1703 676 345 106 12241 22393 2302 12002
NM_021647chr4154768 4350 4256 3931 3135 3111 1893 1863 1845 1670 1170 879 606 459 423 --23688 3089 13129
NM_021813chr685535 5508 4644 4463 3739 1789 1223 412 1434 11073 --
NM_021814chr631594 1560 1442 1172 11526 11608
NM_021815chr233121 2417 29 --32710 2221 298 1954
NM_021818chr1411379 --21385 129 21514 493
NM_021911chr595442 5300 4481 2013 1902 1262 1202 924 227 12025 25238 4453 14203
NM_021912chr1552714 1617 264 202 74 ----11015
NM_021914chr1472295 2285 1829 1806 887 395 256 ----1204
NM_021950chr1151683 1441 864 777 156 --42227 673 441 126 --
NM_021954chr13143673 3617 3256 3072 2931 2844 2775 2762 2716 2360 1409 1113 563 523 11010 23488 3418 12723
NM_021960chr162472 1926 1026 782 708 546 --22202 751 --
NM_021961chr11177402 7250 7212 7061 6206 6168 5441 4720 4524 2443 2057 1794 904 883 838 388 379 --26314 911 --
NM_021964chr3186255 5913 5835 5696 5428 4854 4648 4494 4470 2310 1825 1479 1292 1214 828 422 208 193 22003 1165 45505 4593 1519 559 34529 2429 900
NM_021998chrX31325 1063 253 --31235 464 116 --
NM_022048chr1596155 5675 5658 5333 4782 4474 4087 814 284 --22290 1820 --
NM_022058chr281857 1660 1601 1371 1344 1321 672 497 11952 1623 1120
NM_022080chr2072807 2566 2516 2380 836 688 451 1104 3789 783 373 11116
NM_022114chr1124771 4627 4619 4378 4200 3848 3398 1682 905 631 581 418 --21688 555 --
NM_022118chr13--2466 250 2566 185 176
NM_022121chr64974 311 267 249 11149 1762 --
NM_022130chr531078 928 118 ----21161 455
NM_022133chr871860 1255 1175 694 378 354 208 11675 41832 506 498 411 21215 134
NM_022166chr1696245 6157 6133 5441 5308 2450 2290 1633 352 --25477 1594 --
NM_022351chr863859 3618 3459 3171 3163 2530 --43342 3148 820 519 11551
NM_022456chr12137669 7025 6862 6104 5521 5041 4991 4669 2389 2210 1093 232 118 1988 26821 668 --
NM_022459chr13156307 6268 6142 5409 5110 4848 4689 4570 2137 1674 1613 1541 1358 1294 634 24337 1521 25035 1882 --
NM_022465chr122521 298 --32586 869 454 12506
NM_022475chr43755 631 271 2729 223 --1737
NM_022716chr143133 1018 720 467 1946 --2975 967
NM_022763chr383136 2525 2097 916 865 839 316 114 --32403 1957 360 22833 102
NM_022771chr1251015 903 228 148 136 ----1698
NM_022781chr92333 129 1375 32455 2164 950 32885 2243 2146
NM_022782chr126345 322 145 114 91 39 --1256 --
NM_022824chr531889 1331 1275 1655 21550 371 21948 143
NM_022841chr1542173 671 547 227 --42804 1835 1111 657 22496 2455
NM_022843chr134375 259 139 108 --51514 1413 1354 1247 1020 --
NM_022845chr1682154 2146 1748 1495 591 535 490 163 21688 1606 1527 139
NM_022893chr252746 924 525 296 290 12160 32784 2293 333 --
NM_022918chr1132004 1898 405 31731 282 245 2871 841 --
NM_022977chrX72657 2141 1990 1878 1628 981 356 22171 562 11038 1183
NM_023000chr1451669 1501 1373 669 616 --11219 11346
NM_023001chr1451669 1501 1373 669 616 --11219 11346
NM_023016chr231105 484 379 --32531 2014 490 12774
NM_023039chr53424 177 154 ----1350
NM_023074chr1951351 1023 910 422 104 2937 848 3961 842 134 --
NM_023929chr872448 1969 974 615 319 265 213 22219 2072 32816 2094 169 --
NM_024094chr85843 665 569 188 41 --1284 --
NM_024345chr995525 5351 4812 4519 4387 3921 2326 1312 213 --35536 1965 274 15872
NM_024408chr143727 3079 2862 483 --33208 2321 1373 12899
NM_024416chr931563 1154 243 1155 --1277
NM_024511chr472949 2679 2634 1131 1103 132 30 1255 ----
NM_024524chr352959 2666 2628 2617 2282 22238 242 53099 3074 2038 622 290 1406
NM_024582chr43969 885 384 --31056 893 391 --
NM_024583chr251046 911 883 386 247 4932 859 303 88 1341 --
NM_024584chr251071 987 956 466 360 1969 11180 --
NM_024590chr441904 1227 771 747 --41768 1732 1696 1294 1558
NM_024611chr1542944 2505 2479 355 --1267 1461
NM_024613chr871886 1869 1349 1195 708 513 210 --21840 1368 1722
NM_024624chr271316 1030 647 530 407 380 266 --11684 1124
NM_024636chr792936 2882 2749 2472 2070 1947 752 619 601 11819 22813 907 --
NM_024641chr6122999 2822 2488 2425 1850 748 688 341 289 236 139 111 22373 619 32229 1112 347 21185 1157
NM_024646chr1123894 3608 3228 3073 3041 1457 1214 693 456 408 352 298 --13553 --
NM_024665chr3104341 4028 3208 3044 1800 1519 1435 1186 1149 384 13684 54673 4075 1613 1535 539 --
NM_024670chr1051413 497 249 209 113 --11463 --
NM_024692chr271623 1505 1405 1336 319 291 153 --31764 1233 501 11808
NM_024700chr1--11055 31170 911 794 1386
NM_024713chr1541039 339 274 62 11017 1660 11455
NM_024721chr842211 2172 686 548 12402 11802 12489
NM_024725chr112645 259 1245 --1826
NM_024740chr11104161 3935 2707 1524 1165 1082 1063 936 675 219 14154 24148 3690 --
NM_024744chr2122222 2121 2028 1908 1838 1804 1007 937 834 587 498 26 12469 31775 1027 538 12662
NM_024745chr1641019 178 147 41 --21111 101 1448
NM_024749chr151994 1913 1522 1467 788 12024 2503 272 --
NM_024751chr452135 1713 371 217 186 --21592 433 21882 1455
NM_024761chr975330 5022 4484 3628 3336 2134 768 --11950 25192 4221
NM_024763chr141027 433 372 175 2441 72 11098 --
NM_024770chr276017 6006 5231 1244 332 267 235 46566 5681 2329 2307 24826 4463 --
NM_024817chr1555428 5088 4809 1688 174 15770 24089 3761 15198
NM_024828chr941106 438 391 88 11148 1177 11008
NM_024913chr741409 1132 653 624 --21389 1367 21416 1356
NM_024930chr562830 2714 2685 2324 880 769 22595 2220 11965 --
NM_024947chr3159624 9072 7052 6826 6628 6087 5819 2262 2229 1884 1769 1542 1480 221 213 29094 1958 99580 9571 9245 9112 2963 2825 1969 1313 354 --
NM_024949chr424301 1931 21628 1527 3803 591 191 13402
NM_024953chr1272626 2615 2434 2409 2230 710 226 ----12819
NM_024979chr1331576 585 412 --1506 1568
NM_024989chr2228007 7776 7724 7704 7369 7216 6811 6567 5655 5303 5270 2975 2696 2660 2627 1973 1450 802 558 464 344 120 37194 6598 1830 67985 7409 6605 6393 5402 1167 26252 5943
NM_025054chr883451 3398 3381 2863 1538 1294 820 119 --21664 1603 22985 1683
NM_025073chr1124694 4582 4354 4335 3697 3146 1744 1150 869 853 543 322 --23468 1757 3950 344 262
NM_025134chr1692444 2384 1817 1636 1627 475 389 364 309 32299 1797 1646 32033 616 156 --
NM_025151chr832032 1959 1689 1449 --12198
NM_025160chr184003 3028 2700 1089 696 603 506 158 --24248 3668 13072
NM_025179chr164922 4798 3995 3323 1171 713 24955 4749 23498 314 1491
NM_025184chrX6766 712 362 238 176 160 --2604 106 --
NM_025191chr183327 3299 3089 2979 2797 2629 2470 843 ----12620
NM_025208chr1172280 2208 1975 1921 828 213 22 3521 334 239 ----
NM_025222chr331019 915 522 --1120 22973 1042
NM_025235chr1092117 2099 1933 1800 1692 1544 527 484 374 --71842 1836 1764 1510 552 441 284 --
NM_030621chr14114179 3945 3646 3632 3487 3148 2853 2815 1451 1144 1050 23982 646 73811 3711 3573 3171 1649 1383 727 --
NM_030627chr5144105 4091 3747 3723 3432 3117 3104 3006 2946 2930 2884 2858 1217 221 24018 2741 13691 1930
NM_030647chr7136130 5286 5131 4815 4736 2115 1702 1519 979 761 699 633 481 15632 22146 873 1615
NM_030648chr4125076 4819 4461 3536 2030 1961 1735 1727 1696 1333 885 594 1410 55439 3853 2185 799 623 --
NM_030650chr293635 3332 3256 3231 767 661 459 190 36 1158 33281 701 491 --
NM_030664chr1042171 757 661 568 1733 22157 2090 --
NM_030674chr12104710 4566 4460 2146 2105 1978 1843 458 91 83 --45104 4901 1075 1035 --
NM_030751chr1061873 1605 1554 1271 566 428 --21391 1370 --
NM_030751chr1061873 1605 1554 1271 566 428 --21391 1370 --
NM_030755chr1472688 2123 1979 1078 684 547 320 12713 51120 994 956 845 304 --
NM_030758chr221907 ----21290 984
NM_030777chr2092487 2471 2401 2333 2317 1614 1598 1550 268 ------
NM_030786chr171763 1455 1171 763 495 443 434 ------
NM_030791chr1451539 1363 688 556 96 3329 311 276 11339 --
NM_030799chr552140 2115 813 224 160 --1109 22202 173
NM_030806chr189424 9397 8467 7968 5857 2829 318 71 29385 1783 28442 846 --
NM_030816chr172953 2657 2249 1166 606 454 308 --33201 1025 612 --
NM_030918chr184183 2137 1425 1383 1300 1170 931 644 11210 45195 4408 4065 438 --
NM_030920chr141360 351 315 114 11794 11989 --
NM_030945chr582366 2318 2180 1902 1873 742 395 316 --2764 92 12523
NM_030954chr81607 1270 --1290
NM_031216chr1872218 1924 696 663 463 428 46 1741 ----
NM_031268chr1655242 4728 3906 3820 1608 35267 5084 585 13742 --
NM_031296chr452748 2435 2271 2171 2045 --11967 12365
NM_031362chr272818 2796 2747 2612 1017 944 194 1710 22739 1750 --
NM_031365chr272954 2932 2883 2748 1153 1080 330 1846 32875 1886 1845 --
NM_031366chr272954 2932 2883 2748 1153 1080 330 1846 32875 1886 1845 --
NM_031418chr11102513 2480 2320 2243 1952 1936 934 840 680 505 22529 792 32451 2437 579 12146
NM_031419chr361473 1116 645 510 151 86 1140 --21283 199
NM_031427chr14105877 5631 5513 5310 5080 4790 3935 2033 819 788 41398 1350 258 197 1645 21440 66
NM_031435chr12143410 3311 3047 3013 2713 2669 2566 2512 1301 957 773 466 357 198 13482 12239 --
NM_031442chrX63147 2521 2308 1186 813 54 12037 1170 11240
NM_031445chr243189 3142 2114 1076 13126 12977 12649
NM_031461chr82831 302 1270 --21688 561
NM_031483chr20113577 3519 2744 2690 2346 2242 1021 989 685 571 43 12461 33247 1260 962 --
NM_031844chr173279 1530 1520 1341 1043 673 451 14059 22970 934 21378 1110
NM_031845chr293692 3658 3363 1121 551 288 195 91 79 --2261 218 12306
NM_031847chr293692 3658 3363 1121 551 288 195 91 79 --2261 218 12306
NM_032012chr9195016 4884 4773 4657 4627 4571 4386 4274 4183 3508 3386 3268 3211 1096 1028 1015 659 331 266 35104 325 138 55278 1086 1076 1009 591 --
NM_032021chr112998 974 191 --2949 917
NM_032025chr351268 652 449 383 190 1761 1183 --
NM_032041chr832683 914 630 ----21740 947
NM_032042chr572878 2815 2245 2092 2014 2005 721 12591 1151 --
NM_032047chr342345 1937 1577 948 --52319 1623 682 619 225 1874
NM_032102chr1173068 2951 2553 1989 968 914 239 --22493 154 --
NM_032105chr178111 7620 7085 5756 3006 2926 1072 28029 5786 32677 838 521 --
NM_032144chr241773 1450 369 56 --21216 50 --
NM_032145chr671801 1791 1700 1366 688 396 148 2765 528 ----
NM_032147chr123811 143 112 --2243 122 2321 38
NM_032160chr1861701 1043 1024 271 133 26 --24166 4153 24077 3235
NM_032186chr171260 1076 1039 581 397 331 88 1378 1965 1183
NM_032189chr1395089 5007 4592 4400 4303 3800 1891 1767 517 --22013 1918 14618
NM_032199chr1053822 3564 3185 790 674 13684 33721 2734 1163 1586
NM_032217chr431400 1274 127 --11002 21317 400
NM_032228chr1153058 2651 2247 984 898 --33283 3081 2422 11122
NM_032268chr162367 305 22824 320 --1894
NM_032303chr961759 1480 1400 468 257 93 1456 1227 1431
NM_032321chr2103048 2810 2760 2676 1035 929 735 679 651 376 23015 2227 22428 2337 --
NM_032373chr10135736 4478 1951 1899 1746 1463 1321 1287 1214 1168 852 434 153 35943 4434 2256 14909 23813 2171
NM_032410chr831257 1139 1035 1476 31173 1055 353 --
NM_032435chr162417 2205 1660 1560 463 325 --12009 12387
NM_032438chr641654 1274 623 531 --31567 1505 133 1406
NM_032439chr1051444 1202 1143 614 588 21259 304 1501 --
NM_032440chr1082875 1052 914 597 591 584 346 112 2851 168 2220 122 --
NM_032446chr5133874 3564 3432 3360 3171 3045 3035 3014 2916 2527 1195 923 602 11149 43857 3134 1089 373 12935
NM_032457chr463134 2675 1263 969 742 209 22508 781 23108 33 13863
NM_032458chrX63364 2841 2591 719 545 274 43426 2221 532 156 32709 2095 308 11235
NM_032485chr201614 1717 1641 1667
NM_032499chr1581679 1613 1336 1275 1223 609 466 262 11294 11740 --
NM_032505chr361895 1853 1055 939 253 105 22241 2045 62775 2445 2322 2028 1862 476 --
NM_032509chr81208 11654 12513 1826
NM_032521chr2073226 3115 2947 2574 2526 2280 231 1327 33096 3075 2421 --
NM_032558chr971495 1359 1313 1232 1148 204 181 --11157 --
NM_032590chr1281016 879 824 460 453 246 122 55 1866 ----
NM_032682chr393004 2941 2913 2859 2794 1317 1238 1053 444 --23575 3156 12851
NM_032778chr363255 3073 2525 2075 731 405 --2668 35 --
NM_032833chr192696 2647 2634 2393 1916 845 344 307 143 ------
NM_032859chr13133936 3865 3714 3659 3297 3100 2826 2437 981 938 541 137 24 13016 63924 3603 3141 1164 492 160 12935
NM_032873chr1194336 4123 3837 3213 3195 3041 978 940 906 --33698 1791 1440 --
NM_032961chr461298 976 539 444 259 39 --2399 313 11117
NM_032968chrX74247 4016 3632 3553 3051 2915 1428 11668 33611 3569 227 13137
NM_032969chrX74247 4016 3632 3553 3051 2915 1428 11668 33611 3569 227 13137
NM_032973chrY74239 4008 3624 3549 3046 2910 1428 11662 33603 3565 227 13132
NM_032975chr18103583 3369 3139 3118 3071 1237 931 469 445 418 1848 ----
NM_032980chr18103583 3369 3139 3118 3071 1237 931 469 445 418 1848 ----
NM_033014chr931563 1154 243 1155 --1277
NM_033020chr164548 3739 3475 3163 213 144 13859 43925 3362 1257 516 34059 3940 3445
NM_033055chr141030 974 922 873 1774 --1728
NM_033081chr2061423 1252 1161 1082 376 166 --21408 1065 1582
NM_033083chr333103 611 248 13147 13369 11138
NM_033132chr1382150 2126 1939 1843 1831 1655 837 681 11822 21981 1802 --
NM_033135chr1172280 2208 1975 1921 828 213 22 3521 334 239 ----
NM_033138chr772204 2144 1840 759 585 419 205 21975 1433 1838 --
NM_033139chr772204 2144 1840 759 585 419 205 21975 1433 1838 --
NM_033140chr772204 2144 1840 759 585 419 205 21975 1433 1838 --
NM_033143chr4114051 3781 3763 3437 3255 1734 1674 1524 1182 864 651 13527 54180 3181 1824 967 894 --
NM_033157chr772204 2144 1840 759 585 419 205 21975 1433 1838 --
NM_033181chr673852 2924 2762 2440 397 198 86 --13494 --
NM_033211chr55715 656 521 509 105 --1369 --
NM_033224chr7118054 8040 7536 6989 6467 6072 2448 2272 1395 523 386 11747 56362 5752 2817 815 666 --
NM_033225chr8103008 2702 2046 1182 1118 1019 718 707 655 603 --1890 --
NM_033285chr8154452 4318 4305 4112 3845 3471 2930 2800 2752 1660 1512 739 464 91 46 13214 63773 3331 2903 1795 919 160 13041
NM_033290chrX73563 3480 1226 833 325 290 241 12707 22414 1316 --
NM_033331chr963579 3404 3308 3023 613 424 ----13517
NM_033360chr1294572 3766 3679 2975 2852 1751 1436 912 716 23542 1487 44317 3972 1767 895 11779
NM_033394chr251510 1365 640 431 215 11359 41309 1239 1139 1039 1467
NM_033425chr1173541 3406 3358 3333 3162 3036 942 --13046 21410 1233
NM_033429chr1573136 2669 2578 2541 2282 721 573 --11188 --
NM_033430chr473926 3529 3161 2672 453 132 32 2977 179 13814 --
NM_033437chr473926 3529 3161 2672 453 132 32 2977 179 13814 --
NM_033480chr692979 2967 2871 2657 2564 2554 2419 2274 453 --2808 33 --
NM_033481chr692979 2967 2871 2657 2564 2554 2419 2274 453 --2808 33 --
NM_033505chr264411 4139 1901 1485 276 194 22577 1876 16558 --
NM_033656chr21105918 4700 4544 3834 1977 1935 1175 663 425 163 12177 1108 24995 1318
NM_052832chr8112981 2610 2571 2499 2008 1985 1942 806 501 372 70 --23021 2951 12351
NM_052879chr1273842 3486 3433 3058 2828 1205 285 11554 33910 3533 1395 12492
NM_052885chr12114133 3806 3773 3759 3735 1856 1370 1192 387 324 207 34698 950 370 44498 4224 3868 697 14914
NM_052886chr832150 1676 596 21765 669 2208 52 --
NM_052900chr841726 1321 325 193 ----21153 284
NM_052907chr1273831 3479 3287 3016 954 579 489 23867 3408 11536 1481
NM_052927chr541577 1489 723 197 21625 1607 --1284
NM_052937chr882749 2667 2412 2365 2291 2126 581 181 22074 362 3726 713 390 1334
NM_053016chr9197626 7501 7239 6238 6075 6041 5762 5420 5256 5238 5169 5068 2516 1836 1782 1713 1494 1061 934 42885 2379 2093 549 2856 443 44909 2654 2123 723
NM_053024chr361555 1480 1232 1206 1088 300 --21222 533 --
NM_053042chr462852 2774 1970 741 473 363 32984 2407 2155 ----
NM_053056chr1192757 2524 2447 2066 1120 873 612 591 299 12486 31215 409 325 1246
NM_053064chr1442946 2864 793 772 --42614 2330 2195 2047 --
NM_057159chr941420 1141 1112 1054 1507 --21025 375
NM_057168chr741449 1363 1279 1121 11546 21157 225 --
NM_058170chr151429 640 300 276 202 --1471 --
NM_058241chr272329 2150 1867 1793 1648 460 394 11768 1414 1814
NM_058241chr272329 2150 1867 1793 1648 460 394 11768 1414 1814
NM_078476chr621777 1745 11765 21795 1759 --
NM_080546chr962325 2242 1704 846 727 236 11899 --12308
NM_080597chr182891 307 1773 1696 1237
NM_080683chr43370 206 177 ----1497
NM_080684chr43370 206 177 ----1497
NM_080685chr43370 206 177 ----1497
NM_080759chr1331727 522 45 12005 22549 1960 1637
NM_080760chr1331727 522 45 12005 22549 1960 1637
NM_080867chr14104761 4582 3512 3410 3086 1823 918 297 272 251 1442 14133 --
NM_080872chr873099 3090 2944 2692 1533 843 112 1196 23130 1280 1153
NM_080874chr481896 1800 1568 1434 1288 763 333 206 --11536 --
NM_080927chr382720 2301 2274 2188 1027 936 861 702 193 32728 2348 1074 12217
NM_130391chr993533 3493 3361 3002 2445 915 771 713 251 1611 22946 1400 --
NM_130392chr993533 3493 3361 3002 2445 915 771 713 251 1611 22946 1400 --
NM_130393chr993533 3493 3361 3002 2445 915 771 713 251 1611 22946 1400 --
NM_130435chr1062831 2781 2569 2483 1080 552 --1527 --
NM_130436chr2152204 2096 905 680 40 --12024 22384 375
NM_130438chr2172781 2673 2099 1257 617 480 82 --12601 22961 952
NM_130809chr572529 1088 665 384 279 253 195 32863 1195 1106 11016 --
NM_133334chr485506 5368 5330 4486 4356 2459 593 309 --21485 775 36286 4545 2346
NM_133370chr463050 1336 1300 1001 932 70 --11384 --
NM_133372chr552522 1004 789 776 451 12549 12601 22794 826
NM_133433chr54741 703 678 28 --2669 247 --
NM_133443chr1662022 1827 1818 1781 1753 297 --11704 --
NM_133468chr742089 1865 191 159 --2734 168 --
NM_133473chr1961818 1257 1242 655 412 328 11917 ----
NM_133477chr493273 3045 2449 2290 2257 2165 1269 1262 493 --32967 287 267 --
NM_133496chr1134458 4129 3884 3770 3657 3522 3427 3356 3228 1719 1460 1345 1221 24252 1608 44204 3606 3584 846 --
NM_133631chr341348 603 372 356 --1321 11609
NM_133638chr561217 1008 537 184 50 42 199 1212 --
NM_133646chr285596 5474 5245 5098 4476 3432 967 373 11369 35286 5183 132 14492
NM_133647chr1543137 3062 2877 2430 --23092 541 13817
NM_138270chrX73442 3129 2742 1252 1132 955 729 12799 23222 2165 43431 2846 389 374
NM_138286chr19103051 2914 2821 2769 2703 1065 1014 926 745 549 --33821 3781 448 33418 2999 2724
NM_138288chr1462193 1709 1577 1496 866 858 1752 ----
NM_138335chr42715 642 --2578 163 1876
NM_138348chr5156637 6110 5626 5282 5067 4870 4565 4457 2635 2526 2015 1444 913 655 620 14141 --24898 1962
NM_138391chr13711 627 184 --1211 1657
NM_138423chr1572220 2193 2095 1972 1816 395 337 --31949 894 246 --
NM_138426chr762455 2190 1845 790 649 397 12071 ----
NM_138444chr1384569 4433 3888 3360 1999 1672 1154 493 11241 14772 13218
NM_138468chr276345 5727 4653 2030 1330 193 47 1959 44669 1309 838 383 1969
NM_138473chr1221885 1471 1420 21201 523 23721 3524
NM_138554chr922514 2216 --21847 658 1636
NM_138621chr244192 4097 692 679 --1296 1671
NM_138633chr651756 1546 1362 1108 518 1657 31490 719 347 11403
NM_138635chr762964 2293 1161 1092 1069 219 13080 1869 --
NM_138638chr1472295 2285 1829 1806 887 395 256 ----1204
NM_138694chr683042 1242 782 635 618 544 379 199 ------
NM_138713chr16178083 7626 7384 7267 7194 5942 5554 5051 3074 2971 2533 2458 1814 1660 1295 1250 1200 27429 2797 78171 6844 6605 5009 3138 1930 208 35247 2042 852
NM_138714chr16178083 7626 7384 7267 7194 5942 5554 5051 3074 2971 2533 2458 1814 1660 1295 1250 1200 27429 2797 78171 6844 6605 5009 3138 1930 208 35247 2042 852
NM_138731chr1484097 3589 3499 3278 3094 1528 1257 607 23967 3418 23320 266 23527 3235
NM_138771chr761480 999 559 99 67 45 11005 --11067
NM_138782chr571918 1856 1530 1511 894 883 687 32216 1587 752 42117 1770 741 593 32394 1740 1601
NM_138959chr1166809 6793 6632 6571 6026 6016 4584 2720 2567 2556 2549 2356 2338 2321 1791 574 16129 36312 4987 2252 12188
NM_138970chr1432244 2137 1909 --22411 1680 21584 920
NM_139035chrX2748 290 1274 2513 322 1283
NM_139279chr253274 3036 2894 2246 379 129 --13545
NM_139283chr1272230 1982 1947 1934 1770 1668 450 --22105 2017 --
NM_139321chr2053964 3954 925 856 372 ----2849 208
NM_144570chr1632377 2014 1147 --22134 719 11035
NM_144571chr4157038 5443 4641 4619 4470 4348 4244 1787 879 743 599 488 458 370 206 12006 36068 1419 249 26221 692
NM_144599chr15105434 5423 5207 5200 4373 4347 1530 1117 1024 350 --34868 4813 454 --
NM_144632chr272228 2068 2050 2040 1966 1938 839 22203 651 32352 2000 1679 --
NM_144664chr11102462 2235 2218 1847 1038 840 708 556 369 99 --21907 475 --
NM_144726chr551119 988 914 242 193 --21030 221 --
NM_144778chr1382338 2325 2251 1786 1711 783 758 706 11768 22413 1099 --
NM_144949chr262491 2307 2100 994 552 536 11659 12270 --
NM_144963chr872713 2222 602 296 269 248 63 1864 62415 2208 717 681 371 333 --
NM_144973chr12115356 5170 4708 4563 4446 4213 3601 2061 1272 724 250 14617 24506 1115 23689 554
NM_145055chr1863137 2860 1100 688 630 536 13767 23692 2695 --
NM_145165chr143705 552 45 11058 12569 1101
NM_145207chr465133 4437 4335 4056 1463 353 --45109 4366 2075 867 --
NM_145251chr1481406 581 471 453 399 381 244 111 ------
NM_145259chr2127023 6902 6825 6490 6209 5795 5771 2777 2583 2119 858 651 12688 25765 2822 --
NM_145263chr482384 1912 1544 855 592 398 202 186 1805 --1574
NM_145284chrX42232 863 482 103 12459 12072 12304
NM_145305chrX51328 1047 953 275 239 ----11253
NM_145307chr10104389 3812 3762 3533 1427 1103 528 185 148 106 186 44439 3576 3469 716 24085 3567
NM_145686chr263357 3135 3118 2876 1282 563 22954 166 22233 1005 --
NM_145687chr263357 3135 3118 2876 1282 563 22954 166 22233 1005 --
NM_145698chr1092049 2030 859 848 646 635 380 160 102 --21820 467 --
NM_145735chr1352748 2517 1011 346 261 22788 1915 32854 2813 2250 12595
NM_145759chr13592 578 435 --41720 232 224 166 11380
NM_145808chr752536 2289 1253 1150 686 11166 22905 2460 21982 768
NM_147128chr741175 1093 1083 21 ----11043
NM_147147chr694178 4123 4111 4048 3740 3727 2866 1644 1046 13197 33357 3145 3092 --
NM_147189chr862188 2164 2064 2029 1633 131 --41716 534 316 264 --
NM_148174chr841502 665 501 344 --11783 22256 325
NM_148894chr441142 939 431 160 --21225 1156 11249
NM_148955chr15136422 6338 6253 5786 5744 2474 2453 2163 1919 1891 1786 1519 47 32539 1625 827 36514 2316 1854 36452 6440 1534
NM_148957chr13112637 2593 2582 2256 2218 2212 899 874 826 378 93 --31910 1879 793 12625
NM_152227chr203727 624 535 ----1526
NM_152265chr141559 1275 174 69 --2398 168 11592
NM_152275chr232147 717 679 143 2364 86 12274
NM_152282chr361388 1276 1240 1230 964 303 ----11254
NM_152284chr86913 756 648 612 105 98 ------
NM_152309chr1042210 825 356 86 12224 11416 11376
NM_152330chr1472330 2236 982 756 725 331 122 22459 2343 12541 174
NM_152352chr1873045 2629 2547 2082 1989 1036 538 12126 32655 2649 2643 --
NM_152400chr461793 1625 1614 849 254 137 31952 800 63 --11539
NM_152409chr583203 3065 2756 2383 1284 753 736 715 13262 53505 3431 3307 829 514 --
NM_152424chrX53555 3416 1275 832 641 24088 326 43492 3485 3476 1571 --
NM_152510chr22----1263 2793 341
NM_152519chr252222 2190 1780 1760 676 ----1384
NM_152529chr233879 2992 2980 2955 332 44326 3671 1084 175 1681
NM_152538chr361837 1763 1353 1305 750 107 1460 21233 539 --
NM_152551chr653001 2982 2949 2657 214 2627 616 1932 182
NM_152556chr772104 2031 949 855 782 583 123 1173 12145 22080 102
NM_152564chr841800 692 612 507 11728 1268 11711
NM_152594chr1542347 2066 720 218 1542 52239 1704 1698 710 510 31907 1591 846
NM_152608chr182277 2174 2087 1644 997 337 48 32 --22248 651 1831
NM_152622chr5103417 3192 2589 2560 2302 1396 1354 1023 615 459 --1947 169
NM_152624chr5157198 6122 5352 4987 2650 2568 2555 1736 1659 1322 919 680 193 166 138 11073 36539 2716 880 --
NM_152626chr761122 975 912 812 805 216 --2259 134 1766
NM_152629chr994138 3354 2960 2829 2646 777 731 641 170 33910 3531 3008 44074 1119 619 592 12624
NM_152636chr1152964 2748 1139 963 54 --2868 703 11962
NM_152641chr1262901 2623 2552 2499 2352 1093 22737 1116 1414 --
NM_152678chr342686 2505 2349 547 --12151 12254
NM_152682chr471578 1135 589 513 256 128 99 --11608 --
NM_152734chr685499 4019 3581 3325 2011 1769 933 551 24702 627 33951 3747 124 --
NM_152754chr793769 3637 3484 3173 3074 2998 1198 1082 245 --22824 2461 13337
NM_152756chr593918 3793 1652 1216 1082 937 790 773 561 1632 64178 4141 3682 3238 3104 1064 13125
NM_152758chr892938 2728 2254 1950 1937 971 811 583 29 11149 22919 1982 12841
NM_152774chr772253 1983 1728 1076 623 603 325 --3596 93 87 --
NM_152787chrX43339 1008 951 832 11086 23603 2763 13216
NM_152789chr721241 398 --11350 11359
NM_152793chr774332 3448 2045 1908 1723 1296 759 --44478 3604 3584 84 --
NM_152826chr15136422 6338 6253 5786 5744 2474 2453 2163 1919 1891 1786 1519 47 32539 1625 827 36514 2316 1854 36452 6440 1534
NM_152836chr871860 1255 1175 694 378 354 208 11675 41832 506 498 411 21215 134
NM_152837chr871860 1255 1175 694 378 354 208 11675 41832 506 498 411 21215 134
NM_152838chr2093522 3137 2908 2162 1349 986 312 154 21 23166 111 12325 --
NM_152866chr1151683 1441 864 777 156 --42227 673 441 126 --
NM_152999chr7144633 4360 4284 4276 3243 1717 1624 1512 1018 829 609 565 333 242 --33973 3822 270 --
NM_153013chr552546 1599 978 965 417 --32514 233 134 --
NM_153020chr6101700 1540 1522 1308 1076 440 420 348 320 150 --11458 --
NM_153042chr641794 1276 207 75 --1333 1464
NM_153182chr363255 3073 2525 2075 731 405 --2668 35 --
NM_153184chr371621 1575 1248 1233 463 313 298 --11333 --
NM_153188chr5165276 5003 4516 4305 4092 3847 3569 2231 2192 2063 1968 1618 1283 1090 935 97 54666 4636 3674 1687 1241 75643 3493 1989 1936 1915 772 516 14570
NM_153207chr1293596 3238 3181 3105 1535 1456 903 615 556 11065 63851 3414 2580 1122 366 302 13435
NM_153223chr571472 1348 627 479 250 112 22 11237 1203 1210
NM_153235chr641672 477 428 180 --1266 32436 522 43
NM_153240chr341138 209 151 24 ----11188
NM_153261chr1661092 621 479 326 313 250 ----11620
NM_153262chr152572 1266 1243 888 397 --22784 1045 13169
NM_153267chr94783 752 144 100 ----2225 184
NM_153321chr1751090 807 754 194 181 --21076 290 1208
NM_153322chr1751090 807 754 194 181 --21076 290 1208
NM_153332chr893024 2981 2401 2370 2266 2179 1187 880 255 1223 33217 1181 481 1954
NM_153346chrX71873 1700 1527 1426 643 540 519 --31383 1322 109 --
NM_153365chr462579 2549 2247 1964 1896 766 12464 22452 2241 --
NM_153371chr1372164 2104 1753 1588 810 178 29 12090 1226 --
NM_153456chr1346063 4143 304 199 --36137 4371 4115 14774
NM_153607chr592674 2479 2386 2341 974 964 177 119 107 --42841 2681 2546 79 12629
NM_153616chr1572321 1960 1886 1831 1598 1478 644 --1671 --
NM_153617chr1572321 1960 1886 1831 1598 1478 644 --1671 --
NM_153618chr1572321 1960 1886 1831 1598 1478 644 --1671 --
NM_153619chr1563559 3198 3124 3069 2836 2716 12691 ----
NM_153634chr1251402 1305 1140 416 186 11471 21126 384 --
NM_153686chr452479 1554 607 325 144 1467 5707 175 166 153 112 --
NM_153689chr262273 2075 1810 1652 1541 1489 ----11804
NM_153831chr83841 808 266 ----1801
NM_170672chr221568 389 --2617 319 1293
NM_170709chr832133 1716 312 --32148 200 110 --
NM_170710chr4113048 2893 2719 2590 2529 2262 796 719 482 471 207 33135 2156 653 23180 2935 --
NM_170725chr13632 43 29 --3217 211 201 --
NM_170731chr115686 300 223 130 30 --1404 22774 2245
NM_170732chr115686 300 223 130 30 --1404 22774 2245
NM_170733chr115686 300 223 130 30 --1404 22774 2245
NM_170734chr115686 300 223 130 30 --1404 22774 2245
NM_170735chr115686 300 223 130 30 --1404 22774 2245
NM_170751chr651433 1271 1042 929 227 1235 11363 --
NM_170752chr651433 1271 1042 929 227 1235 11363 --
NM_172070chr252195 2058 2045 1424 21 --31663 869 391 11532
NM_172071chr146739 6684 5662 2668 44562 1771 394 328 87485 7274 6052 5023 4682 2056 1425 749 21760 1646
NM_172159chr341981 1528 907 236 --12237 1562
NM_172160chr341981 1528 907 236 --12237 1562
NM_172193chr1441181 846 351 61 1293 31294 976 184 --
NM_172373chr132221 56 11107 21062 301 1368
NM_173082chr661361 1167 1050 267 252 213 11529 41208 1139 491 99 --
NM_173083chr14885 867 817 181 1230 31256 1133 239 164
NM_173177chr21219 1213 --1258
NM_173198chr963012 2727 2508 2275 1052 861 --22256 214 11967
NM_173200chr963012 2727 2508 2275 1052 861 --22256 214 11967
NM_173214chr16178083 7626 7384 7267 7194 5942 5554 5051 3074 2971 2533 2458 1814 1660 1295 1250 1200 27429 2797 78171 6844 6605 5009 3138 1930 208 35247 2042 852
NM_173468chr4166100 6074 5731 5321 5068 4912 4524 4423 4376 3872 2276 1808 1288 724 634 70 1780 1615 --
NM_173470chrX41031 394 342 184 1740 22819 97 1148
NM_173475chr165709 565 525 241 109 --11273 1485
NM_173496chr1062997 2920 2840 1220 1091 151 31159 693 521 12327 1901
NM_173511chr2103749 3655 3480 3267 3049 3029 2639 2581 446 429 --13325 --
NM_173519chr861914 1865 1783 1748 1402 571 --21480 1284 --
NM_173531chr19153800 2891 2827 2745 2686 2630 2566 1378 1303 1151 971 961 834 772 384 13903 32913 1078 672 11344
NM_173536chr4114449 3215 3168 1788 1624 1350 1096 764 668 650 262 24699 1052 35005 3734 184 --
NM_173545chr23504 138 33 31407 464 314 21698 748 --
NM_173552chr3132468 2309 2134 1864 1784 1768 1550 702 671 624 419 382 100 --32324 1969 351 --
NM_173570chr352170 2092 2009 677 250 11954 12158 12105
NM_173582chr11136257 5828 5724 4914 4346 4249 2172 2089 1218 1174 1009 777 503 25809 395 24906 2239 13880
NM_173602chr124762 553 265 254 --12548 1512
NM_173607chr1452112 1740 1489 1390 555 11776 1100 1437
NM_173642chr1158735 8338 7555 7508 7040 6814 6727 6067 2667 1776 1413 1337 675 176 93 ----12004
NM_173644chr2041857 1653 691 436 --21988 684 11827
NM_173654chr351776 1717 876 229 213 --32383 2042 1608 12217
NM_173694chrX82475 2356 1965 1885 1575 974 903 253 1868 12500 11772
NM_173698chrX71781 1751 1742 1680 762 743 649 --31551 1323 466 11332
NM_173808chr1114394 3177 2709 1683 1632 1572 1509 1348 429 338 112 23074 1190 12972 11138
NM_173826chr32643 612 21745 1635 51459 1427 488 375 172 195
NM_173829chr5126177 5672 5199 5060 4994 4930 4745 4134 1143 938 786 91 --25383 1179 15416
NM_173851chr843825 3574 2786 1451 32499 1284 196 --1646
NM_174921chr46730 475 415 238 222 198 ----1361
NM_174978chr142697 133 1768 2120 62 --
NM_175056chr3112157 2080 2052 2023 1899 1807 1573 1502 393 358 169 --11476 --
NM_175607chr361444 1151 464 298 265 31 1284 11175 1254
NM_175612chr361444 1151 464 298 265 31 1284 11175 1254
NM_175623chr12137669 7025 6862 6104 5521 5041 4991 4669 2389 2210 1093 232 118 1988 26821 668 --
NM_175624chr12137764 7120 6957 6199 5616 5136 5086 4764 2484 2305 1188 327 213 11083 26916 763 --
NM_175625chr12137764 7120 6957 6199 5616 5136 5086 4764 2484 2305 1188 327 213 11083 26916 763 --
NM_175736chr1267601 7553 5912 5158 5108 376 15422 36841 6728 5644 --
NM_175854chr1351938 1081 1041 957 367 --52319 2167 2144 1854 770 12221
NM_175876chr132324 1994 1831 149 265 59 --
NM_175921chr5114191 3899 3756 3591 3583 3212 2928 2694 916 603 283 23415 170 13886 33836 3032 1728
NM_176787chr1851594 1188 511 211 190 --11001 11029
NM_176816chr561535 1265 533 525 512 504 --140 --
NM_176824chr441346 1190 1069 360 11305 1110 21076 384
NM_177414chr111605 11416 11524 11403
NM_177438chr14114179 3945 3646 3632 3487 3148 2853 2815 1451 1144 1050 23982 646 73811 3711 3573 3171 1649 1383 727 --
NM_177538chr268699 8272 3349 1132 331 81 --27656 5697 47690 5673 2192 148
NM_177968chr261869 1775 776 720 451 238 --21507 803 --
NM_177969chr23215 189 117 --2521 514 2153 74
NM_177974chr1572220 2193 2095 1972 1816 395 337 --31949 894 246 --
NM_177985chr252121 2110 1728 595 92 --11673 12231
NM_178011chr1073076 2721 2190 2109 949 394 374 1647 22093 1294 12954
NM_178151chrX177862 7228 6522 6506 5856 4790 3124 2516 1413 1241 1204 1006 955 930 816 681 307 --36663 6015 5557 27183 363
NM_178152chrX177862 7228 6522 6506 5856 4790 3124 2516 1413 1241 1204 1006 955 930 816 681 307 --36663 6015 5557 27183 363
NM_178153chrX177862 7228 6522 6506 5856 4790 3124 2516 1413 1241 1204 1006 955 930 816 681 307 --36663 6015 5557 27183 363
NM_178313chr261992 1608 615 381 255 240 --1132 --
NM_178509chr17104131 4024 3225 3167 3095 1189 533 347 258 227 --43717 3499 1259 420 13062
NM_178558chr741258 807 275 129 --2504 113 --
NM_178585chr493101 2948 2792 1312 1165 405 327 315 95 1969 1941 --
NM_178812chr871406 1103 1039 651 569 294 33 --11577 2476 98
NM_178815chr1062638 2077 2043 906 863 97 --42600 2531 2058 615 --
NM_180989chr1331989 1828 821 --12153 22038 131
NM_180991chr5112867 2508 2489 2476 2352 2300 1927 1136 125 108 27 3922 848 774 21002 371 22441 2340
NM_181054chr1421293 384 --2301 214 1802
NM_181265chr4113048 2893 2719 2590 2529 2262 796 719 482 471 207 33135 2156 653 23180 2935 --
NM_181351chr1181953 881 864 728 649 603 469 202 --23003 680 --
NM_181358chr1144200 4005 3862 3851 2700 1663 1635 1553 1477 1088 905 883 620 486 21152 634 --23792 1254
NM_181361chr351337 1086 1080 1058 122 ------
NM_181457chr221363 913 1147 1919 11037
NM_181458chr221496 1046 1280 11052 11170
NM_181459chr221262 812 146 1818 1936
NM_181460chr221309 859 193 1865 1983
NM_181481chr18175999 5904 5882 5638 5448 5410 5286 5151 4549 2028 2016 1657 1590 609 376 345 162 76888 4789 4765 2621 1608 754 410 2790 626 --
NM_181482chr18175999 5904 5882 5638 5448 5410 5286 5151 4549 2028 2016 1657 1590 609 376 345 162 76888 4789 4765 2621 1608 754 410 2790 626 --
NM_181483chr18175999 5904 5882 5638 5448 5410 5286 5151 4549 2028 2016 1657 1590 609 376 345 162 76888 4789 4765 2621 1608 754 410 2790 626 --
NM_181504chr563945 2991 2534 1350 1330 1016 --24001 2573 --
NM_181521chr16126237 6156 5994 5752 5384 2461 1872 1801 1385 1311 1244 1015 --12196 --
NM_181523chr563945 2991 2534 1350 1330 1016 --24001 2573 --
NM_181524chr563945 2991 2534 1350 1330 1016 --24001 2573 --
NM_181659chr2083090 3059 2830 2767 2380 1047 805 642 --23314 2473 12439
NM_181659chr2083090 3059 2830 2767 2380 1047 805 642 --23314 2473 12439
NM_181672chrX31613 543 534 --1369 11830
NM_181673chrX31613 543 534 --1369 11830
NM_181705chr595626 5592 5493 5350 4828 3661 1022 380 338 25191 2222 --15222
NM_181706chr1172400 1913 1515 352 228 186 109 --21975 194 --
NM_181723chr862317 2309 2187 2051 1800 465 1204 21474 571 --
NM_181782chr632096 928 277 --21823 633 32155 1781 624
NM_181783chr1251538 1356 1309 470 245 21492 1434 --11969
NM_181787chr883489 1539 1277 1217 1042 462 244 77 21344 526 13623 --
NM_181836chr5102550 2314 2034 1697 1649 856 796 780 663 579 --21712 264 --
NM_181861chr1272781 2698 2641 2145 466 115 86 --22729 2094 --
NM_181868chr1272781 2698 2641 2145 466 115 86 --22729 2094 --
NM_181869chr1282866 2783 2726 2230 551 200 171 72 --22814 2179 165
NM_182314chrX61751 1628 1408 1251 677 568 --2396 71 --
NM_182485chr483023 2845 2616 1438 1349 1167 919 880 33016 2325 1328 33709 3494 264 12804
NM_182487chr964419 3677 3311 3045 988 52 ----12855
NM_182503chr6185184 5147 4739 4381 3682 3588 1566 1508 1430 1298 1227 1132 1028 915 738 547 519 434 13835 11267 195
NM_182515chr1995470 4889 2665 2573 1543 1530 1343 1096 233 --45640 5500 5365 1247 12238
NM_182522chr381239 1217 1014 856 537 463 340 84 ----11153
NM_182551chr273121 3065 2616 2282 892 744 136 --23112 83 --
NM_182646chr483023 2845 2616 1438 1349 1167 919 880 33016 2325 1328 33709 3494 264 12804
NM_182715chr751272 1078 849 334 291 1444 21186 483 1144
NM_182734chr20123015 2831 2613 2577 2512 2316 2250 2156 1006 758 739 277 --22915 2555 --
NM_182757chr643412 3093 2553 40 11106 11233 21378 1099
NM_182758chr1583929 3912 3476 3332 2728 2476 1504 920 23427 359 23399 899 13539
NM_182762chr785787 5767 5603 5489 5379 1136 398 175 24330 1160 86210 4568 4486 4473 3906 3833 3798 2292 15065
NM_182763chr162461 1915 1015 771 697 535 --22191 740 --
NM_182765chr1082095 2049 930 900 718 660 620 483 --22299 31 22145 253
NM_182767chr1241612 1388 798 372 11776 21941 183 --
NM_182802chr201614 1717 1641 1667
NM_182830chr1482305 1804 1686 1608 1410 899 798 704 --22299 668 --
NM_182848chr1331444 1226 221 2170 158 11063 1252
NM_182896chr371796 555 375 354 269 151 110 11492 31857 435 296 11689
NM_182898chr7196449 5756 5739 5713 4994 4949 4830 4820 4765 4058 2251 1928 1910 1100 1024 693 263 159 132 1171 26521 4667 25461 2035
NM_182899chr7196449 5756 5739 5713 4994 4949 4830 4820 4765 4058 2251 1928 1910 1100 1024 693 263 159 132 1171 26521 4667 25461 2035
NM_182907chr6112389 2260 2208 1947 1940 1553 1524 1512 1471 414 243 1231 1889 22379 302
NM_182918chr2151399 1381 1302 1204 411 11189 --11178
NM_182972chr172811 2756 2598 2527 2041 1784 1767 1755 11896 --
NM_182976chr14755 521 199 103 --134 1134
NM_183004chr1463836 2998 744 269 217 119 --22690 996 --
NM_183043chr131377 1111 1764 2997 167
NM_183044chr131377 1111 1764 2997 167
NM_183050chr642415 2169 949 178 --52228 1650 718 510 193 --
NM_183078chr673097 2783 2691 2513 2430 1431 1423 12910 21453 759 11474
NM_183227chr651433 1267 1154 1119 32 11112 1219 1629
NM_183234chr1551511 1276 384 370 287 ----11671
NM_183235chr1551511 1276 384 370 287 ----11671
NM_183236chr1551511 1276 384 370 287 ----11671
NM_183416chr141981 1594 626 323 --4738 583 128 104 --
NM_183419chr81595 1523 21425 477 2994 309
NM_194071chr785070 4706 4394 4370 4342 4165 3332 1246 15277 24983 47 --
NM_194247chr274426 4116 3493 3456 640 315 210 24028 2808 ----
NM_194282chr452372 1245 932 321 304 2427 230 42397 2287 2260 2163 11949
NM_194283chr594206 4049 3910 3783 3435 3233 762 303 107 --34199 3630 688 --
NM_194285chr1193413 3306 2652 2428 2291 835 521 137 96 --1782 13394
NM_194291chr892983 2928 2831 2536 1161 1061 737 488 376 --2960 261 --
NM_194292chr161702 1660 1188 697 239 156 ----11529
NM_194314chr1225573 5528 5400 5371 5185 5091 5011 4986 4622 4152 3879 3787 3434 2212 1815 1800 1592 1420 505 463 266 39 34965 1980 1059 11070 44120 4068 3516 2041
NM_194317chr252604 2205 1905 1715 639 --12113 11852
NM_194318chr1332048 1802 1032 12071 12331 12039
NM_194328chr92333 129 1375 32455 2164 950 32885 2243 2146
NM_194329chr92333 129 1375 32455 2164 950 32885 2243 2146
NM_194330chr92333 129 1375 32455 2164 950 32885 2243 2146
NM_194332chr92333 129 1375 32455 2164 950 32885 2243 2146
NM_194356chr1262259 2141 2114 2070 941 867 12394 12309 --
NM_194434chr18125805 5401 5364 4084 4052 2265 2118 1738 1562 1452 1151 699 24565 1791 35067 4812 3549 --
NM_194442chr121757 53 1471 21100 233 11376
NM_194454chr741366 1117 578 431 --11380 1485
NM_194455chr741366 1117 578 431 --11380 1485
NM_194456chr741366 1117 578 431 --11380 1485
NM_198087chr1681416 1409 1377 1337 1163 1022 594 250 11460 11436 --
NM_198088chr1681416 1409 1377 1337 1163 1022 594 250 11460 11436 --
NM_198123chr841726 1321 325 193 ----21153 284
NM_198124chr841726 1321 325 193 ----21153 284
NM_198158chr361983 1085 1018 529 463 189 11208 12152 --
NM_198159chr361983 1085 1018 529 463 189 11208 12152 --
NM_198177chr361983 1085 1018 529 463 189 11208 12152 --
NM_198178chr361983 1085 1018 529 463 189 11208 12152 --
NM_198181chr1562078 234 204 174 146 116 --1906 --
NM_198212chr752019 1987 1623 642 251 ----1394
NM_198215chr1051449 1360 1352 1258 1034 1157 ----
NM_198225chr1071830 729 655 647 615 406 295 1475 1354 --
NM_198268chr1144200 4005 3862 3851 2700 1663 1635 1553 1477 1088 905 883 620 486 21152 634 --23792 1254
NM_198269chr1144200 4005 3862 3851 2700 1663 1635 1553 1477 1088 905 883 620 486 21152 634 --23792 1254
NM_198270chrX83264 2967 2935 2393 2133 1262 542 244 12821 43355 2687 992 404 --
NM_198273chr573064 2678 2459 879 735 545 65 62172 2149 2116 969 857 831 42928 2381 2281 1088 --
NM_198279chrX5994 824 437 224 158 2875 351 2395 330 --
NM_198281chr483335 2917 1243 663 623 597 236 37 ----23221 724
NM_198336chr751773 1708 1504 1418 1187 11478 31844 1195 502 --
NM_198400chr1572770 967 949 916 717 191 45 --11001 --
NM_198401chr84618 424 382 197 --21622 120 11775
NM_198468chr6124530 4484 4407 3972 3517 3364 3207 3196 1446 1311 389 211 34618 4070 1062 43804 639 507 133 24578 4248
NM_198503chr192399 2097 2005 1734 954 624 429 407 269 --32050 1920 1640 11927
NM_198513chr852055 1974 1870 1847 1607 --31755 625 380 --
NM_198549chr1112803 2593 2450 2364 2264 1309 1302 1204 346 252 157 22334 2273 42777 2254 1318 211 --
NM_198578chr1251441 510 463 299 210 --11293 11086
NM_198581chr2146801 6723 6076 6029 4579 2412 2386 2123 1991 1879 1198 1183 739 183 17494 86944 6220 5637 2167 1908 790 694 342 1172
NM_198584chr8102574 1774 964 828 810 800 776 688 509 107 11969 ----
NM_198793chr3114077 3812 3784 3626 3292 3056 2544 1544 1405 1080 142 13961 13846 23742 2724
NM_198794chr1451405 1184 555 204 114 --2428 362 --
NM_198859chr3104487 4140 3915 3589 2046 1993 1498 598 506 198 --1403 14183
NM_198889chr431400 1274 127 --11002 21317 400
NM_198896chr1152080 1917 1593 520 206 --1200 --
NM_198900chr1267601 7553 5912 5158 5108 376 15422 36841 6728 5644 --
NM_198904chr562134 1808 1691 1524 311 141 12046 ----
NM_198935chr2052437 2405 2358 2158 1034 1557 21097 948 11073
NM_198968chr1364024 3993 3828 1116 1007 948 12895 31366 1000 419 1768
NM_199003chr831265 957 574 1387 31500 1293 476 11399
NM_199039chr421091 799 21051 762 31031 814 715 --
NM_199040chr1263485 2949 2519 1109 813 472 --42865 2819 2379 133 --
NM_199072chr793164 2710 2463 2243 2233 2104 2035 208 106 12212 33090 2844 2380 12269
NM_199132chr1952143 2113 1919 1887 131 --11878 1284
NM_199168chr1061466 1331 1278 1196 213 185 --11240 11213
NM_199169chr2053646 3441 3105 616 364 2846 399 1148 1599
NM_199170chr2053646 3441 3105 616 364 2846 399 1148 1599
NM_199171chr2053646 3441 3105 616 364 2846 399 1148 1599
NM_199188chr1273842 3486 3433 3058 2828 1205 285 11554 33910 3533 1395 12492
NM_199190chr1273842 3486 3433 3058 2828 1205 285 11554 33910 3533 1395 12492
NM_199320chr492957 2864 2678 2112 2017 1069 496 320 187 --32812 2466 468 11919
NM_199320chr492957 2864 2678 2112 2017 1069 496 320 187 --32812 2466 468 11919
NM_199324chr4113426 2474 1288 1170 1147 1114 1006 999 375 339 279 23744 703 43596 2319 1402 1196 --
NM_199355chr1641800 1791 265 256 ----21630 1315
NM_199421chr14104761 4582 3512 3410 3086 1823 918 297 272 251 1442 14133 --
NM_199436chr262982 2921 1056 966 502 98 33095 2901 120 12939 --
NM_199454chr1124771 4627 4619 4378 4200 3848 3398 1682 905 631 581 418 --21688 555 --
NM_199461chr1053042 2719 2710 818 225 ----13227
NM_199482chr261803 1416 843 496 256 231 22120 1723 21637 798 --
NM_201269chr171260 1076 1039 581 397 331 88 1378 1965 1183
NM_201559chr664552 1941 1723 1359 998 115 1577 --11493
NM_203301chr1461490 1469 1196 686 363 117 3526 127 34 31558 1459 402 1620
NM_203354chr141607 1233 --1256
NM_203355chr141607 1233 --1256
NM_203356chr141607 1233 --1256
NM_203372chr231536 1295 1172 --1313 1613
NM_203382chr551609 588 435 70 58 ----11285
NM_203390chr841631 1587 603 593 11744 21166 339 21711 1640
NM_203391chrX31796 1767 112 --21506 703 144
NM_203394chr1292736 2437 1742 1690 1668 950 608 572 520 --22463 2147 --
NM_203403chr93345 237 193 11218 --1446
NM_203406chr572863 2202 1913 890 811 375 98 2111 36 22735 2062 --
NM_203437chr23756 681 377 --1191 1171
NM_203446chr2172951 2936 2375 2150 2040 801 206 --22897 2439 12168
NM_203451chr1352412 938 918 861 357 --32149 800 616 11684
NM_203458chr143187 2801 967 589 --21117 932 --
NM_203459chr191646 1034 963 844 760 609 584 547 44 --31855 1616 934 --
NM_203463chr253511 3471 1697 1678 1616 13162 33715 3376 233 --
NM_203504chr432539 1970 200 11887 22301 54 12259
NM_203505chr432539 1970 200 11887 22301 54 12259
NM_206594chr143401 2547 1399 774 --23561 3200 12649
NM_206595chr143401 2547 1399 774 --23561 3200 12649
NM_206853chr6163970 3944 3805 3733 3714 3430 3293 2906 1653 1617 1608 1441 1293 885 195 123 13060 13954 32998 2831 1408
NM_206854chr6145231 5205 5066 4994 4975 4691 4554 4167 3728 2146 1456 1384 1064 215 14321 15215 24259 4092
NM_206855chr6186196 6170 6031 5959 5940 5656 5519 5132 4693 3997 3879 3843 2421 2349 2029 1180 920 410 15286 46180 868 243 83 25224 5057
NM_206876chr2113630 3344 3270 3229 2952 2293 690 664 566 482 249 --43446 3021 2572 2383 --
NM_206907chr593008 2617 871 402 351 337 151 128 28 2989 345 33063 2700 277 2896 314
NM_206909chr8218324 8305 8279 8103 7730 7573 7375 6876 6494 6029 5795 5520 5447 5368 5251 2981 2037 1685 1300 296 200 --38097 7624 439 12383
NM_206943chr23924 710 701 --1604 1361
NM_207015chr392305 2174 1919 1755 1570 191 170 131 34 --22298 1606 --
NM_207171chr142040 1451 780 119 1520 --1566
NM_207299chr96821 806 799 770 327 102 --1781 --
NM_207303chr10123582 3514 2735 1667 1642 1574 1503 1481 951 892 805 175 11650 21239 324 --
NM_207304chr1372225 2212 2138 1673 670 645 593 11655 22300 986 --
NM_207352chr452618 2414 2401 74 67 ----11915
NM_207366chr762315 2308 1918 1834 1580 894 12153 1670 --
NM_207404chr341749 578 291 29 ----31415 251 237
NM_207406chr464918 4360 2403 2268 655 203 ----16351
NM_207647chr962548 1821 767 537 524 160 31954 905 315 1693 --
NM_212471chr1721779 1458 11910 31752 1642 633 21437 127
NM_212472chr1721779 1458 11910 31752 1642 633 21437 127
NM_212543chr32742 47 ----2752 254
NM_212558chr984111 3722 3533 3283 1667 1129 720 262 21295 441 --1855
NM_213589chr295575 5053 4778 4772 4642 2046 1348 1237 386 31741 992 433 25562 3931 --
NM_213651chr171472 1178 1136 584 461 413 164 --31437 375 355 1396