TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4498
miRNA Sequence: UGGGCUGGCAGGGCAAGUGCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1262206 1812 523 459 151 136 11851 31555 428 331 32112 914 144
NM_000033chrX5956 829 795 612 335 2709 636 3982 759 713 2858 784
NM_000037chr852525 2254 2225 1853 1689 12139 32037 1694 1604 11574
NM_000038chr5----1511 --
NM_000044chrX1353 ----134
NM_000052chrX42438 1213 1120 174 11042 --11302
NM_000053chr1371777 803 695 195 131 98 91 --11792 --
NM_000068chr1941046 595 225 96 --3338 70 23 --
NM_000080chr174315 289 256 223 1176 1274 1592
NM_000081chr11229 ------
NM_000084chrX97005 6692 6071 5766 5246 4397 4264 1725 822 --46913 6509 6148 2603 36251 5193 1777
NM_000088chr171501 11202 11103 11099
NM_000089chr71689 ------
NM_000090chr2------1315
NM_000092chr233311 2956 887 23796 1059 ----
NM_000093chr942204 1839 656 649 --3307 299 164 --
NM_000109chrX1901 ------
NM_000129chr621046 389 --1434 --
NM_000134chr431089 580 475 21710 24 ----
NM_000138chr1532582 1704 780 12462 ----
NM_000163chr522214 1621 --11800 --
NM_000165chr61112 ------
NM_000168chr752951 1170 847 693 429 33276 2521 2415 12626 12266
NM_000192chr121281 --2972 470 --
NM_000210chr212260 ------
NM_000212chr1771733 974 784 627 517 356 33 ------
NM_000214chr20--1441 1283 --
NM_000217chr1273626 3457 3336 2117 1889 1597 497 43727 3382 278 43 24652 4057 --
NM_000237chr81604 --1136 --
NM_000248chr312886 1134 ----
NM_000259chr1585101 4595 4140 2517 2431 2403 1942 1209 25701 2540 21290 1129 --
NM_000266chrX2394 58 ------
NM_000267chr1753015 2849 2740 2269 1217 ------
NM_000272chr221350 1158 --11281 11437
NM_000274chr10139 ------
NM_000284chrX101884 1865 1567 1464 1247 783 649 385 294 82 --21609 1494 --
NM_000286chr17193 ------
NM_000291chrX134 1162 --1707
NM_000304chr171250 ----3421 312 92
NM_000314chr1043100 3085 1172 570 ------
NM_000315chr111138 ------
NM_000318chr8112686 2241 2222 2072 2015 1864 1819 787 687 555 111 ------
NM_000330chrX51982 1393 705 434 342 ------
NM_000332chr656625 6553 5397 1269 538 14597 16517 --
NM_000333chr31221 ------
NM_000335chr362006 766 587 268 126 40 --31531 664 85 21962 636
NM_000337chr596202 5625 5030 4706 4465 1886 1599 574 70 15466 11347 --
NM_000340chr311179 11531 ----
NM_000347chr14139 ----1171
NM_000361chr2041534 437 312 59 --1516 --
NM_000376chr1282686 2565 2159 631 471 211 111 86 1465 32632 2380 829 31247 1242 145
NM_000386chr172692 127 2525 245 ----
NM_000399chr10--1183 128 --
NM_000424chr12------146
NM_000430chr1743261 2436 2306 1315 1603 ----
NM_000434chr6----1120 --
NM_000442chr1721224 510 --21057 900 --
NM_000445chr85812 730 673 317 165 136 5847 788 329 195 40 1292
NM_000449chr121107 142 ------
NM_000458chr175834 811 740 730 179 ------
NM_000461chr333367 3230 451 34491 3195 1322 1288 --
NM_000462chr1521174 662 --21727 573 --
NM_000476chr93579 289 275 21076 571 3954 422 250 127
NM_000477chr4--127 ----
NM_000484chr212965 315 ------
NM_000489chrX33145 2367 658 12357 23378 2902 --
NM_000494chr10122 1785 --1308
NM_000500chr62485 22 --1504 1312
NM_000503chr831594 84 67 ------
NM_000533chrX21413 643 154 ----
NM_000539chr371606 1510 1436 1017 318 182 63 --11393 --
NM_000546chr1791061 1017 926 882 872 848 300 217 33 ------
NM_000555chrX47606 5748 5216 493 36784 6386 1446 1501 15767
NM_000567chr111168 --1903 --
NM_000572chr11777 --3863 697 90 --
NM_000595chr62562 250 1119 ----
NM_000599chr294092 4046 3805 3276 1560 906 870 574 57 34131 1304 461 74079 3302 1406 1395 1272 418 46 13670
NM_000602chr731338 1295 421 --11425 --
NM_000609chr1072753 2178 2157 940 422 372 79 --32389 601 44 11179
NM_000610chr1152035 965 836 601 344 12875 ----
NM_000612chr1173755 3548 3211 2673 174 47 26 11487 43524 3291 2506 133 13192
NM_000615chr1132321 2002 1964 ------
NM_000618chr1255542 5408 2049 1212 1171 22470 1548 15181 --
NM_000618chr1255542 5408 2049 1212 1171 22470 1548 15181 --
NM_000621chr1311347 ------
NM_000625chr171398 --2114 56 --
NM_000633chr1854235 3188 1684 999 273 33866 3387 1319 13197 --
NM_000635chr1921328 561 31528 1374 1202 1321 --
NM_000637chr8--1428 ----
NM_000671chr43441 414 88 ------
NM_000680chr8----172 --
NM_000686chrX21034 378 11573 11324 --
NM_000687chr203280 230 29 1268 ----
NM_000719chr12146004 5960 5866 5762 5005 4317 4160 2374 2045 1988 1271 834 614 276 25968 4171 64470 4464 2636 626 477 257 16338
NM_000720chr31428 ------
NM_000721chr1102689 2026 1929 919 712 659 651 461 164 78 11065 1448 11822
NM_000723chr1741596 1112 499 188 11082 21602 164 --
NM_000725chr121106 --1128 --
NM_000738chr116943 889 833 777 739 79 2381 143 3966 864 34 --
NM_000756chr8----1439 --
NM_000757chr13837 594 543 --2888 664 --
NM_000767chr1971415 1148 1141 952 515 336 118 --11403 --
NM_000780chr821157 69 --1431 --
NM_000792chr14742 379 151 74 11000 ----
NM_000793chr1451897 1261 541 534 147 --14335 14798
NM_000795chr113742 55 27 1248 4781 275 215 60 2720 237
NM_000801chr2021002 875 ------
NM_000806chr5130 ------
NM_000807chr41604 ------
NM_000812chr41107 ------
NM_000813chr565350 1909 1172 814 246 59 1281 24562 589 --
NM_000816chr5----1166 --
NM_000817chr21358 ------
NM_000818chr101163 ------
NM_000826chr41269 ------
NM_000827chr552171 2035 2006 1992 1852 12044 21596 49 --
NM_000829chr1141956 461 178 61 ------
NM_000831chr1215739 5733 5724 5431 5374 4929 4649 4430 4119 4068 2296 1821 1615 1418 1392 777 579 355 324 228 176 35506 5162 4595 35815 5410 4257 15889
NM_000832chr95809 615 328 159 34 1624 2749 351 --
NM_000838chr642035 658 542 416 1400 ----
NM_000840chr7164 ------
NM_000841chr64760 167 150 86 --2362 261 --
NM_000868chrX--1989 ----
NM_000875chr1564847 1021 912 620 378 291 14626 41588 969 963 864 --
NM_000880chr81199 ------
NM_000883chr73288 237 65 --2490 115 --
NM_000883chr73288 237 65 --2490 115 --
NM_000891chr1723570 623 --12630 11229
NM_000899chr1253656 3059 1676 507 402 ------
NM_000903chr1611353 --11138 --
NM_000918chr17--1222 1595 --
NM_000920chr11278 22 ------
NM_000921chr121215 ------
NM_000924chr1251109 998 900 421 259 --1353 --
NM_000926chr1189031 7573 6251 3520 3241 2171 1101 1013 11789 27981 7818 --
NM_000939chr2----190 --
NM_000945chr231797 1737 516 ------
NM_000949chr5----1114 --
NM_000961chr20123506 3077 2900 2499 1413 1184 948 863 774 472 398 70 33283 2532 748 61499 1333 1203 63 53 43 --
NM_000964chr1761283 1061 1055 392 206 26 --21006 86 1316
NM_000965chr32292 213 --1992 --
NM_000966chr122690 333 --1200 --
NM_000977chr161395 1147 1355 --
NM_000981chr17152 ------
NM_001001132chr21196 ------
NM_001001323chr121602 --1159 --
NM_001001331chr342261 880 310 294 32037 1895 886 22159 1899 12208
NM_001001342chr1021436 1308 ------
NM_001001344chrX41976 1742 558 187 --1896 --
NM_001001389chr1152035 965 836 601 344 12875 ----
NM_001001390chr1152035 965 836 601 344 12875 ----
NM_001001391chr1152035 965 836 601 344 12875 ----
NM_001001392chr1152081 1011 882 647 390 12921 ----
NM_001001395chr1242576 2084 817 437 ------
NM_001001396chr1103703 1721 1708 1560 1501 1130 499 255 246 238 --53869 3820 3396 1698 1579 14219
NM_001001438chr211362 ------
NM_001001481chr81902 2829 182 ----
NM_001001484chr1031826 941 158 22380 193 1977 168
NM_001001485chr33142 78 66 1170 ----
NM_001001486chr3184 1112 ----
NM_001001487chr3184 1112 ----
NM_001001522chr112156 100 --3360 41 30 1356
NM_001001523chr131208 264 166 --41095 985 220 117 2944 544
NM_001001549chr761806 943 937 920 578 135 32553 2341 434 42219 1985 849 598 --
NM_001001550chr761806 943 937 920 578 135 32553 2341 434 42219 1985 849 598 --
NM_001001555chr761806 943 937 920 578 135 32553 2341 434 42219 1985 849 598 --
NM_001001557chr82167 129 1537 31636 1527 693 1194
NM_001001664chr214032 ----13428
NM_001001669chr532178 314 202 ----12727
NM_001001701chr412312 11868 ----
NM_001001791chr1031088 305 267 21588 390 1440 --
NM_001001974chr10165 11689 --11483
NM_001001995chrX139 ------
NM_001002026chr31375 ----1529
NM_001002233chr851746 1556 657 535 89 --1385 1812
NM_001002762chr10122602 2297 2201 1861 986 896 838 701 680 535 373 356 12761 42090 1877 167 155 --
NM_001002814chr8103632 3563 3167 3092 1556 1177 1014 657 535 89 23152 2760 53264 2510 1263 1097 385 1812
NM_001002838chrX41443 733 702 473 1162 ----
NM_001002860chr1473254 1198 1000 968 635 560 93 --1911 --
NM_001002901chr12434 297 ------
NM_001002909chr1731666 1625 1400 22029 1377 1902 11556
NM_001002919chr21526 ------
NM_001003396chr64499 155 127 46 155 --1168
NM_001003397chr64499 155 127 46 155 --1168
NM_001003398chr12242 31 --170 --
NM_001003652chr18148663 8210 8122 8044 7820 7727 7353 7229 7203 6930 6922 5963 5654 3360 ------
NM_001003674chr18106302 5785 5583 5558 4419 2505 2480 1808 1440 432 12102 12218 24354 1221
NM_001003675chr18106302 5785 5583 5558 4419 2505 2480 1808 1440 432 12102 12218 24354 1221
NM_001003678chr11--1125 ----
NM_001003679chr122077 779 2535 523 ----
NM_001003681chr2211353 21643 1544 11923 --
NM_001003682chr161260 1218 542 277 257 179 --11154 --
NM_001003683chr2137 ------
NM_001003698chr691662 1578 1556 1266 1232 676 658 204 185 11423 11583 --
NM_001003699chr691662 1578 1556 1266 1232 676 658 204 185 11423 11583 --
NM_001003712chr12--22714 528 ----
NM_001003786chr173648 73 30 1538 1250 --
NM_001003787chr173648 73 30 1538 1250 --
NM_001003788chr173648 73 30 1538 1250 --
NM_001003790chr81294 1649 ----
NM_001003791chr81294 1649 ----
NM_001003792chr3--21207 1157 ----
NM_001003793chr3--21207 1157 ----
NM_001003799chr73633 585 577 1210 ----
NM_001003800chr982281 1307 1198 907 877 857 596 123 --3972 447 214 --
NM_001003845chr21482 ------
NM_001003894chrY1207 189 ----
NM_001003940chr15253633 3553 3541 3473 3384 3179 3100 3031 2976 2931 2819 2695 2550 1304 1187 1180 1099 980 857 841 819 796 785 569 534 13128 53546 3132 1046 608 539 --
NM_001003942chr15253633 3553 3541 3473 3384 3179 3100 3031 2976 2931 2819 2695 2550 1304 1187 1180 1099 980 857 841 819 796 785 569 534 13128 53546 3132 1046 608 539 --
NM_001003943chr15253637 3557 3545 3477 3388 3183 3104 3035 2980 2935 2823 2699 2554 1308 1191 1184 1103 984 861 845 823 800 789 573 538 13132 53550 3136 1050 612 543 --
NM_001003945chr971867 1449 1276 316 262 233 142 ------
NM_001004023chr11181 ------
NM_001004051chrX129 ------
NM_001004127chr133916 712 169 ------
NM_001004304chr1262922 2081 2070 2022 328 172 1762 22128 484 12868
NM_001004317chr664073 3887 3554 3293 3284 3080 13492 11732 --
NM_001004354chr95226 201 191 168 160 --4729 283 144 28 --
NM_001004360chr22595 386 ------
NM_001004419chr1211148 2794 728 23595 3589 --
NM_001004439chr1561288 1128 879 854 314 106 --11156 147
NM_001005209chr2175 --4542 106 46 37 --
NM_001005271chr1751084 395 367 346 146 --2815 82 158
NM_001005273chr1751084 395 367 346 146 --2815 82 158
NM_001005291chr17138 ------
NM_001005336chr91465 --4559 481 173 161 --
NM_001005366chr121646 ------
NM_001005375chrY--1661 11187 --
NM_001005404chr1773882 2819 2785 1455 1149 760 159 21676 293 ----
NM_001005408chr171173 ------
NM_001005417chr12519 60 --2283 256 1252
NM_001005463chr1022429 250 1186 ----
NM_001005474chr3152 ----11604
NM_001005502chr12105113 4929 3841 3750 1880 1451 1034 996 654 570 11713 63666 3478 1697 1537 1368 497 --
NM_001005505chr381616 1468 1456 1220 496 461 373 42 --11266 --
NM_001005609chrX83673 3428 2332 1479 1256 1072 1060 612 1465 43469 2410 1525 811 23202 1506
NM_001005612chrX1359 --2445 292 --
NM_001005732chr211472 140 131 --
NM_001005733chr211429 140 131 --
NM_001005741chr13518 501 35 163 ----
NM_001005742chr13518 501 35 163 ----
NM_001005782chr22739 198 ------
NM_001005909chr31104 ------
NM_001005910chr33494 205 150 ------
NM_001005911chr33494 205 150 ------
NM_001005920chr162691 325 3182 150 99 11000 2127 104
NM_001006115chr382177 1789 1773 1068 941 680 462 199 --42272 2168 2069 1107 --
NM_001006600chr5--1353 ----
NM_001006617chr951287 1123 1080 1070 275 --1107 --
NM_001006619chr951287 1123 1080 1070 275 --1107 --
NM_001006620chr951287 1123 1080 1070 275 --1107 --
NM_001006621chr951287 1123 1080 1070 275 --1107 --
NM_001006636chr2--132 ----
NM_001006641chr961776 1603 1318 369 355 50 1456 21574 1364 --
NM_001006642chr961776 1603 1318 369 355 50 1456 21574 1364 --
NM_001006643chr961776 1603 1318 369 355 50 1456 21574 1364 --
NM_001006684chrX2514 37 ------
NM_001006932chr673389 2706 1350 861 746 150 62 32343 994 607 2798 201 32470 2105 1282
NM_001007023chr1451897 1261 541 534 147 --14335 14798
NM_001007024chr17183692 3263 2767 2686 1280 1266 1221 1209 1171 1159 966 890 850 810 770 760 722 558 23532 1351 14076 --
NM_001007025chr17183692 3263 2767 2686 1280 1266 1221 1209 1171 1159 966 890 850 810 770 760 722 558 23532 1351 14076 --
NM_001007097chr994918 4588 4238 4220 3509 3214 1987 1417 1185 24805 4546 13597 14489
NM_001007098chr12639 346 --1283 --
NM_001007102chr621555 1498 ------
NM_001007156chr1551610 378 319 245 232 --51838 1682 1536 1268 390 --
NM_001007226chr1711287 11317 11021 1952
NM_001007227chr1711287 11317 11021 1952
NM_001007228chr1711287 11317 11021 1952
NM_001007229chr1711287 11317 11021 1952
NM_001007230chr1711287 11317 11021 1952
NM_001007257chr11453 ------
NM_001007271chr105860 382 288 192 139 21115 364 1954 --
NM_001007273chr10--1210 149 --
NM_001007277chr113175 52 42 --1390 --
NM_001007466chr675197 3904 3874 3854 3844 1045 43 23882 3409 ----
NM_001007553chr11211 11082 ----
NM_001007559chr1841988 1778 1734 151 11688 --11353
NM_001008220chr5103867 3511 3499 3454 2565 2529 2452 757 341 151 13403 53652 3599 3490 598 368 2576 22
NM_001008392chr343192 1305 1138 74 22799 1362 12277 1355
NM_001008393chr412277 --1422 --
NM_001008407chr771686 674 585 528 96 61 43 1243 31801 561 262 --
NM_001008408chr7135681 5269 2523 2349 1892 1710 1683 1603 1376 759 472 141 69 32515 2340 1860 36061 3961 1028 --
NM_001008529chr1721320 439 11333 1530 --
NM_001008540chr21315 ------
NM_001008541chr1041574 756 697 493 2743 629 ----
NM_001008541chr1041574 756 697 493 2743 629 ----
NM_001008660chr1111122 --1451 --
NM_001008701chr1982707 2554 1905 1224 999 208 143 127 32631 2397 302 72957 2489 2401 1083 1009 770 222 1737
NM_001008707chr141692 ----11317
NM_001008738chr531961 1918 505 21873 334 12098 --
NM_001008777chr171187 ------
NM_001008801chr191565 21530 1415 11446 --
NM_001008860chr153808 748 677 ------
NM_001008892chr153808 748 677 ------
NM_001008894chr153808 748 677 ------
NM_001009555chr42566 483 ------
NM_001009566chr131056 342 199 --165 --
NM_001009813chr19182 --246 26 --
NM_001009899chr395314 5265 4472 4152 2091 2053 1859 1444 542 25147 1398 ----
NM_001009958chr72218 66 ------
NM_001009993chr254186 3196 2984 2866 172 ----1143
NM_001009996chr34586 466 393 161 1385 ----
NM_001010854chr141487 ----1201
NM_001010861chr132705 2359 1893 ------
NM_001010862chrX42930 2824 2515 2143 --12962 1836
NM_001010867chr1175786 5401 5254 5217 4531 4118 2666 2097 1791 1586 1533 1455 1387 1267 1075 873 785 15208 75958 5644 5097 4617 4451 2226 1368 11604
NM_001010891chr596802 6355 5510 5377 5241 5197 2658 2614 1756 --15640 --
NM_001010898chr173248 3066 3022 2761 2637 198 151 13672 53055 2863 1267 232 174 3828 480 299
NM_001010924chr101772 199 ----
NM_001010935chr1121 ------
NM_001010986chrX41837 1551 830 716 11916 ----
NM_001011513chr43691 610 134 23672 3280 21388 777 --
NM_001011537chr322403 498 ------
NM_001011546chr202600 154 ------
NM_001011553chr7148 ------
NM_001011645chrX1353 ----134
NM_001011658chrX42020 1402 698 367 ----11448
NM_001011666chr745129 4490 921 486 24892 311 --11620
NM_001011708chr222307 1109 --32401 2216 423 --
NM_001011713chr141109 ------
NM_001011724chr13183 ------
NM_001011725chr13183 ------
NM_001012264chr143695 196 41 1351 1375 --
NM_001012329chr162333 1865 1638 1480 927 84 1864 22282 1935 --
NM_001012393chr1165000 4329 3522 604 167 81 11276 21753 1337 23977 3852
NM_001012420chr1542615 2569 2332 567 ----12796
NM_001012423chr1542615 2569 2332 567 --11994 12796
NM_001012426chr6123191 3028 2657 2522 1079 940 913 894 712 562 139 81 --103350 2790 2414 2400 2091 1261 1093 875 504 321 --
NM_001012427chr6123191 3028 2657 2522 1079 940 913 894 712 562 139 81 --103350 2790 2414 2400 2091 1261 1093 875 504 321 --
NM_001012614chr41590 --122 --
NM_001012755chrX74615 4531 3443 1299 1071 963 209 25031 1253 11481 11107
NM_001012758chr1------125
NM_001012977chrX31072 954 24 --177 --
NM_001012980chrX1183 ------
NM_001013031chr1042724 2647 2366 999 --1398 --
NM_001013399chr611165 ------
NM_001013415chr41366 ------
NM_001013438chr32246 137 137 ----
NM_001013439chr3192 ------
NM_001013661chr1132 ----1321
NM_001013690chr1251947 1754 1566 1005 34 --32285 2117 483 32281 2231 1678
NM_001013693chr1122686 2484 2305 2275 2260 2150 1984 1134 932 841 438 402 --42375 2199 915 780 3972 967 713
NM_001013693chr1122686 2484 2305 2275 2260 2150 1984 1134 932 841 438 402 --42375 2199 915 780 3972 967 713
NM_001013839chr17102419 2271 2216 2099 2035 1029 945 630 194 182 31702 982 395 31808 1590 661 1358
NM_001013843chr151327 ------
NM_001014435chr164583 518 118 23 1609 ----
NM_001014443chr11226 --1186 --
NM_001014445chr173718 322 51 ------
NM_001014794chr111228 ------
NM_001014795chr111228 ------
NM_001014797chr1047756 5866 1978 1396 37996 6281 2885 22393 706 --
NM_001014987chr164470 380 204 124 --2231 113 --
NM_001014988chr164470 380 204 124 --2231 113 --
NM_001014989chr164470 380 204 124 --2231 113 --
NM_001015045chr491584 957 913 888 809 579 112 83 70 12383 ----
NM_001015053chr172172 110 --51477 1181 429 218 152 21076 292
NM_001015508chr81266 ------
NM_001015877chrX21972 1088 ------
NM_001015881chrX2907 510 --1860 --
NM_001015887chr3--11201 ----
NM_001015892chr51162 ------
NM_001017368chr1721961 72 ------
NM_001017392chr1931262 1034 308 --31348 1180 331 --
NM_001017395chr363148 2858 2457 673 649 263 ------
NM_001017415chr11291 ------
NM_001017416chr11291 ------
NM_001017424chr121203 449 ------
NM_001017425chr121203 449 ------
NM_001017440chr7197908 7491 7222 6487 5933 5906 5465 5128 5052 2968 2880 2710 1793 1713 1361 1098 981 740 570 32635 1879 34 45889 5645 4989 2842 --
NM_001017535chr1282686 2565 2159 631 471 211 111 86 1465 32632 2380 829 31247 1242 145
NM_001017926chr811289 2580 350 ----
NM_001017979chr41164 ------
NM_001018009chr331102 750 232 ------
NM_001018050chr22123329 2711 2668 2558 2518 2433 2379 1333 1157 936 366 141 --132 --
NM_001018052chr22123329 2711 2668 2558 2518 2433 2379 1333 1157 936 366 141 --132 --
NM_001018054chr121008 40 11129 ----
NM_001018057chr1131421 549 161 ------
NM_001018060chr22----184 --
NM_001018065chr995770 4988 3890 2381 1689 989 868 632 150 32180 1092 396 22272 2028 --
NM_001018066chr995770 4988 3890 2381 1689 989 868 632 150 32180 1092 396 22272 2028 --
NM_001018100chr151650 ------
NM_001018108chr1541756 1400 922 890 --157 --
NM_001020658chr111349 11176 11050 --
NM_001020658chr111349 11176 11050 --
NM_001023567chr1521776 570 --12011 12188
NM_001023587chr33939 787 41 ------
NM_001024218chr141665 ------
NM_001024226chr14945 895 337 149 1734 ----
NM_001024227chr14945 895 337 149 1734 ----
NM_001024228chr14945 895 337 149 1734 ----
NM_001024380chr852032 1986 1901 1844 326 --11803 1778
NM_001024381chr852032 1986 1901 1844 326 --11803 1778
NM_001024401chr1662707 2116 1883 922 133 35 32169 981 731 72790 2776 2213 2206 2173 966 910 11851
NM_001024455chrX51847 1706 1002 996 252 12586 --1602
NM_001024463chr153829 180 98 --2396 226 1107
NM_001024649chr542109 951 907 317 22701 2538 12469 --
NM_001024807chr19125 ----177
NM_001024808chr1252290 2249 2125 698 683 2595 248 11052 --
NM_001024809chr1761283 1061 1055 392 206 26 --21006 86 1316
NM_001024847chr331905 1861 556 11549 21658 943 --
NM_001024858chr1462935 2686 2473 2341 2243 2068 155 62584 2269 1899 619 503 235 12480
NM_001024912chr1941651 1554 1540 79 --1484 --
NM_001024937chr172553 223 --3771 274 41 1598
NM_001024948chr1--12245 ----
NM_001024959chr33612 541 225 ------
NM_001024960chr33612 541 225 ------
NM_001025076chr10105043 4974 4628 2321 2301 2248 2207 2190 2005 1929 14377 35167 5161 2016 15704
NM_001025077chr1036401 6332 5986 15735 36525 6519 65 17062
NM_001025105chr53526 402 95 --11339 --
NM_001025108chr282834 2797 1111 928 863 704 211 85 12757 24077 714 --
NM_001025158chr53573 456 101 --4435 109 68 24 --
NM_001025161chr22----124 --
NM_001025205chr35389 382 315 177 33 --1126 122
NM_001025233chr1242142 662 522 441 ------
NM_001025266chr394222 4007 3829 3555 3542 1871 1696 762 25 24877 576 33793 677 370 1571
NM_001025366chr621478 131 --1681 --
NM_001025366chr621478 131 --1681 --
NM_001025367chr621478 131 --1681 --
NM_001025367chr621478 131 --1681 --
NM_001025368chr621478 131 --1681 --
NM_001025368chr621478 131 --1681 --
NM_001025369chr621494 147 --1697 --
NM_001025369chr621494 147 --1697 --
NM_001025370chr621478 131 --1681 --
NM_001025370chr621478 131 --1681 --
NM_001025579chr173804 411 96 --5930 815 747 251 172 --
NM_001025580chrX63446 3312 3113 2962 2824 21 33299 2914 576 13484 11368
NM_001025596chr111398 --1450 --
NM_001025603chr121107 142 ------
NM_001025780chr911029 ------
NM_001029858chr633187 1352 1308 11262 ----
NM_001029859chr1152037 998 341 287 52 --21957 753 --
NM_001029863chr632621 2035 569 ----1545
NM_001029864chr2072248 1817 964 830 367 86 56 22172 351 129 --
NM_001029875chr522335 2011 11999 12405 --
NM_001029883chr263007 2608 1991 809 728 182 2915 798 171 12142
NM_001029989chr152961 873 ----1665
NM_001030001chr14188 1362 1398 --
NM_001030007chr1613409 --1765 --
NM_001030055chr1434698 4418 378 ------
NM_001031680chr182233 1839 999 957 664 312 273 136 --3615 468 211 3765 625 231
NM_001031685chr13906 846 336 --1380 --
NM_001031690chr772897 2607 1155 1132 1070 790 721 12157 33044 810 129 1468
NM_001031695chr2295419 5070 4610 4326 4274 3957 3584 654 33 24886 4672 24990 3562 12020
NM_001031696chr191207 ------
NM_001031732chr422951 480 1247 ----
NM_001031740chr161578 680 598 144 132 77 1589 21664 277 1273
NM_001032221chr931196 741 679 --41290 701 497 103 --
NM_001032280chr62197 74 --141 --
NM_001032282chr82511 125 ------
NM_001032288chr2041581 473 428 421 ------
NM_001032293chr171610 ------
NM_001032296chr1362563 2547 2316 2167 2065 210 --22508 2464 --
NM_001032380chr1011369 ------
NM_001032394chr632217 1832 116 ------
NM_001032999chr20175074 4987 4870 4640 4626 4220 3931 3625 3473 2071 1777 1653 1522 1478 449 355 159 13887 43427 309 285 220 --
NM_001033026chr192600 79 --2563 107 --
NM_001033045chr253223 1632 1381 515 41 --43309 1278 601 433 --
NM_001033057chr311505 1721 ----
NM_001033081chr151619 1493 1389 1276 1262 --2353 187 --
NM_001033082chr151619 1493 1389 1276 1262 --2353 187 --
NM_001033087chr2052591 2236 1260 1118 141 1957 12071 --
NM_001033112chr52683 247 ------
NM_001033117chr354504 4161 1257 242 175 31962 166 51 21862 1668 --
NM_001033507chr111852 --1622 --
NM_001033551chr17183775 3755 3669 3536 3526 3489 3186 2976 2615 2553 2523 1634 1464 1430 1256 724 172 166 11453 113708 3477 3427 3270 3247 2685 1642 1349 361 285 88 1616
NM_001033554chr17--130 134 --
NM_001033557chr21576 ------
NM_001033566chr172955 691 1372 ----
NM_001033568chr172955 691 1372 ----
NM_001033602chr1362626 2468 1804 1676 1026 613 ------
NM_001033677chr122385 275 --1376 --
NM_001033723chr892420 2403 2382 2317 2161 1927 711 685 215 11039 --12551
NM_001033756chr621412 65 --1615 --
NM_001033756chr621412 65 --1615 --
NM_001034025chr12150 --21033 90 --
NM_001034837chr5125 ------
NM_001034838chr5125 ------
NM_001034845chr43900 422 196 ------
NM_001034954chr1053011 604 446 432 258 12749 22357 348 1419
NM_001034955chr1053011 604 446 432 258 12749 22357 348 1419
NM_001034956chr1053011 604 446 432 258 12749 22357 348 1419
NM_001034957chr1053011 604 446 432 258 12749 22357 348 1419
NM_001035chr111044 --1362 --
NM_001035254chr982517 2159 2111 1921 1711 803 710 677 --1330 31848 847 135
NM_001035256chr2----190 --
NM_001035260chr10176 --11632 --
NM_001035511chr121462 432 --1245 --
NM_001035512chr121569 539 --2352 81 --
NM_001035513chr121569 539 --2352 81 --
NM_001035521chr21181 1233 ----
NM_001035534chr931353 1343 68 --21252 1044 --
NM_001037174chr211511 11876 ----
NM_001037317chr132705 2359 1893 ------
NM_001037334chr1832396 2196 1510 ----1547
NM_001037339chr1152 1170 --2647 71
NM_001037340chr1152 1170 --2647 71
NM_001037341chr1152 1170 --2647 71
NM_001037341chr1152 1170 --2647 71
NM_001037494chr12190 157 ----
NM_001037495chr12190 157 ----
NM_001037582chr461431 1302 624 363 319 282 1578 11112 21143 658
NM_001037631chr22253 114 1344 ----
NM_001037666chr222346 24 ------
NM_001037954chr1173119 2916 2833 1356 1214 453 151 --12747 --
NM_001038493chr231244 361 119 1437 --2333 215
NM_001038640chr151638 ------
NM_001038707chr152057 2028 631 558 185 ----155
NM_001038707chr152057 2028 631 558 185 ----155
NM_001039140chr203458 395 35 --1465 --
NM_001039141chr22122598 2540 2300 2270 2227 2194 2138 1895 731 630 413 43 --52419 1981 1814 1094 957 --
NM_001039199chr20114862 4844 3631 1880 1678 1423 1035 702 532 237 128 21894 1741 54304 3717 3550 1641 1509 --
NM_001039348chr2138 ------
NM_001039349chr2138 ------
NM_001039360chr1881847 1817 1699 1563 621 552 463 359 11479 240 32 2274 25
NM_001039459chr72351 160 1240 3767 304 145 --
NM_001039479chr1482271 2137 1998 1848 1781 526 320 101 ------
NM_001039547chr3117541 7280 5886 5125 5106 2773 2729 2716 2218 1908 1082 26609 5144 35731 5618 5565 25424 5149
NM_001039550chr24841 802 664 239 1316 ----
NM_001039569chr253055 2658 2481 2444 1218 1954 23141 2975 --
NM_001039574chr12932 873 ----1414
NM_001039577chr173301 3290 1676 1474 1370 860 59 13314 13707 --
NM_001039585chr133826 606 138 ------
NM_001039590chrX53442 2958 2937 457 396 21384 55 13226 --
NM_001039591chrX53442 2958 2937 457 396 21384 55 13226 --
NM_001039619chr143366 306 251 ------
NM_001039690chr1632158 1508 218 11965 11810 --
NM_001039709chr20175074 4987 4870 4640 4626 4220 3931 3625 3473 2071 1777 1653 1522 1478 449 355 159 13887 43427 309 285 220 --
NM_001039711chr131123 1029 820 ------
NM_001039712chr131123 1029 820 ------
NM_001039715chr14742 379 151 74 11000 ----
NM_001039716chr14806 443 215 138 11064 ----
NM_001039771chr144467 333 252 222 --31091 893 34 --
NM_001039802chr121126 506 1935 ----
NM_001039840chrX21881 1588 --13886 --
NM_001039888chr1----1588 168
NM_001039916chr1241043 485 236 188 --1432 --
NM_001039917chr1241043 485 236 188 --1432 --
NM_001039918chr1241043 485 236 188 --1432 --
NM_001039919chr1241043 485 236 188 --1432 --
NM_001039920chr1241043 485 236 188 --1432 --
NM_001039960chr1261647 1111 659 490 201 179 ------
NM_001040001chr622031 1663 ------
NM_001040002chr1771260 1165 412 352 199 102 92 --1188 --
NM_001040056chr16148 1280 2264 148 1173
NM_001040100chr31895 ------
NM_001040107chr124681 512 503 154 --1674 --
NM_001040108chr1483160 3144 3012 2614 2239 1266 1081 89 32953 2053 105 22582 1166 12986
NM_001040134chr1971513 1354 1242 1228 963 340 92 1352 71193 1039 916 361 58 53 23 --
NM_001040142chr262003 1583 947 880 229 46 ------
NM_001040143chr262003 1583 947 880 229 46 ------
NM_001040144chr1632158 1508 218 11965 11810 --
NM_001040146chr1632158 1508 218 11965 11810 --
NM_001040151chr1154355 4145 4088 3076 1249 24254 4238 13586 13197
NM_001040152chr745016 3524 1442 693 14042 21447 1067 --
NM_001040158chr5123 ------
NM_001040195chr13498 96 53 --2624 112 1204
NM_001040202chr421867 310 1428 ----
NM_001040214chr64736 706 606 331 31591 354 27 ----
NM_001040284chr1635388 5110 4702 --1136 --
NM_001040402chr423136 808 --2970 154 --
NM_001040429chr1322292 2250 1692 ----
NM_001040436chr121537 --2623 457 --
NM_001040439chr1681131 1076 591 532 482 254 244 80 11205 31209 964 65 1263
NM_001040446chr541738 642 381 102 181 1674 --
NM_001040450chr1532812 2464 538 --22732 1119 --
NM_001040453chr1532812 2464 538 --22732 1119 --
NM_001040455chr1141043 903 830 522 --31119 995 391 --
NM_001040653chr341839 1624 963 114 1333 1343 --
NM_001040661chr741094 282 144 124 1896 41021 900 432 388 1295
NM_001040665chr733905 873 848 44078 3735 3174 1357 ----
NM_001040708chr8145 --1789 --
NM_001040712chr913346 ------
NM_001040715chr161367 --2243 178 11175
NM_001040716chr11278 22 ------
NM_001042355chr1635314 3795 950 21621 837 33583 1744 1544 --
NM_001042368chr92607 68 --1538 196
NM_001042371chr1611617 1675 32101 1869 377 --
NM_001042388chr182745 394 ------
NM_001042412chr1635314 3795 950 21621 837 33583 1744 1544 --
NM_001042413chr9123970 3901 3829 3130 3113 2506 1604 1590 1165 996 832 717 2604 100 11387 --
NM_001042424chr492988 2736 2717 2480 2471 2441 2394 922 234 --298 51 1213
NM_001042425chr62197 74 --141 --
NM_001042453chrX--1565 ----
NM_001042459chr3------124
NM_001042476chr1682184 2013 1360 772 415 327 181 105 31884 1641 195 11834 --
NM_001042479chrX71709 1674 1533 804 408 164 126 --21328 25 --
NM_001042480chrX71709 1674 1533 804 408 164 126 --21328 25 --
NM_001042486chr2071549 1469 1105 523 420 387 176 1377 21171 302 21330 298
NM_001042492chr1753015 2849 2740 2269 1217 ------
NM_001042494chr1563675 3038 2851 2666 2622 573 ----170
NM_001042495chr1563675 3038 2851 2666 2622 573 ----170
NM_001042496chr1563675 3038 2851 2666 2622 573 ----170
NM_001042497chr1563675 3038 2851 2666 2622 573 ----170
NM_001042506chrX31082 954 24 --177 --
NM_001042510chr81644 1219 ----
NM_001042511chr81644 1219 ----
NM_001042539chr162155 97 --2960 954 --
NM_001042555chr1231284 1240 545 ------
NM_001042599chr247796 5792 4833 2634 ------
NM_001042601chr312057 ------
NM_001042603chr1274866 4046 3658 1803 975 845 351 11026 11381 --
NM_001042604chr344152 4053 3512 3265 11827 ----
NM_001042632chr204882 621 352 28 ----2892 34
NM_001042633chr204882 621 352 28 ----2892 34
NM_001042663chr141322 1184 218 51 11217 1352 1250
NM_001042664chr141322 1184 218 51 11217 1352 1250
NM_001042665chr141322 1184 218 51 11217 1352 1250
NM_001042678chr1----2145 74 --
NM_001042679chr1----2145 74 --
NM_001042681chr14830 602 558 217 ------
NM_001042682chr14830 602 558 217 ------
NM_001042682chr14830 602 558 217 ------
NM_001042728chr122690 333 --1200 --
NM_001042749chrX21777 677 ------
NM_001042750chrX21777 677 ------
NM_001042751chrX21777 677 ------
NM_001043318chr14123825 3591 3408 3239 2765 2721 1352 986 917 848 497 182 --41452 1373 662 484 --
NM_001043351chr141691 1510 350 190 --164 --
NM_001044385chr222802 1264 --1842 12464
NM_001071775chr132483 226 ------
NM_001079874chr172086 1795 1769 342 226 219 135 --1497 --
NM_001083620chr41268 ------
NM_001083621chr1134562 4205 4170 3476 3267 1547 1490 1437 900 846 781 653 613 11539 44548 3844 1528 1518 --
NM_001087chr2----1126 --
NM_001092chr17122282 2269 2227 2214 2034 2015 1563 709 460 417 328 126 21990 1022 81672 616 499 306 193 187 50 41 1380
NM_001095chr1291349 1306 1257 1245 701 620 541 352 66 1492 31511 472 290 1747
NM_001099678chr385887 5181 4901 4820 4009 2556 2181 2083 --24987 178 --
NM_001100108chr166215 5577 2774 2271 1706 711 35935 5903 293 47467 6138 5939 5663 16299
NM_001106chr3148871 8149 8131 8009 7687 7176 7026 6910 6663 3863 2841 2058 822 302 16214 47309 6898 3830 2640 --
NM_001113490chrX53346 2581 944 584 173 ------
NM_001116chr1662607 2236 1114 717 583 128 ----22614 1159
NM_001117chr1831705 720 34 1689 1996 1585
NM_001127chr222347 338 --127 --
NM_001128chr1613409 --1765 --
NM_001148chr42831 124 ------
NM_001149chr1021100 410 ------
NM_001150chr151159 --2285 27 1134
NM_001157chr103704 223 98 --1709 --
NM_001163chr92928 791 --1970 --
NM_001173chr1434698 4418 378 ------
NM_001174chrX6932 799 753 526 401 181 1613 ----
NM_001189chr41764 --3891 130 124 --
NM_001191chr2021166 67 1103 31428 1060 1019 --
NM_001196chr221877 1891 ----
NM_001204chr246914 5377 4988 2007 11789 15077 --
NM_001219chr731856 1616 1460 --11810 --
NM_001222chr1071560 465 367 297 162 90 33 --41780 1652 1638 595 --
NM_001225chr11--123 127 --
NM_001226chr42225 53 --1140 --
NM_001241chr21870 ------
NM_001241chr21870 ------
NM_001259chr776343 6180 5386 4848 1627 1308 115 --11571 --
NM_001267chr17199 --3450 176 23 --
NM_001273chr123478 134 65 ------
NM_001277chr113950 782 305 --1898 --
NM_001280chr19----2528 147 --
NM_001292chr1531077 900 700 --4985 971 245 206 --
NM_001293chr111405 --1448 --
NM_001299chr19275 65 --1108 --
NM_001304chr171916 1672 12500 11028
NM_001310chr1242988 2532 1126 466 ------
NM_001319chr198928 795 789 406 378 359 157 42 193 1895 1891
NM_001328chr41590 --122 --
NM_001331chr1132645 2278 131 ------
NM_001343chr551656 1463 1374 1247 109 ------
NM_001346chr342340 1846 865 21 --1347 --
NM_001351chr311623 1566 11156 --
NM_001356chrX4792 673 186 110 --1940 --
NM_001364chr111387 13461 43527 3509 3039 2942 --
NM_001386chr831992 574 297 --1847 --
NM_001387chr573094 2941 2775 2067 1982 1278 556 --12438 --
NM_001396chr213913 547 265 12436 1793 --
NM_001397chr1162406 2263 2231 2224 2168 1802 1717 1027 1007 995 936 716 605 582 133 84 21983 1707 22001 66 1692
NM_001399chrX83673 3428 2332 1479 1256 1072 1060 612 1465 43469 2410 1525 811 23202 1506
NM_001401chr931404 53 27 --11564 --
NM_001406chr1771581 1464 1132 701 548 269 96 1339 31643 114 35 21524 638
NM_001407chr341672 1530 1332 96 --21568 126 11665
NM_001408chr121238 48 --41459 1192 1119 398 --
NM_001412chrX21257 1248 --13068 --
NM_001417chr1231497 1476 170 --1516 1554
NM_001419chr1973725 3650 3516 3485 3059 3017 526 24402 3292 43420 3274 3231 275 --
NM_001420chr1952926 2438 2369 1168 107 22797 776 12825 1501
NM_001430chr241426 1381 1371 50 --11363 --
NM_001431chr611188 --1174 1361
NM_001433chr172286 35 1141 1843 --
NM_001438chr141169 1079 1063 745 --1581 --
NM_001447chr53524 395 324 1120 11237 --
NM_001453chr611207 1161 ----
NM_001454chr17----3271 226 148 --
NM_001456chrX3291 57 28 ----184
NM_001458chr74666 536 499 42 1700 2152 24 --
NM_001478chr122878 815 ------
NM_001495chr831181 492 201 ------
NM_001518chr71795 --2985 800 --
NM_001520chr164581 555 528 31 ------
NM_001521chr21181 1233 ----
NM_001530chr14--1204 --1762
NM_001543chr5144794 4299 4184 3511 3348 3063 1926 1745 1108 1083 857 500 481 244 13585 44549 1279 815 544 14415
NM_001552chr172392 340 3265 238 113 1380 --
NM_001555chrX186 ------
NM_001560chrX52466 2175 1611 765 680 1124 1600 --
NM_001567chr115694 669 561 459 59 --1294 --
NM_001610chr113776 504 127 ----182
NM_001614chr17189 ------
NM_001614chr17189 ------
NM_001616chr232729 1365 265 ------
NM_001619chr114944 787 254 178 1893 3884 130 120 --
NM_001620chr112579 50 ----1214
NM_001635chr73951 826 695 ------
NM_001650chr1822670 1399 13029 ----
NM_001655chr1171876 1628 1505 1483 647 603 469 21489 423 --21665 1634
NM_001658chr14945 895 337 149 1734 ----
NM_001659chr1242550 2459 2248 652 --168 --
NM_001660chr32692 541 ------
NM_001663chr14--1621 ----
NM_001664chr34997 778 217 22 ------
NM_001665chr112523 369 ------
NM_001668chr131538 760 497 ------
NM_001670chr221134 --2522 28 1638
NM_001677chr1128 ------
NM_001682chr121316 ------
NM_001683chr342261 880 310 294 32037 1895 886 22159 1899 12208
NM_001684chr173420 1438 1425 1277 1218 847 216 --53586 3537 3113 1415 1296 13936
NM_001694chr165346 333 157 72 22 ------
NM_001701chr921011 88 ------
NM_001703chr11208 1231 1235 --
NM_001706chr31181 --133 --
NM_001707chr71603 1776 ----
NM_001717chr1551474 1458 1150 538 189 1212 1419 --
NM_001731chr121657 --1662 --
NM_001746chr542109 951 907 317 22701 2538 12469 --
NM_001755chr161621 11784 ----
NM_001759chr1244690 3879 1073 555 24712 4311 13554 --
NM_001773chr161379 1360 1271 1202 304 140 21351 1046 ----
NM_001783chr192323 89 162 147 --
NM_001788chr7148 ------
NM_001789chr331709 314 292 129 11401 --
NM_001791chr121126 506 1935 ----
NM_001802chr162821 707 ------
NM_001810chr203761 753 179 --1559 --
NM_001829chr42614 387 ------
NM_001830chrX43775 3503 2931 592 1862 1899 --
NM_001838chr174728 667 173 118 ------
NM_001839chr1163 ------
NM_001842chr93533 456 421 --1170 --
NM_001856chr11337 ------
NM_001858chr621412 1389 11122 --11502
NM_001859chr9113729 3531 3125 2658 2610 1537 1106 815 677 596 427 --43815 3649 2495 763 --
NM_001862chr2162 ------
NM_001865chr6144 ------
NM_001866chrX--144 ----
NM_001874chr12105113 4929 3841 3750 1880 1451 1034 996 654 570 11713 63666 3478 1697 1537 1368 497 --
NM_001882chr51102 --1116 --
NM_001891chr41347 ------
NM_001892chr53526 402 95 --11339 --
NM_001893chr171296 ------
NM_001895chr2011161 --1325 --
NM_001901chr63817 426 395 ------
NM_001903chr51676 ----1132
NM_001904chr31301 ------
NM_001907chr162294 276 ----126
NM_001923chr114585 232 216 113 ------
NM_001927chr24220 201 117 103 1170 3456 97 67 1518
NM_001933chr143437 291 51 ------
NM_001939chrX93571 2713 1488 1015 626 563 545 248 67 1275 11494 --
NM_001946chr122442 116 1253 ----
NM_001949chr682159 2136 1296 1103 1040 974 615 526 ------
NM_001954chr63560 284 246 2681 107 1571 --
NM_001957chr41447 21582 1412 ----
NM_001962chr51138 --1219 --
NM_001964chr51840 ------
NM_001968chr41906 ------
NM_001969chr1453208 2934 2828 2710 60 1487 ----
NM_001970chr171414 --1454 --
NM_001975chr121798 ------
NM_001978chr85900 859 237 145 27 --2787 422 1918
NM_001981chr11206 ------
NM_001982chr1231048 821 186 --3251 114 100 --
NM_001987chr1283296 3099 1704 1665 1631 1483 697 460 21031 37 23779 1294 --
NM_001999chr53565 557 46 ------
NM_002006chr445086 1100 798 500 22161 579 --12166
NM_002010chr13198 ------
NM_002015chr1363381 3078 2575 2116 655 542 32071 1351 71 12896 --
NM_002017chr1111214 ------
NM_002023chr141066 469 391 175 11411 11151 21550 1082
NM_002025chrX58726 6202 2850 1659 278 --13093 11472
NM_002028chr1451046 294 273 45 22 1229 1287 --
NM_002033chr1173670 2942 2815 2637 2559 918 521 23592 553 11020 --
NM_002035chr1863300 2601 1272 990 795 587 12892 13211 23387 2561
NM_002037chr6179 ------
NM_002040chr2132603 738 296 ------
NM_002045chr3175 --1139 --
NM_002054chr2145 ------
NM_002061chr111866 --41951 1786 1476 1311 --
NM_002062chr641336 1273 435 226 ------
NM_002063chrX1492 ------
NM_002072chr92693 209 ------
NM_002077chr952032 1798 1742 387 71 --1261 11502
NM_002080chr163860 116 45 ------
NM_002083chr141114 --143 --
NM_002086chr1772005 1917 1902 1493 793 721 88 --1878 1536
NM_002092chr494640 4445 4432 4384 4229 3800 3112 1500 1301 1809 23632 854 14220
NM_002101chr21424 ----1492
NM_002114chr61157 ------
NM_002126chr172524 237 ----13127
NM_002129chr4--186 ----
NM_002136chr12183 ------
NM_002146chr1741316 1216 925 130 --1564 --
NM_002156chr21371 ------
NM_002158chr223677 398 --1274 --
NM_002160chr9------182
NM_002161chr9130 ------
NM_002168chr152203 89 ------
NM_002187chr531095 942 356 --1214 1866
NM_002188chr55670 652 202 179 144 1166 1664 --
NM_002189chr103486 240 23 ------
NM_002193chr271654 494 384 375 275 178 44 --2570 65 --
NM_002199chr4------1187
NM_002202chr5191 ------
NM_002205chr123902 816 405 --4631 379 266 41 1127
NM_002211chr101983 ------
NM_002214chr774947 4888 2186 1970 1745 1322 1278 24301 1058 ----
NM_002221chr192696 2312 1980 1797 680 563 456 411 238 --32788 2335 340 --
NM_002223chr1233137 581 27 23128 3057 23152 3145 --
NM_002228chr11953 11038 ----
NM_002246chr23491 466 163 --21242 308 11077
NM_002247chr1022310 523 ------
NM_002249chr1------1360
NM_002252chr21115 ------
NM_002253chr41150 11130 ----
NM_002254chr271855 1722 565 525 429 369 299 --22332 1865 --
NM_002264chr361818 1086 626 524 74 48 1223 14443 --
NM_002265chr171421 ------
NM_002267chr131748 ------
NM_002268chr31739 ------
NM_002270chr531907 1011 24 ------
NM_002271chr132906 578 1939 1586 --
NM_002272chr12136 124 --1338
NM_002282chr123223 216 67 ------
NM_002285chr282834 2797 1111 928 863 704 211 85 12757 24077 714 --
NM_002290chr631470 480 66 --1979 --
NM_002293chr152700 1912 1786 1746 344 ----1457
NM_002296chr1143 ------
NM_002309chr2272952 2791 2565 2423 2144 1989 735 1899 42945 2801 2452 388 22797 147
NM_002310chr524081 28 --11090 1670
NM_002319chr751050 985 851 199 91 --4768 740 251 178 --
NM_002332chr123700 309 79 --3640 513 84 --
NM_002333chr1931047 139 31 --21101 804 11166
NM_002336chr1244939 4761 3721 628 ------
NM_002355chr12135 1520 287 23 --
NM_002356chr621010 700 ------
NM_002359chr17104003 3978 3381 3276 3260 3196 3133 2799 715 440 2465 455 53928 3813 3657 1372 535 13254
NM_002372chr51284 ------
NM_002373chr1521338 1164 --142 --
NM_002375chr352262 1823 325 275 191 12280 1355 --
NM_002382chr142301 168 --41102 1045 351 342 --
NM_002383chr16----3783 777 379 --
NM_002384chr182899 168 1784 ----
NM_002390chr17111903 1641 1598 1328 640 624 349 239 214 73 45 1297 21660 1646 11888
NM_002397chr522229 812 11413 ----
NM_002398chr221100 70 ------
NM_002401chr1762332 2227 1827 1772 1715 183 1118 52373 1893 871 551 205 --
NM_002406chr52375 63 --1929 --
NM_002419chr115465 379 334 79 31 ------
NM_002429chr1271547 1213 1117 1037 628 293 188 ------
NM_002442chr1241402 1164 564 85 1410 5616 291 248 157 32 --
NM_002473chr224861 412 280 50 --1203 --
NM_002479chr11478 --1114 1284
NM_002480chr1241438 1149 393 290 ------
NM_002481chr1117510 7386 7135 6756 5900 5290 3184 3082 2213 1375 643 57746 7033 7028 1185 889 32299 1716 68 16362
NM_002486chr952346 1817 763 384 357 --11903 --
NM_002499chr152593 185 ------
NM_002500chr2178 11181 ----
NM_002501chr19173910 3723 3435 3373 3361 3304 2961 807 779 653 624 611 513 374 176 168 23 1224 124042 3712 3702 3639 3395 3054 1491 1401 949 850 193 136 2132 127
NM_002505chr62607 322 1386 ----
NM_002508chr151719 1600 660 413 381 11766 2315 123 1119
NM_002515chr1411533 --11601 --
NM_002519chr11--11130 ----
NM_002522chr1773811 2843 2505 948 819 169 139 21269 912 13191 21080 795
NM_002533chr1----1178 134
NM_002537chr153717 284 62 ------
NM_002544chr171115 ------
NM_002545chr1165000 4329 3522 604 167 81 11276 21753 1337 23977 3852
NM_002547chrX64182 3960 3471 1208 120 110 23274 2887 ----
NM_002553chr72367 64 ------
NM_002558chr17111135 1104 1058 1050 764 443 226 220 112 69 46 --11142 --
NM_002569chr1581380 1363 1323 1080 343 308 179 99 --41434 472 272 266 --
NM_002570chr153847 273 225 ----1409
NM_002576chr1131169 1008 860 --1831 --
NM_002577chr363271 3146 2646 2602 559 233 22556 257 ----
NM_002579chr1971513 1354 1242 1228 963 340 92 1352 71193 1039 916 361 58 53 23 --
NM_002581chr9133874 3652 1813 1569 1490 1430 1377 973 756 563 446 273 250 13986 11235 --
NM_002582chr161369 ----1853
NM_002585chr11243 ------
NM_002588chr561605 1424 1271 1148 665 158 11223 1527 150
NM_002589chr42365 98 ------
NM_002594chr2032080 713 664 1752 2788 42 --
NM_002595chr12----236 29 --
NM_002599chr1141040 966 460 45 ------
NM_002600chr1152 1170 --2647 71
NM_002601chr21200 --1151 --
NM_002609chr581492 737 665 549 513 481 407 91 21341 615 3658 570 205 11577
NM_002611chr172632 287 --2770 763 1177
NM_002613chr16105207 4021 3662 1915 1446 1243 1152 889 354 94 --2301 281 --
NM_002616chr172366 110 1206 1434 2211 149
NM_002628chr3----1775 --
NM_002632chr143754 619 212 1707 ----
NM_002634chr174291 255 67 46 ------
NM_002645chr1132399 454 313 ------
NM_002646chr121507 222 --1116 --
NM_002648chr621070 69 ------
NM_002653chr54895 840 639 132 --2935 764 1101
NM_002655chr874764 4673 4313 3960 1715 1189 975 ------
NM_002657chr2032944 2625 1482 32981 689 23 33552 2880 708 13063
NM_002660chr2041032 334 111 81 --1199 --
NM_002663chr172456 32 --1503 1409
NM_002668chrX----1153 --
NM_002698chr198841 792 673 613 514 304 158 41 --31029 814 807 12874
NM_002699chr141025 945 179 52 --11097 --
NM_002709chr252680 2273 2267 1276 85 ------
NM_002714chr66772 737 430 197 103 47 1844 1119 --
NM_002716chr1153040 1334 1249 1166 313 32970 2952 691 13529 --
NM_002717chr81201 1437 ----
NM_002721chr91374 ------
NM_002730chr1971136 1100 1043 318 270 255 187 --3970 386 263 1281
NM_002731chr152563 2356 2221 2160 1097 --1704 --
NM_002733chr12--1222 1236 --
NM_002734chr1722224 793 ------
NM_002736chr711569 12222 ----
NM_002737chr17175761 5320 5308 4971 4838 4794 2626 2397 2311 2168 2124 2022 1998 1791 1698 1041 526 11186 42508 1074 41 34 --
NM_002740chr322684 758 --12331 --
NM_002745chr2274434 4384 3079 656 549 467 207 1186 22757 91 --
NM_002746chr161166 1111 195 --
NM_002747chr1881545 1498 1447 787 764 463 365 175 ------
NM_002753chr43288 137 94 ------
NM_002755chr152603 563 ------
NM_002760chrY135740 5661 5495 5146 5137 5054 4666 4423 4106 3631 1861 1098 1008 11320 23942 1183 --
NM_002763chr1143 1553 ----
NM_002776chr1951893 1627 586 92 21 --41994 1336 593 275 --
NM_002811chr16----1507 --
NM_002819chr1921451 581 1192 31411 496 229 --
NM_002822chr122662 47 1586 ----
NM_002827chr2051278 1254 1166 486 358 ------
NM_002830chr21389 ------
NM_002833chr1521214 148 --2496 34 11343
NM_002834chr122988 669 11064 21496 912 11269
NM_002835chr71512 ------
NM_002837chr1232800 763 89 23116 647 ----
NM_002839chr913346 ------
NM_002840chr121348 1334 1125 4601 543 88 58 --
NM_002843chr1142991 2850 2462 432 13089 ----
NM_002844chr611062 ----11380
NM_002846chr23418 114 93 129 3478 167 33 --
NM_002849chr12--1257 1166 --
NM_002850chr194439 408 207 154 --1175 --
NM_002855chr11103408 3166 3072 2750 2508 1451 1389 1289 1179 111 13622 62390 2361 1442 347 126 44 32530 1460 753
NM_002857chr172550 1891 1778 470 248 148 33 --22126 699 --
NM_002859chr12136 21632 1547 11636 1278
NM_002866chr193225 116 83 --2407 74 --
NM_002868chr1261947 1897 937 756 390 137 --11760 12319
NM_002869chr112614 438 31864 1620 369 ----
NM_002880chr32752 638 --3719 310 255 --
NM_002884chr1121 ------
NM_002885chr15921 822 811 398 379 --3988 238 117 --
NM_002886chr351211 1070 592 333 21 ------
NM_002892chr1431123 373 209 11050 ----
NM_002896chr111112 ------
NM_002902chr15154 ------
NM_002906chr112954 802 ------
NM_002918chr1941026 915 400 382 --61036 703 416 311 262 92 --
NM_002923chr1195 ------
NM_002928chr141465 1274 151 27 --1583 1534
NM_002941chr31290 ------
NM_002955chr691662 1578 1556 1266 1232 676 658 204 185 11423 11583 --
NM_002957chr9133035 2906 2857 1571 1487 616 544 465 252 223 127 71 58 22584 1350 72865 1501 1233 812 801 470 335 --
NM_002959chr184110 3971 3409 3016 1194 517 487 397 --33162 544 109 23634 2807
NM_002972chr224279 229 87 74 --2256 93 --
NM_002977chr232727 2692 31 ------
NM_002996chr164799 453 444 355 21720 1470 71594 786 479 319 287 230 173 --
NM_003000chr1------136
NM_003001chr121569 539 --2352 81 --
NM_003010chr171582 --1714 --
NM_003011chr911425 --151 --
NM_003012chr883163 2894 2157 1278 1080 736 657 126 1871 ----
NM_003013chr44579 114 108 74 ------
NM_003015chr104633 509 487 27 --2574 78 1570
NM_003016chr1721774 745 11378 ----
NM_003026chr91236 --1121 --
NM_003027chr15--1428 ----
NM_003028chr9163819 3576 3470 3345 3013 2664 2569 1539 1513 1403 1337 1045 981 845 829 368 11157 43085 835 308 217 175
NM_003029chr131260 1117 147 --11373 21339 1334
NM_003030chr331680 1447 46 --1107 --
NM_003035chr1--1344 1278 --
NM_003036chr12809 70 2458 95 1238 --
NM_003038chr2132689 1944 1930 1898 1693 1642 691 636 368 173 126 65 58 12520 21916 780 --
NM_003045chr13114335 4171 3471 3295 3190 940 490 431 311 151 35 31080 980 756 24209 3412 33494 291 158
NM_003047chr12156 139 11329 41039 985 515 247 --
NM_003051chr111648 ------
NM_003062chr5139 ------
NM_003071chr321539 1425 --1736 --
NM_003074chr362143 1878 910 865 189 114 ------
NM_003075chr12162 --192 --
NM_003076chr123573 347 198 --21072 580 --
NM_003077chr171125 --127 --
NM_003079chr17--2808 332 2375 220 --
NM_003081chr20--1108 ----
NM_003088chr741179 869 726 403 --41041 903 897 418 --
NM_003091chr201197 ------
NM_003098chr203541 522 447 --122 1547
NM_003107chr642560 1850 724 236 --11939 --
NM_003108chr247197 6476 2811 2397 1886 21959 1831 --
NM_003110chr174426 219 105 36 ----1873
NM_003113chr21174 ------
NM_003131chr682246 682 535 484 425 272 196 154 11651 21871 403 --
NM_003136chr141347 ------
NM_003137chr631649 730 256 ------
NM_003139chr112792 372 ------
NM_003145chr12152 114 --1170 --
NM_003146chr11194 ------
NM_003153chr1221046 34 ------
NM_003155chr821941 327 ----11043
NM_003156chr111284 --1291 --
NM_003161chr1722808 736 2957 557 ----
NM_003162chr2--11058 ----
NM_003164chr113569 537 401 ------
NM_003173chrX11407 --41109 459 324 199 --
NM_003174chr101296 ------
NM_003175chr1130 ----140
NM_003178chr332205 881 152 ------
NM_003179chrX2903 211 ------
NM_003180chr195383 303 257 66 22 1341 282 40 --
NM_003181chr61118 ------
NM_003185chr201135 ------
NM_003186chr112156 100 --3360 41 30 1356
NM_003187chr51162 ------
NM_003189chr1133081 2609 2435 2399 2188 908 728 632 514 397 356 263 25 13313 11094 12624
NM_003199chr1834947 4490 927 1284 ----
NM_003200chr1931614 246 39 --11605 21979 1954
NM_003201chr10--1136 1930 --
NM_003202chr581646 1561 1326 1176 746 695 498 129 --31481 82 21 --
NM_003203chr21953 ------
NM_003211chr122615 230 ------
NM_003214chr651325 1129 1052 309 225 --31387 905 267 --
NM_003215chr441378 1157 1029 282 11557 1145 --
NM_003217chr1231276 651 480 11930 31623 1295 379 --
NM_003220chr62197 74 --141 --
NM_003221chr663133 3072 731 651 592 463 11639 43084 1643 826 616 --
NM_003236chr263164 3057 2232 1107 334 135 ----1541
NM_003242chr331905 1861 556 11549 21658 943 --
NM_003255chr1772361 1687 1071 764 680 570 344 --3697 289 67 11756
NM_003269chr61987 ------
NM_003281chr1124962 4675 4100 3492 1947 1730 1123 907 489 473 403 254 1615 52121 1778 568 313 127 162
NM_003285chr11394 ------
NM_003289chr9129 ------
NM_003290chr1951097 881 331 221 211 11084 1967 1810
NM_003292chr132276 1619 525 ------
NM_003298chr3125464 4978 4515 4506 4497 3824 2078 2011 1750 1326 1099 708 24529 2153 35846 3988 2304 --
NM_003300chr141188 ------
NM_003317chr14----2711 704 126
NM_003320chr1173592 3005 1030 393 381 141 71 1854 3898 721 34 --
NM_003322chr61292 --1160 --
NM_003325chr221282 --1148 1144
NM_003326chr152527 2300 2174 943 227 --22128 657 1103
NM_003329chr9127 ------
NM_003330chr1241618 717 636 259 ------
NM_003340chr441357 1171 1086 182 ------
NM_003342chr1722108 768 ------
NM_003344chr751496 1255 1118 483 273 --1393 --
NM_003348chr1241478 557 473 126 11552 ----
NM_003349chr2041581 473 428 421 ------
NM_003350chr81107 ------
NM_003352chr22739 198 ------
NM_003359chr42847 216 ------
NM_003363chr31548 ------
NM_003368chr11291 ------
NM_003369chr1152652 2162 712 673 263 1551 11917 --
NM_003371chr982071 1940 1585 1483 443 430 176 110 11547 2236 54 --
NM_003374chr52644 118 ------
NM_003375chr101401 ------
NM_003376chr621478 131 --1681 --
NM_003376chr621478 131 --1681 --
NM_003387chr251141 1085 495 292 225 ------
NM_003389chr91459 --1549 --
NM_003390chr112404 195 --1238 --
NM_003392chr321091 23 33763 1555 937 ----
NM_003394chr122459 60 ------
NM_003404chr201125 1132 11461 --
NM_003411chrY21709 66 ------
NM_003412chr331101 1071 916 --12563 --
NM_003413chrX1810 ------
NM_003430chr192330 51 ------
NM_003445chr196712 629 576 545 229 185 --2769 523 2747 331
NM_003455chr1161595 460 389 175 79 34 ------
NM_003457chr171610 ------
NM_003458chr3163728 3572 3288 2866 1617 1610 1213 1153 874 824 782 537 476 398 308 86 13187 21126 728 --
NM_003459chr23714 499 44 --3163 157 145 --
NM_003463chr622692 1221 12107 --23255 2715
NM_003466chr2142452 1965 1613 1531 975 908 865 730 509 484 459 289 283 47 1896 1740 1446
NM_003467chr21315 ------
NM_003468chr293685 3660 3326 2736 1640 1106 640 551 488 ----1189
NM_003470chr166639 608 591 550 525 85 158 21564 375 --
NM_003472chr61999 ------
NM_003482chr1242110 2036 622 369 --31022 239 212 1397
NM_003483chr1242921 2198 839 216 ----12410
NM_003485chr1431044 941 415 41389 1177 973 49 1904 --
NM_003489chr21--21195 380 ----
NM_003502chr163522 506 207 ----1246
NM_003508chr72263 99 ------
NM_003557chr131369 517 63 21332 1044 ----
NM_003559chr17103506 3084 2792 2724 2569 1441 1271 1029 821 142 21327 405 13266 --
NM_003563chr1711287 11317 11021 1952
NM_003564chr14533 491 268 131 ------
NM_003565chr12111313 1276 1141 1113 1087 459 423 304 253 147 139 1160 21265 293 --
NM_003566chr1232376 893 220 ------
NM_003567chr1147 ------
NM_003576chr1362563 2547 2316 2167 2065 210 --22508 2464 --
NM_003582chr11181 ------
NM_003583chr1221048 382 23616 952 ----
NM_003590chr232547 898 577 23959 312 13794 --
NM_003592chr7----189 --
NM_003603chr431829 1621 38 --1347 --
NM_003607chr163454 3367 3105 2705 1414 1271 23737 2938 13801 1178
NM_003612chr152509 156 141 1494 --
NM_003622chr1241049 917 619 455 12309 --12539
NM_003624chr1971370 1340 1125 938 476 346 125 1967 41288 1207 424 334 --
NM_003626chr1131216 1090 983 1491 ----
NM_003627chr114481 450 415 220 ------
NM_003629chr173162 2973 2668 2434 2280 194 151 --1622 --
NM_003632chr172662 307 --3667 50 32 --
NM_003633chr562377 2350 1972 1880 441 296 --12143 --
NM_003644chr17156115 5243 4669 4515 4470 4095 1830 998 791 743 656 549 492 360 204 32643 464 155 3878 843 782 22100 1338
NM_003654chr111599 ----1129
NM_003656chr3153 ------
NM_003659chr22362 295 ------
NM_003663chr333078 1122 375 11188 ----
NM_003682chr113821 785 577 ----131
NM_003684chr12352 94 --1312 --
NM_003685chr191241 --1376 --
NM_003686chr1137 ------
NM_003709chr21392 ------
NM_003714chr552787 1893 1080 1036 407 --32233 2049 1971 2838 808
NM_003732chr5192 ------
NM_003735chr561605 1424 1271 1148 665 158 11223 1527 150
NM_003736chr561605 1424 1271 1148 665 158 11223 1527 150
NM_003737chr11183 --3359 150 128 --
NM_003743chr262172 1817 1805 1515 779 472 ------
NM_003746chr12190 157 ----
NM_003748chr151241 561 472 323 27 --3996 903 77 --
NM_003749chr133519 453 79 ------
NM_003758chr151359 ------
NM_003758chr151359 ------
NM_003759chr433757 3720 3227 11558 13928 --
NM_003778chr3--1105 ----
NM_003780chr12519 60 --2283 256 1252
NM_003787chr181336 ----1218
NM_003791chr161108 ------
NM_003792chr92107 32 ----1130
NM_003794chr31333 ------
NM_003800chr632107 950 236 12217 1155 --
NM_003806chr123269 231 42 ------
NM_003818chr20168 --1327 --
NM_003822chr152548 2281 558 483 233 1596 13200 --
NM_003829chr9195 ------
NM_003850chr131230 ------
NM_003870chr1552017 1770 829 97 54 11528 --122
NM_003872chr24685 576 514 473 12187 32378 2214 603 --
NM_003873chr1022094 562 21907 1752 1888 --
NM_003884chr311611 ------
NM_003887chr231842 1739 1717 2431 104 31785 554 435 1916
NM_003888chr1531356 1338 167 11564 272 31 --
NM_003893chr103374 107 56 --1484 --
NM_003895chr2121973 274 21888 806 21892 354 --
NM_003896chr2159 1105 ----
NM_003908chr20--11132 ----
NM_003913chr632961 1667 1428 ------
NM_003930chr742127 866 798 82 --1957 --
NM_003939chr1093864 3414 3394 3358 1606 1534 809 757 127 43375 1122 521 182 1525 13922
NM_003941chr752408 2319 2248 1972 446 12191 ----
NM_003947chr31128 131 ----
NM_003949chr17102018 1710 1568 1544 725 716 583 511 414 380 11496 31850 1438 46 11301
NM_003951chrX1314 --236 27 --
NM_003954chr1791439 1371 1361 1289 1208 392 293 85 42 1953 31415 360 107 1535
NM_003955chr1751134 1074 1035 239 221 11057 11479 1988
NM_003958chr663698 3195 2860 2479 1059 76 3969 618 558 1173 11194
NM_003975chr11102 ------
NM_003980chr61565 ------
NM_003981chr152745 24 ------
NM_003992chr15----268 54 --
NM_003993chr1------153
NM_003994chr1253656 3059 1676 507 402 ------
NM_004006chrX1901 ------
NM_004007chrX1901 ------
NM_004009chrX1901 ------
NM_004010chrX1901 ------
NM_004011chrX1901 ------
NM_004012chrX1901 ------
NM_004013chrX1901 ------
NM_004014chrX1901 ------
NM_004015chrX1901 ------
NM_004016chrX1815 ------
NM_004017chrX1901 ------
NM_004018chrX1815 ------
NM_004020chrX1901 ------
NM_004021chrX1815 ------
NM_004022chrX1815 ------
NM_004023chrX1815 ------
NM_004028chr1822670 1399 13029 ----
NM_004035chr1784420 3795 3625 3433 1965 1879 1247 1231 --15052 --
NM_004036chr23462 231 126 125 ----
NM_004050chr1431872 1693 316 ------
NM_004068chr35389 382 315 177 33 --1126 122
NM_004077chr121189 --11270 --
NM_004081chrY--1661 11187 --
NM_004082chr2277 38 --182 --
NM_004085chrX2613 575 ------
NM_004089chrX2907 510 --1860 --
NM_004090chr1782669 2641 2261 1133 1096 512 487 143 --22209 1256 --
NM_004093chr1343204 2336 1075 602 2761 626 ----
NM_004095chr8170 --2317 130 --
NM_004096chr102265 108 ------
NM_004097chr22260 253 --3927 827 580 --
NM_004098chr10--1435 ----
NM_004100chr631727 463 383 ------
NM_004104chr174776 577 563 494 --1522 1114
NM_004105chr2138 ------
NM_004112chr1761760 1516 1283 668 353 48 11436 2549 73 --
NM_004114chrX172 ------
NM_004116chr2154 ------
NM_004117chr671922 1745 1368 672 633 156 40 11413 1638 1269
NM_004118chr20124 --193 --
NM_004119chr131726 1608 ----
NM_004123chr17159 ------
NM_004124chr1422262 1160 ------
NM_004145chr194331 202 86 40 --1142 --
NM_004157chr3154 ----1882
NM_004162chr311121 ----2319 81
NM_004170chr92511 156 --11834 --
NM_004171chr11169058 8589 8500 7370 7215 6389 6353 6115 3543 2722 2410 2234 2057 1258 1162 287 37727 3465 2006 16013 16868
NM_004172chr521583 1539 177 --1659
NM_004176chr17138 ------
NM_004185chr11170 ------
NM_004193chr102377 155 ------
NM_004200chr1171233 1040 988 515 439 123 79 1191 42147 393 195 175 --
NM_004225chr8----11336 --
NM_004227chr7103059 3042 2649 2508 2445 2429 1951 944 718 64 --22658 2066 --
NM_004229chrX21706 64 ------
NM_004232chr1813013 22664 2542 1299 --
NM_004236chr15--1596 ----
NM_004241chr101171 ------
NM_004248chr101443 --1136 1132
NM_004263chr241648 1591 1460 1240 --41604 1417 1375 96 --
NM_004267chr3--179 ----
NM_004269chr9----121 --
NM_004272chr51181 ------
NM_004274chr141307 12964 ----
NM_004276chr122385 275 --1376 --
NM_004279chr732164 2072 697 11547 ----
NM_004286chr2272811 2803 2245 2156 2112 874 585 --52837 2416 2364 840 95 --
NM_004295chr1731004 173 138 --1517 --
NM_004297chr9----194 --
NM_004302chr125996 855 547 460 444 12564 1100 32522 1016 403
NM_004308chr11121769 1710 1696 1472 1398 1367 1234 1190 630 266 153 39 --61659 1585 1372 379 141 24 11581
NM_004311chr1052862 2690 1178 699 105 ----2855 491
NM_004319chr141239 1133 604 206 1796 22898 1256 1870
NM_004321chr293525 2538 2491 2381 2314 1335 1023 420 168 1103 33253 2319 83 138
NM_004327chr2272464 2410 2365 2226 2022 1919 1613 31632 889 644 11962 1766
NM_004329chr101300 1452 --11083
NM_004337chr81328 22102 738 ----
NM_004338chr18106302 5785 5583 5558 4419 2505 2480 1808 1440 432 12102 12218 24354 1221
NM_004339chr2141819 1488 162 21 156 2436 120 161
NM_004341chr22188 38 ------
NM_004342chr71785 ------
NM_004346chr441303 1278 965 171 11015 ----
NM_004349chr831011 883 845 --11017 1963
NM_004350chr182233 1839 999 957 664 312 273 136 --3615 468 211 3765 625 231
NM_004364chr1931213 944 834 1890 31205 476 34 --
NM_004369chr2148 ------
NM_004370chr621647 688 ------
NM_004379chr221677 650 --31764 1597 389 --
NM_004380chr1622332 2288 --22110 1627 --
NM_004385chr52580 39 1272 --1231
NM_004387chr5149 ------
NM_004389chr2----190 1555
NM_004392chr1332021 1692 1026 ------
NM_004393chr342233 2094 912 353 --31863 1844 699 1803
NM_004395chr54571 94 69 53 --1123 --
NM_004397chr1144085 3836 1509 504 ------
NM_004398chr11----1440 --
NM_004416chr1221002 408 182 21051 965 --
NM_004418chr2186 --1566 --
NM_004420chr1192365 2335 1568 1516 938 830 549 467 21 1734 82412 2358 2270 2217 2188 2107 2078 538 1785
NM_004421chr12586 147 --2161 22 --
NM_004423chr372493 2110 1050 902 542 186 42 --62661 1949 1787 930 869 21 12098
NM_004426chr1251694 1677 1513 564 300 31685 1224 327 --127
NM_004427chr12996 469 1877 1277 --
NM_004429chrX61284 1091 519 453 298 88 --31329 1142 1074 --
NM_004430chr882751 1032 1023 900 173 126 78 55 --1261 --
NM_004431chr12713 282 ------
NM_004434chr141692 ----11317
NM_004436chr11516 ------
NM_004437chr183599 3416 2936 2278 1416 1174 746 412 1301 31152 537 483 --
NM_004438chr242201 2134 852 253 --11102 --
NM_004439chr41132 ------
NM_004441chr3----2513 298 --
NM_004443chr31754 ------
NM_004444chr71189 --4889 354 282 80 --
NM_004450chr141116 --1275 --
NM_004451chr114545 131 101 57 --1507 --
NM_004454chr332221 1880 626 11748 ----
NM_004456chr71178 ------
NM_004459chr17--1142 1472 --
NM_004463chrX1415 --4499 402 255 71 187
NM_004468chr12557 84 ------
NM_004475chr171984 --51115 1091 804 484 40 --
NM_004480chr142783 66 ------
NM_004491chr19124217 3889 3283 3144 3099 2757 2655 1503 1182 651 487 149 11008 33725 1343 307 11339
NM_004501chr122673 1441 ------
NM_004503chr121156 ----1537
NM_004504chr222010 381 --12413 --
NM_004505chr173718 603 252 --1798 --
NM_004514chr1732531 1878 135 22102 571 11900 --
NM_004517chr111228 ------
NM_004519chr81156 ------
NM_004527chr1771260 1165 412 352 199 102 92 --1188 --
NM_004528chr11104 ------
NM_004529chr91176 11448 1216 --
NM_004530chr164849 407 283 106 ------
NM_004535chr2061703 1653 1145 719 700 591 2640 276 --131
NM_004544chr23289 54 23 --1279 --
NM_004549chr1141349 1305 1057 407 --11074 --
NM_004576chr5----1155 --
NM_004577chr73641 514 470 ------
NM_004580chr151197 1505 ----
NM_004584chr119801 755 749 635 294 211 144 79 54 --1689 --
NM_004586chrX54353 4014 1362 606 108 13469 33549 1735 1568 --
NM_004588chr1193638 2906 2567 2524 1562 1372 1281 714 22 --33192 1051 257 1474
NM_004596chr19167 ------
NM_004598chr522767 569 --1400 --
NM_004603chr761151 897 734 430 392 369 --1123 --
NM_004606chrX2380 28 ----147
NM_004630chr114853 427 384 203 --1881 --
NM_004631chr121008 40 11129 ----
NM_004637chr32512 117 --1223 --
NM_004646chr192439 70 --1358 --
NM_004654chrY--11345 ----
NM_004656chr351091 960 934 188 106 128 21225 859 --
NM_004660chrY52194 2145 669 179 109 ------
NM_004663chr151211 ------
NM_004673chr141479 1015 396 51 ------
NM_004675chr1----124 --
NM_004687chr1741562 759 609 498 11640 1267 --
NM_004698chr12162 50 ------
NM_004709chrX11494 ----1439
NM_004710chr175794 743 625 275 202 1814 3913 346 85 --
NM_004711chr22143352 3193 2750 2700 2364 2343 1350 1129 821 796 744 508 296 101 22522 156 33370 1305 60 --
NM_004713chr141690 ------
NM_004716chr113756 296 202 --1693 --
NM_004723chr12863 416 --21007 125 --
NM_004726chrX55566 1945 1441 931 731 14475 ----
NM_004729chrX41894 1667 1343 331 21994 43 2410 251 --
NM_004730chr511924 1210 21515 172 --
NM_004734chr1333231 2544 2210 12450 127 --
NM_004736chr13736 381 87 ------
NM_004737chr223173 132 70 1226 1178 --
NM_004739chr111240 ------
NM_004742chr321816 178 --21686 68 --
NM_004745chr885960 4830 4374 2737 1840 1600 1204 329 14608 46033 5038 4287 1589 --
NM_004747chr1031385 277 60 --1388 --
NM_004748chr1543174 3167 1675 435 ------
NM_004762chr1771749 1423 1307 750 561 267 199 ----11340
NM_004768chr11106 ------
NM_004772chr521229 344 ------
NM_004774chr1742094 1940 1925 981 ------
NM_004776chr2031173 181 50 ------
NM_004783chr161177 --1118 --
NM_004786chr18147 ------
NM_004788chr1142274 2180 1846 1053 ------
NM_004796chr142950 198 12115 --12120
NM_004801chr211071 1433 ----
NM_004805chr23881 565 202 21092 130 ----
NM_004807chr272226 1990 1050 746 697 479 441 2770 200 42242 947 598 461 1531
NM_004808chr1063072 3040 2904 2748 2153 879 12144 33157 2992 964 --
NM_004815chr134605 4458 4128 24222 3439 34556 4480 1459 --
NM_004821chr53775 259 36 ----1245
NM_004822chr17163094 2835 2803 2631 2496 1606 1428 1279 1031 636 626 576 345 235 164 74 13325 43676 1383 946 535 12816
NM_004831chr192281 86 ----1121
NM_004834chr223346 2589 11223 1314 --
NM_004841chr1----171 --
NM_004844chr331102 750 232 ------
NM_004845chrX74098 3454 3258 3123 3079 3042 546 2512 109 21583 426 --
NM_004850chr211674 --21760 1595 --
NM_004854chr2--1294 11248 --
NM_004856chr151102 --1398 --
NM_004863chr14135131 5049 4990 4972 4823 4499 4298 4286 3807 1767 395 301 49 45228 4411 3592 243 34910 4212 1601 --
NM_004865chr6----1142 --
NM_004871chr17183692 3263 2767 2686 1280 1266 1221 1209 1171 1159 966 890 850 810 770 760 722 558 23532 1351 14076 --
NM_004874chr81115 ------
NM_004879chr11153 --1268 --
NM_004884chr1541154 504 462 156 --31159 1141 176 --
NM_004887chr51967 ------
NM_004891chr21230 ------
NM_004893chr5123 ------
NM_004896chr10----11547 --
NM_004898chr432920 2719 189 22617 437 12533 --
NM_004899chr22107 90 ------
NM_004904chr745129 4490 921 486 24892 311 --11620
NM_004911chr73608 580 473 ------
NM_004922chr103670 658 337 ------
NM_004926chr141486 1248 137 --
NM_004932chr52338 126 1227 ----
NM_004943chr1961077 839 404 199 185 49 --61151 1053 393 382 122 42 --
NM_004948chr1821359 959 11232 21443 1135 --
NM_004953chr3157 --1366 --
NM_004956chr733905 3045 1798 11832 13574 --
NM_004958chr11651 ------
NM_004961chrX2431 301 21280 416 --11007
NM_004962chr101227 1103 2197 182 --
NM_004964chr11401 ------
NM_004974chr1--129 ----
NM_004975chr204719 366 343 238 ------
NM_004976chr11194903 4871 4087 3850 3704 3440 3424 3250 1937 1802 1700 1669 1568 1292 828 585 383 237 43 24274 3936 74987 4054 3872 3766 3297 2015 555 --
NM_004977chr194584 531 516 190 --2592 392 --
NM_004978chr151595 1536 1267 1186 399 1448 2423 55 11077
NM_004979chrX3959 363 290 1938 ----
NM_004980chr11206 ------
NM_004992chrX177969 7655 7326 6467 5961 5860 5273 3254 3177 3137 2973 2550 2299 1681 1648 1500 426 26120 2499 128169 6689 6545 6492 5918 2998 1794 1396 1350 647 585 435 28097 3266
NM_004992chrX177969 7655 7326 6467 5961 5860 5273 3254 3177 3137 2973 2550 2299 1681 1648 1500 426 26120 2499 128169 6689 6545 6492 5918 2998 1794 1396 1350 647 585 435 28097 3266
NM_004995chr1441202 468 233 115 --3436 286 243 11328
NM_004996chr1641231 669 402 268 1381 1637 --
NM_004999chr634261 2947 1337 --13914 --
NM_005006chr211016 ------
NM_005020chr71517 ------
NM_005023chr511422 ------
NM_005028chr1022189 343 --1705 --
NM_005029chr10152 --1230 --
NM_005044chrX104296 4217 4050 3665 3656 3573 3185 2942 1490 877 --11045 --
NM_005056chr1275110 4290 3902 2047 1219 1089 595 21270 172 11625 --
NM_005060chr131208 264 166 --41095 985 220 117 2944 544
NM_005065chr1474915 4867 4535 4299 3307 1163 303 --11359 24584 540
NM_005068chr631316 1206 549 ----1555
NM_005072chr162130 75 --1100 1392
NM_005076chr1144011 3958 3948 3592 3524 3512 3022 2583 1213 962 941 874 756 380 43473 3385 2989 1332 43529 3005 712 61 --
NM_005078chr1541787 1657 750 136 ------
NM_005080chr223358 210 105 ------
NM_005087chr3192 ------
NM_005093chr20175074 4987 4870 4640 4626 4220 3931 3625 3473 2071 1777 1653 1522 1478 449 355 159 13887 43427 309 285 220 --
NM_005095chr12842 64 ------
NM_005103chr112286 21 ------
NM_005105chr13722 423 55 ----11703
NM_005109chr352416 1677 696 649 531 31951 548 304 --11976
NM_005110chr52621 275 ------
NM_005112chr41133 1260 ----
NM_005116chr2094078 3780 3766 3206 1757 1708 1692 1656 822 --1264 --
NM_005117chr113220 172 84 --1708 1701
NM_005121chr1752726 2708 1384 306 267 21422 1124 11128 --
NM_005126chr321632 171 32318 2279 709 ----
NM_005134chr182745 394 ------
NM_005135chr1563675 3038 2851 2666 2622 573 ----170
NM_005137chr2272382 2311 2305 730 510 397 156 21013 692 3898 696 94 --
NM_005144chr841182 1136 1067 317 157 2952 407 --
NM_005151chr1832396 2196 1510 ----1547
NM_005153chr161302 ------
NM_005155chr61460 --1601 --
NM_005156chr955136 1792 1422 337 182 175 11905 --
NM_005161chr1151880 454 238 45 36 11971 21925 647 --
NM_005165chr17234 23 --1265 --
NM_005166chr19125 ----177
NM_005169chr11168 --1507 --
NM_005180chr1021626 1461 ------
NM_005182chr164583 518 118 23 1609 ----
NM_005184chr1951474 1395 1062 1034 504 --41434 474 392 316 --
NM_005187chr16131997 1986 1974 1750 1743 1545 1527 1484 1406 1377 1348 781 586 --41630 1362 1299 54 --
NM_005189chr1782381 2336 2194 2065 1899 1715 675 447 21544 731 22111 705 32054 1912 79
NM_005190chr611165 ------
NM_005197chr1486037 5037 2408 2047 1695 1216 606 311 12139 45497 3792 1995 614 24589 4184
NM_005202chr161869 1418 700 547 405 344 1257 41433 743 427 261 --
NM_005206chr1721350 1319 --21436 1269 --
NM_005214chr22216 77 1307 ----
NM_005216chr11424 --1510 --
NM_005219chr551562 1405 701 342 26 --31276 328 231 --
NM_005220chr1741248 485 319 68 --21447 566 --
NM_005225chr2041006 820 399 54 1222 188 1910
NM_005229chrX3415 216 59 --11001 11158
NM_005230chr121476 ------
NM_005235chr247796 5792 4833 2634 ------
NM_005245chr43766 266 151 ------
NM_005258chr151305 --1130 1334
NM_005263chr13319 123 52 --1335 --
NM_005271chr1031033 280 146 1820 ----
NM_005274chr11141 ------
NM_005275chr61112 ------
NM_005277chr4----1223 --
NM_005281chr13805 171 106 1233 4852 841 701 86 --
NM_005311chr761806 943 937 920 578 135 32553 2341 434 42219 1985 849 598 --
NM_005312chr9122633 2491 2323 2085 2017 1721 1030 992 614 164 103 51 --32590 1874 128 --
NM_005324chr1741903 1721 1377 1298 ------
NM_005328chr81296 ------
NM_005329chr1652038 1936 1591 896 170 ----1391
NM_005338chr793945 3609 3528 2772 2747 2516 1519 1386 70 31600 1309 975 33695 2881 322 22833 812
NM_005359chr1856110 6075 5966 2195 297 12149 25296 3973 --
NM_005370chr1941070 1041 443 74 135 11133 --
NM_005374chr17142379 2342 2246 2184 2154 2118 1820 1569 911 723 603 376 127 97 31843 927 770 32348 610 534 --
NM_005375chr611085 ------
NM_005376chr111115 --186 --
NM_005378chr22748 210 ------
NM_005380chr121072 850 --1422 21198 482
NM_005381chr21113 ------
NM_005382chr81322 ------
NM_005384chr9--159 ----
NM_005386chr201819 --1331 --
NM_005388chr91270 --1520 --
NM_005389chr61104 ------
NM_005392chr9101588 1261 706 596 509 415 328 283 242 153 --21350 383 --
NM_005399chr154181 4037 1536 1094 68 1713 1246 --
NM_005400chr242432 945 753 555 --22655 114 --
NM_005406chr18--1395 ----
NM_005407chr142631 269 1360 21368 518 --
NM_005412chr121485 ------
NM_005413chr21175 --168 --
NM_005415chr22743 200 ------
NM_005417chr2031765 1659 1325 1345 31368 338 226 --
NM_005418chr112657 529 --2626 66 1128
NM_005426chr13906 846 336 --1380 --
NM_005430chr122831 106 --1762 --
NM_005433chr1822566 686 ------
NM_005437chr1021363 26 1585 ----
NM_005438chr114561 164 72 39 1496 1429 --
NM_005443chr42500 480 ------
NM_005455chr12666 525 ------
NM_005458chr961612 572 518 506 383 355 --2529 458 --
NM_005465chr141802 1700 1549 120 --173 --
NM_005474chr172172 110 --51477 1181 429 218 152 21076 292
NM_005477chr1532531 2302 382 11876 3828 822 752 --
NM_005477chr1532531 2302 382 11876 3828 822 752 --
NM_005483chr19----1369 --
NM_005487chr2211353 21643 1544 11923 --
NM_005493chr61842 --164 --
NM_005494chr7--1135 ----
NM_005497chr17145718 5292 4947 4811 4798 4774 4640 4472 4389 4116 1870 1727 1690 1290 34070 1681 54 55939 5554 5378 4991 4308 11916
NM_005499chr191233 ------
NM_005501chr1751206 926 830 465 308 180 41118 1112 1000 835 --
NM_005505chr127725 624 362 131 118 102 26 --3110 62 54 1694
NM_005522chr731279 1052 375 2883 28 ----
NM_005529chr11347 --144 1950
NM_005539chr104446 255 170 147 --1130 --
NM_005540chr141151 561 426 382 162 21447 46 --
NM_005546chr571676 941 540 252 197 131 113 --1928 193
NM_005552chr142119 26 ------
NM_005554chr12296 32 ------
NM_005557chr17239 25 ------
NM_005578chr323697 3656 23354 668 13175 --
NM_005585chr153426 89 57 ------
NM_005587chr151688 ------
NM_005595chr11915 ------
NM_005596chr9115424 5055 4765 4142 3883 1101 930 661 567 338 46 --1673 16364
NM_005603chr1821658 812 --2586 458 2727 294
NM_005604chr61912 --2663 69 --
NM_005607chr82108 52 ------
NM_005610chr1--1138 ----
NM_005614chr72819 414 ------
NM_005619chr19299 48 --2337 39 --
NM_005629chrX51175 840 538 58 47 --31221 945 228 125
NM_005632chr1671040 871 826 774 721 703 189 --41004 726 270 253 1129
NM_005637chr1841988 1778 1734 151 11688 --11353
NM_005638chrX31514 1333 104 ----1577
NM_005639chr1221767 96 11745 ----
NM_005644chr1164 ------
NM_005647chrX62829 1151 724 250 68 45 --32616 2385 274 --
NM_005652chr163836 201 54 --1796 --
NM_005655chr82511 125 ------
NM_005660chrX159 1181 2203 193 --
NM_005665chr164550 4305 3985 3229 747 611 ----1793
NM_005668chr543380 1028 773 149 23462 727 ----
NM_005677chr341396 1217 919 457 1570 1579 1575
NM_005688chr311087 --1893 --
NM_005707chr1541056 384 45 29 --11143 --
NM_005711chr511036 ------
NM_005715chr642432 790 311 305 22727 1898 2826 593 --
NM_005718chr33612 541 225 ------
NM_005721chr21816 --11043 --
NM_005723chr4143 ------
NM_005730chr1293354 3323 3167 2604 2408 842 695 511 107 --21124 1041 22440 1222
NM_005736chr1031568 636 612 21547 1326 11351 --
NM_005737chr242579 1100 769 212 12042 1338 1243
NM_005739chr152402 95 22064 1960 ----
NM_005740chr223610 574 68 --3590 583 317 --
NM_005748chr1233444 2974 1101 --12749 --
NM_005754chr531073 95 68 ------
NM_005766chr132458 125 --1199 --
NM_005768chr124552 284 143 125 1238 --1463
NM_005778chr31311 ------
NM_005779chr54976 765 156 118 153 ----
NM_005792chr161214 --1457 --
NM_005795chr212115 --1168 --
NM_005803chr6----128 --
NM_005808chr343192 1305 1138 74 22799 1362 12277 1355
NM_005811chr12----154 --
NM_005822chr63544 448 343 1261 31826 727 349 1588
NM_005828chr1755032 3903 3524 1279 157 23860 210 24096 3207 1808
NM_005834chrX185 --2233 199 --
NM_005840chrX35027 2618 98 ----27311 227
NM_005852chr1751084 395 367 346 146 --2815 82 158
NM_005857chr111381 --165 --
NM_005864chr141601 1292 ----
NM_005868chr72403 202 ------
NM_005871chr101759 ------
NM_005876chr23801 793 641 ------
NM_005880chr16170 ------
NM_005885chr531634 1497 426 ------
NM_005896chr21150 ----1238
NM_005898chr1142776 1997 564 375 ------
NM_005899chr1711404 --11007 --
NM_005901chr18148663 8210 8122 8044 7820 7727 7353 7229 7203 6930 6922 5963 5654 3360 ------
NM_005902chr1564231 3759 3562 2971 1724 889 21636 348 54451 1438 502 452 295 1498
NM_005904chr182972 457 --1571 --
NM_005907chr641429 1217 500 199 ------
NM_005909chr564177 4067 4027 3548 2676 276 13761 ----
NM_005910chr1783949 3742 3580 2684 2595 1623 749 99 --31347 1236 80 13102
NM_005911chr241365 1027 429 108 --1596 --
NM_005920chr131420 693 26 11327 33280 2509 894 --
NM_005933chr1162847 2772 2631 2020 663 453 12186 ----
NM_005934chr19132507 2264 2242 2024 2013 1632 1047 904 844 795 273 133 113 11951 51732 403 362 322 310 --
NM_005935chr434949 4384 1018 2717 68 1684 --
NM_005937chr17113585 3055 3028 2726 2570 1470 1454 1284 1209 603 67 14044 53501 3033 904 610 469 13866
NM_005941chr863294 2669 1034 691 218 109 ------
NM_005943chr6101444 1355 1283 1253 502 470 387 287 112 42 31473 1103 249 --31108 439 167
NM_005955chr1105172 4597 4417 3797 1959 1832 1652 1072 1017 606 14844 14287 --
NM_005957chr1164901 4818 4737 3894 3868 3490 3465 3397 1543 1361 987 849 338 216 184 110 1806 53265 1774 1500 559 351 --
NM_005962chr1041574 756 697 493 2743 629 ----
NM_005962chr1041574 756 697 493 2743 629 ----
NM_005964chr171436 ----1136
NM_005966chr211514 1102 ----
NM_005967chr121641 ------
NM_005969chr113997 307 45 ------
NM_005977chr131793 ------
NM_005990chr552527 2009 1911 944 432 --1122 21745 112
NM_005996chr122165 98 --11239 134
NM_006007chr953896 3743 1314 805 189 13697 24224 3046 --
NM_006011chr1583644 3636 2981 2715 2640 1505 463 45 13951 83863 3469 3451 3096 3047 2701 2645 313 11233
NM_006015chr12920 122 --1360 --
NM_006016chr612052 ------
NM_006030chr381616 1468 1456 1220 496 461 373 42 --11266 --
NM_006032chr142211 32 ------
NM_006036chr242296 2114 1908 299 --11022 --
NM_006037chr261960 876 847 789 206 56 ------
NM_006038chr2032066 1553 537 2640 631 123 11796
NM_006041chr174519 468 377 136 ------
NM_006047chr2043159 3084 555 373 --13202 --
NM_006049chr151390 ------
NM_006085chr121137 183 --2269 106 --
NM_006089chrX51862 1526 1401 213 183 ------
NM_006094chr81814 --163 --
NM_006095chr434268 4205 85 ----13386
NM_006096chr831444 1038 391 --21501 63 --
NM_006100chr31140 ------
NM_006109chr143366 306 251 ------
NM_006113chr172086 1795 1769 342 226 219 135 --1497 --
NM_006121chr122330 293 --2145 90 --
NM_006129chr81554 --1400 --
NM_006133chr1182205 1897 1567 925 823 279 257 22 22098 1806 1478 --
NM_006135chr131049 330 129 ------
NM_006136chr7187 ------
NM_006139chr272417 2339 1062 984 90 38 26 --21070 904 --
NM_006141chr1612256 --12703 --
NM_006145chr193842 257 234 --1289 11064
NM_006147chr12382 79 ------
NM_006153chr3178 1153 ----
NM_006154chr1542554 2480 1872 600 --12474 --
NM_006156chr141204 ------
NM_006157chr111375 ------
NM_006160chr1741297 531 429 150 --160 --
NM_006166chr12----22284 2121 --
NM_006176chr114693 624 318 116 --1633 --
NM_006185chr112525 95 1539 ----
NM_006186chr2--1103 1136 --
NM_006191chr123378 294 22 --1169 --
NM_006194chr1421150 926 ------
NM_006195chr91249 187 ----
NM_006197chr81452 --21815 1470 --
NM_006201chrX41070 831 348 64 --3877 322 282 3938 873 368
NM_006202chr1951662 1504 1396 1379 413 --3742 575 569 --
NM_006203chr555453 4327 2199 2158 1945 34512 312 145 24215 4153 --
NM_006206chr432508 2249 126 22329 2211 12343 11808
NM_006224chr17102393 2271 2241 2197 2020 1950 759 611 544 61 12041 ----
NM_006228chr84280 84 33 24 ------
NM_006238chr6102028 1968 1918 1840 1776 1466 738 589 186 98 21434 1327 41752 1497 191 84 --
NM_006241chr312209 1235 ----
NM_006243chr12708 157 1692 1768 --
NM_006245chr62700 41 133 ----
NM_006246chr14----11098 --
NM_006252chr197557 6918 5992 5436 5027 4946 2390 1819 877 32768 2308 945 45637 5178 5172 5113 --
NM_006266chr92607 68 --1538 196
NM_006268chr113886 784 165 31077 949 347 2291 132 --
NM_006275chr2011951 ------
NM_006277chr21238 134 ----
NM_006282chr20104439 4283 4074 4013 3927 3540 3150 1256 1020 605 1860 23839 29 --
NM_006283chr884611 4595 3319 3248 3170 3019 1620 168 23435 3117 --14553
NM_006288chr1131007 879 361 --21121 973 --
NM_006289chr94385 344 335 321 --2326 146 2295 34
NM_006293chr152882 417 --5953 405 337 239 197 2645 85
NM_006306chrX64971 4353 4053 3883 1360 1066 --13697 11273
NM_006311chr17------1130
NM_006323chr4--1756 ----
NM_006328chr111573 1451 ----
NM_006330chr821377 75 ------
NM_006334chr9--146 ----
NM_006336chr981442 1391 1376 1209 985 612 393 298 169 21357 367 --
NM_006350chr52264 242 ------
NM_006351chr194369 360 142 25 --1117 --
NM_006352chr1--11436 ----
NM_006371chr364844 4740 3735 3222 505 327 2281 73 23914 822 --
NM_006373chr1761336 1015 987 881 466 86 21148 403 1311 --
NM_006378chr93221 137 113 --11080 --
NM_006380chr1763646 3556 3063 2762 1662 1266 11376 --2731 117
NM_006386chr2231912 1811 210 ------
NM_006387chr1931035 906 305 2873 92 4877 446 429 416 1767
NM_006389chr1111171 1163 2556 222 --
NM_006393chr1034566 4264 1202 23002 1439 23150 1397 1884
NM_006405chr14168 ------
NM_006411chr61723 1292 1713 --
NM_006420chr2052613 1037 967 502 30 12327 ----
NM_006421chr8--1238 1161 --
NM_006424chr491887 1545 1472 1434 1337 1297 495 469 132 --11371 --
NM_006434chr1053011 604 446 432 258 12749 22357 348 1419
NM_006440chr22----147 --
NM_006451chr52918 874 ------
NM_006454chr4113042 2621 2306 2079 995 781 227 192 124 53 40 32252 2236 468 52813 2605 2138 1949 83 32551 615 610
NM_006457chr43691 610 134 23672 3280 21388 777 --
NM_006458chr11--1312 1295 --
NM_006471chr181117 --1215 --
NM_006482chr1221048 382 23616 952 ----
NM_006489chr1411533 --11601 --
NM_006494chr193772 682 90 ------
NM_006500chr1131005 253 69 --2871 47 1200
NM_006516chr171153 616 371 271 131 101 40 11466 121 --
NM_006517chrX72256 1459 865 744 704 322 120 21440 892 21776 35 21772 722
NM_006521chrX5567 434 371 280 53 --1483 11082
NM_006526chr2021940 651 1476 ----
NM_006527chr4133 1114 ----
NM_006529chr4--11420 ----
NM_006532chr1981628 655 449 267 254 200 177 130 --21672 581 11708
NM_006538chr273587 3546 3045 1335 1086 757 452 11190 2651 633 11101
NM_006539chr162133 38 ------
NM_006540chr82107 62 ------
NM_006544chr1465395 3949 1573 1247 900 67 ------
NM_006546chr17176639 6486 5968 5611 5277 5151 4992 4623 4488 2666 2175 2126 2029 1372 1085 372 176 --25508 4732 11030
NM_006547chr731954 204 116 ------
NM_006548chr361785 1496 257 196 81 42 11458 11440 --
NM_006549chr1242760 2478 2304 2087 --22271 1910 --
NM_006557chr92679 22 11156 --1686
NM_006558chr82367 204 --143 --
NM_006560chr111398 --1450 --
NM_006561chr10105043 4974 4628 2321 2301 2248 2207 2190 2005 1929 14377 35167 5161 2016 15704
NM_006572chr1732489 1164 263 12325 1981 --
NM_006587chr4131 ------
NM_006589chr14430 65 47 34 ------
NM_006595chr1121718 1691 ------
NM_006599chr1686209 5276 5239 5110 2635 2301 826 252 16203 25647 2585 --
NM_006603chrX21777 677 ------
NM_006614chr313452 --21365 1205 --
NM_006618chr121033 350 11367 1105 --
NM_006620chr631734 1647 622 21816 1479 11820 --
NM_006621chr121778 595 ----2249 27
NM_006624chr1011548 --1110 --
NM_006626chr932598 954 477 ------
NM_006628chr1544215 3729 3594 3550 11374 ----
NM_006646chr1352897 2693 1195 805 784 2830 706 12632 --
NM_006650chr5103867 3511 3499 3454 2565 2529 2452 757 341 151 13403 53652 3599 3490 598 368 2576 22
NM_006651chr461245 508 306 115 91 21 --21350 189 --
NM_006653chr61167 --146 --
NM_006654chr1231284 1240 545 ------
NM_006662chr162292 276 ------
NM_006667chrX--158 ----
NM_006690chr20102341 2290 2093 782 666 645 344 211 74 40 22174 2126 2424 219 --
NM_006698chr203419 347 94 11373 ----
NM_006700chr123817 258 214 --1701 --
NM_006709chr6167 279 45 ----
NM_006711chr162146 69 --1606 149
NM_006722chr312886 1134 ----
NM_006726chr421130 302 ------
NM_006727chr5198 ------
NM_006734chr621238 462 --21226 1048 --
NM_006736chr291851 1812 1674 1521 1249 762 687 449 397 21326 182 11454 --
NM_006738chr15134646 4618 4216 4169 3795 3572 3519 2914 1688 1336 1009 476 131 --23800 118 21668 49
NM_006749chr81989 --1120 --
NM_006754chr7----1811 --
NM_006761chr171220 ------
NM_006764chr32445 192 ------
NM_006766chr872611 2099 1869 1807 1029 919 387 --2946 839 --
NM_006769chr1----1113 --
NM_006772chr631342 1317 188 --41711 1668 1230 1083 --
NM_006775chr642144 1979 1206 571 ------
NM_006777chrX--1229 ----
NM_006795chr1141456 626 305 39 21213 1146 31274 1081 278 --
NM_006803chr832122 96 78 ------
NM_006805chr551442 1359 1329 1274 210 156 ----
NM_006807chr171354 1146 ----
NM_006814chr2042143 689 237 177 --22452 258 --
NM_006819chr111354 --1342 --
NM_006825chr122901 224 ----1711
NM_006827chr1442735 2600 2553 39 --12780 --
NM_006832chr141292 1999 ----
NM_006833chr71109 ----1367
NM_006836chr121494 1250 ----
NM_006852chr1752120 1843 1777 929 192 ------
NM_006853chr191268 124 1256 --
NM_006854chr7------11726
NM_006856chr1231099 990 29 --1201 --
NM_006861chr1251907 1651 510 312 226 --61296 562 457 357 192 49 21866 394
NM_006870chr202600 154 ------
NM_006874chr4--1271 ----
NM_006884chr331680 1447 46 --1107 --
NM_006885chr1643947 3472 967 959 1409 ----
NM_006887chr22587 510 1595 ----
NM_006888chr1453540 3180 2167 1378 1350 1983 --12475
NM_006892chr201365 1227 ----
NM_006892chr201365 1227 ----
NM_006896chr731107 816 276 1717 4358 281 179 138 11144
NM_006897chr121630 ----1473
NM_006898chr24824 750 529 210 ------
NM_006902chr142873 2098 742 59 22395 460 ----
NM_006904chr81906 --1926 --
NM_006906chr113134 115 53 1727 2619 41 --
NM_006908chr731400 471 238 1566 ----
NM_006913chr6130 --1120 --
NM_006920chr23542 228 45 --1704 --
NM_006924chr1712906 13897 ----
NM_006927chr1692105 1938 1615 849 753 380 242 200 146 1100 52024 1848 542 470 56 2796 30
NM_006931chr1261947 1862 1781 1548 444 283 11453 ----
NM_006939chr1411201 ------
NM_006940chr1231843 1703 158 11549 ----
NM_006941chr2231121 1056 841 --41131 799 48 35 --
NM_006943chr2093240 3138 3062 2662 944 755 675 110 39 32146 826 187 42369 1050 388 261 --
NM_006946chr114533 515 412 174 1612 ----
NM_006951chr101827 ------
NM_006981chr932856 824 116 ------
NM_006982chr121209 ------
NM_006990chr172497 2477 2418 1540 394 378 356 22042 736 11970 --
NM_006991chr32907 306 --2393 227 --
NM_007007chr1244380 4370 3233 1004 ------
NM_007010chr1721607 1439 --1316 --
NM_007011chr15145547 4643 4220 2404 2303 2248 1977 1801 1116 788 630 461 159 32 14571 45633 5467 2215 1870 --
NM_007023chr21156 ----140
NM_007024chr31505 --1511 1227
NM_007026chr173458 436 27 ------
NM_007030chr5135150 4282 3439 3310 3258 3203 1756 1567 1509 1359 1329 1138 249 2988 951 54311 1788 1047 886 631 24486 4263
NM_007032chr22122598 2540 2300 2270 2227 2194 2138 1895 731 630 413 43 --52419 1981 1814 1094 957 --
NM_007039chr1421705 28 ----11744
NM_007042chr352517 2500 2030 400 139 --31907 970 466 --
NM_007043chr1222027 1540 1364 ----
NM_007050chr20137773 7611 6067 5646 2814 1815 1787 1758 1695 1367 1122 657 233 15176 42829 1864 1679 624 47542 3121 2803 2165
NM_007051chr1248 25 ------
NM_007067chr1721433 293 11009 --11227
NM_007084chr132556 425 ------
NM_007106chr132757 549 ------
NM_007107chr312059 ------
NM_007124chr63634 511 496 ------
NM_007125chrY1186 21102 538 ----
NM_007126chr92117 101 ------
NM_007144chr173971 946 29 --194 --
NM_007146chr1712210 12178 22728 581 --
NM_007153chr1974279 3773 3168 3033 1646 1602 737 --43088 1489 368 30 --
NM_007158chr11211 11082 ----
NM_007159chr321347 638 ------
NM_007162chr65456 233 199 166 37 ------
NM_007166chr1111122 --1451 --
NM_007170chr1174 ------
NM_007174chr125738 705 550 290 102 --21709 812 --
NM_007175chr833230 3206 2652 21323 378 ----
NM_007178chr12166 ------
NM_007185chr11728 --4720 427 153 70 1412
NM_007189chr731434 1080 65 1312 51512 1354 1212 254 125 1402
NM_007191chr121659 ------
NM_007192chr142891 40 ------
NM_007195chr1852811 2673 2364 1281 396 --11466 11235
NM_007197chr121278 --1719 --
NM_007200chr15134646 4618 4216 4169 3795 3572 3519 2914 1688 1336 1009 476 131 --23800 118 21668 49
NM_007207chr11752 ------
NM_007212chr121455 1434 ------
NM_007213chrX----6569 549 254 219 186 157 153
NM_007214chr61493 ------
NM_007216chr112755 253 1941 ----
NM_007217chr3194 ------
NM_007221chr11278 --1314 2383 111
NM_007222chr811289 2580 350 ----
NM_007236chr1541769 1590 362 289 ------
NM_007245chr164740 587 335 162 --2603 186 --
NM_007249chr13109195 8254 7159 5866 3177 2912 2742 1646 1517 556 ------
NM_007260chr12663 295 ----134
NM_007270chr741489 1308 1062 512 11333 --1576
NM_007271chr641453 697 550 367 ------
NM_007275chr32480 285 --2400 351 --
NM_007278chr17----1148 --
NM_007282chr33795 375 226 ------
NM_007286chr532093 1964 94 --1168 2845 674
NM_007292chr1784420 3795 3625 3433 1965 1879 1247 1231 --15052 --
NM_007294chr173305 137 96 --11283 --
NM_007295chr173305 137 96 --11283 --
NM_007296chr173305 137 96 --11283 --
NM_007297chr173305 137 96 --11283 --
NM_007298chr173305 137 96 --11283 --
NM_007299chr173305 137 96 --11283 --
NM_007300chr173305 137 96 --11283 --
NM_007302chr173305 137 96 --11283 --
NM_007303chr173305 137 96 --11283 --
NM_007304chr173305 137 96 --11283 --
NM_007305chr173305 137 96 --11283 --
NM_007327chr971124 930 855 739 474 349 69 1939 31064 187 124 175
NM_007331chr442596 2575 2138 300 ------
NM_007349chr71103 ------
NM_007350chr1254491 4455 3803 1259 526 ------
NM_007353chr793027 2116 1912 1034 732 531 392 148 38 --2668 523 --
NM_007358chr121902 140 ------
NM_007363chrX159 ------
NM_007368chr135998 365 334 302 56 --1318 1121
NM_007371chr92671 561 --1567 --
NM_007373chr1011841 ------
NM_009588chr61205 ------
NM_012064chr122852 405 --164 --
NM_012074chr1421150 751 ------
NM_012081chr5------13335
NM_012082chr81682 1157 --160
NM_012083chr103952 321 161 --21105 95 --
NM_012090chr111071 --1967 --
NM_012095chr1053398 3249 3163 2926 2661 --13083 --
NM_012097chr211511 11876 ----
NM_012099chr193803 259 218 --21151 1131 --
NM_012102chr14830 602 558 217 ------
NM_012104chr1141369 788 754 286 --22829 668 --
NM_012104chr1141369 788 754 286 --22829 668 --
NM_012115chr61536 ------
NM_012120chr632913 1830 904 --1872 --
NM_012124chr11--1268 ----
NM_012134chr151739 1725 1706 1617 1490 --21235 366 --
NM_012137chr142867 2814 1091 984 ------
NM_012154chr83597 291 52 --179 --
NM_012156chr2053007 2132 1331 1076 104 22225 2204 ----
NM_012160chr62531 474 ------
NM_012161chr411147 ------
NM_012168chr1128 ------
NM_012180chr41531 ------
NM_012193chr11135219 4711 4523 4300 4174 4086 4043 3781 2173 2015 1512 1358 956 11428 ----
NM_012199chr173861 2993 910 898 608 364 184 14355 22870 691 34570 4360 3476
NM_012214chr2114967 4296 4227 2476 2276 2075 1718 1704 1576 1424 231 14255 44338 4315 2509 1510 15208
NM_012215chr102105 82 ------
NM_012229chr10----21244 1076 --
NM_012234chr322407 594 --22604 1239 --
NM_012238chr1021628 1424 --11110 --
NM_012244chr1471513 1500 1372 1305 621 545 244 --3712 687 188 --
NM_012247chr1011020 ------
NM_012249chr233338 1117 464 --1354 --
NM_012250chr1141346 1082 448 91 ------
NM_012252chr733527 3470 693 ------
NM_012257chr71777 ----1665
NM_012259chr61203 ------
NM_012262chr144417 3901 3853 67 14232 ----
NM_012264chr2241536 746 346 301 1740 61683 1600 835 354 213 67 --
NM_012264chr2241536 746 346 301 1740 61683 1600 835 354 213 67 --
NM_012268chr191207 ------
NM_012272chr121323 ------
NM_012282chrX2564 277 --1296 --
NM_012285chr171105 --1475 --
NM_012287chr394315 3785 3710 1740 1695 1474 1350 1313 660 24392 1304 --11530
NM_012289chr19--134 ----
NM_012293chr281985 1596 1484 907 729 590 386 128 --1912 --
NM_012294chr763459 3290 2778 1134 167 139 11314 33272 2819 2641 1288
NM_012296chr11103714 2807 2531 427 403 382 286 212 120 114 33396 3354 1477 83523 3244 3033 2686 2648 2420 876 854 11461
NM_012297chr42921 96 ------
NM_012300chr522203 1638 1143 ----
NM_012302chr13307 241 74 ------
NM_012304chr562338 2097 1712 1602 601 101 22407 695 1612 --
NM_012307chr18--21047 125 ----
NM_012309chr11154103 3843 3812 3782 1760 1636 1358 1202 1122 1093 818 684 450 410 265 11567 24136 3542 --
NM_012311chr10----1598 --
NM_012316chr1135375 5329 5271 4862 4777 3887 2067 1832 1359 641 97 60 44 --65176 5012 4697 4485 4188 3665 --
NM_012318chr431239 1070 424 ------
NM_012323chr2291385 1082 1008 1001 619 159 46 39 25 --21471 1305 --
NM_012325chr2041514 1347 1104 639 11282 ----
NM_012326chr23715 698 298 --1802 --
NM_012343chr51273 ------
NM_012381chr6160 ------
NM_012384chr20122252 2065 1970 1820 1776 1707 950 922 858 627 427 52 --1874 11722
NM_012399chr2231962 1504 1373 --11796 --
NM_012402chr1151303 1264 363 352 52 --11390 --
NM_012405chr183715 2941 2804 2760 2451 939 766 47 13736 ----
NM_012408chr20--1746 ----
NM_012416chr91307 1834 ----
NM_012428chr151163 1635 ----
NM_012446chr5142 ------
NM_012448chr1752267 2221 1713 934 842 --1907 --
NM_012455chr281442 1253 1233 1148 604 458 225 214 31085 439 292 41381 1336 550 231 --
NM_012461chr143665 284 187 ------
NM_012471chrX31656 434 425 11464 ----
NM_012473chr22157 --2134 72 1296
NM_012475chr11226 --1186 --
NM_012479chr73935 684 217 --12653 --
NM_012482chr1--1274 1665 --
NM_013233chr221276 1146 ------
NM_013235chr52810 69 ------
NM_013246chr112822 151 --3845 330 63 --
NM_013247chr21570 ------
NM_013250chr111403 ------
NM_013253chr1131421 549 161 ------
NM_013255chr7108755 7653 7429 5964 5507 3162 2594 2504 1703 66 --16333 --
NM_013261chr433762 1170 623 12991 12888 --
NM_013269chr1211075 2721 655 23522 3516 --
NM_013272chr151337 ------
NM_013275chr162567 204 ------
NM_013279chr1172282 1976 1794 1736 940 728 172 --41531 660 448 103 --
NM_013281chr2011307 ------
NM_013282chr192492 387 11146 ----
NM_013305chr184880 793 187 131 ------
NM_013309chr1532328 2216 427 12279 22170 144 --
NM_013312chr19183 --124 156
NM_013313chr2241235 688 444 88 1909 63537 2621 2567 1181 774 611 --
NM_013316chr72793 78 165 ----
NM_013330chr11197 ------
NM_013335chr2----268 27 --
NM_013336chr391934 1849 1487 1444 1416 1375 804 730 223 --11632 11738
NM_013341chr222307 1109 --32401 2216 423 --
NM_013372chr1542906 2339 114 42 11061 ----
NM_013381chr122547 244 ------
NM_013382chr14102335 2319 2003 1617 842 717 706 194 79 53 --32008 135 23 --
NM_013390chr971450 1230 1157 475 366 344 162 ----1533
NM_013392chr2280 59 --1288 --
NM_013417chr9130 ------
NM_013423chrX----1201 152
NM_013427chrX----1201 152
NM_013433chr1961921 765 733 721 461 300 1288 ----
NM_013434chr291995 1911 1836 1773 1634 524 314 239 73 11869 71765 1558 1509 1244 775 431 244 21505 1326
NM_013434chr291995 1911 1836 1773 1634 524 314 239 73 11869 71765 1558 1509 1244 775 431 244 21505 1326
NM_013438chr911156 --11582 --
NM_013444chrX1936 ------
NM_013449chr1262982 2926 2173 1022 930 526 --32121 825 768 --
NM_013951chr2142452 1965 1613 1531 975 908 865 730 509 484 459 289 283 47 1896 1740 1446
NM_013952chr2132529 2042 1690 1608 985 942 807 586 561 536 366 360 124 1973 1817 1523
NM_013953chr2132529 2042 1690 1608 985 942 807 586 561 536 366 360 124 1973 1817 1523
NM_013958chr8--1328 ----
NM_013959chr8--1328 ----
NM_013960chr85548 288 252 161 34 --1300 --
NM_013961chr8--1328 ----
NM_013962chr8--1328 ----
NM_013989chr1451897 1261 541 534 147 --14335 14798
NM_013992chr2132529 2042 1690 1608 985 942 807 586 561 536 366 360 124 1973 1817 1523
NM_013993chr63560 284 246 2681 107 1571 --
NM_013994chr63560 284 246 2681 107 1571 --
NM_013995chrX12031 198 1102 --
NM_013999chr1771297 1202 449 389 236 139 129 --1225 --
NM_014002chr12652 474 1109 1517 --
NM_014007chr92896 238 --2194 142 --
NM_014015chr163527 516 60 ------
NM_014023chr1042210 363 146 80 --11144 --
NM_014028chr61914 12663 12160 --
NM_014039chr112977 189 --1891 --
NM_014045chr14180 --1399 --
NM_014048chr1654722 3493 3465 1503 399 23914 818 ----
NM_014079chr3----2747 21 1113
NM_014096chr113693 511 24 1519 ----
NM_014106chr153942 685 410 ----12135
NM_014109chr811125 ------
NM_014112chr833756 3673 1097 --24030 638 --
NM_014154chr3----1473 --
NM_014155chr11107372 6936 6924 6709 6156 5526 2206 1530 1363 972 --16910 16623
NM_014160chr321346 402 ----11237
NM_014191chr121737 --1756 --
NM_014217chr121203 449 ------
NM_014231chr1241891 1677 808 705 21362 441 11809 1109
NM_014232chr1751453 149 86 73 54 --21250 302 --
NM_014232chr1751453 149 86 73 54 --21250 302 --
NM_014233chr1731365 205 191 1374 1264 --
NM_014238chr1751463 1236 626 567 129 --1400 --
NM_014240chr383839 3597 3374 3337 3085 2834 1556 1287 33328 1539 384 23760 2584 --
NM_014246chr2242125 410 401 117 12179 2749 353 --
NM_014250chr2211353 21643 1544 11923 --
NM_014253chrX31947 1581 502 --1442 --
NM_014263chr1031308 976 248 --21066 574 --
NM_014268chr184962 902 193 143 ------
NM_014271chrX1570 154 ----
NM_014275chr55263 253 213 134 94 --4815 614 589 35 1705
NM_014280chr13636 608 274 ------
NM_014281chr8------2106 101
NM_014288chr1----1111 --
NM_014289chrX31400 409 220 ----11058
NM_014292chr2251674 1280 665 513 402 1234 61607 1400 1286 1182 601 86 --
NM_014294chr811253 ------
NM_014299chr1971983 1964 1943 1665 1543 1464 214 1460 31755 1381 261 --
NM_014309chr2295409 5060 4600 4316 4264 3947 3574 644 23 24876 4662 24980 3552 12010
NM_014316chr1682184 2013 1360 772 415 327 181 105 31884 1641 195 11834 --
NM_014319chr1211637 11314 ----
NM_014321chr162671 195 2782 139 2556 504 --
NM_014323chr221916 --1273 --
NM_014333chr1112064 ------
NM_014351chr2251139 979 950 201 51 ------
NM_014368chr951983 1471 729 260 54 31687 1593 1331 11724 --
NM_014381chr1483160 3144 3012 2614 2239 1266 1081 89 32953 2053 105 22582 1166 12986
NM_014382chr31163 1510 ----
NM_014388chr1155765 5670 5491 4737 4517 4394 4040 3732 2433 2368 2314 2166 1142 640 489 24135 532 25113 1229 --
NM_014390chr73539 360 111 --3399 43 28 1484
NM_014399chr71678 ------
NM_014405chr1772152 2134 1629 1528 628 582 114 11512 42034 1866 1809 30 --
NM_014408chr11487 ------
NM_014409chr121013 154 --1398 --
NM_014417chr191349 --5856 754 171 160 120 1167
NM_014423chr524968 3421 14473 ----
NM_014445chr3--1519 ----
NM_014452chr61913 ------
NM_014454chr62912 847 ------
NM_014470chr121328 1552 ----
NM_014488chr111204 ------
NM_014491chr73974 887 126 --1150 --
NM_014507chr2241215 804 753 70 --1838 --
NM_014515chr121655 ------
NM_014517chr321667 305 --1231 --
NM_014520chr173465 170 25 ------
NM_014554chr1232260 689 308 --3298 91 45 --
NM_014563chrX42020 1402 698 367 ----11448
NM_014567chr16----2108 51 --
NM_014569chr741307 1274 1034 138 --11242 --
NM_014571chr172052 783 717 433 405 181 126 --62702 2641 2625 2156 825 195 --
NM_014592chr5125 ------
NM_014601chr1951462 645 538 476 106 --51272 456 320 218 41 --
NM_014603chr1781531 1245 1230 1162 537 464 224 21 1167 51617 1601 631 280 271 1212
NM_014607chr23414 299 254 ------
NM_014612chr911033 ------
NM_014615chr1642495 777 436 334 --12309 --
NM_014630chr1563447 2658 2639 470 372 200 --3840 414 164 --
NM_014632chr11289 73 ------
NM_014634chr22173394 3301 3280 3253 3111 3089 2693 2676 2669 2637 2392 2363 1441 1373 496 157 138 --53117 2738 501 430 259 12734
NM_014635chr221529 206 --1490 --
NM_014636chr994229 3836 3419 1104 922 775 609 188 73 ----1303
NM_014640chr22275 81 --165 --
NM_014646chr1862889 2827 2799 2031 448 157 23101 184 31104 598 91 11100
NM_014647chr1631499 482 407 ----11992
NM_014657chr203273 76 49 --1279 --
NM_014659chr153829 180 98 --2396 226 1107
NM_014660chr72918 799 122 ----
NM_014661chr10143881 3845 3429 2979 2751 2714 2617 2570 1152 901 819 464 200 48 22688 256 32379 1233 1121 --
NM_014665chr8183601 3581 3539 3323 3131 3003 2737 2697 2523 2492 2290 997 959 835 741 689 672 482 22765 2379 73524 3097 2906 2329 1047 694 645 --
NM_014674chr342904 1232 470 71 --23486 1468 --
NM_014676chr111349 11176 11050 --
NM_014682chr841423 887 673 146 ------
NM_014686chr1971815 1605 767 698 328 216 160 --21691 96 --
NM_014690chr772897 2607 1155 1132 1070 790 721 12157 33044 810 129 1468
NM_014701chr153987 637 31 ------
NM_014702chr643027 841 692 535 ------
NM_014705chr71103 12102 ----
NM_014710chrX1167 1715 ----
NM_014712chr162530 156 --2439 74 --
NM_014713chr2137 ------
NM_014715chr11130 ------
NM_014718chr122593 577 2727 708 3599 183 123 --
NM_014719chr71443 --11007 1839
NM_014726chr1751165 902 874 199 176 ----1511
NM_014727chr19166 --183 --
NM_014730chr12165026 4908 4883 4346 4331 4312 3440 3354 1922 1542 1401 1381 1209 201 166 52 14168 21027 232 --
NM_014730chr12165026 4908 4883 4346 4331 4312 3440 3354 1922 1542 1401 1381 1209 201 166 52 14168 21027 232 --
NM_014731chr2031530 1322 1207 1191 41438 1427 570 339 --
NM_014733chr511457 ----11964
NM_014735chrX32106 1865 1395 11376 ----
NM_014736chr152986 898 ----1690
NM_014739chr624059 308 ------
NM_014742chr203615 542 513 --51488 1386 582 547 519 --
NM_014743chr432456 945 198 ------
NM_014747chr185025 4710 1519 1473 1158 898 585 139 23740 1771 33704 3521 1193 --
NM_014748chr21396 ------
NM_014754chr82796 314 ------
NM_014755chr253648 3506 3489 3228 1197 12726 11369 --
NM_014758chr1182203 1785 1708 1582 858 608 447 64 --11642 11965
NM_014759chr841416 1257 219 119 21650 61 1193 --
NM_014761chr1621137 826 --1399 --
NM_014762chr152032 1590 701 544 513 2166 130 22210 772 --
NM_014765chr12682 69 11705 ----
NM_014767chr10123262 3193 3091 2655 2559 2453 1337 1256 916 650 573 397 13641 83545 3337 3077 2696 2480 1323 622 416 1412
NM_014770chr1241155 1045 1009 145 --41165 1141 987 461 1210
NM_014771chr1641010 931 872 173 1216 2839 116 --
NM_014772chr18183604 3275 3229 3020 2913 2865 2774 2408 2256 1449 1282 626 617 564 537 462 367 138 127 53301 1191 1172 818 202 --
NM_014774chr153011 2544 2457 957 82 ----11155
NM_014784chr11132 1214 ----
NM_014788chr9122894 2671 2057 1992 1236 1085 751 495 330 124 49 24 12486 42757 1224 552 418 --
NM_014795chr21142 ------
NM_014797chr662735 2655 2512 2470 2442 1192 --2528 50 --
NM_014800chr72351 160 1240 3767 304 145 --
NM_014803chr10----1372 --
NM_014806chr92507 392 ------
NM_014807chr111323 2541 38 1560 --
NM_014810chr183543 3452 2553 2518 1407 1330 786 172 ------
NM_014819chr5------12463
NM_014824chr1151752 1729 329 263 60 ------
NM_014826chr163454 3367 3105 2705 1414 1271 23737 2938 13801 1178
NM_014827chr111469 1547 ----
NM_014830chr12122908 2527 1401 902 786 704 665 561 495 365 190 82 21238 1119 2511 309 12666
NM_014832chr13------1722
NM_014836chr1011369 ------
NM_014840chr1262634 2624 2587 2336 258 145 33332 2095 800 ----
NM_014841chr611173 ------
NM_014844chr14114169 3795 3764 3173 2638 1588 1212 431 402 309 179 11292 33259 2704 1520 --
NM_014847chr12364 50 2357 124 ----
NM_014849chr121102 518 --1826 --
NM_014850chr354504 4161 1257 242 175 31962 166 51 21862 1668 --
NM_014853chr1781344 1307 1287 444 309 285 219 86 --21321 469 11317
NM_014858chr161172 947 302 200 125 41 --21086 928 --
NM_014868chr122559 183 1341 ----
NM_014870chr1134562 4205 4170 3476 3267 1547 1490 1437 900 846 781 653 613 11539 44548 3844 1528 1518 --
NM_014872chr931923 906 93 --12184 --
NM_014873chr163960 3016 1496 1317 524 501 31271 907 634 ----
NM_014876chr2231834 42 32 --11547 --
NM_014877chr17127105 6997 6847 6827 6773 6063 6019 5232 2879 2468 1698 1596 16432 12076 15366
NM_014883chr491584 957 913 888 809 579 112 83 70 12383 ----
NM_014890chr3------124
NM_014891chr761552 1402 586 499 401 99 11620 31538 1489 1322 --
NM_014893chrY21815 352 --1576 --
NM_014897chr1732711 2578 458 --13264 --
NM_014901chr511461 1145 31895 1442 601 1631
NM_014902chr2071549 1469 1105 523 420 387 176 1377 21171 302 21330 298
NM_014903chr1212411 12136 1518 --
NM_014905chr231837 1548 1520 --1681 --
NM_014906chr1722911 1327 --11391 --
NM_014909chr1483651 3590 3261 3213 2964 2648 1044 739 21008 547 83968 3354 3158 2936 1109 745 417 67 3862 764 137
NM_014917chr12289 251 ------
NM_014921chr1982707 2554 1905 1224 999 208 143 127 32631 2397 302 72957 2489 2401 1083 1009 770 222 1737
NM_014923chr13--11803 ----
NM_014925chr122375 302 --1345 --
NM_014926chr3--1785 ----
NM_014931chr192601 453 1486 3660 632 565 --
NM_014932chr311906 ------
NM_014935chr1133760 3491 3402 2892 2604 2375 1464 1356 1188 1117 962 499 316 12638 2455 216 23199 3003
NM_014938chr1272282 1848 1596 921 828 191 96 32008 762 270 3521 393 80 1126
NM_014939chr1831278 1087 401 ------
NM_014941chr22121 ------
NM_014944chr131056 342 199 --165 --
NM_014945chr541914 1846 604 567 ------
NM_014947chr152182 1996 1163 1028 213 --12095 --
NM_014949chr12334 315 ------
NM_014951chr1042570 1607 925 280 --1730 --
NM_014952chr1541362 489 455 416 --21766 1721 --
NM_014961chr4----21381 350 --
NM_014964chr17112377 2365 2291 2213 1910 954 400 303 192 151 117 --42087 1879 1743 379 --
NM_014974chr1021533 1480 --11385 --
NM_014977chr145456 438 198 41 32 ------
NM_014978chr1031388 1222 241 ------
NM_014982chr1454767 3634 3547 1550 658 --1853 --
NM_014989chr611516 ------
NM_014990chr141160 1188 ----
NM_014991chr44912 734 616 64 ------
NM_014992chr142550 42 ------
NM_014994chr15172195 2048 1917 1746 1667 925 807 770 699 572 480 433 288 221 139 131 56 --11904 --
NM_014997chr772620 2605 2128 2012 1973 1893 1853 1625 12178 --
NM_015000chr1222746 182 ------
NM_015001chr12124 70 1213 ----
NM_015002chr1221976 173 --11669 --
NM_015008chr363148 2858 2457 673 649 263 ------
NM_015011chr13----11123 --
NM_015017chr131279 338 301 1292 ----
NM_015020chr165944 582 389 221 185 22649 806 1403 --
NM_015023chr191658 1628 1572 1294 1247 1205 1188 1181 442 --51735 1446 1174 211 25 --
NM_015024chr811287 --2980 262 --
NM_015025chr222154 1703 ------
NM_015026chr1244595 3597 1223 861 --1468 --
NM_015027chr1621915 536 --11703 --
NM_015033chr9112557 2520 2141 2132 1207 1072 775 345 237 160 110 2323 96 2745 178 1872
NM_015035chr20116074 5432 4948 4671 4117 4075 2679 2445 2367 937 34 32156 1846 150 45835 5518 5352 4122 --
NM_015039chr1113996 3567 3402 3035 2693 1717 1640 1551 1016 255 49 12650 33534 1384 614 23687 938
NM_015042chr1584113 3668 3317 1066 1022 967 647 245 44217 3817 1110 318 34071 3278 376 13294
NM_015045chr1021393 387 ------
NM_015051chr933078 2974 1330 22581 2372 ----
NM_015052chr72959 222 11373 ----
NM_015061chr91875 ------
NM_015063chr1971309 978 894 881 527 487 181 --4507 494 361 291 21356 243
NM_015064chr12113566 3403 2679 2603 2525 1456 1185 1093 1033 161 23 11382 53646 3486 2221 1014 50 --
NM_015070chr1321484 520 11197 ----
NM_015071chr5106375 5895 5643 5113 4823 4231 2468 2247 616 179 12453 35252 4009 1136 --
NM_015073chr19121705 1695 1594 803 741 664 353 300 234 182 82 76 --21441 318 --
NM_015074chr164593 4007 3637 3270 1402 1237 24574 3473 64093 3927 3341 3185 1323 1158 13276
NM_015075chrX132082 2003 1850 1584 753 714 659 603 501 424 393 376 349 1272 42070 2044 1992 470 31614 627 578
NM_015076chr622852 1675 13212 11484 233 28
NM_015077chr17214086 3971 3959 3905 3861 3725 3412 3301 1820 1270 1164 912 873 832 811 678 562 450 373 78 66 1895 74357 3013 1718 1582 825 646 22 11305
NM_015079chr1563197 2492 836 679 523 403 --62752 2462 800 745 394 52 --
NM_015080chr115821 264 230 205 29 ------
NM_015082chr542493 1917 376 58 --12262 --
NM_015090chr1135298 5278 5101 4358 4346 2463 2389 1753 1725 1594 1494 1157 194 44690 4131 1923 1439 55728 4680 4363 1379 610 --
NM_015091chr14--1135 ----
NM_015092chr1654580 4318 1680 731 63 --11766 --
NM_015093chr621268 1168 21213 147 ----
NM_015094chr22173901 3618 3566 3228 3084 3009 2927 1886 1770 1739 1725 1611 1599 1473 1467 441 164 11297 53044 1661 1406 242 208 12853
NM_015100chr141865 1773 1724 1664 ------
NM_015102chr1295 37 ------
NM_015103chr311004 1394 1379 --
NM_015107chrX61876 1678 1502 956 924 244 11546 42170 1928 1804 413 1470
NM_015110chr962193 2059 2015 1867 1615 335 ------
NM_015113chr1752367 2352 2082 2062 502 1400 3445 274 103 --
NM_015115chr423136 808 --2970 154 --
NM_015133chr1681131 1076 591 532 482 254 244 80 11205 31209 964 65 1263
NM_015138chr152852 130 1953 21005 194 --
NM_015150chr32923 293 --2271 250 --
NM_015155chr1062509 2454 2380 2260 888 664 23201 3151 1821 --
NM_015156chr1463371 1360 931 327 318 78 1812 23496 139 --
NM_015163chr143155 71 24 31336 1235 248 ----
NM_015170chr841970 1926 1551 322 1539 1525 --
NM_015171chr161364 1334 153 --
NM_015176chr12612 335 ------
NM_015191chr1152660 2502 2335 2215 1672 12177 2802 67 --
NM_015193chr891106 1086 958 600 521 469 288 241 107 21310 1225 51324 1280 506 42 24 --
NM_015194chr1791874 1853 1401 859 735 562 515 508 32 21599 592 31825 555 442 2457 59
NM_015199chr352854 2565 2150 2038 725 12131 ----
NM_015200chr4153 ------
NM_015205chr13144742 4261 4229 4133 4042 3519 1969 1922 1859 1110 866 775 546 56 24490 895 64467 4271 4212 4103 1562 835 13946
NM_015206chr1523737 3025 --12606 --
NM_015213chr113808 523 51 ------
NM_015215chr122290 2201 1709 12394 --
NM_015219chr17102419 2271 2216 2099 2035 1029 945 630 194 182 31702 982 395 31808 1590 661 1358
NM_015221chr1051383 1309 1254 976 46 167 125 --
NM_015225chr922898 752 21995 1978 --12289
NM_015229chr175357 295 282 34 26 --3878 476 367 --
NM_015233chr1362626 2468 1804 1676 1026 613 ------
NM_015245chr692801 2722 2431 2319 2274 2234 932 626 90 22479 447 1406 --
NM_015247chr1635314 3795 950 21621 837 33583 1744 1544 --
NM_015250chr93583 450 49 --133 --
NM_015251chr1672142 1674 1653 1508 901 815 319 ------
NM_015254chr832354 845 67 --3526 474 41 --
NM_015263chr15--1907 ----
NM_015265chr222050 1672 ------
NM_015267chr121370 ----11666
NM_015268chr3160 ------
NM_015270chr1292210 2133 2040 1753 1553 815 677 576 522 --41892 1584 1547 260 --
NM_015271chr443859 1246 955 571 --22943 558 --
NM_015272chr1612073 --11731 --
NM_015278chr662886 2103 989 766 347 302 13328 ----
NM_015282chr272818 2160 2139 326 266 145 89 --22073 660 --
NM_015284chr191827 1807 1785 1743 1642 1521 377 360 281 --51920 771 473 166 85 11948
NM_015285chr1872266 2249 2057 1981 974 772 446 ----1354
NM_015288chr592748 2567 1405 872 749 596 489 218 79 157 33830 3787 2593 4819 674 388 327
NM_015289chr1551812 1712 1616 298 181 ------
NM_015293chr61124 ------
NM_015296chr131829 --1106 --
NM_015299chr14103914 3425 3248 2826 2717 1472 915 211 186 37 33198 2973 1404 1191 23452 54
NM_015305chr141735 --31406 414 203 1509
NM_015310chr8137874 7818 7632 7202 7161 6584 5709 2651 1327 1260 774 670 457 27522 1397 13058 27710 7040
NM_015315chr5103177 2829 2776 2747 2651 2200 2117 635 509 346 1423 22841 73 1678
NM_015316chr1421322 35 11257 11034 11352
NM_015317chr232260 2161 206 12291 ----
NM_015319chr124345 325 309 61 --1170 --
NM_015326chr1112680 2654 651 557 436 381 329 302 232 221 207 11869 22477 2277 --
NM_015327chr161205 1180 1120 536 512 268 --1254 --
NM_015328chr732405 1968 723 --1752 --
NM_015331chr1------2561 29
NM_015335chr124354 257 235 118 156 1383 1474
NM_015336chr1222647 2267 ------
NM_015338chr2071360 1273 1215 1197 725 386 225 --21842 230 --
NM_015339chr203668 385 38 ------
NM_015345chr692713 2366 2217 1923 1050 928 725 546 365 --22610 1061 --
NM_015346chr1421694 1314 11344 ----
NM_015349chr663017 2538 1871 1184 602 554 --1114 11190
NM_015356chr8----147 --
NM_015365chrX63446 3312 3113 2962 2824 21 33299 2914 576 13484 11368
NM_015374chr2231012 196 28 --31210 945 510 --
NM_015375chr184692 4282 3771 3184 1900 1811 1305 776 1198 44368 4202 1986 943 14600
NM_015378chr172758 2481 2337 2319 2162 1820 1018 --32716 2618 67 --
NM_015381chr22101908 1899 1886 1398 819 707 332 263 182 64 1358 31556 362 274 --
NM_015382chr141192 1632 ----
NM_015385chr1053011 604 446 432 258 12749 22357 348 1419
NM_015388chr62231 73 --126 --
NM_015396chr321013 904 11476 166 --
NM_015401chr123386 128 71 ------
NM_015404chr92559 412 --251 38 2580 141
NM_015417chr201456 ------
NM_015435chr8--1540 ----
NM_015439chr62396 62 ------
NM_015442chr31198 ------
NM_015443chr172533 352 ------
NM_015444chr31224 ------
NM_015446chr11367 1172 ----
NM_015449chr1137 ------
NM_015455chr573888 3578 1475 896 641 577 24 ------
NM_015457chr11--11006 11073 --
NM_015460chr341834 615 573 41 ------
NM_015466chr31215 ------
NM_015470chr221238 386 --1434 --
NM_015477chr152733 154 ------
NM_015481chr123973 888 43 --2309 71 1741
NM_015483chr71279 ------
NM_015484chr1----1770 --
NM_015493chr1962009 1603 875 843 708 24 --31998 796 181 --
NM_015503chr163594 212 49 --1634 --
NM_015508chr321086 549 1319 ----
NM_015509chr1221425 603 ------
NM_015520chr352203 1981 585 414 262 ------
NM_015526chr1931357 906 480 11424 21204 129 --
NM_015531chr11----142 --
NM_015534chr12800 151 ------
NM_015535chr263770 1569 1171 992 853 156 21602 327 33949 3064 1176 --
NM_015537chr961087 978 926 865 196 23 2433 425 1810 1417
NM_015542chr1021229 881 --1165 --
NM_015550chr733077 2627 478 ------
NM_015557chr1113531 3501 3444 3409 3068 2850 2508 2487 1188 550 43 23171 470 1627 33400 747 177
NM_015564chr522493 2314 ------
NM_015568chr20154289 4247 4198 3872 3313 3003 2785 1576 1286 1244 1121 710 671 575 68 11108 83988 2687 1464 1442 1327 1169 286 139 21113 61
NM_015569chr124565 251 ------
NM_015570chr711172 1202 ----
NM_015571chr622304 521 ------
NM_015576chr352872 2136 817 445 75 ------
NM_015609chr152689 2644 2493 1987 901 22583 2531 32756 2675 2454 11150
NM_015630chr2157 ------
NM_015635chr952099 2056 1796 1619 1401 ------
NM_015638chr201201 ------
NM_015642chr31220 ------
NM_015649chr19------187
NM_015651chr941803 1679 1499 70 21756 1724 31472 441 183 11873
NM_015678chr131191 --1384 --
NM_015686chrX32394 165 44 11791 2353 50 12131
NM_015695chr63630 521 283 --1766 1686
NM_015711chr193706 675 72 --1550 --
NM_015716chr172553 223 --3771 274 41 1598
NM_015719chr19--1559 2563 197 1777
NM_015834chr212929 735 --1369 --
NM_015844chr182899 168 1784 ----
NM_015846chr182899 168 1784 ----
NM_015847chr182899 168 1784 ----
NM_015850chr82232 59 1165 21532 606 --
NM_015855chr112800 361 1182 2774 273 --
NM_015866chr11453 ------
NM_015872chr161729 1363 1175 690 272 124 --41675 1546 726 583 --
NM_015878chr8--1670 ----
NM_015879chr18148545 8361 7822 7285 7142 6617 5789 5756 2652 1499 1362 1068 704 337 22699 1436 25854 5205 2888 715
NM_015881chr1131421 549 161 ------
NM_015891chr611257 1612 11343 --
NM_015895chr61207 ------
NM_015898chr1942282 1688 1534 333 --22449 234 --
NM_015902chr83899 789 233 ------
NM_015905chr7--1154 ----
NM_015906chr144468 4160 3767 878 ------
NM_015912chr842172 2053 935 310 ------
NM_015955chr2------162
NM_015981chr552235 2190 2120 1019 705 --22459 287 --
NM_015982chr173284 170 126 --2352 289 --
NM_015984chr1----1123 --
NM_015989chr122246 24 --2166 71 --
NM_015995chr15145422 4936 3657 3442 3388 3363 1804 1757 1680 1343 1311 654 516 375 13719 63834 3695 1231 739 505 414 --
NM_016009chr144630 3521 1931 118 11762 13441 --
NM_016016chr173318 250 66 ------
NM_016019chr731001 111 25 ------
NM_016020chr6--125 ----
NM_016021chr622091 1890 --11927 --
NM_016022chr12194 184 --271 65 --
NM_016026chr141387 1272 2506 122 --
NM_016041chr17129 ------
NM_016059chr6251 24 ------
NM_016062chr16123 --150 --
NM_016072chr1222192 303 --11995 --
NM_016073chr152926 757 ------
NM_016076chr152942 2634 2309 1224 554 1133 ----
NM_016083chr622906 741 ----11560
NM_016096chr81644 1219 ----
NM_016098chr6147 ------
NM_016120chrX1462 ------
NM_016131chr2--1249 ----
NM_016147chr1151069 951 934 921 100 1752 1408 1214
NM_016152chr32292 213 --1992 --
NM_016169chr1082489 2120 1209 1007 734 335 272 40 2367 139 53198 1023 988 976 871 51272 1261 688 422 188
NM_016201chr392064 902 577 476 444 259 110 78 65 2307 222 1881 --
NM_016205chr441100 270 185 21 ------
NM_016206chr357502 7082 2741 2649 2111 22567 2492 --1883
NM_016223chr11153 ------
NM_016235chr1621158 134 ------
NM_016250chr14----2182 34 --
NM_016257chr142896 1018 610 497 22706 2522 5477 471 218 123 101 1684
NM_016258chr11749 ------
NM_016260chr276696 5617 1970 1912 1879 976 742 21574 263 ----
NM_016264chr191366 --2504 193 --
NM_016269chr431106 840 118 ------
NM_016271chr1821723 735 ------
NM_016272chr224959 782 486 212 21798 1009 41949 1759 1733 562 31837 1715 140
NM_016277chr641335 1242 1036 62 ------
NM_016281chr121441 ------
NM_016284chr166950 870 666 645 147 85 --1104 --
NM_016287chr141371 1281 831 389 21417 785 ----
NM_016289chr211557 1149 ----
NM_016290chr51102 ------
NM_016291chr31104 ------
NM_016319chr123316 94 41 ------
NM_016322chr923224 2773 ------
NM_016340chr531169 1084 229 195 11194 1112
NM_016356chr622518 777 ------
NM_016364chr10--1210 149 --
NM_016376chr1753989 1729 1506 1149 1006 24351 910 43713 3316 1025 68 --
NM_016396chr1532855 2484 2286 12623 12613 --
NM_016418chr22133653 3574 3402 3392 2945 2652 1452 1160 1047 796 733 193 74 31069 1023 532 43683 536 404 211 23298 1009
NM_016423chr14----2362 114 1181
NM_016441chr252049 1667 1528 709 488 ------
NM_016451chr111123 ------
NM_016453chr3130 ------
NM_016470chr201347 ----1411
NM_016472chr141387 --1450 --
NM_016480chr52683 247 ------
NM_016484chrX3452 228 83 ------
NM_016485chr621854 166 271 52 ----
NM_016486chr13159 125 43 ------
NM_016490chr23316 258 246 123 1114 --
NM_016506chr111124 --1212 --
NM_016519chr42527 47 ------
NM_016522chr1141181 1065 330 123 21406 397 --1429
NM_016530chr1541644 1431 1286 1158 --32967 158 76 --
NM_016531chr433946 3713 1645 1602 ----
NM_016532chr1721035 234 --287 50 1919
NM_016542chrX--1565 ----
NM_016545chr11827 ------
NM_016559chr32535 158 1126 ----
NM_016569chr122165 98 --11239 134
NM_016574chr113742 55 27 1248 4781 275 215 60 2720 237
NM_016577chr363573 3485 2960 673 662 564 13128 24340 4092 2887 451
NM_016578chr111549 ------
NM_016586chr142516 137 ------
NM_016596chr123386 128 71 ------
NM_016598chr321419 1076 ------
NM_016603chr51618 ------
NM_016604chr521159 136 ------
NM_016605chr571970 1677 1033 710 390 243 216 22568 2313 2330 312 --
NM_016621chr11174448 4423 4331 4139 4113 3751 3578 3572 3548 3200 3110 1833 1714 1496 710 314 231 34374 3162 1102 44428 3326 3271 2942 13813
NM_016628chr101317 ------
NM_016631chr211753 ------
NM_016653chr221089 1072 ------
NM_016734chr951993 1781 744 310 284 --4583 345 295 64 21963 291
NM_016823chr1721220 1189 --21306 1139 --
NM_016829chr34531 293 160 67 --1172 --
NM_016834chr1783949 3742 3580 2684 2595 1623 749 99 --31347 1236 80 13102
NM_016835chr1783949 3742 3580 2684 2595 1623 749 99 --31347 1236 80 13102
NM_016841chr1783949 3742 3580 2684 2595 1623 749 99 --31347 1236 80 13102
NM_016929chr684582 4295 4218 4017 3916 789 237 63 1223 31397 242 147 --
NM_016936chr1662039 1534 1353 792 258 227 ------
NM_016946chr173399 3266 3222 2385 853 779 427 --12563 1891
NM_016952chr1163502 3265 1176 597 553 388 --34059 4053 2767 --
NM_016953chr285371 4484 4440 4402 4090 4014 2244 39 159 43700 2330 1844 1659 --
NM_017409chr121535 ------
NM_017413chrX31646 705 97 --31874 264 136 32327 711 222
NM_017415chr594371 4118 4078 4067 4059 3486 1734 967 732 1682 11702 --
NM_017420chr1433252 2938 192 12670 ----
NM_017426chr41180 ------
NM_017450chr1741116 1107 923 80 11243 2557 234 --
NM_017455chr151163 1635 ----
NM_017456chr1771749 1423 1307 750 561 267 199 ----11340
NM_017491chr41133 1260 ----
NM_017522chr121008 40 11129 ----
NM_017525chr11----3221 215 184 --
NM_017544chrX1365 ------
NM_017548chr321788 474 --2434 128 --
NM_017550chr196987 436 415 342 324 202 130 3830 817 786 --
NM_017551chr10--22583 1656 --11819
NM_017553chr153810 484 229 --3930 921 912 --
NM_017558chr161159 --1412 --
NM_017572chr19----134 --
NM_017575chr1771544 1518 1384 1360 578 510 295 11083 21585 1087 --
NM_017582chr121349 1322 --21741 1576 --
NM_017590chr2282221 1803 482 299 292 286 195 118 --31817 599 125 1691
NM_017592chr19132654 2069 1723 1072 986 866 848 821 792 330 311 206 88 22123 634 42488 1809 899 507 11031
NM_017594chr93929 830 520 ------
NM_017596chr1194370 3954 3687 3385 3258 1787 1759 1721 1649 1535 1525 1432 1305 1119 941 665 652 620 464 53742 1623 1411 568 371 73772 3350 2971 1751 1347 996 403 1992
NM_017599chr1221746 458 --1827 --
NM_017602chrX4875 667 335 206 ----2684 152
NM_017607chr191117 --1400 --
NM_017610chr1521403 778 ------
NM_017611chr113693 511 24 1519 ----
NM_017626chr1051440 1135 699 389 356 11599 1715 --
NM_017628chr474620 4270 4258 3299 1865 1182 1004 13753 24959 4058 13565
NM_017629chr151758 1510 267 118 46 ----11526
NM_017633chr633132 2940 649 --23059 91 --
NM_017634chr8--11218 11915 --
NM_017635chr11158 21541 614 ----
NM_017637chr989096 8947 7178 6378 3141 2866 1727 615 16027 47909 6031 339 30 --
NM_017643chr1742126 458 446 68 1563 1971 --
NM_017651chr621571 615 --1567 --
NM_017664chr13------153
NM_017668chr162686 548 ------
NM_017670chr113810 643 619 ------
NM_017672chr1521059 413 ------
NM_017676chr511897 --1713 1280
NM_017684chr153700 659 518 1202 ----
NM_017709chr163647 2824 2812 1524 876 111 ------
NM_017719chr341630 496 474 195 ------
NM_017724chr31285 ----1221
NM_017728chr17143092 2605 2569 2482 2440 2302 1865 1065 1050 712 491 204 174 140 --32253 1195 48 23038 2249
NM_017730chr32201 33 ------
NM_017736chr1652050 2035 285 180 149 3734 532 371 ----
NM_017737chr1--1716 1356 --
NM_017739chr12519 452 --157 --
NM_017740chr1631524 1251 183 177 ----
NM_017741chr442798 1025 919 782 21120 76 42319 2153 423 257 --
NM_017744chr131688 948 342 --1925 --
NM_017745chrX1140 ------
NM_017763chr1751053 470 404 252 240 1919 2931 189 --
NM_017770chr632783 758 33 1764 ----
NM_017772chr641149 474 454 88 11394 ----
NM_017778chr811274 21072 351 11228 1239
NM_017780chr82807 797 ------
NM_017784chr33845 758 34 ------
NM_017787chr1062724 2302 2173 1891 1000 951 2438 424 ----
NM_017789chr23252 134 68 --2782 198 --
NM_017798chr20174 ------
NM_017799chr1431711 1345 259 ------
NM_017801chr32937 556 1279 1996 --
NM_017810chr162488 77 --182 --
NM_017811chr952870 2297 2177 537 126 ------
NM_017813chr875001 4897 2100 2056 1473 1079 594 15545 ----
NM_017824chr1022054 1787 --11987 --
NM_017830chr4142 --2898 733 --
NM_017845chr4----123 --
NM_017848chrX44131 3569 1723 1457 11827 13517 13210
NM_017849chr282806 2391 1240 927 348 261 52 32 43185 3123 2345 1178 33133 2620 721 --
NM_017851chr1571056 835 509 275 183 172 84 ------
NM_017856chrX71709 1674 1533 804 408 164 126 --21328 25 --
NM_017857chr116488 435 193 178 124 99 ------
NM_017866chr81777 ------
NM_017873chr992724 2659 2271 1196 787 585 180 132 48 23084 40 22321 2279 --
NM_017880chr22421 345 ------
NM_017893chr1041444 455 159 149 1204 1996 140
NM_017902chr1085593 4788 4769 4659 1125 437 408 275 33966 3561 1246 44445 1311 982 775 --
NM_017907chr11123 --172 --
NM_017911chr2271528 1321 1286 1072 562 518 37 1947 ----
NM_017919chr9105187 5167 4856 4838 4314 2332 1351 1026 697 676 12106 25544 5522 11279
NM_017921chr1772246 2195 2077 2047 1564 790 104 11442 32339 358 43 139
NM_017929chr222912 22 1962 21220 1036 1107
NM_017938chrX31377 450 430 2598 209 --1241
NM_017944chr1152762 2675 2270 532 348 1656 ----
NM_017946chr721356 1148 1414 21442 1276 --
NM_017955chr1441104 841 246 158 3897 137 90 194 --
NM_017966chr1161377 1127 483 246 60 22 --1389 1470
NM_017987chr1021612 81 1140 ----
NM_017994chr742622 2551 2197 120 1390 167 12642
NM_017999chr14155 ------
NM_018008chr31327 --1287 --
NM_018014chr23299 236 47 ----1152
NM_018017chr1052449 1167 844 228 97 --11083 --
NM_018026chr1151360 1231 1064 417 197 1583 61344 1209 1192 1040 409 46 21188 183
NM_018027chr1062832 1029 1006 411 381 203 --42050 844 510 113 12445
NM_018045chr162640 2527 2088 1909 1012 702 22414 688 32732 2053 252 12349
NM_018051chr7--1323 ----
NM_018056chr1140 ------
NM_018071chr14--2828 330 2613 316 --
NM_018078chr41666 1372 ----
NM_018084chr232697 429 149 --11306 --
NM_018085chr1157771 6993 6965 6184 4975 2271 2236 2080 1844 1758 1254 854 543 59 40 15758 37034 6352 1678 --
NM_018086chr211779 --11577 --
NM_018092chr162351 50 ------
NM_018095chr111124 --1212 --
NM_018096chr173718 322 51 ------
NM_018098chr3--1401 ----
NM_018110chr1661282 1232 1189 902 396 77 1496 ----
NM_018114chr34586 466 393 161 1385 ----
NM_018116chr1----1462 --
NM_018119chr161216 ------
NM_018121chr1043078 3070 2117 1108 32888 2177 1082 13095 --
NM_018126chr411498 ------
NM_018128chr1771302 1270 531 491 362 97 36 1107 11222 --
NM_018131chr101736 ------
NM_018133chr3--1364 --1477
NM_018137chr161271 1060 929 472 38 21 ------
NM_018150chr1137 --4773 315 246 53 --
NM_018156chr172758 2481 2337 2319 2162 1820 1018 --32716 2618 67 --
NM_018157chr1242180 2148 550 285 --1500 --
NM_018171chr121731 ----1879
NM_018172chr1161555 1530 1490 1445 1428 1385 --11051 11549
NM_018176chr461522 1302 1290 1248 1090 519 11132 --11059
NM_018178chr142091 1668 419 333 ----21823 1688
NM_018182chr1762091 2080 2055 785 512 279 --1284 --
NM_018198chr171355 1347 1185 316 222 199 165 1403 --11194
NM_018206chr161609 ------
NM_018207chr151659 1502 1177 380 139 --2337 133 3471 333 88
NM_018211chr131862 535 84 ------
NM_018214chr621259 176 1442 1100 --
NM_018223chr124847 784 202 95 1428 ----
NM_018227chr413087 --13098 --
NM_018231chr161332 1169 4971 700 198 179 --
NM_018237chr101183 ------
NM_018240chr15848 720 690 615 586 --2191 107 --
NM_018244chr204881 437 31 24 --1953 --
NM_018246chr812729 12682 1313 --
NM_018247chr622874 2183 --148 --
NM_018252chr1----1507 --
NM_018254chr121957 1556 ------
NM_018256chr2194 ------
NM_018263chr262572 1900 1894 1787 539 504 ------
NM_018273chr193790 327 25 ------
NM_018287chr101290 ------
NM_018293chr332664 966 319 ------
NM_018299chr81902 2829 182 ----
NM_018307chr172955 691 1372 ----
NM_018313chr332403 2190 2026 ----12060
NM_018315chr41366 ------
NM_018320chr112782 169 1396 11113 1998
NM_018340chr16115043 3998 3874 3837 3240 3188 3160 1696 1616 921 609 23828 102 24056 1781 --
NM_018351chr1274195 4184 4026 3543 3418 3046 530 --21525 1359 --
NM_018358chr31111 --1258 --
NM_018362chr1143284 3241 2774 2748 13118 13464 --
NM_018364chr1--13347 12658 --
NM_018374chr741942 1672 1449 315 13605 --1243
NM_018383chr261658 1375 1331 1278 174 100 --1182 --
NM_018400chr1154355 4145 4088 3076 1249 24254 4238 13586 13197
NM_018403chr3103923 3411 3354 2999 2914 2610 1337 817 467 381 22768 2498 52834 620 387 363 37 21063 407
NM_018416chr1242506 2240 1961 604 2799 28 22221 75 --
NM_018419chr202121 46 ------
NM_018429chr522482 744 ------
NM_018439chr1822030 108 --22044 1781 --
NM_018440chr885727 5699 5615 2017 1611 700 359 277 12303 36392 574 566 11891
NM_018445chr152151 91 ------
NM_018449chr93677 320 113 ------
NM_018462chr3278 71 ----1768
NM_018471chr2--136 ----
NM_018482chr832166 1822 617 --1468 --
NM_018489chr122114 54 1577 ----
NM_018490chr1131347 485 153 ------
NM_018509chr1741662 1377 626 454 11646 132 1567
NM_018527chr13--140 ----
NM_018553chr1721384 267 ----1481
NM_018566chr154673 4646 4596 3597 1087 14738 ----
NM_018569chr41395 ------
NM_018584chr121053 860 ------
NM_018638chr1235490 4652 493 ------
NM_018640chr1242576 2084 817 437 ------
NM_018644chr1182255 2076 2002 1806 1462 812 462 266 21547 492 3715 636 146 11429
NM_018650chr111644 ------
NM_018655chr1294 57 ----2327 66
NM_018660chr832627 1935 347 --174 12454
NM_018667chr1672483 2249 1987 1128 585 494 214 148 31992 527 32 31880 744 591
NM_018674chr22678 663 --3573 551 504 --
NM_018682chr71223 ------
NM_018695chr5--1353 ----
NM_018708chr1941580 1236 577 425 11344 11229 --
NM_018710chr811107 ------
NM_018712chr11--178 ----
NM_018715chr162002 1725 1472 888 845 595 11768 61928 1857 1531 904 870 464 22167 1947
NM_018717chr47754 714 434 373 337 278 163 --42729 931 898 878 --
NM_018718chr7102047 1825 1716 1642 878 824 780 750 500 334 21487 832 ----
NM_018719chr751135 1098 894 333 23 --11265 --
NM_018837chr202897 235 ------
NM_018841chr1103363 3346 3180 1360 1324 1087 988 938 738 56 --1422 --
NM_018844chr741931 1567 1541 1445 --1198 --
NM_018890chr731400 471 238 1566 ----
NM_018898chr532088 1683 463 11870 1290 --
NM_018899chr532088 1683 463 11870 1290 --
NM_018900chr532088 1683 463 11870 1290 --
NM_018901chr532088 1683 463 11870 1290 --
NM_018902chr532088 1683 463 11870 1290 --
NM_018903chr532088 1683 463 11870 1290 --
NM_018904chr532088 1683 463 11870 1290 --
NM_018905chr532088 1683 463 11870 1290 --
NM_018906chr532088 1683 463 11870 1290 --
NM_018907chr532088 1683 463 11870 1290 --
NM_018908chr532088 1683 463 11870 1290 --
NM_018909chr532088 1683 463 11870 1290 --
NM_018910chr532088 1683 463 11870 1290 --
NM_018911chr532088 1683 463 11870 1290 --
NM_018912chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018913chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018914chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018915chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018916chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018917chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018918chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018919chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018920chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018921chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018922chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018923chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018924chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018925chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018926chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018927chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018928chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018929chr561605 1424 1271 1148 665 158 11223 1527 150
NM_018947chr765035 3997 1921 992 962 133 --44381 4216 4077 3406 --
NM_018951chr71375 --1360 --
NM_018952chr172250 168 ------
NM_018957chr223140 69 26 --1103 --
NM_018963chr211151 --179 --
NM_018970chr711098 11978 22430 773 --
NM_018976chr121958 130 1981 --
NM_018977chrX----1291 --
NM_018994chr11530 ------
NM_018999chr1041867 567 468 100 1332 ----
NM_019001chr344152 4053 3512 3265 11827 ----
NM_019004chr71301 1600 ----
NM_019006chr151725 ------
NM_019024chr2--1318 142 --
NM_019046chr105903 839 694 315 228 --1780 --
NM_019057chr5154 ------
NM_019058chr101255 ------
NM_019062chr1131 --1154 --
NM_019063chr242115 1980 785 652 ------
NM_019091chr21873 ------
NM_019096chr63732 388 187 ------
NM_019106chr2292523 2452 2430 2348 2324 2315 2187 2104 870 --13334 22464 2303
NM_019114chr911934 12543 ----
NM_019116chr1621230 908 11035 33221 914 871 --
NM_019555chr351712 1692 1644 1147 126 --31173 686 375 --
NM_019593chr2053090 2921 2861 2057 193 --1584 --
NM_019594chr951581 1241 602 532 105 21373 415 2289 46 --
NM_019595chr21238 134 ----
NM_019596chr2152915 2665 1041 590 182 11012 4721 681 511 75 --
NM_019606chr71158 ------
NM_019624chr125741 610 310 231 78 --1692 --
NM_019625chr125741 610 310 231 78 --1692 --
NM_019843chr221174 ------
NM_019845chr2----154 --
NM_019848chrX127 --134 --
NM_019859chr1021026 495 ------
NM_019862chr1641231 669 402 268 1381 1637 --
NM_019885chr252354 2050 838 212 201 2235 25 22194 906 130
NM_019891chr111165 ------
NM_019898chr1641231 669 402 268 1381 1637 --
NM_019899chr1641231 669 402 268 1381 1637 --
NM_019900chr1641231 669 402 268 1381 1637 --
NM_020039chr1291349 1306 1257 1245 701 620 541 352 66 1492 31511 472 290 1747
NM_020066chr11874 --1384 --
NM_020122chr255652 5022 3989 3656 667 --65724 5515 4947 4782 3745 570 15476
NM_020123chr10----1295 --
NM_020127chr131349 374 209 31303 504 454 11148 11528
NM_020141chr152357 2019 330 229 202 ------
NM_020142chr12295 41 1402 1554 2421 47
NM_020143chr24714 317 129 80 ------
NM_020144chr72767 377 ------
NM_020145chr93624 429 58 1537 1188 --
NM_020150chr1042109 1981 780 633 ------
NM_020151chr221528 50 --139 --
NM_020152chr212332 151 ------
NM_020155chr11183 ------
NM_020160chr19182 --246 26 --
NM_020168chr1551150 1112 518 504 407 1151 2130 61 --
NM_020177chr533323 2950 2779 ------
NM_020178chr1731031 454 406 ----1789
NM_020180chr181139 ----1398
NM_020182chr2063445 3351 2963 2578 2466 893 12446 ----
NM_020198chr17------176
NM_020200chr10168 ------
NM_020205chr1175 12475 ----
NM_020211chr1591235 1208 1200 1112 978 480 372 339 239 11082 11372 --
NM_020239chr152057 2028 631 558 185 ----155
NM_020245chr665103 3810 3780 3760 3750 951 23788 3315 ----
NM_020248chr162333 1865 1638 1480 927 84 1864 22282 1935 --
NM_020310chr1781952 1926 1866 920 803 680 588 88 --92270 2261 2177 861 854 847 261 104 74 1251
NM_020318chr11355 ------
NM_020337chr421017 711 ------
NM_020338chr1043448 2483 1383 147 32435 2337 1218 21174 291 32741 1316 524
NM_020341chr2041771 305 248 107 ------
NM_020342chr222239 1755 1628 ----
NM_020348chr1052549 2466 923 633 554 12049 12423 --
NM_020357chr321378 410 ------
NM_020360chr173439 224 82 ------
NM_020374chr12--21500 112 ----
NM_020381chr621417 647 ------
NM_020390chr363794 1171 1078 1034 956 457 1249 11216 --
NM_020403chr1321795 182 ------
NM_020416chr472687 2582 1692 792 761 488 169 --22002 34 --
NM_020420chrY--1661 11187 --
NM_020429chr7103054 2814 2537 2462 826 810 426 406 322 58 12086 ----
NM_020432chr741538 1527 691 452 ------
NM_020438chr921013 947 --3252 179 26 --
NM_020440chr162654 2566 2078 1186 688 415 --1104 --
NM_020443chr1176904 6428 6305 5986 5894 5850 5692 5636 4878 4594 4486 2510 1963 1891 1742 1185 743 35589 4569 1648 44573 1163 764 103 --
NM_020452chr171675 1598 616 453 187 168 55 --21479 248 --
NM_020455chr632217 1832 116 ------
NM_020456chr1331923 1879 1746 ----11498
NM_020457chr163565 457 45 ------
NM_020463chr221242 543 ------
NM_020466chr664810 4653 3769 549 464 85 14361 24495 383 --
NM_020474chr181131 --1178 --
NM_020475chr862462 2191 2162 1790 1626 989 12076 31974 1631 1541 11511
NM_020476chr862462 2191 2162 1790 1626 989 12076 31974 1631 1541 11511
NM_020477chr862462 2191 2162 1790 1626 989 12076 31974 1631 1541 11511
NM_020478chr852525 2254 2225 1853 1689 12139 32037 1694 1604 11574
NM_020480chr862462 2191 2162 1790 1626 989 12076 31974 1631 1541 11511
NM_020526chr151520 1418 715 695 94 11221 31544 1427 1395 --
NM_020530chr223211 114 78 ------
NM_020631chr141322 1184 218 51 11217 1352 1250
NM_020644chr111210 1201 ----
NM_020647chr84563 298 171 75 148 ----
NM_020654chr3--1445 1384 179
NM_020665chrX1555 ------
NM_020689chr2031339 59 29 --1257 11192
NM_020690chr51117 ------
NM_020693chr112392 48 --161 --
NM_020699chr174989 4251 3592 1285 1239 998 528 24894 1271 14626 1909
NM_020702chr991845 1531 1429 1397 685 437 303 148 37 11197 11549 1532
NM_020704chr732404 766 42 --12211 --
NM_020706chr211110 ------
NM_020708chr202427 253 1352 41842 1579 793 40 --
NM_020713chr20132966 2568 2037 1260 1155 1111 983 863 830 706 558 500 138 --42552 2168 784 68 --
NM_020717chrX214848 4682 4190 4003 3893 3798 3733 1949 1583 1528 1471 1383 1348 1297 979 653 427 399 366 167 37 1951 21359 114 --
NM_020727chr2133543 2454 34 ------
NM_020728chr753081 2994 2914 2776 2512 12060 32862 2691 1118 1911
NM_020734chr1221344 458 ------
NM_020738chr231442 464 186 --1191 --
NM_020739chr1543174 3167 1675 435 ------
NM_020742chrX31881 1833 370 --1590 --
NM_020747chr51114 ------
NM_020748chr171364 ------
NM_020750chr63403 291 112 ----11146
NM_020753chr174506 263 165 142 1180 ----
NM_020760chr21302 ----11630
NM_020761chr1781919 1606 1577 1487 780 520 468 92 21618 665 21695 1665 --
NM_020762chr1211023 1325 11063 --
NM_020766chrX84048 3979 3745 3519 3215 1737 1499 159 11521 ----
NM_020770chr12937 353 --11299 --
NM_020772chr1768401 6902 6173 5261 5239 1263 11832 ----
NM_020773chr442273 794 232 53 31061 880 197 32456 2059 580 --
NM_020774chr1835844 4584 807 --21973 1527 --
NM_020777chr452327 1938 717 553 299 --1469 --
NM_020778chr15124678 4665 4562 3990 1438 1250 1192 720 713 515 245 156 1192 43227 3077 1848 1153 43073 1641 366 361
NM_020791chr1731238 558 77 ------
NM_020792chr3----1355 --
NM_020794chr12212 34 ------
NM_020795chr1761920 803 541 247 181 46 --31941 1313 32 --
NM_020801chr511664 1665 ----
NM_020804chr6102224 2102 1921 1865 1625 1013 912 773 696 536 21658 244 72295 2119 1957 1930 1685 721 712 --
NM_020805chr181253 ------
NM_020806chr141665 ------
NM_020807chr1691494 1305 1216 1123 731 689 560 542 493 171 31385 112 27 1367
NM_020813chr195801 338 209 150 115 3823 540 260 32589 1879 991 11966
NM_020821chr153700 659 518 1202 ----
NM_020824chr101100 ------
NM_020830chr25824 699 626 70 41 1869 1873 --
NM_020834chr1451712 1696 1261 772 559 1726 ----
NM_020836chr142105 66 1610 4207 201 153 83 145
NM_020839chr321557 175 ----21245 547
NM_020841chr12--22714 528 ----
NM_020843chr15----1401 --
NM_020845chr12172384 2371 2176 2079 1984 1961 1955 1908 1901 1864 1844 1766 1684 874 517 401 340 --5916 699 418 221 55 --
NM_020850chr1683055 2749 2590 1325 1247 1227 1096 592 22485 647 32736 2627 2618 --
NM_020856chr192483 385 ------
NM_020858chr152870 861 12021 ----
NM_020868chr22595 386 ------
NM_020873chr31205 ------
NM_020888chr141849 513 121 67 1497 --1534
NM_020897chr121175 500 1170 2977 22 --
NM_020899chr1731739 318 251 --3328 270 66 1728
NM_020918chr1043165 220 192 61 --1173 11015
NM_020920chr141314 ------
NM_020922chrX41443 733 702 473 1162 ----
NM_020927chr1621919 283 --1383 --
NM_020935chr254211 4081 1303 730 689 1119 21747 550 --
NM_020946chr921615 664 --2381 198 --
NM_020951chr1942412 1793 1749 1576 1442 11621 --
NM_020956chr19144558 4400 4361 4223 4000 3867 3728 1583 1349 1066 964 899 821 774 13194 64260 3453 1420 544 234 30 1132
NM_020958chr14134 ------
NM_020959chr19188 ------
NM_020962chr1551733 681 443 355 311 1967 3524 391 362 31739 1575 450
NM_020963chr1272 31 ------
NM_020964chr1883621 3568 3483 1461 1194 803 631 303 14179 23917 3125 --
NM_020967chr202402 324 --128 --
NM_020972chr42746 163 ----1770
NM_020974chr111540 --3550 407 402 --
NM_020977chr42831 124 ------
NM_020983chr1292210 2133 2040 1753 1553 815 677 576 522 --41892 1584 1547 260 --
NM_020987chr1021100 410 ------
NM_020988chr1661310 1146 525 493 360 106 ------
NM_020993chr1252290 2249 2125 698 683 2595 248 11052 --
NM_021003chr14--155 1587 1160
NM_021007chr262003 1583 947 880 229 46 ------
NM_021019chr12159 ------
NM_021033chr1332381 829 119 ------
NM_021035chr202354 269 1906 2189 55 --
NM_021038chr323174 123 --13163 --
NM_021061chr844370 1783 1731 60 33314 1506 68 ----
NM_021069chr431829 1621 38 --1347 --
NM_021072chr5196 ------
NM_021078chr174179 143 113 22 1409 1190 --
NM_021083chrX33557 3443 2509 12919 22279 2219 --
NM_021090chr2294034 3365 3066 1839 1274 1110 1064 1014 922 44799 3513 3079 1612 23812 555 --
NM_021097chr242620 1018 941 118 2808 227 11971 --
NM_021116chr7168930 6966 6409 6112 6058 3606 3336 3110 2950 2639 2451 1756 1618 437 88 78 27995 6877 56495 6324 6066 805 484 23066 2547
NM_021120chrX102985 2573 2502 2250 2218 1984 1017 776 688 449 12829 12308 --
NM_021132chr10--11056 1137 --
NM_021135chr673389 2706 1350 861 746 150 62 32343 994 607 2798 201 32470 2105 1282
NM_021136chr14157 ------
NM_021140chrX1380 ------
NM_021145chr72282 119 ------
NM_021149chr1641029 494 148 70 ----293 85
NM_021155chr1992881 2527 2310 2175 1849 1178 1002 685 442 12660 22966 1027 --
NM_021159chr4------11083
NM_021174chr82577 133 --1659 --
NM_021177chr6----1229 163
NM_021183chrX1250 12553 ----
NM_021189chr12988 219 --21023 433 1119
NM_021192chr21167 --259 30 --
NM_021202chr2092847 2639 2293 2019 2001 1906 1177 1169 523 21115 707 62708 2645 2630 498 356 312 11934
NM_021213chr1731092 451 131 ----1209
NM_021218chr91912 --2998 831 --
NM_021222chr141249 1110 511 283 1494 ----
NM_021229chr121330 ------
NM_021238chr1221816 193 ------
NM_021239chr141401 1263 ----
NM_021242chrX3739 390 285 ------
NM_021259chr1651028 224 186 101 43 --2478 80 --
NM_021267chr1971057 1021 907 439 377 160 51 1213 2200 32 --
NM_021569chr971124 930 855 739 474 349 69 1939 31064 187 124 175
NM_021574chr2272464 2410 2365 2226 2022 1919 1613 31632 889 644 11962 1766
NM_021622chr10165 11689 --11483
NM_021629chr331881 610 311 159 13273 21968 1802
NM_021633chr11884 ----2388 39
NM_021638chr4133995 3875 3586 3417 3407 3062 1844 1801 1763 1138 1049 943 491 14918 51768 1376 830 332 24 --
NM_021639chr11599 --1346 --
NM_021648chr671762 938 917 908 708 547 499 22349 740 11785 --
NM_021705chr62607 322 1386 ----
NM_021728chr141271 ------
NM_021738chr101296 ------
NM_021783chrX52219 824 761 747 33 11656 ----
NM_021808chr122732 481 1687 1691 --
NM_021809chr2071860 1778 1719 664 349 150 34 2823 548 42189 2174 1631 307 --
NM_021813chr695400 5308 4840 1866 1823 1780 1446 1380 60 14379 21883 24 --
NM_021911chr565350 1909 1172 814 246 59 1281 24562 589 --
NM_021914chr1411858 1160 --153
NM_021925chr2--11462 ----
NM_021943chr661811 1774 1399 210 135 73 --31869 1671 114 --
NM_021945chr6162918 2905 2656 2535 2518 2497 2425 2369 1414 1400 1354 1085 1003 841 621 104 22580 600 23258 1176 --
NM_021947chr171372 ----21073 1025
NM_021949chrX42271 2037 853 482 --1258 --
NM_021956chr6--1291 1480 --
NM_021959chr62381 355 1863 3186 168 71 --
NM_021961chr1176523 5759 5024 2595 1592 1409 383 32872 2365 268 45642 5290 4688 1128 --
NM_021962chr17122282 2269 2227 2214 2034 2015 1563 709 460 417 328 126 21990 1022 81672 616 499 306 193 187 50 41 1380
NM_021964chr346467 5521 4225 2399 ------
NM_021969chr13225 137 57 ------
NM_021984chrX2431 301 21280 416 --11007
NM_021987chrX2431 301 21280 416 --11007
NM_021988chr2041581 473 428 421 ------
NM_021990chrX2431 301 21280 416 --11007
NM_022003chr1151132 916 208 103 87 1890 1445 1895
NM_022039chr103428 190 41 --1556 --
NM_022042chr471053 1003 984 814 726 346 25 1272 1821 --
NM_022048chr1574189 3856 2272 1099 858 559 60 26071 1128 35241 4219 2489 15438
NM_022049chr141702 1671 1637 1284 ------
NM_022060chr1451365 1125 1101 986 106 ----11188
NM_022066chr172899 45 1846 1869 --
NM_022075chr12342 287 ----1177
NM_022080chr2011887 1349 12620 --
NM_022085chr6163 --21414 35 --
NM_022095chr20----3289 202 42 --
NM_022107chr62522 391 155 2459 21 --
NM_022121chr61894 ------
NM_022130chr511063 --1301 --
NM_022133chr821737 1264 ------
NM_022157chr1133 ------
NM_022166chr16145357 5222 4293 3912 2342 1899 1498 771 694 665 447 213 170 79 14207 31428 621 566 --
NM_022169chr1131314 1235 1184 --5190 163 56 50 28 --
NM_022172chr11278 22 ------
NM_022336chr222065 695 22077 543 --2272 264
NM_022343chr951315 1285 1200 936 833 --11273 --
NM_022351chr81499 13424 ----
NM_022356chr14441 353 331 134 1104 ----
NM_022361chr61374 ------
NM_022373chr73917 795 411 ------
NM_022442chr2041581 473 428 421 ------
NM_022458chr742870 2427 2069 977 ------
NM_022459chr1344325 1329 1090 340 25127 1100 ----
NM_022462chr19133576 3512 3401 3025 2913 2626 1230 1134 1091 962 707 657 150 1204 53303 3122 2576 1256 616 --
NM_022463chr1771412 1236 629 380 245 157 40 21270 517 31556 1116 119 --
NM_022465chr1252261 1103 1048 384 99 126 32496 2460 497 --
NM_022470chr321167 925 --11253 --
NM_022473chr1543584 1437 151 119 --52950 1523 1363 1241 894 --
NM_022477chr2071484 1459 1389 1345 1254 1210 260 1182 11586 --
NM_022480chr1531493 145 22 --2129 88 1643
NM_022484chr7--1510 ----
NM_022488chr3----1158 --
NM_022491chr1242389 2287 1101 113 ------
NM_022497chr382472 1314 1128 907 665 639 567 316 12872 42643 1214 1048 611 --
NM_022557chr17----1216 --
NM_022574chr731849 640 592 --62022 1731 1365 860 696 72 --
NM_022640chr17----1214 --
NM_022648chr2114465 3816 3484 3237 3061 3053 3037 2915 1246 1066 649 14071 21172 1099 --
NM_022652chr122442 116 1253 ----
NM_022658chr1231319 1289 152 --11113 --
NM_022716chr132717 1942 586 22239 304 ----
NM_022733chr13152 61 37 1917 1229 --
NM_022735chr11336 --21693 215 11510
NM_022737chr1981150 922 860 418 294 276 126 32 --1344 --
NM_022739chr172445 54 ------
NM_022744chr1671225 1146 1089 1025 964 843 403 1975 2810 378 1858
NM_022745chr142735 2074 442 38 --11086 --
NM_022755chr952332 1910 1747 985 449 1817 21814 1645 12074
NM_022758chr6103164 2851 2569 2084 2043 1220 1161 1127 1086 592 11276 12909 12453
NM_022763chr322759 369 1950 ----
NM_022776chr321379 487 ------
NM_022778chr161396 1327 1315 1306 1159 1105 --31320 463 276 --
NM_022780chr221654 606 --21495 564 --
NM_022781chr912597 11305 22777 92 12538
NM_022784chr1521152 176 1104 ----
NM_022810chrX1314 --236 27 --
NM_022821chr13462 383 199 ------
NM_022822chr113682 156 105 --4709 333 191 60 --
NM_022824chr511215 ----1688
NM_022831chr121422 1315 11484 ----
NM_022832chr43964 911 637 12472 ----
NM_022833chr931353 1343 68 --21252 1044 --
NM_022841chr151265 12048 ----
NM_022842chr312122 1219 42735 2522 2490 256 12846
NM_022845chr161575 11738 ----
NM_022897chr55810 707 379 151 32 --1743 187
NM_022898chr1474442 4385 4355 4209 4053 4039 1854 ------
NM_022903chr3140 ------
NM_022917chr91295 1918 2958 154 1253
NM_023000chr1431123 373 209 11050 ----
NM_023001chr1431123 373 209 11050 ----
NM_023008chr191246 --1332 --
NM_023009chr12176 131 --1526 --
NM_023019chr2277 38 --182 --
NM_023035chr192313 116 --2226 29 --
NM_023075chr182625 306 --1705 --
NM_023076chr1642631 2270 1117 175 --31203 1038 739 --
NM_023079chr1721781 1366 --1320 --
NM_023105chr82232 59 1165 21532 606 --
NM_023106chr82232 59 1165 21532 606 --
NM_023110chr82232 59 1165 21532 606 --
NM_023111chr82232 59 1165 21532 606 --
NM_023927chr5------1146
NM_023929chr81914 12474 ----
NM_024007chr532688 2636 674 ------
NM_024015chr172961 323 ----1884
NM_024017chr1771473 1377 1184 691 509 338 281 2604 402 31270 325 23 --
NM_024019chr42980 59 ------
NM_024046chr311173 21040 903 3818 219 213 --
NM_024061chr72218 66 ------
NM_024072chr1241240 1225 1070 452 21119 179 21329 1310 1637
NM_024076chr1982301 2244 2101 1683 1584 352 261 173 2553 230 32049 1950 1891 22414 2031
NM_024082chrX196 --1431 --
NM_024085chr24957 423 220 170 --1281 1277
NM_024086chr1773382 2933 2861 2777 1483 423 293 21116 88 43692 2697 1197 701 --
NM_024090chr431482 744 547 1725 ----
NM_024103chr193373 230 48 --21312 335 --
NM_024106chr191262 --1348 --
NM_024117chr951287 1123 1080 1070 275 --1107 --
NM_024293chr22652 269 ------
NM_024294chr6103164 2851 2569 2084 2043 1220 1161 1127 1086 592 11276 12909 12453
NM_024297chr171556 2445 73 ----
NM_024306chr163963 401 32 2265 130 3835 121 38 --
NM_024312chr1271456 1412 1232 1059 373 346 207 21189 154 ----
NM_024328chr141237 --1513 --
NM_024411chr2011401 1106 --1138
NM_024423chr181106 1670 14195 --
NM_024490chr151429 ------
NM_024494chr11170 ------
NM_024496chr141323 --138 --
NM_024511chr453459 608 564 475 431 22386 2161 12935 --
NM_024513chr3142708 2646 2615 1449 1426 1287 1261 824 697 557 295 185 174 111 31124 1097 715 1549 --
NM_024522chr151709 1679 282 201 112 --41758 1746 413 319 --
NM_024528chrX1137 ------
NM_024541chr1081827 1178 1160 671 634 503 271 23 ------
NM_024545chr21309 ------
NM_024551chr1262254 2070 2041 717 633 112 32241 232 133 --1724
NM_024551chr1262254 2070 2041 717 633 112 32241 232 133 --1724
NM_024556chr111322 ------
NM_024567chr82518 162 --1238 --
NM_024581chr6122 ------
NM_024586chr11211 ------
NM_024595chr121141 90 --11227 --
NM_024607chr893423 3356 2957 1746 1116 718 443 379 168 11639 11667 12913
NM_024613chr8198 ------
NM_024617chr91795 ------
NM_024626chr1----11544 --
NM_024628chr341097 404 315 271 ------
NM_024639chr621174 327 ------
NM_024640chr14875 387 224 110 1741 ----
NM_024646chr144006 2898 2642 2611 13382 32984 2818 2482 --
NM_024659chr2--132 ----
NM_024665chr31344 ----24456 106
NM_024666chr1531249 1175 519 21449 68 --11579
NM_024674chr142203 2166 824 287 22431 899 12682 --
NM_024676chr13301 269 193 --21147 212 --
NM_024698chr1131014 467 25 --5514 449 363 250 102 2356 70
NM_024704chr202340 71 --1345 --
NM_024713chr1511191 ------
NM_024721chr812299 ------
NM_024735chr1651874 1521 761 735 93 2705 488 31441 1199 727 31189 710 133
NM_024740chr11104023 3920 3758 3369 3319 3042 2828 1473 1428 458 33483 2996 508 --13224
NM_024742chr1631281 384 210 11901 41514 1358 628 39 --
NM_024751chr452023 1795 1530 1337 361 --1650 --
NM_024753chr21512 --1691 --
NM_024755chr151327 ------
NM_024759chr84801 319 194 156 1762 ----
NM_024769chr11183 --11122 --
NM_024770chr2126619 6280 5762 5638 2645 2499 2080 1575 1531 1363 1158 809 36392 1485 594 52377 2166 1997 1495 729 11719
NM_024784chr1181035 995 836 792 724 446 258 226 152 1972 --
NM_024785chr22943 474 1284 1498 --
NM_024798chr1592689 2339 2263 2199 2010 973 576 420 251 22627 756 32814 829 338 --
NM_024804chr11345 --123 --
NM_024811chr1121536 177 11226 2671 534 --
NM_024817chr15184949 4935 4785 4575 4309 3701 2155 2054 1795 1215 1201 1159 1138 1130 965 746 304 202 55323 5290 1322 609 484 35245 2392 765 --
NM_024828chr91129 ------
NM_024830chr561720 1589 453 332 119 28 --3885 801 761 --
NM_024834chr1021305 576 ------
NM_024845chr1681275 1247 644 601 392 240 134 103 --11164 31655 1491 534
NM_024852chr12209 98 --1656 --
NM_024873chr41867 --2953 788 --
NM_024874chr151038 311 290 119 47 --2869 52 --
NM_024881chr1993681 3336 3270 3050 2377 1050 657 550 96 13004 63421 3231 1295 1216 1135 46 --
NM_024884chr1462849 1601 1218 1174 711 414 1396 4796 627 482 293 --
NM_024887chr121354 402 1673 ----
NM_024900chr441979 765 415 63 --22186 1544 --
NM_024900chr441979 765 415 63 --22186 1544 --
NM_024909chr621098 516 ------
NM_024915chr852833 2136 1888 1877 1022 1371 42197 2169 1011 73 --
NM_024921chrX11450 ------
NM_024922chr1661635 1593 1441 675 320 72 1349 61534 1338 836 808 732 110 1659
NM_024923chr351297 1027 313 125 35 1978 21134 115 11059
NM_024927chr17140 ------
NM_024930chr532689 1953 1784 ------
NM_024939chr1621358 29 --4568 497 236 148 --
NM_024946chr1631647 1535 268 --1517 11387
NM_024947chr378346 8302 7416 7149 3807 3797 1192 17370 28680 6551 --
NM_024948chr102703 691 ------
NM_024949chr474457 3680 1711 1278 792 737 357 14185 13113 34226 3987 1689
NM_024953chr1242088 1964 1916 374 ------
NM_024969chr21152 ------
NM_024989chr242741 2471 2293 1469 12247 ----
NM_024991chr1053011 604 446 432 258 12749 22357 348 1419
NM_025047chr32376 177 ------
NM_025072chr9145 --1135 --
NM_025083chr1572006 1976 1600 455 436 292 247 --1538 --
NM_025099chr172453 249 --1161 --
NM_025104chr1761754 1694 1470 1460 1158 357 --31780 1614 517 --
NM_025133chr231040 974 869 1320 ----
NM_025134chr1642388 2220 564 368 ------
NM_025137chr151123 ------
NM_025138chr131334 ------
NM_025140chr123411 398 62 ------
NM_025146chr341982 1873 1012 770 ------
NM_025151chr851746 1556 657 535 89 --1385 1812
NM_025154chr731227 593 355 ------
NM_025160chr142651 1494 742 528 ------
NM_025164chr1171956 1818 1730 1364 784 675 451 ------
NM_025179chr1134476 4444 4388 3979 3621 3433 3193 3075 3006 1869 981 185 159 --21812 1656 --
NM_025181chr2124 1238 ----
NM_025182chr92950 230 --1944 --
NM_025187chr1621103 887 ------
NM_025191chr143215 1363 913 906 ------
NM_025208chr112141 102 11996 ----
NM_025209chr10125 ------
NM_025222chr322503 759 21204 423 22339 985 --
NM_025224chr2081888 1660 1482 685 653 524 431 107 1381 62026 1878 1861 825 313 151 --
NM_025235chr1021698 813 11864 --1427
NM_025237chr173250 190 182 --141 --
NM_025248chr17103226 2893 2801 2778 2353 2130 1186 846 277 139 --12118 1344
NM_025251chr85486 428 378 274 44 --31111 438 102 198
NM_025256chr6167 279 45 ----
NM_030576chr1792529 2097 2013 1960 1711 840 660 632 244 1497 32458 825 295 --
NM_030594chr1521252 61 ------
NM_030621chr1422833 386 --1440 --
NM_030627chr523070 974 ------
NM_030629chr1641610 1361 673 463 --31400 1203 181 --
NM_030634chr132236 2179 234 ------
NM_030647chr7105946 5810 4912 4412 4231 3973 2368 2312 2158 42 ------
NM_030648chr484724 4521 4323 1513 1215 1203 566 193 ------
NM_030650chr233974 2993 1083 --24259 4094 --
NM_030661chr751641 1343 1142 1122 1096 11251 11547 11215
NM_030664chr1031826 941 158 22380 193 1977 168
NM_030665chr1771167 1136 419 316 180 156 82 --31107 1097 1087 11175
NM_030674chr1254580 3765 2015 1929 969 1394 ----
NM_030758chr222403 39 --41190 324 202 107 197
NM_030761chr142482 2079 1933 564 12494 62619 2451 2033 1845 676 666 --
NM_030762chr1221656 248 ------
NM_030767chr9112715 2117 1143 1003 701 663 563 450 310 182 150 --72742 2652 2612 2534 2436 2131 220 --
NM_030786chr111817 11554 ----
NM_030795chr85431 68 51 42 33 ------
NM_030798chr73230 191 26 --3600 594 78 --
NM_030799chr531923 561 368 --1649 --
NM_030802chr17--3603 307 219 3616 607 170 --
NM_030806chr1198015 7821 7430 7417 7259 6962 6642 6527 6436 6364 6285 6158 5780 5736 3378 3348 3103 2784 1412 27043 6845 59214 7173 6880 3462 3015 26725 799
NM_030808chr172718 325 --4844 729 165 86 --
NM_030810chr6163 --21414 35 --
NM_030813chr117889 860 759 735 650 156 109 1137 ----
NM_030815chr204731 602 183 110 --1547 --
NM_030820chr62329 294 126 ----
NM_030881chr2231912 1811 210 ------
NM_030884chr352262 1823 325 275 191 12280 1355 --
NM_030885chr311945 --22048 1749 --
NM_030906chr112144 86 ------
NM_030911chr1331442 1213 63 ------
NM_030912chr103962 770 615 --145 --
NM_030914chr91969 1689 2611 367 --
NM_030918chr1134881 4492 4224 4146 3930 3896 3644 3429 2079 1675 1119 818 533 15070 ----
NM_030920chr1--1290 ----
NM_030922chr153808 748 677 ------
NM_030952chr12380 202 --21017 24 1106
NM_030962chr1121080 196 --1128 1649
NM_030964chr593353 3309 3173 3127 2697 2557 1389 914 135 13577 1350 --
NM_031157chr12183 ------
NM_031205chr122385 275 --1376 --
NM_031216chr181124 --11673 --
NM_031268chr16105207 4021 3662 1915 1446 1243 1152 889 354 94 --2301 281 --
NM_031284chr15143 --1129 --
NM_031286chr13347 320 256 --156 --
NM_031289chr123197 101 77 2885 125 ----
NM_031296chr452776 1076 943 899 511 ----1666
NM_031306chr12855 356 --2961 774 1278
NM_031309chr882080 1948 1911 1823 1454 517 47 22 1428 41971 1771 448 168 1671
NM_031407chrX1136 ------
NM_031411chr532088 1683 463 11870 1290 --
NM_031412chr121983 2349 195 ----
NM_031417chr19112347 2314 2203 1801 895 879 500 178 169 85 42 22233 608 1505 --
NM_031419chr3152 ----11604
NM_031427chr1475377 5239 4299 3617 991 302 269 --65758 4385 4218 1775 1662 1609 --
NM_031439chr881442 1417 1357 1273 128 86 77 27 31821 469 210 2251 200 --
NM_031442chrX2663 163 ------
NM_031444chr2292474 1871 1806 907 803 656 260 117 51 22146 124 42405 762 673 282 --
NM_031445chr22383 214 --122 12844
NM_031453chr103919 843 97 12267 1809 --
NM_031468chr7197908 7491 7222 6487 5933 5906 5465 5128 5052 2968 2880 2710 1793 1713 1361 1098 981 740 570 32635 1879 34 45889 5645 4989 2842 --
NM_031469chr663380 3260 1469 1342 1072 821 --1870 --
NM_031476chr1672650 2346 2167 1046 617 491 199 11096 ----
NM_031483chr2042781 2350 2254 624 22847 807 23332 825 --
NM_031492chr112384 228 ------
NM_031844chr122673 1441 ------
NM_031849chr532088 1683 463 11870 1290 --
NM_031857chr532088 1683 463 11870 1290 --
NM_031858chr1711404 --11007 --
NM_031860chr532088 1683 463 11870 1290 --
NM_031862chr1711404 --11007 --
NM_031886chr1942428 2034 1621 381 12279 32120 1707 1024 --
NM_031890chr2272644 2590 2533 2325 2256 929 884 1713 22076 361 --
NM_031892chrX4914 838 784 66 ------
NM_031899chr321342 64 2332 327 ----
NM_031934chr171275 --2318 34 --
NM_031935chr1--11043 ----
NM_031940chr852032 1986 1901 1844 326 --11803 1778
NM_031964chr17266 30 ------
NM_031990chr1921451 581 1192 31411 496 229 --
NM_031991chr1921451 581 1192 31411 496 229 --
NM_032012chr944684 4047 3687 85 21507 60 23559 1681 --
NM_032013chr2071484 1459 1389 1345 1254 1210 260 1182 11586 --
NM_032017chr141988 1732 467 406 71823 724 655 604 507 385 136 51751 731 706 627 46 --
NM_032042chr552710 1050 775 704 239 32460 2300 1152 185 --
NM_032050chr221916 --1273 --
NM_032052chr2231301 932 98 1365 ----
NM_032088chr561605 1424 1271 1148 665 158 11223 1527 150
NM_032092chr561605 1424 1271 1148 665 158 11223 1527 150
NM_032102chr1132266 2182 755 1381 12102 --
NM_032105chr1107643 7519 7268 6889 6033 5423 3215 2346 1508 776 57879 7166 7161 1318 1022 32432 1849 201 16495
NM_032108chr193912 848 35 --2976 168 --
NM_032109chr541275 257 232 109 1291 1177 --
NM_032124chr182168 96 ------
NM_032128chr41321 ------
NM_032144chr23334 287 218 11720 ----
NM_032153chr331117 903 402 11818 ----
NM_032181chr21140 --189 --
NM_032182chr101427 ------
NM_032189chr13134544 4063 4031 3935 3844 3321 1771 1724 1661 912 668 577 348 24292 697 64269 4073 4014 3905 1364 637 13748
NM_032192chr172684 222 1266 ----
NM_032195chr21--1115 ----
NM_032199chr1073618 3358 2494 1272 1255 942 121 33026 1504 23 --1183
NM_032204chr224248 158 129 115 ------
NM_032208chr232701 737 228 33276 2249 1359 --13012
NM_032214chr202164 59 11126 11141 1932
NM_032217chr41944 ------
NM_032228chr1133020 2797 2160 --13221 1202
NM_032233chr142842 54 1806 1771 --
NM_032242chr383225 2059 1245 905 737 427 372 65 --53268 2927 2575 1259 130 12024
NM_032256chr121206 ------
NM_032268chr1642598 2473 1235 389 42390 2062 867 238 22249 439 --
NM_032271chr1651374 1329 1051 988 384 21524 497 41309 561 198 40 1235
NM_032272chr85471 117 87 34 24 --2403 149 1335
NM_032281chr1952926 2438 2369 1168 107 22797 776 12825 1501
NM_032288chr322403 498 ------
NM_032289chr53486 96 69 ------
NM_032291chr111522 --1176 --
NM_032293chr91210 ------
NM_032319chr2124 --1320 --
NM_032320chr111658 ------
NM_032325chr1161908 1690 1511 1375 561 450 --1786 --
NM_032353chr171440 --1122 --
NM_032355chr3292 23 ------
NM_032364chr124692 272 223 150 ------
NM_032369chr124681 512 503 154 --1674 --
NM_032373chr1055463 4056 3976 2035 657 35293 5247 834 14142 --
NM_032375chr192665 102 --2793 707 1166
NM_032403chr561605 1424 1271 1148 665 158 11223 1527 150
NM_032408chr751131 1108 929 318 156 ----1304
NM_032410chr8182 ------
NM_032415chr7--1190 1392 --
NM_032420chr5243 36 --3202 48 23 --
NM_032431chr113706 238 44 --5218 182 116 79 25 --
NM_032434chr21123 ------
NM_032438chr621555 1498 ------
NM_032440chr1021056 907 12233 ----
NM_032442chr171173 ------
NM_032444chr167878 803 766 446 402 132 42 2855 158 51020 814 753 701 240 --
NM_032445chr1552186 2169 212 101 65 22391 2196 ----
NM_032457chr432839 645 542 12964 ----
NM_032458chrX22302 2209 ------
NM_032466chr8------144
NM_032468chr8------144
NM_032484chr171160 --127 --
NM_032523chr2121 ------
NM_032538chr6192754 2524 2359 2352 2155 2115 1930 1748 983 963 486 454 317 277 202 118 88 76 61 --72640 2591 2024 533 514 282 44 --
NM_032539chrX----1705 --
NM_032552chr9151864 1755 1732 1638 1477 1448 1428 1321 778 323 247 181 153 126 82 --41791 1772 340 175 --
NM_032560chr142220 118 ------
NM_032562chr102350 49 ------
NM_032582chr173741 618 264 ------
NM_032595chr1791590 1487 1390 1088 988 461 336 221 145 --194 --
NM_032603chr22568 171 1299 1787 --
NM_032623chr41289 ------
NM_032626chr16--188 ----
NM_032638chr341189 1027 467 144 3552 111 64 1100 --
NM_032682chr322872 340 ------
NM_032711chr17104003 3978 3381 3276 3260 3196 3133 2799 715 440 2465 455 53928 3813 3657 1372 535 13254
NM_032727chr1061394 1355 1052 371 360 192 2246 67 ----
NM_032741chr61723 1292 1713 --
NM_032765chr53918 750 396 --11002 --
NM_032781chr113134 115 53 1727 2619 41 --
NM_032784chr62741 73 ------
NM_032786chr12174 ----1530
NM_032808chr15----4837 824 158 79 --
NM_032810chr103550 262 246 --1213 --
NM_032818chr962250 1661 888 856 715 690 --42099 1933 383 264 1246
NM_032833chr132219 1710 1636 --1183 --
NM_032838chr191130 ------
NM_032842chr72540 496 --1676 --
NM_032859chr1321379 644 12513 ----
NM_032871chr1151801 1463 782 593 31 --21221 673 11909
NM_032873chr1144162 3633 650 380 1101 21400 544 --
NM_032892chr15129 1138 ----
NM_032906chr42232 170 --1217 --
NM_032946chrX1141 --285 31 1341
NM_032947chr54916 325 132 22 --31016 966 244 11029
NM_032961chr421350 332 ------
NM_032968chrX1454 32615 995 882 ----
NM_032969chrX1454 32615 995 882 ----
NM_032973chrY1454 32614 995 882 ----
NM_032983chr792846 2772 2494 2355 2255 2120 1154 352 24 12074 42706 1029 993 334 --
NM_032991chr441303 1278 965 171 11015 ----
NM_032992chr42225 53 --1140 --
NM_032995chr241315 628 354 331 11536 51218 1120 561 544 513 --
NM_032998chr131123 1029 820 ------
NM_032999chr71795 --2985 800 --
NM_033000chr71795 --2985 800 --
NM_033001chr71795 --2985 800 --
NM_033018chrX41070 831 348 64 --3877 322 282 3938 873 368
NM_033020chr144468 4160 3767 878 ------
NM_033027chr31795 1346 31137 228 25 --
NM_033030chr231376 86 72 ----128
NM_033036chr1151246 475 371 240 55 --11076 --
NM_033044chr111071 --1967 --
NM_033058chr82242 32 --168 --
NM_033071chr61124 ------
NM_033089chr203497 163 38 1950 ----
NM_033102chr141169 336 201 68 --31095 980 51 --
NM_033102chr141169 336 201 68 --31095 980 51 --
NM_033103chr1921086 950 1904 ----
NM_033116chr141265 ------
NM_033118chr203846 840 103 165 2304 243 2743 664
NM_033119chr161141 1301 1355 1215
NM_033121chr122570 293 ------
NM_033127chr1----2116 74 --
NM_033129chr2071808 1670 1528 1484 1350 766 226 2705 513 5739 733 138 133 86 --
NM_033132chr131125 ------
NM_033135chr112141 102 11996 ----
NM_033136chr52415 169 ----1288
NM_033137chr52415 169 ----1288
NM_033138chr71785 ------
NM_033139chr71785 ------
NM_033140chr71785 ------
NM_033141chr1472129 1900 389 346 316 225 68 --32215 2047 101 --
NM_033143chr454591 4497 2816 937 135 --1249 --
NM_033157chr71785 ------
NM_033161chr971648 1292 792 447 295 272 82 11316 21320 225 --
NM_033181chr622906 741 ----11560
NM_033201chr1631016 359 61 --21006 861 11058
NM_033212chr162153 63 --1106 --
NM_033219chr9124 ------
NM_033221chr992700 2477 1863 1798 1042 891 557 301 136 12292 42563 1030 358 224 --
NM_033222chr921348 554 ------
NM_033224chr7136889 6753 6709 6316 6164 5463 5240 5159 3200 3092 3001 2526 1441 16663 25553 5326 16551
NM_033225chr831107 614 572 ------
NM_033226chr163226 107 95 1165 ----
NM_033240chr1541608 1087 668 551 11265 61345 1269 686 640 489 62 51367 607 592 577 562
NM_033244chr1541128 469 188 71 2785 488 4865 789 206 160 5887 127 112 97 82
NM_033251chr161395 1147 1355 --
NM_033255chr13186 ------
NM_033259chr34690 350 294 255 --3308 301 37 197
NM_033278chr11--1312 1295 --
NM_033285chr833648 3543 1428 11098 ----
NM_033290chrX53748 3356 3049 2872 1469 ------
NM_033300chr121008 40 11129 ----
NM_033306chr11--123 127 --
NM_033309chr164935 863 427 417 1917 ----
NM_033315chr1761681 1505 1427 678 275 110 11543 6871 708 459 448 252 184 --
NM_033319chr11459 --2543 379 --
NM_033326chr1132094 1541 396 ------
NM_033375chr1731452 1217 1116 21483 542 21021 245 11017
NM_033389chr1783768 3703 3356 1587 509 502 491 469 --34255 4203 1377 --
NM_033407chr11515 ------
NM_033419chr1771425 1119 571 483 336 316 228 --21236 172 1148
NM_033420chr1981136 934 924 374 342 258 165 150 --51099 490 379 238 170 --
NM_033421chr203783 405 226 --1632 1236
NM_033425chr1173119 2916 2833 1356 1214 453 151 --12747 --
NM_033429chr1562867 2253 1122 1009 961 166 --2283 231 --
NM_033430chr433850 3618 737 ------
NM_033437chr433850 3618 737 ------
NM_033438chr1----123 --
NM_033449chr551821 1421 800 628 575 11548 21509 690 11756
NM_033503chr15253633 3553 3541 3473 3384 3179 3100 3031 2976 2931 2819 2695 2550 1304 1187 1180 1099 980 857 841 819 796 785 569 534 13128 53546 3132 1046 608 539 --
NM_033535chr411147 ------
NM_033542chr2031747 1635 1449 --3777 671 303 184
NM_033551chr5103177 2829 2776 2747 2651 2200 2117 635 509 346 1423 22841 73 1678
NM_033624chr1221976 173 --11669 --
NM_033626chrX41271 1155 644 507 11454 11669 --
NM_033631chr1103749 3670 3622 1352 1203 620 482 474 372 47 --1694 13535
NM_033632chr41366 ------
NM_033637chr1093864 3414 3394 3358 1606 1534 809 757 127 43375 1122 521 182 1525 13922
NM_033642chrX172 ------
NM_033644chr522203 1638 1143 ----
NM_033645chr522203 1638 1143 ----
NM_033656chr2144649 4527 1488 1373 24468 2156 15480 --
NM_048368chr183640 623 64 --1189 --
NM_052820chr91459 --1549 --
NM_052834chr1872266 2249 2057 1981 974 772 446 ----1354
NM_052839chr224948 913 750 291 1370 3388 80 62 2398 384
NM_052840chr1541501 1407 515 83 ----1522
NM_052845chr12113092 2927 2912 2822 2486 2445 2037 1154 1082 978 118 13192 12739 2406 132
NM_052854chr11--1621 1137 --
NM_052865chr203873 340 218 ------
NM_052876chr1981970 1822 1790 1784 1666 395 375 272 --22033 126 11676
NM_052880chr2251227 1221 1126 997 251 21173 50 ----
NM_052882chr191509 ------
NM_052885chr1264818 4481 3982 3101 1646 360 1105 ----
NM_052897chr122767 74 ------
NM_052898chr821632 1288 1723 1415 --
NM_052899chr55950 257 250 218 116 --4880 620 223 148 --
NM_052901chr961776 1603 1318 369 355 50 1456 21574 1364 --
NM_052905chr2186 11438 ----
NM_052910chr133412 312 108 1772 1231 11409
NM_052913chr61384 ------
NM_052925chr19139 --1402 1796
NM_052927chr5--11653 ----
NM_052932chr1122476 615 ------
NM_052934chr161480 732 657 530 505 341 1713 11916 21776 1451
NM_052936chrX1264 ------
NM_052996chr1651619 1491 1157 495 454 --1590 1109
NM_052998chr11164 ------
NM_053001chr81161 1269 2132 115 --
NM_053016chr9117488 6756 5828 5319 5057 4887 3156 1573 474 292 34 --36842 5606 3071 17338
NM_053023chr1142578 645 287 251 133 11005 --
NM_053024chr31329 --11097 --
NM_053025chr3--31765 385 380 ----
NM_053026chr3--31765 385 380 ----
NM_053027chr3--31765 385 380 ----
NM_053028chr3--31765 385 380 ----
NM_053031chr3--31765 385 380 ----
NM_053032chr3--31765 385 380 ----
NM_053043chr7135681 5269 2523 2349 1892 1710 1683 1603 1376 759 472 141 69 32515 2340 1860 36061 3961 1028 --
NM_053046chr191539 --1418 --
NM_053056chr1151946 1195 931 776 75 11027 22319 54 22704 944
NM_054013chr55263 253 213 134 94 --4815 614 589 35 1705
NM_054016chr112003 --2738 572 --
NM_054016chr112003 --2738 572 --
NM_054016chr112003 --2738 572 --
NM_054025chr1182255 2076 2002 1806 1462 812 462 266 21547 492 3715 636 146 11429
NM_054027chr532174 571 458 --22261 2094 --
NM_054033chr21183 ------
NM_057159chr931404 53 27 --11564 --
NM_057161chr61524 ----1530
NM_057164chr2148 ------
NM_057165chr2148 ------
NM_057166chr2148 ------
NM_057167chr2148 ------
NM_057178chr1721961 72 ------
NM_057749chr81109 11361 11131 --
NM_058172chr41375 ------
NM_058241chr21770 ------
NM_058241chr21770 ------
NM_058243chr192673 189 ------
NM_078471chr172330 23 --11076 --
NM_078473chr852032 1986 1901 1844 326 --11803 1778
NM_078480chr8------2106 101
NM_078483chr5123694 3372 3108 3037 2777 2604 2555 2530 2491 1394 1367 1055 22635 1063 52903 1265 1121 931 260 12616
NM_078487chr932357 1332 320 13154 ----
NM_079834chr1961550 1100 488 427 218 105 --41582 1423 1114 574 --
NM_080391chr11574 ------
NM_080392chr11623 ------
NM_080491chr11103714 2807 2531 427 403 382 286 212 120 114 33396 3354 1477 83523 3244 3033 2686 2648 2420 876 854 11461
NM_080538chr341396 1217 919 457 1570 1579 1575
NM_080539chr341396 1217 919 457 1570 1579 1575
NM_080541chr341396 1217 919 457 1570 1579 1575
NM_080546chr92606 147 ------
NM_080594chr162146 69 --1606 149
NM_080599chr1021229 881 --1165 --
NM_080604chr61279 168 1445 182
NM_080607chr2051070 1056 309 136 94 1981 3797 781 379 --
NM_080616chr202248 129 --2622 52 --
NM_080617chr202764 137 ------
NM_080645chr621647 688 ------
NM_080669chr17124586 4120 3654 3442 1851 1802 1290 1055 763 676 428 392 23284 1083 44134 3866 469 181 2379 83
NM_080670chr55820 667 610 317 96 --1810 --
NM_080671chr261919 1814 1679 1635 161 35 ----2852 557
NM_080672chr20--186 ----
NM_080676chr2052591 2236 1260 1118 141 1957 12071 --
NM_080679chr62941 65 ------
NM_080680chr62941 65 ------
NM_080681chr62941 65 ------
NM_080717chr121281 --2972 470 --
NM_080732chr191539 --1418 --
NM_080738chr142032 1814 1503 361 21895 1695 11745 --
NM_080743chr6----21871 1015 --
NM_080744chr74444 253 197 145 ------
NM_080759chr1332021 1692 1026 ------
NM_080760chr1332021 1692 1026 ------
NM_080764chr2262317 1247 1213 549 453 408 ------
NM_080792chr2061895 1551 756 575 242 192 --11772 --
NM_080832chrX128 ------
NM_080867chr1474398 3855 3811 3721 3679 3194 911 23601 1279 ----
NM_080872chr872978 2534 1211 578 385 102 36 12507 23728 562 13781
NM_080881chr54571 94 69 53 --1123 --
NM_10026