TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-449a
miRNA Sequence: UGGCAGUGUAUUGUUAGCUGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000068chr1911337 ------
NM_000074chrX189 ------
NM_000081chr1--1418 11867 11184
NM_000115chr1342578 1048 958 395 ----12331
NM_000125chr653745 3561 940 886 659 13855 33775 3026 1177 --
NM_000135chr166971 752 698 313 146 110 --1350 1984
NM_000188chr102504 25 ------
NM_000210chr231647 408 226 ------
NM_000214chr2051786 1282 1216 622 61 --11308 --
NM_000217chr1265212 4979 4593 3282 1795 1478 24273 138 ----
NM_000238chr73314 257 50 ------
NM_000245chr762064 1963 1870 1563 786 590 11660 22171 57 --
NM_000248chr353004 2918 533 487 35 12351 22374 2341 --
NM_000264chr9172 1857 1690 12557
NM_000276chrX32138 2118 1848 21995 197 1538 --
NM_000314chr1022261 1040 --1644 --
NM_000318chr8102959 2889 2644 2231 2064 723 635 575 513 216 --1117 --
NM_000332chr686525 6483 6284 6132 5507 2372 1253 934 22518 713 ----
NM_000337chr566207 5556 5533 2254 1225 676 167 15447 1266
NM_000408chr233087 2437 106 13388 1761 --
NM_000425chrX2184 108 1149 2720 642 --
NM_000430chr1733468 3437 1487 22300 736 32638 2492 2479 13047
NM_000437chr11296 --1134 11900
NM_000461chr331474 579 154 13265 162 --
NM_000522chr721201 344 1209 11318 --
NM_000555chrX75909 4980 2934 2903 1787 886 659 --36474 1775 1421 11112
NM_000598chr721341 570 161 ----
NM_000602chr72520 445 ----2966 430
NM_000633chr1855098 4588 3205 1499 1230 2315 209 --25215 1117
NM_000681chr101869 21222 186 2936 99 --
NM_000719chr1285511 5319 4789 2576 2407 2053 944 77 14401 24453 1340 16028
NM_000721chr122588 266 ----2474 211
NM_000723chr1731400 1164 671 --21382 1277 --
NM_000806chr521576 88 11737 ----
NM_000807chr4--184 1213 --
NM_000808chrX4309 281 196 33 --1728 1228
NM_000813chr575440 4814 4720 4164 3709 3645 1895 --15037 --
NM_000814chr1543848 3783 3495 1353 11630 13229 1798
NM_000828chrX31832 1523 344 12084 --12150
NM_000838chr672750 2069 639 154 144 136 126 12146 ----
NM_000844chr31435 ----1217
NM_000868chrX22498 608 ----11736
NM_000873chr17----1120 --
NM_000875chr15146985 6281 6123 5711 5659 4495 4289 2490 1028 761 718 439 133 124 1367 22378 580 --
NM_000891chr1743642 3186 1203 784 42541 2296 1213 524 ----
NM_000899chr1243267 2923 512 22 33928 1536 1468 ----
NM_000919chr51591 ------
NM_000924chr1241190 1082 947 244 1291 ----
NM_000945chr23804 713 663 21769 721 ----
NM_000949chr51850 --1261 --
NM_000961chr2073705 3250 2858 2821 560 553 213 13553 1327 13583
NM_000965chr33473 166 80 ------
NM_001001132chr212154 130 --170 --
NM_001001323chr1222664 828 12023 12883 --
NM_001001331chr312584 11661 12213 148
NM_001001481chr863248 2497 922 592 528 132 1623 1352 --
NM_001001485chr32331 195 131 ----
NM_001001522chr11----1316 --
NM_001001664chr233148 1307 634 --1535 --
NM_001001890chr2164219 4124 3108 2703 1671 1560 14034 24130 2604 13020
NM_001001924chr8----1292 11753
NM_001001974chr1042381 2005 833 112 1445 1700 --
NM_001001995chrX----1120 --
NM_001002006chr21296 --1329 --
NM_001002243chr2----1344 --
NM_001002257chr263262 2508 2210 1422 872 389 1110 ----
NM_001002259chr121293 ------
NM_001002265chr10--163 ----
NM_001002295chr1041073 790 278 162 2775 433 11111 --
NM_001002838chrX2378 202 --21300 658 11471
NM_001002860chr1444346 1226 1219 1076 24041 355 14636 13886
NM_001003398chr121178 127 193 --
NM_001003407chr1095075 5021 4284 3929 1904 1844 824 430 336 ----15107
NM_001003694chr3--1658 164 --
NM_001003800chr933281 3159 24 ----12712
NM_001003805chr14----161 --
NM_001004304chr1243056 2674 1068 613 12006 --1865
NM_001004317chr694420 3565 3506 3048 3039 2883 936 746 585 2670 529 --13281
NM_001004342chr1126007 5487 5412 5222 4947 4797 3880 2207 1779 1649 1253 22 24017 196 13715 26115 202
NM_001005366chr1221007 242 1378 144 --
NM_001005386chr23485 302 200 22277 56 --1945
NM_001005417chr12678 37 --1554 1268
NM_001005463chr1042353 1827 780 694 --42494 1984 1928 578 1722
NM_001005474chr3----1259 140
NM_001005476chr2------1701
NM_001005505chr341655 1161 337 318 --11423 --
NM_001005781chr2----1222 --
NM_001006115chr362476 2427 2110 1915 243 40 11103 22773 2120 --
NM_001006600chr51171 ------
NM_001006641chr961583 1512 1453 1250 664 414 ------
NM_001006944chr112288 105 --2672 253 --
NM_001007098chr13627 239 106 --1376 --
NM_001007277chr111112 ----1941
NM_001007278chr1364604 3238 3209 1546 683 437 14128 1562 --
NM_001008220chr522505 860 23171 778 1334 32722 743 320
NM_001008222chrX----21097 524 --
NM_001008225chr7----1689 --
NM_001008391chr111195 --1503 --
NM_001008392chr373324 2238 1133 1056 1043 604 312 1843 11412 21084 1010
NM_001008407chr721729 1386 1518 --1394
NM_001008493chr141138 667 650 485 ------
NM_001008541chr1022238 719 1701 11712 --
NM_001008564chr1352093 1761 1576 748 427 12038 ----
NM_001008701chr1952625 2410 1038 895 455 11916 11251 --
NM_001009993chr274559 3806 2871 1024 582 415 218 ------
NM_001009997chr10----1331 --
NM_001010846chr141567 1326 431 212 34136 1592 98 ----
NM_001010888chrX114655 4528 3634 3261 2966 2859 1692 1172 699 486 295 ----1228
NM_001010898chr153390 3297 2802 616 323 11231 32739 2558 1082 --
NM_001010924chr103821 480 128 2877 41 ----
NM_001011553chr71649 1373 --1703
NM_001011666chr7106580 6227 6062 2587 1610 1404 1367 1290 764 691 15540 ----
NM_001012270chr1711914 21953 1843 21876 662 --
NM_001012393chr1194730 4722 4158 3444 1873 1667 1298 1020 65 14326 ----
NM_001012398chr162993 80 21122 117 ----
NM_001012423chr1512913 22692 349 ----
NM_001012755chrX64770 3528 3455 1970 1257 122 14486 2751 479 11759
NM_001012989chrX1500 --1558 1180
NM_001013031chr1032904 679 94 1474 13005 --
NM_001013415chr411402 ----1570
NM_001013620chr12108423 7781 7663 6735 6298 6036 3111 2805 2787 2129 1763 --16352
NM_001013690chr1232222 1986 1801 ------
NM_001013693chr152554 2216 846 750 614 12709 ----
NM_001014839chr11367 ----1862
NM_001015053chr1721586 460 --1137 --
NM_001015508chr81516 ------
NM_001015877chrX82548 2407 2397 2055 981 135 106 69 ------
NM_001015880chr1041646 1545 1158 267 ------
NM_001017440chr7157834 6306 6061 5721 5256 5112 4979 3058 2654 2416 1946 1936 1635 614 23 58167 7726 2588 758 633 11991 --
NM_001017523chr1271722 1680 1472 686 659 126 118 --2281 268 1755
NM_001017923chr14--11241 --11226
NM_001017999chr12421 25 --1748 --
NM_001018004chr151524 1219 --1101
NM_001018050chr2262885 2501 2145 1222 676 185 --32810 891 668 1709
NM_001018064chr9175 ------
NM_001018108chr1521933 330 ------
NM_001018111chr71313 34019 2730 1522 53007 1369 990 876 412 11209
NM_001020818chr1941403 1316 432 356 --11491 1658
NM_001023567chr1532305 719 496 22079 848 11597 --
NM_001024401chr1652690 2381 1873 858 711 22666 2261 42529 2345 1842 930 --
NM_001024463chr1531026 776 38 --1451 --
NM_001024808chr1241026 830 388 218 1518 32392 857 267 --
NM_001024948chr182944 2919 2838 2285 2278 2166 1035 384 12199 ----
NM_001025068chr341729 1589 363 296 ------
NM_001025077chr10116956 6045 5683 5564 5378 1845 1614 1358 911 882 239 12842 37055 6610 423 26126 102
NM_001025079chr343873 1478 851 93 13338 1375 --
NM_001025081chr1831555 217 50 ----1383
NM_001025252chr853019 2871 2759 1192 788 ----3820 79 32
NM_001025266chr344916 3250 1617 534 11385 14559 13789
NM_001029858chr643324 3270 1266 557 1375 1694 --
NM_001029863chr632855 2770 1254 ----12227
NM_001029998chr41921 1199 ----
NM_001030006chr1732037 1070 396 1476 1200 --
NM_001030007chr1683994 3735 3129 3056 595 193 148 122 ------
NM_001031689chr9----1167 --
NM_001031695chr2285444 4318 3891 3726 3597 3314 2013 1379 --35413 1457 1291 15002
NM_001031732chr472608 2574 2432 1460 1169 739 582 1356 1501 --
NM_001031803chr171289 ------
NM_001031804chr1664177 3303 1384 1342 1178 1094 1279 ----
NM_001031812chr51925 11775 22289 584 --
NM_001032280chr651678 1589 172 121 108 21660 185 21106 142 --
NM_001032288chr2011084 1488 21602 234 --
NM_001032293chr17----1623 --
NM_001033044chr141477 1280 1192 620 11420 1273 --
NM_001033045chr264411 3550 3299 1457 963 591 11721 13009 --
NM_001033047chr422673 2538 2921 522 ----
NM_001033057chr341514 1444 1366 1310 1415 ----
NM_001033081chr121890 132 ----1545
NM_001033087chr2023204 2799 23150 2451 12769 --
NM_001033112chr53624 94 47 1823 --1114
NM_001033117chr324348 1183 13414 24464 670 11288
NM_001033602chr134633 341 276 159 1980 ----
NM_001034025chr122944 762 11005 ----
NM_001034837chr52733 584 1189 2686 271 --
NM_001034841chr1674754 4446 4091 3364 1888 729 546 1126 13527 --
NM_001034954chr1063199 2079 631 492 462 341 13128 1523 --
NM_001035254chr96981 822 533 525 312 215 --42484 768 668 162 --
NM_001035511chr122098 1747 --1312 --
NM_001037290chr11------1389
NM_001037331chr18----1684 --
NM_001037339chr111763 ------
NM_001037533chr1----1663 --
NM_001037631chr2----21100 937 --
NM_001037954chr1193477 3366 3277 3234 2907 2721 643 590 477 ----11284
NM_001039348chr21418 --11052 --
NM_001039459chr72738 360 --1212 1270
NM_001039479chr1461949 1753 567 532 465 361 1581 11652 --
NM_001039577chr184172 3511 3117 3096 1786 925 248 217 ----14163
NM_001039577chr184172 3511 3117 3096 1786 925 248 217 ----14163
NM_001039580chr423569 190 11343 23554 3208 --
NM_001039590chrX43596 3542 574 351 --2595 136 --
NM_001039618chr1111696 --11304 --
NM_001039690chr1622324 1614 12054 11970 159
NM_001039840chrX44146 1469 566 318 33709 701 635 16016 --
NM_001039937chr1343971 3151 1662 1648 --21226 691 --
NM_001040001chr641910 1434 768 459 1194 1216 --
NM_001040101chr42487 158 21117 476 1200 --
NM_001040110chr721865 571 --1224 --
NM_001040142chr211871 1374 1238 --
NM_001040152chr765117 4578 3557 1711 813 431 34925 1505 1405 35042 673 444 --
NM_001040152chr765117 4578 3557 1711 813 431 34925 1505 1405 35042 673 444 --
NM_001040153chr136755 651 395 257 191 124 --1970 --
NM_001040214chr621968 336 ----1638
NM_001040402chr492695 2645 2602 2350 2324 1063 244 105 32 12889 --1453
NM_001040429chr1332892 2217 372 --1165 --
NM_001040445chr2105234 4143 4097 3586 2191 1547 1326 1016 940 727 1133 14983 1768
NM_001040613chr851615 1473 1316 537 348 ------
NM_001040712chr963087 2545 2492 2443 526 440 22682 348 13031 --
NM_001040876chr43555 542 408 11660 ----
NM_001042355chr1675190 5024 4858 4510 4412 924 514 33366 1469 729 24568 90 --
NM_001042368chr94664 645 343 139 --1198 --
NM_001042430chr141487 189 --1411
NM_001042494chr1573556 3176 3057 2802 2454 2441 401 --23032 529 --
NM_001042537chrX32155 626 465 ------
NM_001042543chr4--1287 ----
NM_001042555chr1264567 4272 4086 1889 1249 373 ----13904
NM_001042603chr1254603 1850 1820 467 254 --11676 14854
NM_001042632chr2041739 682 259 151 2111 25 22529 164 --
NM_001042749chrX41670 1654 1631 772 1663 ----
NM_001043318chr1473933 3512 3388 3026 2679 779 394 11312 13915 --
NM_001044305chr651349 1068 502 456 241 ------
NM_001044385chr232538 1272 1189 32923 2521 1427 ----
NM_001046chr553018 2439 2158 1953 832 11167 1455 --
NM_001068chr32235 204 ------
NM_001077628chr11259 --1122 --
NM_001092chr1792287 2232 1808 1681 1631 828 663 598 181 22376 414 1611 --
NM_001094chr174536 234 142 130 ----1267
NM_001095chr124501 272 252 69 1346 11294 --
NM_001100108chr1148315 8102 8093 7707 7497 7121 7000 6503 6288 5653 2831 2014 1527 518 38266 7903 2955 36919 3342 2960 45835 2717 2615 1695
NM_001106chr377408 7245 6643 2594 2186 2133 1163 28392 6592 --28176 6765
NM_001148chr451719 801 708 286 178 --2763 602 --
NM_001149chr103888 504 113 3949 439 40 1551 --
NM_001153chr23882 142 123 ----173
NM_001157chr10--1520 ----
NM_001167chrX95539 5418 4896 4461 4260 2199 2159 1926 1835 --35892 2249 1315 --
NM_001172chr14199 --1739 --
NM_001191chr201401 11077 --177
NM_001197chr22----2142 49 --
NM_001201chr453745 3265 2879 1511 421 33309 3038 162 --194
NM_001206chr922996 2080 --22134 122 --
NM_001220chr7153 ------
NM_001241chr22813 74 1204 1209 --
NM_001259chr732272 1074 375 2317 288 36243 4994 1094 --
NM_001270chr52199 70 --1282 --
NM_001271chr1563242 2725 2544 2038 743 656 13010 23171 691 --
NM_001332chr521362 372 ------
NM_001362chr1421040 202 ------
NM_001364chr1174559 3033 1717 1580 1437 655 200 1367 13604 --
NM_001383chr17--1817 1608 --
NM_001386chr83960 394 384 --12359 --
NM_001390chr1863414 2909 2518 2499 1149 529 --13305 12452
NM_001396chr2122264 361 12157 11749 --
NM_001407chr31637 ------
NM_001419chr1954908 3183 1099 785 323 --24407 1913 --
NM_001427chr721779 1638 --11600 --
NM_001438chr183693 3379 2764 1390 1283 946 794 641 33242 1366 1348 ----
NM_001447chr521040 557 --21256 1027 --
NM_001455chr624897 1095 23237 1931 34392 3215 1916 1919
NM_001543chr5134403 4349 4204 4118 3527 3312 2936 1461 1422 1381 1001 323 308 34857 1589 854 21822 657 23799 381
NM_001554chr11244 1163 ----
NM_001584chr1111044 148 ----
NM_001616chr262600 1267 1082 681 167 69 23396 374 21129 173 --
NM_001617chr22923 299 --21217 284 --
NM_001621chr732983 2213 534 2226 74 1704 12762
NM_001627chr331570 527 339 --1903 --
NM_001642chr1111052 175 21129 422 192
NM_001650chr1874089 3589 2690 1478 1389 1112 44 --22604 538 --
NM_001663chr142839 513 187 ----
NM_001664chr31929 1642 1207 --
NM_001677chr11315 21094 88 ----
NM_001679chr34762 634 196 180 1297 ----
NM_001695chr854067 2943 2774 2716 384 --11522 21643 497
NM_001699chr1951657 1520 699 486 443 ----151
NM_001701chr92541 165 21136 92 ----
NM_001706chr3------1198
NM_001709chr113511 455 333 --1940 --
NM_001731chr12----1633 --
NM_001742chr721132 206 --11391 1367
NM_001755chr1652198 1539 559 93 73 1199 ----
NM_001773chr131543 1382 483 --1177 --
NM_001789chr321670 499 1522 ----
NM_001844chr121295 ------
NM_001845chr1311362 11336 2412 99 --
NM_001860chr93939 171 76 --21122 787 --
NM_001865chr6--1120 ----
NM_001923chr114605 491 116 54 1525 ----
NM_001927chr2----152 --
NM_001935chr2--1650 --175
NM_001938chr131844 713 175 ------
NM_001949chr622123 2044 2828 553 --12737
NM_001991chr1752015 1639 1432 168 89 1690 269 43 12195
NM_001995chr42516 460 --1172 --
NM_002025chrX58916 3630 3003 2282 1896 29281 8933 ----
NM_002031chr61182 --1218 --
NM_002046chr12----159 --
NM_002048chr921249 886 ------
NM_002069chr71552 ------
NM_002070chr3--2781 614 1875 --
NM_002076chr1262673 2369 2354 1284 1188 265 2851 733 13256 --
NM_002086chr1731872 1687 74 --1236 --
NM_002089chr41609 ------
NM_002126chr1743146 2912 2794 757 1629 33503 810 713 --
NM_002158chr222722 779 33663 3525 3411 ----
NM_002193chr2--11496 ----
NM_002199chr42650 395 --1281 --
NM_002202chr54875 698 336 175 --1416 --
NM_002214chr785616 5355 5007 4925 2091 1594 1236 812 24528 738 ----
NM_002247chr103903 279 22 --12316 --
NM_002270chr585090 3623 2029 1939 1766 1479 1394 180 --15685 --
NM_002283chr125840 784 722 514 54 --1799 --
NM_002298chr1331607 1431 47 ------
NM_002336chr1264535 3546 1350 892 741 26 ------
NM_002356chr6----12565 1460
NM_002373chr1531386 973 62 11180 1882 2554 280
NM_002382chr1451277 1070 442 194 33 ------
NM_002390chr1731973 687 62 1290 31716 1607 255 --
NM_002395chr6----1561 --
NM_002430chr2232343 946 528 --1483 --
NM_002442chr122170 130 --11339 11269
NM_002467chr81143 ------
NM_002473chr221100 --11038 --
NM_002499chr1582298 2064 1881 1875 704 633 579 480 12101 22353 1519 --
NM_002500chr25907 150 93 58 42 ------
NM_002501chr1984086 3986 3406 2955 1668 1011 490 348 --11090 --
NM_002505chr641505 1413 1344 46 --11170 --
NM_002515chr1431288 803 533 11254 22018 422 --
NM_002537chr152914 320 --1301 2747 365
NM_002544chr17------1329
NM_002556chr1121827 1668 ------
NM_002576chr1121206 430 ------
NM_002583chr12--1461 --1560
NM_002589chr4----1108 --
NM_002594chr2032056 588 477 ----1141
NM_002595chr1281791 1574 1520 1290 739 430 335 317 --1115 --
NM_002603chr8127 ------
NM_002634chr173908 853 97 1235 ----
NM_002636chr61342 ------
NM_002645chr1182735 2152 2115 2082 1074 550 394 217 ------
NM_002651chr1----1268 --
NM_002655chr855243 4836 4086 3226 1759 --13909 1223
NM_002660chr2041166 1123 738 328 21186 964 --1781
NM_002667chr61829 ----1328
NM_002697chr1--259 22 1231 --
NM_002698chr1932664 517 96 ----1649
NM_002709chr253137 2594 1112 177 71 22704 1123 11020 --
NM_002718chr332585 2162 81 12420 --1483
NM_002731chr132966 2912 517 42840 1210 404 136 11145 --
NM_002738chr16------2329 84
NM_002742chr143283 132 32 2640 85 ----
NM_002745chr2293569 1599 1412 1265 1171 1136 1008 700 263 24474 1186 24202 1329 --
NM_002753chr4--2730 628 ----
NM_002755chr151170 --1320 1580
NM_002841chr33619 450 245 ------
NM_002849chr121733 21086 427 ----
NM_002851chr71497 1812 ----
NM_002869chr1142125 2075 1496 130 12228 141 --
NM_002871chr11249 11932 190 1684
NM_002892chr1431204 386 100 2500 37 ----
NM_002906chr11--11678 1233 --
NM_002911chr1951634 1432 1242 1078 119 --1496 1101
NM_002912chr61367 --1106 --
NM_002941chr31345 1455 1351 --
NM_002971chr31195 ------
NM_002973chr12150 --1492 --
NM_002977chr22878 564 12856 12188 12502
NM_002994chr431820 1733 450 1701 ----
NM_002998chr822114 797 11862 22168 1623 --
NM_003010chr1772328 2287 2023 1914 1870 1852 1586 21712 807 1463 --
NM_003016chr17----11408 --
NM_003021chr19190 ------
NM_003026chr921317 254 --2419 59 --
NM_003032chr342550 2179 2051 2029 21682 314 22120 1843 --
NM_003042chr341693 865 427 369 1769 --11601
NM_003081chr20--1381 ----
NM_003082chr1421300 308 186 ----
NM_003098chr20172 ------
NM_003099chr1566248 5894 4674 2190 1007 139 22577 1221 34927 54 39 --
NM_003107chr632183 2018 1979 --12581 --
NM_003108chr2107082 6766 6187 5750 5658 5466 2798 2739 2145 602 --21516 1504 --
NM_003118chr52408 318 2797 703 ----
NM_003131chr631865 1712 1584 --1515 --
NM_003139chr11----1205 --
NM_003145chr11341 ------
NM_003155chr831993 1919 667 --12027 --
NM_003156chr1131319 1010 134 ------
NM_003161chr1763512 2299 2225 887 386 327 1806 ----
NM_003164chr111480 3566 124 71 1139 --
NM_003173chrX41435 1189 1087 398 190 165 --
NM_003184chr8--1399 ----
NM_003188chr62195 121 ------
NM_003205chr1542301 1906 860 291 --11789 --
NM_003216chr2231129 362 30 --13287 --
NM_003234chr331623 980 269 1815 ----
NM_003246chr1521829 1736 1748 1753 11767
NM_003257chr152362 189 --1279 --
NM_003288chr2071117 993 534 488 229 150 24 ------
NM_003309chr641584 676 500 287 --1303 --
NM_003334chrX----1150 --
NM_003338chr102606 80 ----1698
NM_003339chr521231 84 --21621 204 --
NM_003340chr431009 449 198 --1337 --
NM_003342chr1721006 64 13118 ----
NM_003345chr161173 --1138 --
NM_003347chr2272339 1940 1891 1884 784 498 457 --22209 236 --
NM_003348chr1231720 573 296 ----1180
NM_003350chr8------1224
NM_003369chr1141845 779 569 521 12485 ----
NM_003373chr102787 75 21405 483 --1661
NM_003403chr141188 1726 ----
NM_003406chr841938 1637 339 313 ------
NM_003458chr343046 2979 203 46 33580 2595 1569 43235 1257 659 441 1757
NM_003459chr23739 709 67 ----129
NM_003462chr121758 565 21686 290 1316 11110
NM_003470chr1691665 1634 1174 712 600 553 350 173 112 1260 ----
NM_003474chr1061823 1655 891 868 857 137 ----1804
NM_003477chr112631 532 ------
NM_003478chr1123309 563 1657 12947 --
NM_003482chr1242094 741 625 113 --1768 --
NM_003483chr1252259 452 375 237 64 2693 89 12894 --
NM_003558chr91547 ----1275
NM_003566chr1223337 3003 12675 ----
NM_003583chr1263501 2769 2379 1033 592 44 33623 2439 305 ----
NM_003586chr164537 477 455 94 ------
NM_003590chr233458 2739 2527 13269 --1766
NM_003591chr101419 ----140
NM_003615chr3------11203
NM_003622chr1252679 2313 1792 879 370 --12636 --
NM_003624chr192909 173 ------
NM_003632chr172591 350 --1194 --
NM_003637chr1--1620 ----
NM_003654chr111521 ------
NM_003672chr111220 ----11969
NM_003692chr91408 ------
NM_003701chr13----11046 1850
NM_003709chr2----194 --
NM_003714chr553081 2656 1193 919 641 --32446 703 662 --
NM_003716chr33898 873 698 2639 130 ----
NM_003718chr7------1470
NM_003728chr42696 154 ------
NM_003743chr232065 1845 1395 12257 ----
NM_003768chr121809 1630 --11481 11153
NM_003779chr1177 --1146 --
NM_003818chr201683 --1107 --
NM_003822chr133033 2892 98 --22757 2271 12424
NM_003825chr151179 --11550 1314
NM_003831chr1821352 1195 151 11792 --
NM_003860chr11----1334 --
NM_003870chr1532066 1432 700 --11662 --
NM_003872chr21221 2661 593 --12696
NM_003887chr22410 200 --2901 124 --
NM_003895chr2131864 1491 440 1406 --1823
NM_003908chr2041320 1184 1091 526 31303 1293 107 1180 --
NM_003916chrX145 --21211 967 --
NM_003939chr1074047 3600 1487 1371 1284 211 107 11634 12847 --
NM_003947chr321263 349 --11024 --
NM_003948chr421703 122 --12571 --
NM_003966chr5127586 6548 5482 5284 2441 2307 2273 1224 1162 651 488 65 37723 5772 145 27669 6517 --
NM_003969chr191376 ------
NM_003980chr611223 11265 ----
NM_003988chr102658 52 --3823 612 62 --
NM_004050chr1441765 1020 786 506 12426 ----
NM_004055chr1132128 1676 696 2347 246 --1255
NM_004064chr12----21036 50 --
NM_004102chr1--1515 2444 67 --
NM_004114chrX1406 1248 ----
NM_004116chr2----2305 117 --
NM_004124chr1432898 2167 92 22825 2679 --1841
NM_004133chr821959 246 12447 ----
NM_004170chr9--11801 21848 67 --
NM_004183chr111303 --2625 554 --
NM_004232chr1833269 1429 317 21248 97 --178
NM_004235chr92663 544 --168 132
NM_004263chr221200 217 --31187 732 717 --
NM_004272chr51163 --2490 44 --
NM_004274chr1453135 3055 3042 2873 1992 --1122 --
NM_004277chr6------11408
NM_004301chr32338 312 ------
NM_004308chr1161359 648 530 491 468 352 --21427 209 --
NM_004316chr1221093 1031 ------
NM_004326chr1--1300 ----
NM_004330chr15----1165 1915
NM_004337chr8--11640 --2216 196
NM_004342chr741929 498 334 198 --12019 --
NM_004370chr621946 1812 --12161 --
NM_004379chr251754 1200 1193 365 119 1460 ----
NM_004392chr1332680 2026 255 ------
NM_004393chr321796 1746 --192 12130
NM_004397chr1163458 1710 820 718 241 209 11244 11251 --
NM_004420chr1152353 888 864 332 201 --52236 2126 2016 590 313 --
NM_004429chrX41287 1125 366 347 11195 11272 --
NM_004432chr94449 325 251 240 12078 1879 --
NM_004438chr262672 2237 1324 1291 1276 189 22213 319 42801 1178 1087 290 --
NM_004458chrX1768 ----11920
NM_004475chr17----41185 1177 856 456 1213
NM_004480chr14------1303
NM_004496chr142838 531 ----11065
NM_004501chr163940 3909 3568 3102 2819 467 22612 2581 --21470 1457
NM_004571chr2132490 2367 2107 1432 22798 2544 1316
NM_004574chr171127 ------
NM_004575chr41534 --11316 --
NM_004580chr1521209 723 1335 11620 11216
NM_004583chr171272 --2596 23 --
NM_004586chrX73402 2020 1725 1393 1236 494 425 25256 4905 34240 2150 102 --
NM_004588chr1193986 3782 3698 3339 3264 3185 2967 1363 638 11041 12508 22459 1454
NM_004607chr5------177
NM_004655chr172263 55 1282 ----
NM_004687chr1741924 1831 775 534 21793 1465 ----
NM_004705chr112753 297 ------
NM_004711chr22103388 3300 3027 2753 2316 1294 1132 633 171 80 1717 32266 1389 990 --
NM_004713chr14----2183 117 --
NM_004717chr7----1341 11250
NM_004742chr341841 1793 1613 1184 ------
NM_004755chr145995 975 817 799 31 ------
NM_004756chr1941267 1028 484 467 --1232 1495
NM_004768chr111007 --1367 --
NM_004781chr131756 407 25 1297 ----
NM_004789chr9--1303 ----
NM_004800chr13175 ------
NM_004815chr124052 3355 2620 107 14204 --
NM_004824chr61275 ------
NM_004834chr211108 --1846 --
NM_004842chr63432 157 124 1340 11551 --
NM_004849chr621333 115 ----1203
NM_004852chr181514327 14248 13713 12743 9861 9207 9079 3782 3100 2783 1822 1718 1616 1293 245 614044 11237 10181 9343 2554 1198 112695 --
NM_004863chr1494900 4024 3895 1758 1325 939 576 375 176 13804 1114 24979 1999
NM_004884chr152581 127 175 --21193 395
NM_004891chr21192 ------
NM_004898chr442722 2645 2289 158 1276 1921 1396
NM_004899chr21115 ------
NM_004906chr6155 1446 ----
NM_004921chr151861 1607 524 332 112 ------
NM_004929chr841300 567 418 37 ----11515
NM_004947chr342605 1015 347 147 ----1641
NM_004952chr12393 179 ------
NM_004973chr661662 699 268 229 216 195 11463 ----
NM_004985chr1273585 3531 3118 1363 1182 865 531 --14165 1562
NM_004991chr3145 --1336 --
NM_004992chrX78015 7767 7415 6949 6369 3187 2280 43029 2190 2180 1386 26825 1895 18126
NM_004998chr151824 --1914 --
NM_004999chr654071 3701 3685 1510 1235 14423 11367 13546
NM_005028chr1031785 1673 817 ----11840
NM_005045chr71161 1784 ----
NM_005063chr1073370 2557 2416 1504 1100 628 275 --11207 13712
NM_005076chr163497 2730 1142 929 268 91 33758 3636 74 11417 1766
NM_005094chr93596 446 126 1145 1159 --
NM_005095chr1----1619 1549
NM_005096chrX41149 809 411 113 11134 11001 --
NM_005097chr10--3329 123 23 ----
NM_005099chr13846 238 79 ------
NM_005109chr332554 2185 625 185 ----
NM_005121chr1763736 3199 2778 765 525 57 12510 ----
NM_005156chr944790 4668 1184 609 23830 3736 ----
NM_005171chr1211272 21215 1026 ----
NM_005187chr1631662 157 108 --21286 149 --
NM_005206chr1721426 278 1192 1474 --
NM_005229chrX11216 ----1815
NM_005238chr1123196 990 ------
NM_005249chr142645 254 --1605 --
NM_005259chr2--11255 ----
NM_005281chr11773 ------
NM_005284chr61340 1378 ----
NM_005295chr7--176 ----
NM_005313chr154425 377 327 171 ------
NM_005328chr8----1107 --
NM_005339chr423824 3659 24038 800 13580 --
NM_005374chr1741592 1559 598 216 --32330 680 355 22047 173
NM_005375chr611155 --11091 --
NM_005378chr2----1587 130
NM_005400chr232618 2214 332 --2255 127 --
NM_005402chr741183 742 393 220 --1671 163
NM_005406chr1841527 571 542 276 ------
NM_005430chr121905 --1269 --
NM_005436chr1063959 3879 3676 2992 2803 2700 13565 ----
NM_005438chr112189 183 ----1437
NM_005458chr962430 2104 1918 1681 735 417 22390 510 178 --
NM_005465chr12711 247 --11952 129
NM_005491chrX41619 807 603 441 42124 880 830 800 12072 --
NM_005509chr511652 1696 1192 11554
NM_005523chr7------11210
NM_005539chr1081323 1283 1274 1263 1060 999 547 369 1332 1186 --
NM_005561chr13----1973 --
NM_005566chr11----130 --
NM_005569chr221210 --147 --
NM_005593chr122482 179 ------
NM_005596chr946389 5896 4909 3987 36372 6300 1983 14342 15068
NM_005614chr7158 --1833 --
NM_005618chr61108 --1203 --
NM_005626chr1----193 --
NM_005639chr1271759 1686 1559 1468 1461 1447 271 11545 21565 194 --
NM_005665chr194650 4110 3333 3000 1255 1119 783 569 365 ----23874 206
NM_005668chr564561 4462 4112 3483 731 324 --12858 1317
NM_005678chr151637 1666 ----
NM_005688chr33930 876 379 --21235 851 143
NM_005698chr1----1198 --
NM_005711chr52726 414 ------
NM_005717chr14868 530 456 400 11036 180 --
NM_005730chr1253503 3357 3094 3022 53 --23237 1441 1407
NM_005736chr1031155 432 87 --21586 1000 --
NM_005746chr75765 742 674 601 121 --1490 --
NM_005761chr12----1123 --
NM_005768chr12--1140 1532 --
NM_005789chr1722131 1910 11973 21567 54 --
NM_005802chr9169 2554 229 ----
NM_005813chr21751 11793 --12248
NM_005828chr17134892 4801 4063 3868 3771 3507 3485 3479 3197 1880 363 123 109 13786 34173 801 648 --
NM_005853chr161595 --1602 --
NM_005857chr121433 1345 --11134 11500
NM_005859chr511574 --11105 --
NM_005876chr21764 --1677 --
NM_005885chr53612 554 189 ------
NM_005896chr21523 1176 --1273
NM_005899chr17127 ------
NM_005906chr631441 662 31 11480 1192 1497
NM_005909chr534018 3968 1194 12783 ----
NM_005911chr241392 931 266 251 ------
NM_005933chr1162672 2494 2329 2298 793 389 --1753 22862 2309
NM_005934chr1942267 1619 518 138 12337 51739 570 355 330 100 --
NM_005941chr821358 562 --22734 881 11401
NM_005955chr184654 4239 3915 3815 1640 697 353 250 11766 34780 1333 748 --
NM_005966chr221770 1541 ----11559
NM_006015chr12879 460 ----1849
NM_006037chr244611 4286 4038 337 ------
NM_006038chr2042033 1593 372 354 1746 ----
NM_006047chr2023489 183 23381 2423 --23478 1411
NM_006055chr222064 30 12139 --12079
NM_006060chr7134277 4265 4104 3615 3481 3221 3140 3023 1413 777 759 656 60 1232 11614 --
NM_006062chr221252 490 --2195 100 --
NM_006079chr62720 339 1173 ----
NM_006080chr742969 2918 1963 270 1327 ----
NM_006089chrX11331 ------
NM_006096chr821364 90 21347 296 ----
NM_006139chr21987 12014 31844 509 60 --
NM_006141chr1642824 2583 787 701 --12635 --
NM_006145chr192897 119 ----11104
NM_006147chr11431 ------
NM_006156chr14----187 --
NM_006160chr1721621 432 --11033 --
NM_006186chr22453 110 21140 51 11199 --
NM_006197chr832261 1460 199 --1112 --
NM_006206chr451992 1983 1937 946 331 12676 12705 11895
NM_006212chr174812 4236 4224 2019 1657 1101 480 --25274 1129 --
NM_006228chr8138 ----1370
NM_006237chr1311935 12049 ----
NM_006243chr1----2861 388 --
NM_006252chr186896 6132 5134 5103 2812 1082 556 88 35633 2111 1762 ----
NM_006270chr19148 --1236 1278
NM_006277chr2----1718 --
NM_006282chr2054763 4004 3108 791 768 23166 1012 14646 --
NM_006283chr8105003 4758 4741 3609 3358 3056 1808 580 134 87 54831 4486 4400 1901 156 24979 1419 --
NM_006285chr92268 214 ------
NM_006305chr15--1208 ----
NM_006306chrX55892 4687 1958 519 314 14742 24929 4460 1131
NM_006313chr1251345 1270 484 432 373 1641 ----
NM_006317chr53767 343 171 ------
NM_006320chr421008 66 2893 178 ----
NM_006352chr121372 310 --1608 --
NM_006373chr1751419 1308 1297 1221 1109 ------
NM_006375chrX2338 193 1454 ----
NM_006401chr9151 1461 ----
NM_006420chr2032972 2561 278 2426 265 31352 956 815 --
NM_006472chr131157 997 923 21165 1068 11209 --
NM_006517chrX--2650 351 --1423
NM_006546chr17116541 6383 4129 4109 2488 2378 2221 1918 1564 1095 531 21009 569 34144 864 208 16132
NM_006557chr911696 --11763 11439
NM_006565chr1611269 11041 ----
NM_006595chr1151508 1474 1382 152 126 11673 ----
NM_006599chr1668047 7189 6499 5185 2853 995 --27282 6764 --
NM_006601chr12------1722
NM_006609chr2--12233 12572 --
NM_006624chr10--11509 ----
NM_006633chr52603 223 --195 --
NM_006670chr61454 ------
NM_006736chr251754 1724 1689 97 56 --1582 --
NM_006738chr1584409 4331 3919 3632 1718 1266 220 29 23962 3050 1102 1999
NM_006742chr1642005 1573 1505 51 12024 21274 314 --
NM_006749chr81156 --1340 --
NM_006750chr16115977 5630 5164 5018 4958 3061 2034 1854 1108 502 131 55357 1277 1184 281 34 47733 7091 724 631 1917
NM_006751chr2----1342 --
NM_006763chr151845 1737 1643 576 43 ------
NM_006775chr632725 1924 584 12895 12169 --
NM_006800chrX2149 30 --1565 --
NM_006823chr84491 474 444 116 --1525 --
NM_006827chr1452558 2338 816 637 429 --1754 12310
NM_006841chr31113 --1677 --
NM_006846chr51265 ------
NM_006861chr1282143 1955 1711 1462 1442 524 403 32 11530 1256 --
NM_006874chr421230 206 ------
NM_006885chr1663824 3817 2863 1143 654 393 12959 11573 --
NM_006887chr2------1692
NM_006902chr141220 785 564 555 --12891 194
NM_006908chr71336 --11205 11228
NM_006912chr122310 885 --2827 197 22133 2061
NM_006920chr21354 1371 21381 237 --
NM_006930chr561299 1239 723 715 438 160 --2754 445 --
NM_006931chr1241938 1658 1367 310 ----11485
NM_006939chr142888 264 2786 230 1205 --
NM_006941chr2211085 --1154 --
NM_006943chr2053027 2942 2617 1299 815 --22350 692 --
NM_006946chr11193 3519 141 51 ----
NM_006948chr2122376 1709 1524 ----
NM_006951chr10------1758
NM_006990chr11499 11698 12298 12193
NM_006997chr10----160 --
NM_006999chr551961 1685 784 433 45 --11283 --
NM_007005chr921372 113 ------
NM_007008chr23747 383 146 1177 ----
NM_007030chr544919 3445 1398 763 14029 35170 1242 28 53540 3361 1237 1119 944
NM_007038chr2185784 5222 4789 1635 1542 875 726 295 24936 4759 26089 174 13935
NM_007106chr1332379 602 74 1308 --1141
NM_007112chr1------1231
NM_007114chr332030 1164 459 12849 1567 --
NM_007122chr1----186 --
NM_007125chrY31315 459 154 1242 ----
NM_007159chr321405 138 11509 11153 --
NM_007172chr2232789 2078 202 3740 483 31 ----
NM_007174chr1212026 --1670 --
NM_007178chr12182 --1447 --
NM_007189chr741316 1202 114 103 --21534 610 --
NM_007192chr1411035 1431 1903 --
NM_007213chrX------1445
NM_007217chr3150 1139 ----
NM_007245chr161204 --1176 --
NM_007249chr1379269 8198 6643 6436 6204 932 803 25953 3666 28143 2211 --
NM_007271chr61708 21285 618 --1746
NM_007278chr171308 ------
NM_007285chr16134 1428 ----
NM_007363chrX1419 ------
NM_007373chr1031263 1120 27 144 11343 --
NM_012074chr14----11102 --
NM_012081chr543086 2653 2441 626 31377 1265 1068 23340 690 12291
NM_012095chr1063500 3239 803 597 532 477 12646 1574 --
NM_012104chr1143529 1349 1330 528 13009 11216 --
NM_012105chr21----1152 --
NM_012120chr61546 12910 --12280
NM_012156chr2022818 791 1118 1209 --
NM_012166chr941564 591 411 66 --41513 1365 1266 1073 --
NM_012174chr1242634 2246 1083 294 32860 726 215 22916 758 --
NM_012180chr4----1240 --
NM_012199chr163453 3275 3163 3073 2911 1537 21287 612 21832 1490 --
NM_012214chr2106361 6145 5801 5634 4782 4127 4022 2094 1711 1500 35146 5087 4691 --35958 1900 608
NM_012234chr362332 1446 1359 1082 750 551 1122 23622 2286 --
NM_012238chr1011751 21440 1106 ----
NM_012242chr10----1276 --
NM_012247chr1021015 746 --1163 11008
NM_012249chr273297 3005 2696 2587 2463 322 30 23450 2400 12748 --
NM_012261chr20------1549
NM_012262chr154937 4699 1813 1634 933 ----13892
NM_012282chrX1251 ------
NM_012290chr231323 315 245 ------
NM_012301chr73868 671 324 ----22218 90
NM_012309chr1164447 3709 3496 1683 832 30 21350 1032 13475 --
NM_012329chr1721313 76 1641 --11653
NM_012419chr6--2418 208 --1623
NM_012428chr152877 119 --1360 --
NM_012446chr52617 214 --1470 --
NM_012463chr1241820 1351 567 107 ------
NM_012471chrX--11861 2492 91 --
NM_012481chr171757 --1155 --
NM_012482chr1------166
NM_012484chr51696 1111 ----
NM_013231chr1464038 3921 3159 2990 2928 2729 12719 --24176 1303
NM_013233chr231337 1244 451 ------
NM_013249chr11----1347 --
NM_013261chr483562 3457 2981 2393 1274 1159 921 820 11187 13135 --
NM_013262chr621274 162 ----11237
NM_013272chr15------1311
NM_013279chr1142364 1979 1659 93 11973 21763 849 --
NM_013281chr2051484 1129 1086 185 80 11141 ----
NM_013306chr111288 ----144
NM_013316chr71224 --1865 --
NM_013411chr162644 2127 868 819 712 468 --32367 2340 33 --
NM_013449chr122880 84 12939 12274 --
NM_013952chr23800 270 199 22286 1885 --157
NM_013958chr8196 ------
NM_014001chr1751665 1626 538 156 46 31200 480 369 21394 267 11022
NM_014011chr262545 2403 2104 1826 1688 476 ------
NM_014016chr32600 167 21597 628 11201 --
NM_014028chr663001 2389 2316 958 825 444 --12183 --
NM_014048chr1665068 3549 3296 3282 1734 444 1694 --14656
NM_014112chr854160 4070 3916 1235 342 14972 --11427
NM_014141chr735016 3893 1833 --11162 21855 1114
NM_014153chr161697 1218 ----
NM_014181chr252053 1786 817 775 727 --12913 --
NM_014216chr1431516 1066 366 1318 11664 --
NM_014231chr1252076 1566 861 452 344 --11757 134
NM_014232chr1711261 1617 21244 1117 11298
NM_014240chr373915 3548 3332 3205 2696 1462 930 1391 33948 3783 1109 11553
NM_014253chrX62482 2301 998 532 128 37 1438 11696 --
NM_014271chrX2676 81 --1696 --
NM_014289chrX1963 --11434 1512
NM_014299chr1951694 1507 1350 242 201 ------
NM_014325chr122515 388 ----1103
NM_014372chr1----1529 --
NM_014382chr31577 ----1568
NM_014399chr73370 311 260 --1254 --
NM_014423chr585679 4717 4626 4537 3457 1968 943 44 169 14898 --
NM_014456chr1021673 1187 1313 ----
NM_014489chr111829 --138 --
NM_014491chr7--1381 ----
NM_014494chr16----11498 --
NM_014517chr341219 398 325 259 ----2178 172
NM_014573chr1751654 1615 1391 1224 251 1636 21437 76 --
NM_014577chr221684 ------
NM_014603chr1711456 --1495 --
NM_014607chr22628 84 ----1220
NM_014612chr941489 1469 587 515 --11071 --
NM_014613chr553009 2284 501 181 148 22112 1002 11985 --
NM_014618chr9------1395
NM_014636chr963910 3355 3146 1583 441 330 13675 --23176 1032
NM_014646chr1882845 2621 1077 872 470 436 347 294 11305 --12292
NM_014647chr1612168 --141 --
NM_014655chr152320 2312 1507 468 157 --21740 1576 --
NM_014665chr883060 2534 2224 1442 1365 912 847 278 22589 637 31389 685 250 --
NM_014682chr851755 1604 1431 124 103 180 ----
NM_014701chr1521381 819 11027 186 --
NM_014707chr74453 419 334 299 11609 2683 645 --
NM_014720chr1011324 ----1277
NM_014729chr82710 287 1790 ----
NM_014730chr12115283 4886 4694 4334 4264 2103 1707 1148 652 618 337 11003 15277 12066
NM_014731chr2021613 1113 --21591 177 --
NM_014742chr202722 596 --31459 1144 383 --
NM_014747chr1135724 5608 5079 4060 3827 3802 3664 2062 1066 1032 525 499 380 13517 11248 12200
NM_014751chr821802 824 --11586 --
NM_014752chr1121815 1640 1652 ----
NM_014757chr552321 1967 1825 890 369 --1321 --
NM_014770chr12----1515 --
NM_014772chr1873547 3372 3036 2727 2565 780 612 1973 32810 2390 1165 --
NM_014795chr211249 --169 --
NM_014798chr1741910 1849 324 314 11755 21632 548 21375 599
NM_014819chr511941 1329 ----
NM_014820chr331998 1761 1548 11973 --174
NM_014827chr121354 1274 ------
NM_014832chr1311570 --11402 --
NM_014841chr641292 1143 1094 884 ------
NM_014846chr81244 ------
NM_014862chr1544192 3319 557 154 ------
NM_014871chr122527 416 ----1491
NM_014873chr173021 2952 1626 1275 1125 817 641 14547 ----
NM_014877chr17116519 6189 5977 5677 5247 4997 2658 2485 2191 1678 659 27769 5361 15615 --
NM_014903chr1221949 1652 1604 2892 824 181
NM_014912chr1033041 804 334 23086 305 166 --
NM_014917chr12855 234 1759 --1248
NM_014924chr1433209 3146 2737 --22662 2182 --
NM_014942chr641876 1613 979 931 ------
NM_014943chr82223 24 --21157 939 --
NM_014952chr1521823 432 11753 163 --
NM_014974chr1051644 1204 1179 476 227 ------
NM_014982chr1474831 4570 3845 1753 994 644 225 1379 2299 181 1849
NM_014989chr621807 1773 --11892 --
NM_014991chr452737 1111 870 839 468 ------
NM_014992chr14----175 1792
NM_014999chr1231423 307 143 170 21647 51 --
NM_015000chr1231232 420 401 --2483 277 --
NM_015001chr13803 350 90 ----1113
NM_015017chr13933 823 296 ----11152
NM_015018chr6----163 --
NM_015035chr2056303 5508 4747 2411 954 21909 84 --1370
NM_015040chr273377 3170 2278 1344 1313 142 103 12934 ----
NM_015042chr1533630 2694 694 --2923 332 --
NM_015051chr91475 11033 12211 1290
NM_015052chr71165 1219 ----
NM_015057chr133695 520 38 ------
NM_015071chr5136274 6017 4807 4528 1494 1403 1036 544 433 370 197 53 23 1693 24296 1839 11246
NM_015075chrX2869 258 1303 31982 1722 591 --
NM_015076chr6114513 4431 4387 4363 4234 4070 4018 3600 1222 626 525 13624 ----
NM_015080chr115882 219 189 106 32 --1354 126
NM_015086chr12----11550 --
NM_015092chr1653973 2962 1756 1390 893 ------
NM_015093chr621536 455 --1238 182
NM_015099chr171755 1741 ----
NM_015100chr11285 ------
NM_015104chr113419 110 33 ------
NM_015132chr731693 1244 242 --21515 1319 --
NM_015138chr1542770 2303 774 400 1127 12072 --
NM_015143chr421112 198 --1294 --
NM_015155chr1073380 3332 2503 2494 2476 2348 648 ------
NM_015156chr1483924 3173 2535 821 685 673 666 209 1522 ----
NM_015170chr821531 199 --1153 --
NM_015173chr441506 1400 1285 313 21548 1490 140 --
NM_015176chr121465 1250 --21346 681 --
NM_015185chrX52065 1888 688 350 82 --21920 399 --
NM_015192chr2032801 2088 451 --22356 78 --
NM_015210chr183944 839 250 --1129 --
NM_015215chr143137 556 194 37 11957 --12136
NM_015236chr4--2192 36 ----
NM_015245chr642167 824 571 21 1342 1800 21724 63
NM_015251chr1632320 584 519 1469 22013 415 1620
NM_015252chr2------1900
NM_015265chr212160 --1726 12329
NM_015267chr1241763 1461 793 592 --1195 --
NM_015268chr32738 86 ------
NM_015271chr454149 2885 1564 796 775 13609 ----
NM_015272chr16--22144 203 ----
NM_015277chr1831696 1484 1339 ------
NM_015278chr693258 3208 3177 2679 1330 1024 943 894 47 --13085 --
NM_015288chr573770 3156 2640 1482 823 352 164 43211 753 112 70 --2507 333
NM_015291chr162936 2775 2656 1051 732 263 23092 438 --12970
NM_015296chr1311253 --11204 --
NM_015315chr51690 12327 31164 463 453 --
NM_015317chr222166 652 ------
NM_015319chr12----3397 149 38 --
NM_015328chr772201 2147 1036 885 254 194 106 --2862 501 11148
NM_015336chr12------1188
NM_015338chr2031917 296 214 11292 21933 486 1142
NM_015339chr203974 130 89 ------
NM_015343chr17195 ------
NM_015344chr811690 ----11963
NM_015347chr1232791 2496 2250 ----1854
NM_015379chr7----1210 --
NM_015396chr331100 962 474 11217 ----
NM_015435chr841493 1160 267 32 ------
NM_015446chr121613 1121 --21700 1299 --
NM_015447chr9--1571 2272 260 --
NM_015455chr531572 1177 938 1202 31162 971 348 --
NM_015458chr874942 4520 4471 4146 3794 1490 1249 --44655 4337 2104 882 --
NM_015460chr33391 186 133 12118 2807 34 12105
NM_015464chr7----184 1998
NM_015472chr3----1152 --
NM_015477chr151854 1808 ----
NM_015497chr154979 798 732 397 --1230 --
NM_015509chr1211275 --11407 --
NM_015526chr1921442 1432 --1388 --
NM_015534chr151124 1000 850 236 178 ------
NM_015549chr14----1632 --
NM_015550chr732572 2410 659 --22966 2901 --
NM_015554chr1552260 1997 1871 1132 337 --32244 1986 788 --
NM_015568chr2053927 3528 3519 2996 152 24293 3075 21563 1515 1491
NM_015569chr153240 1805 599 469 153 2513 196 14711 14198
NM_015577chr54687 181 166 103 --126 177
NM_015578chr1911413 ----1630
NM_015609chr1102914 2439 2413 1982 667 202 172 150 126 33 --21842 73 --
NM_015630chr21872 ------
NM_015651chr921597 1483 32166 1818 682 ----
NM_015670chr17----1335 --
NM_015680chr21509 --1628 --
NM_015686chrX72467 2299 2239 2193 1985 893 788 1736 ----
NM_015695chr632135 336 295 21339 823 1516 11430
NM_015702chr2------167
NM_015879chr1898000 7880 7133 6645 6521 1963 859 817 296 28387 5668 58588 5869 3288 1625 145 18430
NM_015885chr112272 173 ------
NM_015902chr82733 267 --1322 --
NM_015906chr144735 4562 4260 1459 --23684 3435 --
NM_015980chr531321 1078 86 --1288 --
NM_015981chr552658 2592 2394 1986 22 12097 13117 --
NM_015984chr1----1549 --
NM_015995chr1555188 4875 1919 1829 758 12076 11810 --
NM_016022chr1----283 47 --
NM_016026chr141411 41434 1147 214 161 ----
NM_016061chr221511 651 ----173
NM_016072chr1252354 2078 1918 425 396 ----12377
NM_016076chr12201 31 33124 1180 394 12823 --
NM_016100chr201272 --1336 --
NM_016131chr241531 1506 914 159 ----11870
NM_016141chr3----1647 1221
NM_016144chr51634 1278 --170
NM_016147chr1151051 986 969 954 67 --179 --
NM_016162chr121633 1908 1256 --
NM_016166chr151208 ------
NM_016252chr2------1270
NM_016257chr133477 2838 1251 1990 --11207
NM_016258chr1----1769 --
NM_016269chr43743 217 100 11122 --2197 165
NM_016279chr5141 1432 ----
NM_016281chr12--11156 1940 --
NM_016287chr121524 789 11871 ----
NM_016289chr211732 197 1755 --
NM_016297chr252965 2652 2356 2310 313 11406 --12954
NM_016322chr962531 2026 946 474 346 69 1160 22568 2192 --
NM_016340chr53253 99 81 ------
NM_016357chr1221164 876 --2816 55 --
NM_016374chr141207 254 182 65 --1278 --
NM_016396chr152941 883 13052 --174
NM_016433chr12290 69 --11428 --
NM_016472chr14--1304 2506 312 11359
NM_016525chr92211 134 --1810 --
NM_016577chr384536 4078 3970 3916 3737 3318 2876 687 1250 22852 1409 --
NM_016588chr6----1717 --
NM_016592chr2011044 1985 1507 1960
NM_016604chr51266 --1154 --
NM_016605chr532574 2555 2293 22595 2160 11068 --
NM_016607chrX--21122 93 1225 --
NM_016620chr1------11424
NM_016623chr81246 ------
NM_016626chr1831481 1416 426 1601 1685 1441
NM_016630chr154553 509 485 117 ------
NM_016631chr211208 ------
NM_017423chr422123 200 31995 1522 664 --1466
NM_017508chr111619 ------
NM_017519chr611375 ------
NM_017533chr17----165 --
NM_017550chr1921068 1053 --3370 253 49 1233
NM_017551chr1032679 1903 431 --32207 2175 411 --
NM_017553chr152942 236 --1833 --
NM_017559chr17----1219 --
NM_017582chr131431 1283 548 21216 1170 2376 82 --
NM_017602chrX--1839 1175 1182
NM_017610chr1531693 697 55 --11418 --
NM_017622chr17----1612 --
NM_017629chr131789 1690 503 --1156 1736
NM_017633chr643343 3135 898 509 21491 1384 ----
NM_017637chr9139347 8486 8024 7936 6565 6358 6131 6049 5976 5785 3635 1807 1137 45990 993 885 61 17957 --
NM_017645chr931227 1037 103 ----1693
NM_017658chr1443832 441 94 46 11764 ----
NM_017712chr1995690 4820 2425 2052 1838 1699 1597 1134 240 15124 25541 5129 --
NM_017736chr1622222 404 ------
NM_017754chr653552 3445 1189 1038 305 24894 4031 34214 3530 78 14904
NM_017761chr121466 135 --1435 --
NM_017762chr1552130 727 606 544 64 ------
NM_017772chr6368 59 30 11372 --1191
NM_017789chr21117 ----1169
NM_017798chr2011202 ------
NM_017811chr932194 924 27 ------
NM_017824chr101936 1814 12658 --
NM_017842chr12--1620 2477 52 1693
NM_017848chrX43736 3728 1278 770 23872 2991 14012 11150
NM_017893chr1031303 979 941 --164 --
NM_017913chr9------1431
NM_017915chr121986 ----11225
NM_017919chr975810 4489 3914 3760 2276 2244 2060 24133 245 --15058
NM_017925chr941306 651 571 230 --11829 --
NM_017943chr143333 258 129 ------
NM_017944chr1162909 2871 2108 1157 168 129 ------
NM_018026chr111467 1447 --2149 39
NM_018027chr1063009 2822 1221 1198 894 297 2791 696 1160 --
NM_018028chr1921108 259 ------
NM_018083chr19----171 --
NM_018084chr223241 2651 1223 ----
NM_018086chr221469 686 11725 11758 --
NM_018087chr11192 --133 --
NM_018094chrX2269 78 ------
NM_018113chr122424 50 ----141
NM_018115chr46798 744 692 270 123 108 ------
NM_018133chr331881 426 127 22106 879 --12169
NM_018144chr102373 337 ------
NM_018157chr1223143 2528 --11227 --
NM_018178chr12792 467 21563 48 --12026
NM_018181chr1821710 97 ------
NM_018184chr351993 1847 1521 1363 109 11489 1141 --
NM_018200chr1551990 1054 754 733 695 12235 32000 1861 573 --
NM_018202chr13785 170 49 ------
NM_018241chr42371 137 --1277 --
NM_018293chr32909 501 --12168 --
NM_018312chr1151954 1877 1721 1655 1449 --195 --
NM_018330chr102315 209 11648 11068 --
NM_018351chr1253324 1515 1198 452 330 11273 23803 3310 198
NM_018361chr832974 1159 1104 11460 11579 --
NM_018364chr163438 3235 1577 1540 1134 598 1880 13710 --
NM_018387chr92390 368 ------
NM_018403chr343875 3336 2990 180 13290 21281 972 1673
NM_018413chr121220 --1229 --
NM_018416chr1252569 2344 267 156 145 --12411 1731
NM_018440chr8107630 6644 6489 6382 5826 2736 1963 1949 1940 1543 45748 5679 1015 372 58257 6014 2174 2152 978 --
NM_018471chr23436 419 232 ------
NM_018482chr852421 1006 650 304 48 2884 771 ----
NM_018490chr113672 479 458 11495 1103 11311
NM_018566chr113126 13617 15013 --
NM_018569chr4--11299 11473 --
NM_018650chr132023 844 557 1829 1677 1763
NM_018667chr1662385 2320 2027 217 176 153 1369 1409 --
NM_018689chr1532261 813 105 22046 169 1983 12707
NM_018698chrX41882 1576 1502 273 1151 1166 --
NM_018704chr1--21749 405 1503 --
NM_018710chr82453 157 --11117 --
NM_018711chr1231597 1581 1100 --186 --
NM_018712chr1151533 1141 407 200 170 11362 21105 40 --
NM_018713chr131079 971 773 ------
NM_018836chr11250 ------
NM_018841chr143917 3905 2546 2477 ----198
NM_018847chr911638 ------
NM_018937chr5162 ------
NM_018945chr683545 3170 3015 2629 1034 998 874 385 --1204 13262
NM_018970chr742707 2371 2298 616 1194 1232 --
NM_018976chr1232807 2277 995 --22251 1852 --
NM_019012chr121617 1584 ----
NM_019035chr432009 1340 299 --1344 190
NM_019045chrX------1203
NM_019057chr51265 151 1280 --
NM_019072chr563599 3120 2949 1566 1399 1021 --14188 --
NM_019074chr152843 70 --1264 --
NM_019106chr22113451 3165 3074 2854 2556 2436 2351 2230 897 774 676 43149 2101 944 706 53154 2205 2169 716 227 --
NM_019106chr22113451 3165 3074 2854 2556 2436 2351 2230 897 774 676 43149 2101 944 706 53154 2205 2169 716 227 --
NM_019116chr1683537 2605 2417 1348 1124 818 665 430 12579 23712 52 --
NM_019555chr311573 31316 682 166 ----
NM_019556chrX21290 60 ----11169
NM_019558chr2----1124 --
NM_019613chr171105 11203 --11209
NM_019885chr251811 755 521 438 329 --11036 --
NM_020062chr20----1988 --
NM_020116chr441528 1244 450 47 --11817 --
NM_020123chr1021073 186 1471 ----
NM_020144chr722100 470 ------
NM_020150chr106711 659 574 309 197 180 --1149 11650
NM_020177chr593137 3119 3015 2731 2636 2228 609 68 25 11127 ----
NM_020180chr1821262 370 11123 1173 --
NM_020193chr1111278 --11081 --
NM_020297chr1212765 13479 --1870
NM_020341chr20------11578
NM_020342chr252350 2297 1767 947 80 11822 ----
NM_020381chr651875 1687 817 605 129 1162 11275 --
NM_020440chr183147 2977 2332 2241 1348 1211 868 605 ------
NM_020443chr1147037 6441 6356 5808 4467 4436 2740 2587 2505 2115 1907 1287 653 351 21159 702 45489 4590 2304 1490 1475
NM_020447chr1532453 2280 719 ------
NM_020474chr1821547 796 --12005 --
NM_020645chr111648 ----1252
NM_020647chr831485 465 413 --11865 --
NM_020689chr20----11330 --
NM_020698chr1222792 459 13159 1229 --
NM_020699chr184025 3473 3301 1841 1466 1254 505 21 34622 1581 532 33858 1323 200 --
NM_020708chr2062135 1532 867 621 407 277 12324 2235 130 --
NM_020718chr1696279 5877 5545 5508 1993 1976 1859 1147 861 1666 14138 15135
NM_020734chr1222682 2231 --13305 --
NM_020747chr5--1297 1858 --
NM_020748chr1711837 1324 ----
NM_020750chr611359 1611 --2109 88
NM_020752chr1021949 812 --12754 22393 452
NM_020753chr174715 661 214 22 --143 --
NM_020755chr63404 366 137 11439 ----
NM_020760chr221863 50 1246 21649 1244 --
NM_020768chr562905 2708 2312 970 795 140 12144 ----
NM_020771chr62335 256 1419 21444 1400 --
NM_020772chr1777713 6562 6125 5430 2776 2248 1298 22739 1752 --11284
NM_020778chr1543530 3205 3144 726 14282 1303 1217
NM_020781chr742754 584 504 491 2733 721 ----
NM_020791chr1741263 340 190 54 11088 1512 --
NM_020794chr111014 --1362 --
NM_020796chr542780 2068 903 79 --22630 967 --
NM_020801chr541815 893 819 185 1736 ----
NM_020805chr182510 438 41719 1596 454 102 ----
NM_020814chr211309 --1498 11351
NM_020830chr232347 1153 832 ----1796
NM_020845chr1221753 901 12212 12355 --
NM_020854chr181159 --1147 --
NM_020858chr153946 642 171 1352 ----
NM_020871chrX62006 1991 1813 1019 758 166 1970 ----
NM_020872chr311277 --1273 --
NM_020888chr141609 1564 1489 1278 1739 126 --
NM_020895chr19----168 --
NM_020897chr11517 1142 199 4497 402 393 278
NM_020904chr19----1163 --
NM_020921chr1433339 2877 922 199 ----
NM_020956chr19154518 4206 4131 3165 2931 1851 1695 1458 1425 1098 976 777 751 411 255 1931 34035 1116 553 --
NM_020975chr1021600 1328 --11366 --
NM_021003chr142602 329 1776 ----
NM_021038chr383388 3346 2991 2820 2078 1295 194 187 2989 479 --11165
NM_021044chr12----1354 --
NM_021076chr221115 ------
NM_021090chr2274742 3531 3310 1101 308 300 293 23886 3431 1515 14501
NM_021103chr2--1173 ----
NM_021109chrX2125 28 --147 --
NM_021132chr1011152 11214 --1205
NM_021145chr731082 319 45 --1364 --
NM_021155chr1953019 1987 1034 1013 643 --11971 --
NM_021183chrX22364 1849 ------
NM_021215chr2041652 991 552 287 --31942 1635 753 --
NM_021238chr1221499 151 ----11532
NM_021620chr61729 ------
NM_021643chr231472 373 83 1746 ----
NM_021785chrX------1295
NM_021809chr2052220 1649 573 369 161 22162 339 --2615 97
NM_021813chr675723 4470 4165 4070 3742 3682 71 34733 3932 3791 1242 --
NM_021814chr631578 1214 324 --1262 --
NM_021943chr611657 --21759 292 --
NM_021947chr1731248 1018 349 1848 ----
NM_021948chr12300 251 --238 23 --
NM_021960chr112108 --1199 --
NM_021961chr1196945 6568 6209 4816 4551 2842 2023 1911 1004 25040 4636 11502 --
NM_021964chr345137 5079 391 187 36189 4142 1908 24445 1199 16281
NM_021977chr623796 2815 23180 2574 --12528
NM_022048chr1566393 2318 1698 646 610 256 31267 1184 320 34360 4325 240 14343
NM_022068chr183601 531 180 ------
NM_022130chr521383 250 1214 ----
NM_022133chr811207 --1179 --
NM_022166chr16116291 5637 5389 4959 4353 4086 2375 1670 1465 229 222 35241 827 787 36362 4154 536 14104
NM_022444chr711495 --11923 --
NM_022459chr1334341 4175 1389 34295 1741 1303 26153 892 14536
NM_022557chr17155 --130 --
NM_022574chr742045 1384 654 424 1707 21421 814 --
NM_022640chr17155 --130 --
NM_022644chr171322 --125 --
NM_022648chr241731 1343 695 403 13047 11426 24528 1387
NM_022658chr1211107 188 ----
NM_022719chr2253791 2900 1432 1378 1100 1238 33378 2824 719 --
NM_022735chr121844 345 ------
NM_022737chr191202 --21243 1135 --
NM_022744chr163895 452 417 1143 3819 423 214 1337
NM_022753chr162586 2083 1989 917 628 279 --22226 159 --
NM_022763chr363005 2776 2563 2332 635 511 23109 2617 ----
NM_022780chr211725 1742 11164 --
NM_022781chr91133 ------
NM_022817chr232269 1769 438 21905 1463 ----
NM_022893chr212604 22586 2382 13124 12762
NM_022894chr231119 553 274 31602 235 152 11641 --
NM_022897chr5----11042 11020
NM_022898chr1433936 1908 1879 24066 1581 --14236
NM_023009chr13633 120 88 1694 2478 66 --
NM_024029chr191416 ------
NM_024034chr20131 --21024 81 --
NM_024052chr173596 553 496 --32605 2134 994 --
NM_024090chr421632 636 --1225 --
NM_024329chr12482 275 --31281 1007 297 --
NM_024408chr133283 2860 1049 --22472 1169 --
NM_024496chr143811 523 338 ------
NM_024513chr353233 2340 1290 769 122 --52601 1117 725 578 45 --
NM_024524chr343089 2548 1034 639 --1678 --
NM_024539chrX21187 258 149 ----
NM_024541chr1051929 1499 629 85 32 21760 1647 ----
NM_024551chr121589 --11821 --
NM_024565chr51657 ------
NM_024567chr82691 551 ------
NM_024590chr421369 172 --3671 308 279 --
NM_024595chr111217 ----1917
NM_024612chr171998 ------
NM_024646chr182974 2606 2472 807 731 712 412 143 --2390 219 11063
NM_024665chr3159 22978 78 --11180
NM_024689chrX21744 253 --1621 --
NM_024692chr221695 1566 --11444 1612
NM_024700chr12311 119 1841 ----
NM_024721chr81589 2863 671 ----
NM_024742chr1671532 1526 1413 1328 663 463 71 1118 1521 162
NM_024745chr162933 50 --165 --
NM_024900chr432177 1974 834 2529 163 11762 --
NM_024915chr831140 255 112 32277 1917 699 1160 1310
NM_024947chr399517 8338 7374 5952 5811 3768 2389 2243 835 1870 11652 18085
NM_025040chr1942472 2078 805 119 --1977 --
NM_025054chr854214 3991 2877 997 177 22939 2663 ----
NM_025126chr12--1568 1291 --
NM_025134chr1632373 464 138 --1505 --
NM_025146chr332730 2028 650 1999 21940 474 --
NM_025191chr163172 2561 544 468 241 194 12382 ----
NM_030576chr1732565 2450 2303 22556 1061 11665 22232 368
NM_030579chr1663735 2972 2349 305 226 207 1651 23071 2793 --
NM_030627chr532546 1221 179 1210 11639 --
NM_030647chr745959 2276 1026 154 14149 1116 --
NM_030648chr4105019 4572 4545 4383 3638 2007 1930 1842 1593 89 ------
NM_030784chr6----1401 --
NM_030786chr1--11433 ----
NM_030791chr142545 157 ----1562
NM_030805chr231213 1008 333 133 11175 11124
NM_030806chr1128956 8541 7836 7109 6868 6588 6053 5943 3275 2938 2787 1450 47612 6599 2817 1938 57048 6518 6396 2432 1507 18371
NM_030820chr61309 --1282 --
NM_030927chr1011082 21623 296 21021 645 --
NM_030939chr61240 ----1475
NM_030957chr19----1399 --
NM_031216chr18------11728
NM_031417chr1931906 826 172 --32213 78 72 --
NM_031445chr263033 2827 2684 799 634 103 ----11362
NM_031461chr821917 1712 1889 --1842
NM_031483chr2042723 2681 2471 702 11437 ----
NM_031892chrX----1760 --
NM_031922chr6----189 --
NM_032042chr552181 684 376 324 299 1176 162 22108 236
NM_032047chr321835 1626 --1183 132
NM_032102chr1122257 98 --1410 --
NM_032128chr4------1384
NM_032160chr1843684 1493 1009 970 11051 13313 2815 367
NM_032172chr71995 --1228 --
NM_032182chr1071477 1383 1210 160 90 45 32 ----11459
NM_032195chr21----1120 --
NM_032217chr43936 313 174 ------
NM_032268chr1652773 2154 2092 1018 384 1214 --2601 435
NM_032283chr121762 353 21350 96 ----
NM_032287chr2282699 1701 1454 1242 1112 1022 887 227 11667 21616 665 13996
NM_032298chr19----1461 --
NM_032327chr101163 ----1424
NM_032342chr9196 ------
NM_032364chr122402 181 --1845 --
NM_032373chr1024132 1467 11298 1490 --
NM_032389chr111460 ----1970
NM_032436chr13--1778 1123 --
NM_032439chr102311 246 ----1115
NM_032440chr1051839 943 429 71 49 --11863 --
NM_032458chrX82878 2737 2727 2385 1311 465 436 399 ------
NM_032505chr322262 1865 --1672 --
NM_032532chr6----1102 1537
NM_032536chr9----3719 633 164 --
NM_032538chr652759 2283 1854 973 829 1582 11895 12819
NM_032547chr41549 --1287 --
NM_032552chr951718 1603 515 198 65 11569 ----
NM_032560chr141948 --1236 --
NM_032575chr1641965 1539 1463 99 --151 --
NM_032578chr1031508 1488 1177 --31333 268 110 --
NM_032595chr1731075 976 265 1317 ----
NM_032603chr21277 2137 59 --1688
NM_032622chr421250 402 --11511 --
NM_032632chr141239 ------
NM_032682chr353150 2257 1457 1279 453 --23482 471 --
NM_032727chr10----11389 1414
NM_032737chr191477 1117 31927 575 198 1185
NM_032804chr1012597 1216 --1222
NM_032833chr131820 1668 1014 1652 --1986
NM_032859chr1332808 915 753 --1129 --
NM_032875chr171622 --1662 --
NM_032982chr722086 575 42590 2506 970 233 1648 12574
NM_032983chr782900 2291 2078 763 580 531 371 327 33404 3320 1047 --13388
NM_033036chr1131251 285 65 ----11514
NM_033083chr362757 1165 1098 856 682 78 12554 ----
NM_033089chr201371 --11402 11146
NM_033131chr131641 1363 1210 --11789 --
NM_033132chr132909 251 --1326 1561
NM_033161chr911559 179 ----
NM_033224chr766667 5316 2942 1729 979 438 15898 27829 5917 17223
NM_033225chr862877 2690 2417 2049 986 105 1272 ----
NM_033255chr132115 93 ------
NM_033260chr61523 --1711 --
NM_033272chr21314 ------
NM_033315chr172178 60 1541 ----
NM_033389chr1774821 4355 4063 1116 1025 766 755 21870 303 11202 --
NM_033420chr1931222 275 28 --1109 1312
NM_033502chr6173 ------
NM_033512chr82812 609 1890 1269 2934 444
NM_033626chrX41660 1458 736 124 ------
NM_052840chr152469 243 11058 ----
NM_052851chr1322189 1949 12409 2501 278 --
NM_052854chr112606 572 2599 422 ----
NM_052885chr1234517 4002 1308 34056 3827 1767 174 --
NM_052886chr8----1764 --
NM_052897chr122781 166 --3862 673 363 --
NM_052900chr831471 1122 425 ----172
NM_052905chr221758 49 11574 ----
NM_052907chr1241035 465 395 247 23247 2713 13187 13523
NM_052978chr1421881 496 11328 137 --
NM_053025chr321300 512 21538 1476 ----
NM_053056chr1162766 2739 2184 1965 1152 205 12082 --11228
NM_057749chr821398 103 ----1130
NM_058172chr411706 --1500 --
NM_058197chr91653 --1181 1814
NM_058243chr191658 1873 1826 --
NM_080422chr181115 1290 ----
NM_080546chr911787 --11450 --
NM_080617chr20--1407 ----
NM_080738chr152023 1928 1533 1341 574 ------
NM_080867chr1443847 3636 1458 334 15012 ----
NM_130387chr32890 36 ------
NM_133264chr1783375 3231 3089 2871 2715 583 376 330 --32990 2538 764 --
NM_133328chr191818 189 ----
NM_133334chr475295 4797 4663 4159 3945 2364 2032 34935 4019 1038 --1452
NM_133478chr252429 2164 1726 969 787 11829 ----
NM_133496chr164054 3785 3587 2975 749 413 24326 1047 1433 --
NM_138395chr2----1195 --
NM_138459chr653285 3022 2560 2272 1331 --11289 --
NM_138473chr12124871 4742 4581 4521 4374 3922 3908 3698 1667 1150 771 527 11038 ----
NM_138771chr731452 1277 36 11231 --11490
NM_138782chr532239 1971 1929 ------
NM_139279chr2197 32906 2530 1382 11213 12328
NM_139280chr171429 --11200 1103
NM_144571chr456930 6749 6718 5726 5618 32720 1116 771 12653 --
NM_144578chr1464677 3817 2222 2199 1142 144 45281 4110 1597 530 14512 --
NM_144631chr21248 --1212 --
NM_144720chr41176 ------
NM_144726chr51287 ------
NM_144967chrX21022 716 1953 --1161
NM_144982chr121756 2523 42 ----
NM_145008chr11186 1819 1748 --
NM_145117chr1132441 836 179 12737 ----
NM_145171chr14------193
NM_145175chr22213 189 --21411 1259 --
NM_145206chr1063049 2791 2695 2271 2040 657 13104 --23262 829
NM_145245chr1941122 1020 396 282 --21218 1196 --
NM_145285chr101209 ----1762
NM_145727chr651072 1041 425 356 83 ----1913
NM_145735chr1332221 1989 157 22604 690 ----
NM_145800chrX1999 196 1950 --
NM_145808chr72995 394 --2513 56 --
NM_145891chr161525 11524 --1567
NM_147161chr121139 302 1247 1458 --
NM_147190chr121543 2603 160 1265 --
NM_147202chr952709 2579 2295 560 139 22614 1963 1597 --
NM_152253chr2283995 3977 3920 3363 3284 2864 2797 71 12986 13153 1707
NM_152271chr851095 1053 831 431 69 ------
NM_152277chr531590 1407 326 21544 1332 196 --
NM_152280chr132894 843 299 1652 13440 --
NM_152345chr171471 --1401 --
NM_152346chr1721070 215 1358 1432 --
NM_152390chr21702 ------
NM_152409chr543028 1282 1138 672 22891 154 12934 --
NM_152414chr811435 ------
NM_152415chr8157 125 ----
NM_152424chrX63624 3180 2938 2871 762 226 23293 632 44690 3674 3113 534 1871
NM_152437chr121823 --2694 306 --
NM_152447chr14------1299
NM_152450chr152787 82 1612 --11868
NM_152470chr1823399 205 --11079 --
NM_152519chr21407 ----1728
NM_152522chr2----175 --
NM_152556chr712259 ----1680
NM_152600chr191145 1344 ----
NM_152608chr132062 677 553 --1513 --
NM_152622chr51981 1745 1321 --
NM_152641chr1231012 654 225 --12066 --
NM_152660chr11395 --1334 1990
NM_152663chr1----1255 --
NM_152678chr33431 320 306 1111 12647 --
NM_152695chrX22205 2025 ------
NM_152716chr1111054 140 3396 177 51 --
NM_152745chr71470 --1110 --
NM_152748chr71159 ------
NM_152753chr632093 2081 1285 --1295 1788
NM_152756chr584079 3504 1638 1128 855 490 156 120 13117 ----
NM_152758chr8----1384 --
NM_152787chrX63158 2515 1144 771 459 317 --23487 2829 --
NM_152857chr62888 357 --1135 --
NM_152890chr111050 --1381 --
NM_152896chr92721 177 ------
NM_152996chr13825 323 50 22081 471 1578 --
NM_153020chr641526 1288 1167 341 ------
NM_153035chr153235 1101 720 295 210 --1397 --
NM_153184chr341629 743 231 212 1123 ----
NM_153207chr1221083 418 23194 1223 ----
NM_153334chr22----1632 --
NM_153343chr432158 1648 510 --11908 --
NM_153607chr512394 2945 209 ----
NM_153635chr3----152 --
NM_153689chr21724 12121 11814 --
NM_153695chr9237 24 ------
NM_153756chr13561 252 151 11568 11492 --
NM_170662chr31678 ------
NM_170665chr1294512 4401 3528 3312 2825 1691 1543 861 69 21670 1373 23219 791 --
NM_170768chr1121284 71 --1326 --
NM_172071chr145378 2707 1396 1143 36760 5814 4949 26076 1565 --
NM_172196chr21189 ----1149
NM_172375chr142795 757 ------
NM_173075chr431691 446 328 --1367 11493
NM_173156chr152088 1655 1607 780 244 11933 1561 --
NM_173468chr4125735 5573 5026 4841 4649 2262 2135 2075 1696 756 545 309 45106 4211 836 791 ----
NM_173494chrX2691 575 --1870 --
NM_173495chrX1759 1400 --1118
NM_173511chr263943 3563 3047 1475 993 745 12743 --11334
NM_173536chr475085 4987 3692 3444 1543 1057 908 13593 11735 --
NM_173552chr342452 1798 1519 669 11903 12338 12102
NM_173570chr342096 1436 602 419 ------
NM_173576chr101693 12309 1856 --
NM_173582chr1156242 5979 4134 1888 27 34319 2423 2040 11690 --
NM_173595chr1265284 4535 3563 3514 1524 944 31547 381 317 44320 3332 1074 416 14069
NM_173683chr831646 1549 464 1502 ----
NM_173694chrX21976 23 ------
NM_173698chrX3699 515 92 11539 ----
NM_173808chr144422 3088 950 475 ------
NM_173822chr23551 316 100 11381 --11915
NM_173828chr5----190 --
NM_173834chrX----1408 1157
NM_174916chr1562249 1981 1921 1895 1807 622 11837 ----
NM_174921chr411163 1186 ----
NM_175061chr722210 1423 --11640 --
NM_175575chr1721014 826 ----11190
NM_175736chr1287562 7139 6573 5765 5250 2414 981 196 17458 46349 6030 578 539 --
NM_175767chr51628 --11198 --
NM_175854chr133982 552 147 1194 11090 --
NM_175866chr1----1140 --
NM_176806chr52333 72 ------
NM_176812chr20----2779 306 --
NM_176814chr71143 --1192 --
NM_176823chr163845 3362 1513 1257 667 385 ------
NM_177538chr2208891 8583 8371 7992 7703 7268 6964 6933 6751 6388 6171 5863 5590 3440 2930 2883 2284 1757 1446 188 13250 22480 2369 25825 3520
NM_177968chr242138 1603 742 658 11451 1194 --
NM_178568chr172606 317 ----131
NM_178580chr202490 39 ------
NM_178812chr821220 1148 1555 ----
NM_178815chr1042466 420 271 24 11092 ----
NM_178818chr1651910 1639 755 549 301 --12345 --
NM_178819chr8----181 --
NM_178831chr742930 2447 1135 821 12398 42947 1875 127 76 --
NM_178835chr42855 291 ----179
NM_181077chr1532298 521 496 22077 848 11595 --
NM_181356chr61291 ------
NM_181358chr133682 3582 3183 --11519 --
NM_181670chr122386 104 1535 --1409
NM_181672chrX21385 193 1828 ----
NM_181836chr52459 396 ----131
NM_181843chr11----176 --
NM_182485chr463080 3013 2722 2591 1433 667 33698 3055 711 --11193
NM_182509chr1451586 1086 1056 517 63 11438 1252 --
NM_182526chr1453017 2657 845 785 588 --13072 --
NM_182701chr6----1805 --
NM_182734chr2043048 2335 698 69 --22603 325 --
NM_182765chr1031679 894 469 --22017 1695 2377 368
NM_182830chr141434 1806 --1871
NM_182920chr341104 1022 578 296 ------
NM_182970chr2064109 3617 1698 1557 1161 314 12881 42886 1448 1051 354 --
NM_183387chr14------1205
NM_194071chr754820 1899 1806 1378 313 22043 239 11961 --
NM_194247chr2124081 3636 3549 3361 3354 3315 3084 1714 1339 899 328 158 2869 195 ----
NM_194272chr1551053 951 699 149 107 1992 179 1421
NM_197941chr542903 2507 2282 704 22945 871 1629 --
NM_198081chr632248 1030 486 33033 2595 613 22531 501 --
NM_198270chrX42735 1216 526 325 --12864 2353 114
NM_198281chr42701 343 --1950 --
NM_198465chrX22787 1987 22944 2612 ----
NM_198511chrX51831 1357 1327 611 199 1627 --1289
NM_198990chr733150 2790 739 13340 12562 --
NM_198991chr181548 ------
NM_198993chr1711680 21629 1156 11616 11106
NM_199141chr19----2778 642 1210
NM_199320chr411819 ----2839 235
NM_199334chr17----1153 --
NM_199453chr5163 ------
NM_201263chr121538 412 --1266 --
NM_201634chr571897 1488 562 491 172 151 105 --2221 66 1696
NM_203394chr1242592 1929 761 425 ----12555
NM_203406chr521010 301 11852 --1763
NM_203434chr92816 320 --1973 --
NM_203463chr254560 3934 824 499 243 ----24944 145
NM_205833chrX----1711 1281
NM_205848chr112334 138 --12748
NM_206853chr642570 1512 1314 268 1225 --14071
NM_207311chr123972 952 99 --21288 352 --
NM_207325chr1912011 --11554 11414
NM_207362chr21648 163 1661 --
NM_207381chr1531273 1106 918 ------
NM_207444chr15--11292 11020 1419
NM_212467chr1562570 1035 237 81 38 22 --2589 101 --
NM_213589chr284825 4785 4180 4090 1799 1093 730 568 11990 --143
NM_213604chr193708 367 297 1256 1846 2342 183