TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-449c-5p
miRNA Sequence: UAGGCAGUGUAUUGCUAGCGGCUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52162 108 ------
NM_000016chr11614 ----1129
NM_000020chr12112345 1974 955 817 584 547 401 387 190 127 28 ------
NM_000024chr51135 ------
NM_000037chr842011 1906 1820 236 ------
NM_000038chr531499 515 49 --11307 --
NM_000044chrX160 ------
NM_000053chr13101596 1426 673 573 429 404 329 308 200 37 ------
NM_000055chr31320 ------
NM_000074chrX------191
NM_000075chr12275 38 ------
NM_000081chr131183 1161 417 21329 1235 11868 --
NM_000082chr51700 ------
NM_000084chrX186757 6582 6330 5774 5645 5393 5375 5360 4811 4215 2778 2721 2653 2201 1708 1659 1320 619 15282 24572 4433 --
NM_000088chr1741136 558 416 353 ------
NM_000090chr21860 --1603 --
NM_000092chr284373 3426 3253 3166 2996 2854 1702 577 14022 1877 --
NM_000094chr3168 ------
NM_000104chr24915 598 132 95 --12506 --
NM_000109chrX3827 640 625 --12655 --
NM_000114chr2021278 807 1211 ----
NM_000115chr1312330 12491 11049 --
NM_000118chr92848 151 1696 ----
NM_000125chr6103854 3745 3455 2707 2701 1177 687 372 178 82 --13776 13028
NM_000134chr451201 575 532 426 281 ------
NM_000135chr164983 754 350 146 --2972 111 --
NM_000138chr1512603 ------
NM_000141chr1031056 303 220 ------
NM_000142chr441471 1377 370 195 ------
NM_000158chr3162 ------
NM_000161chr146756 331 261 229 59 42 11572 ----
NM_000166chrX5604 578 239 229 90 ------
NM_000167chrX41389 650 271 69 11276 11460 --
NM_000168chr732987 2702 763 22742 1242 22383 198 --
NM_000170chr91211 ------
NM_000176chr543950 932 794 24 --22405 515 --
NM_000188chr101481 --127 --
NM_000189chr221910 829 ------
NM_000192chr122392 346 ------
NM_000194chrX--193 ----
NM_000202chrX53827 3311 2953 2431 1218 12680 ----
NM_000214chr2021631 61 --21788 1309 --
NM_000216chrX43865 3213 921 96 --13746 --
NM_000217chr1244272 1851 1269 137 ----13284
NM_000245chr721870 1659 --21964 58 12173
NM_000248chr332659 2350 2341 --42919 2375 489 36 --
NM_000252chrX3509 447 94 1390 ----
NM_000259chr1594944 4901 4805 4232 4156 4125 2508 1197 1153 13926 31842 1314 649 --
NM_000264chr922556 856 1360 2691 73 --
NM_000267chr1763376 3285 2745 371 328 184 1170 ----
NM_000276chrX52080 1994 1954 780 196 1860 21850 539 --
NM_000289chr121254 ------
NM_000291chrX1267 ------
NM_000292chrX3693 575 467 1670 ----
NM_000296chr1651011 917 635 330 137 ------
NM_000301chr61160 ------
NM_000304chr17----2986 814 --
NM_000314chr1023006 1040 --1645 --
NM_000319chr1261096 1083 455 326 279 132 ------
NM_000321chr133476 347 334 ------
NM_000332chr6136525 6484 6284 6208 6187 4616 2517 934 736 712 448 438 285 22188 1655 --12375
NM_000333chr331085 1059 431 --1263 --
NM_000334chr1792130 2092 1963 1954 1852 1769 640 501 237 11860 ----
NM_000335chr381956 1812 1673 1519 1463 838 500 403 ------
NM_000337chr5116579 6505 5737 5447 5025 4960 4240 1253 676 265 66 --12255 15558
NM_000345chr41761 ----1394
NM_000346chr1741654 1502 733 364 ------
NM_000353chr163833 245 140 --1450 --
NM_000362chr22123144 3024 2995 2904 2808 1368 1259 828 771 749 565 534 23494 3089 11288 --
NM_000367chr672134 1977 1929 1667 1514 481 455 ------
NM_000368chr984169 4095 4052 3758 1466 1239 1055 372 1919 34643 3052 525 --
NM_000378chr111259 1192 156 --
NM_000380chr92482 449 ------
NM_000382chr1761887 368 360 348 216 142 21776 1701 ----
NM_000391chr1171661 1492 1259 544 372 205 107 ------
NM_000393chr2----21761 605 --
NM_000397chrX62413 2283 2262 821 393 41 21883 87 1891 --
NM_000399chr103911 291 141 1968 ----
NM_000408chr263387 2698 2597 2141 761 106 1415 23088 2438 --
NM_000424chr12----258 23 --
NM_000428chr1472473 2374 2228 2216 1708 812 126 --2862 177 --
NM_000430chr17113468 3456 3046 2853 2638 2559 2535 2492 2479 2299 735 12543 ----
NM_000434chr6245 31 ------
NM_000435chr195847 708 133 70 53 ------
NM_000439chr55760 645 421 226 62 ------
NM_000445chr83874 363 303 ------
NM_000447chr11470 --1428 --
NM_000448chr1122694 86 22305 1997 ----
NM_000449chr141073 1055 510 164 149 ----
NM_000450chr111421 1102 ----
NM_000452chr1321542 580 --22070 1399 --
NM_000459chr91585 1931 ----
NM_000461chr353264 1309 1121 579 154 11463 11476 164
NM_000462chr152563 424 --1355 --
NM_000480chr1141393 417 280 147 ------
NM_000484chr211428 1438 ----
NM_000489chrX52404 2242 608 526 314 22984 197 12424 --
NM_000495chrX2968 97 ------
NM_000503chr831353 611 145 ------
NM_000522chr741318 1225 406 208 ------
NM_000523chr21170 1228 --1947
NM_000525chr1171497 1321 1268 1240 1136 1028 373 11017 11427 --
NM_000533chrX21242 87 1545 ----
NM_000555chrX97336 5897 5710 5622 5024 4820 1775 1712 1111 45669 5533 797 319 36475 2935 1422 --
NM_000572chr12985 887 ------
NM_000581chr3247 25 ------
NM_000599chr274118 3592 3255 3241 3155 1149 562 14182 23829 3098 --
NM_000601chr71332 1324 142 --
NM_000602chr75965 429 298 151 120 --1447 --
NM_000609chr10102537 2384 2330 2263 2173 1070 652 528 256 110 --21129 683 --
NM_000615chr1162831 2258 1036 920 783 149 ------
NM_000618chr12116397 6278 5854 5747 5403 5326 5202 5153 5017 2567 293 16100 ----
NM_000618chr12116397 6278 5854 5747 5403 5326 5202 5153 5017 2567 293 16100 ----
NM_000621chr1351424 1289 1155 1062 571 ------
NM_000633chr18105214 4588 1804 1116 988 958 849 314 290 208 25237 1465 ----
NM_000663chr161239 167 ----
NM_000668chr431254 433 419 ------
NM_000676chr171215 --1111 --
NM_000679chr51151 ------
NM_000681chr1041221 455 185 99 --1937 --
NM_000682chr261835 1446 721 593 80 56 --11385 --
NM_000685chr33827 572 309 ------
NM_000685chr33827 572 309 ------
NM_000719chr1296027 5938 4453 4400 2407 2223 1347 404 362 --22577 1341 --
NM_000721chr152478 2284 473 222 210 ------
NM_000723chr17131636 1587 1414 1400 1382 1299 1277 1195 1164 1064 482 206 103 11328 ----
NM_000724chr1041654 494 268 110 11408 11483 --
NM_000725chr1281016 1004 955 937 885 785 282 144 ------
NM_000726chr221326 1074 ------
NM_000735chr6232 21 ------
NM_000759chr176851 812 765 682 230 143 ------
NM_000767chr1961418 1386 1116 1066 331 93 --11432 --
NM_000780chr8----1512 --
NM_000795chr114954 730 160 31 --2948 863 --
NM_000800chr511067 11394 1263 --
NM_000806chr551736 1577 155 95 81 11883 189 --
NM_000807chr4183 --1214 --
NM_000809chr479011 6217 5740 2819 1841 1791 1087 15769 46467 3509 1516 753 11477
NM_000810chr15----2494 147 --
NM_000812chr42410 82 --1380 --
NM_000813chr555037 4815 4722 4327 1895 25195 1404 ----
NM_000814chr1553783 3023 1629 797 60 ----13231
NM_000817chr231000 447 350 --1910 --
NM_000826chr4--12314 ----
NM_000827chr572144 1988 1846 983 958 753 624 1271 --1647
NM_000829chr1122137 2039 --12212 --
NM_000831chr1235898 5834 5780 5520 5386 5263 5109 5028 4876 4796 4371 4074 1761 1646 1257 1022 568 459 365 224 180 116 108 14027 ----
NM_000832chr92146 104 --1670 --
NM_000833chr1611088 ------
NM_000834chr12--1509 1470 --
NM_000838chr652145 1753 154 145 136 --12752 --
NM_000841chr67825 367 351 327 250 159 90 ------
NM_000844chr33334 216 161 11009 ----
NM_000860chr451576 1172 1062 577 276 --11298 --
NM_000861chr362622 2557 2481 2233 1974 634 11771 ----
NM_000868chrX41796 1735 507 103 1967 12499 --
NM_000870chr581272 1091 514 460 436 313 252 68 ------
NM_000872chr1011439 ------
NM_000875chr15157035 6613 6123 5711 4913 2822 1958 1732 951 855 718 366 345 133 124 1582 26283 2379 16987
NM_000876chr63577 325 97 ------
NM_000880chr8--165 ----
NM_000883chr76576 556 266 211 194 156 ------
NM_000883chr76576 556 266 211 194 156 ------
NM_000891chr1793611 2540 2295 1415 1291 1212 784 523 372 --11204 --
NM_000899chr1263927 3769 1535 1467 661 100 ------
NM_000901chr452533 2388 1975 535 28 ------
NM_000908chr53578 177 31 ------
NM_000922chr111293 11055 --175
NM_000937chr173378 277 70 ------
NM_000944chr4199 1927 ----
NM_000945chr271781 1768 1528 1480 772 720 690 ------
NM_000949chr51144 --1852 1263
NM_000950chrX73341 2755 2733 2410 1448 1066 1009 --32956 886 326 --
NM_000960chr193739 495 35 ------
NM_000964chr1751042 969 885 418 55 --1193 --
NM_000965chr311055 186 1474 --
NM_000966chr122964 279 1805 ----
NM_000983chr13564 430 320 21094 180 ----
NM_000984chr172430 68 ------
NM_001001132chr21170 --1132 --
NM_001001323chr1232022 1935 829 1891 12884 --
NM_001001331chr352213 1660 949 739 47 ------
NM_001001342chr1021080 1055 11127 ----
NM_001001344chrX42491 2395 2250 1686 12268 ----
NM_001001395chr1232474 588 170 12688 22298 1796 --
NM_001001419chr551571 1405 795 540 288 15061 ----
NM_001001420chr551571 1405 795 540 288 15061 ----
NM_001001436chr161730 ------
NM_001001438chr213385 368 124 ------
NM_001001481chr832611 622 352 ----23250 925
NM_001001484chr1041727 830 573 143 ------
NM_001001485chr3130 --1332 --
NM_001001522chr112316 72 ------
NM_001001523chr15994 531 525 236 23 ------
NM_001001557chr861724 1554 873 763 407 224 22070 618 --12096
NM_001001560chr222527 47 ------
NM_001001567chr21177 --1189 --
NM_001001568chr21177 --1189 --
NM_001001571chr21177 --1189 --
NM_001001572chr21177 --1189 --
NM_001001573chr21177 --1189 --
NM_001001574chr21177 --1189 --
NM_001001575chr21177 --1189 --
NM_001001576chr21177 --1189 --
NM_001001577chr21177 --1189 --
NM_001001579chr21177 --1189 --
NM_001001580chr21177 --1189 --
NM_001001581chr21177 --1189 --
NM_001001582chr21177 --1189 --
NM_001001584chr21177 --1189 --
NM_001001585chr21177 --1189 --
NM_001001664chr221139 634 --21308 536 --
NM_001001706chr64786 412 228 37 --11163 --
NM_001001710chr91115 ------
NM_001001787chr13455 78 63 ------
NM_001001852chr224765 295 191 39 ------
NM_001001890chr21114219 4130 4033 3206 3108 3038 3019 2604 1671 1560 1377 ----12706
NM_001001928chr22178339 8009 7591 6197 5732 5652 5339 5085 2890 2050 1673 1148 1038 864 699 549 359 15787 ----
NM_001001936chr1061062 991 984 470 373 59 ------
NM_001001974chr104833 444 234 24 --2701 114 --
NM_001001994chrX----1348 --
NM_001001995chrX1761 11274 1121 --
NM_001001996chrX----1348 --
NM_001002032chr17123 --1543 --
NM_001002033chr172123 32 --2643 533 --
NM_001002233chr8173 1676 ----
NM_001002243chr2----1345 --
NM_001002252chr121266 --156 --
NM_001002257chr243322 2540 389 109 --21424 873 --
NM_001002295chr1041073 965 774 432 --21112 791 --
NM_001002762chr10112598 2342 2335 2211 2177 2017 1040 1030 1009 972 48 --1464 --
NM_001002814chr863850 3175 2949 2533 1326 73 1676 13692 --
NM_001002838chrX51470 1300 697 658 378 11734 ----
NM_001002840chr72558 191 --1706 --
NM_001002860chr1464040 3885 3616 1226 1108 354 24156 203 24637 1220 --
NM_001002909chr17112115 2106 2069 1904 1837 1647 1384 834 429 326 295 ------
NM_001002914chr17180 2814 245 11290 --
NM_001003398chr122179 26 --194 --
NM_001003652chr18137483 7356 7131 6439 2326 2195 1828 1615 1579 816 688 552 396 38546 5600 3490 ----
NM_001003665chr1123162 3080 2704 2434 1148 719 607 439 372 320 188 163 ------
NM_001003674chr18117038 6922 4962 4647 4615 4572 4422 2523 1950 1845 967 --22689 1134 --
NM_001003675chr18117038 6922 4962 4647 4615 4572 4422 2523 1950 1845 967 --22689 1134 --
NM_001003676chr113329 245 23 --1979 --
NM_001003681chr2251894 1356 417 408 279 1830 ----
NM_001003682chr141263 1020 578 482 --1982 --
NM_001003694chr32657 64 ------
NM_001003698chr621631 1277 --11500 --
NM_001003699chr621631 1277 --11500 --
NM_001003712chr1243896 1524 1399 1383 ------
NM_001003760chr622396 2269 ------
NM_001003792chr3235 23 ------
NM_001003793chr3235 23 ------
NM_001003794chr352314 2114 741 470 299 21965 1100 13050 --
NM_001003800chr953281 2711 1236 1136 39 ------
NM_001003805chr14----162 --
NM_001003809chr183249 121 72 ------
NM_001003891chr224810 648 130 117 ------
NM_001003940chr15123739 3717 3577 3221 3154 3116 3109 2943 2625 2516 1232 761 --12344 --
NM_001003942chr15123739 3717 3577 3221 3154 3116 3109 2943 2625 2516 1232 761 --12344 --
NM_001003943chr15123743 3721 3581 3225 3158 3120 3113 2947 2629 2520 1236 765 --12348 --
NM_001004065chr963930 3771 3473 3213 2927 943 33175 2947 733 ----
NM_001004128chr13655 435 42 ------
NM_001004196chr331097 501 153 ------
NM_001004304chr1263056 3025 2887 2433 2005 864 ------
NM_001004317chr684426 3867 3566 3506 3280 3048 669 528 13423 23040 586 --
NM_001004342chr1256114 5794 5222 5071 5017 4797 4016 3981 3715 2336 2207 1995 1989 1867 1845 1779 1749 1737 1635 1610 805 604 452 201 195 --25488 1650 --
NM_001004360chr222015 2006 11833 ----
NM_001004419chr1254111 1780 1570 551 278 ------
NM_001004441chr511371 ------
NM_001005158chr32393 63 ------
NM_001005159chr32393 63 ------
NM_001005217chr43902 451 58 ------
NM_001005271chr1761072 1053 401 372 285 77 ------
NM_001005273chr1761072 1053 401 372 285 77 ------
NM_001005291chr172478 32 ------
NM_001005353chr12795 181 ------
NM_001005353chr12795 181 ------
NM_001005366chr122377 242 --145 --
NM_001005375chrY----21850 31 --
NM_001005386chr292276 1678 944 702 486 303 242 235 55 --1201 --
NM_001005404chr1784068 2795 964 788 754 330 182 174 14304 13997 --
NM_001005417chr14631 554 267 184 --138 --
NM_001005463chr1041984 1928 721 657 --32495 2354 695 1580
NM_001005473chr555970 5935 4707 2331 771 36381 1549 347 35927 5413 4940 --
NM_001005474chr331052 81 39 --1260 --
NM_001005476chr21700 ------
NM_001005502chr12135064 5054 4961 4924 4898 3866 1665 1561 1068 1042 679 521 232 --14756 --
NM_001005505chr371655 1423 1161 1143 359 318 247 21606 339 ----
NM_001005609chrX93730 3557 3538 2414 1098 990 856 828 167 13020 ----
NM_001005739chr2--1855 ----
NM_001005743chr1451335 508 476 394 200 ------
NM_001005744chr1451335 508 476 394 200 ------
NM_001005745chr1451335 508 476 394 200 ------
NM_001005746chr221326 1074 ------
NM_001005747chr221326 1074 ------
NM_001005753chr272049 1663 737 588 409 377 48 --2727 284 --
NM_001005781chr21222 ------
NM_001005782chr21671 ------
NM_001005785chrY----21850 31 --
NM_001005786chrY----21850 31 --
NM_001005849chr171508 ------
NM_001005861chr31657 --1358 --
NM_001005910chr32563 269 --1223 --
NM_001005911chr32563 269 --1223 --
NM_001006115chr362773 2655 1915 1719 1102 243 1703 32477 2121 2111 --
NM_001006600chr51974 ------
NM_001006610chr162765 72 ------
NM_001006617chr951116 906 206 187 45 ------
NM_001006618chr9157 ------
NM_001006619chr951116 906 206 187 45 ------
NM_001006620chr951116 906 206 187 45 ------
NM_001006621chr951116 906 206 187 45 ------
NM_001006623chr262463 2032 1969 1765 823 696 12039 1537 1262
NM_001006634chr161556 ------
NM_001006636chr22959 124 ------
NM_001006665chr12289 124 ------
NM_001006933chrX154 ------
NM_001006944chr115528 509 288 105 76 --2673 254 --
NM_001006946chr261826 1304 771 191 176 54 --21291 337 --
NM_001007024chr17124100 2716 1511 1313 1129 1054 1002 730 553 540 509 398 11726 3606 384 87 --
NM_001007025chr17124100 2716 1511 1313 1129 1054 1002 730 553 540 509 398 11726 3606 384 87 --
NM_001007027chr11166 ----1268
NM_001007067chr811119 1742 1435 --
NM_001007068chr811119 1742 1435 --
NM_001007069chr811119 1742 1435 --
NM_001007070chr811119 1742 1435 --
NM_001007072chr15294 29 158 ----
NM_001007097chr9104514 4456 4446 3224 1075 1067 906 621 83 57 24066 111 ----
NM_001007098chr15824 209 151 131 106 --2377 240 --
NM_001007102chr641401 1197 1147 36 11578 1555 2548 198
NM_001007156chr1521314 404 ------
NM_001007189chr5------128
NM_001007226chr1741385 1134 313 59 ------
NM_001007227chr1741385 1134 313 59 ------
NM_001007228chr1741385 1134 313 59 ------
NM_001007229chr1741385 1134 313 59 ------
NM_001007230chr1741385 1134 313 59 ------
NM_001007233chr51700 ------
NM_001007237chr142584 2007 1931 838 12196 2773 165 --
NM_001007246chr211602 --11245 --
NM_001007257chr14568 370 180 150 ------
NM_001007271chr102431 267 --1199 --
NM_001007277chr112940 129 ------
NM_001007466chr655128 5024 3178 3138 424 --24898 3948 --
NM_001007471chr92633 94 ------
NM_001007527chr51228 ------
NM_001007553chr12410 304 1796 ----
NM_001007559chr1811729 11386 ----
NM_001008220chr5113817 3170 2820 2721 2694 2505 860 777 742 334 319 ------
NM_001008222chrX41356 1097 524 323 ------
NM_001008225chr7------1691
NM_001008239chr1893142 3131 2873 2392 2368 1383 562 323 296 --12423 --
NM_001008392chr3113324 3227 2876 2399 1412 1083 1009 842 604 312 63 11394 ----
NM_001008407chr741580 517 393 67 --11388 --
NM_001008408chr7156277 6243 5947 5430 4696 4677 3956 1794 1720 1706 1655 1343 952 602 65 --46039 5080 1065 909 12244
NM_001008491chr241967 1899 1858 1409 1471 ----
NM_001008492chr241967 1899 1858 1409 1471 ----
NM_001008495chr8--21823 314 ----
NM_001008528chr1771749 1472 701 600 394 318 227 11266 ----
NM_001008539chr8105354 5047 4652 4203 4069 3965 3815 3651 1266 658 ------
NM_001008541chr1042238 1780 719 700 --11713 --
NM_001008541chr1042238 1780 719 700 --11713 --
NM_001008564chr1322037 838 --11577 --
NM_001008566chr222117 31 --1323 --
NM_001008567chr93244 86 28 ------
NM_001008657chr55875 784 745 711 702 ------
NM_001008660chr113350 237 83 ------
NM_001008701chr1982885 2851 2835 2410 1915 1251 662 455 ------
NM_001008738chr542835 2048 1913 1102 --12355 1987
NM_001008777chr171228 ------
NM_001008783chr62877 252 ------
NM_001008801chr1911571 ------
NM_001008860chr151664 ------
NM_001008892chr151664 ------
NM_001008894chr151664 ------
NM_001008938chr111169 ------
NM_001009185chr52727 216 ----139
NM_001009552chr83232 120 22 ------
NM_001009554chr451342 1251 777 513 149 ------
NM_001009554chr451342 1251 777 513 149 ------
NM_001009566chr151279 1136 181 48 31 ------
NM_001009598chr1141 ------
NM_001009880chr2294761 4152 3405 3083 1751 1356 1014 416 55 14440 13807 --
NM_001009881chr1162 ------
NM_001009882chr1162 ------
NM_001009894chr1211181 ----1552
NM_001009944chr1651011 917 635 330 137 ------
NM_001009955chr11508 ------
NM_001009955chr11508 ------
NM_001009993chr253442 1194 943 633 582 --1219 --
NM_001009996chr31109 ------
NM_001009997chr10----1332 --
NM_001010000chr1842813 2434 1121 479 --21076 922 --
NM_001010854chr142540 510 ------
NM_001010867chr1256361 6170 6101 6034 5924 5869 5732 5541 5353 5249 4727 4706 4641 4475 2600 2459 2092 2066 1737 1727 1549 713 359 154 88 --36443 2654 2450 --
NM_001010888chrX34099 3261 227 ------
NM_001010898chr1143553 3486 3333 3212 3043 2739 2452 1230 1082 846 709 616 290 133 1987 12559 --
NM_001010908chr102503 480 ------
NM_001010924chr1041224 876 482 40 --1822 --
NM_001010926chr12684 563 ------
NM_001010932chr71332 1324 142 --
NM_001010934chr71382 --2276 225 --
NM_001010938chr34780 296 269 30 ------
NM_001010942chr1231252 908 262 ------
NM_001010986chrX22493 357 11600 ----
NM_001011513chr484021 3995 3190 2532 1247 982 837 801 13225 ----
NM_001011515chr441037 952 881 93 ------
NM_001011516chr441037 952 881 93 ------
NM_001011537chr352054 1950 1840 454 202 ------
NM_001011538chr421082 987 ------
NM_001011546chr202741 107 --1521 --
NM_001011553chr72702 372 --1651 --
NM_001011645chrX160 ------
NM_001011658chrX51671 1397 1371 362 164 ------
NM_001011663chr10--1932 ----
NM_001011666chr7116050 6028 5539 5206 4750 4651 4442 1534 1367 1290 322 11035 16063 --
NM_001011708chr232802 2425 722 ------
NM_001011713chr1411109 ------
NM_001011885chr1511654 ------
NM_001012264chr144761 665 298 45 --1630 --
NM_001012267chr951887 1412 475 436 386 2117 88 ----
NM_001012329chr152338 2208 769 710 605 1406 1907 --
NM_001012338chr15252 37 ------
NM_001012393chr11124730 4325 4189 3683 1951 1850 1809 1719 1432 884 288 35 --14159 --
NM_001012398chr1641121 993 168 116 --181 --
NM_001012420chr1552913 2691 2031 651 348 22893 1168 ----
NM_001012423chr1552913 2691 2031 651 348 32893 1168 410 ----
NM_001012426chr6103365 3152 3123 3014 2652 2626 2578 2458 2159 1348 --2588 275 --
NM_001012427chr6103365 3152 3123 3014 2652 2626 2578 2458 2159 1348 --2588 275 --
NM_001012614chr42631 484 ------
NM_001012643chr194527 219 208 24 1515 ----
NM_001012644chr203332 124 56 ------
NM_001012732chr42356 319 --1155 --
NM_001012751chr1021968 1525 --175 --
NM_001012753chr1931146 1104 285 ------
NM_001012754chr1321662 398 --1491 --
NM_001012755chrX64485 3626 3528 1758 1294 704 187 1480 1753
NM_001012756chr1953240 2581 2447 2421 1197 --12984 --
NM_001012761chr552534 2391 960 703 470 ------
NM_001012958chr131067 1013 179 ------
NM_001012958chr131067 1013 179 ------
NM_001012968chrX3958 692 165 11826 32016 886 196 --
NM_001012977chrX31425 467 278 ----11134
NM_001012979chrX3164 54 44 ------
NM_001012989chrX3558 255 179 ------
NM_001013031chr1083326 3005 2982 1099 1080 756 533 473 12226 1680 --
NM_001013406chr71198 11408 ----
NM_001013415chr451349 1084 990 569 216 ------
NM_001013437chr183380 114 65 ------
NM_001013620chr12157971 7039 6415 6351 6298 5979 3071 2935 2787 2129 1027 998 918 762 198 1595 38424 7782 6736 --
NM_001013622chr411929 465 416 404 342 280 221 169 157 95 33 ------
NM_001013635chr123903 340 36 1847 2890 827 --
NM_001013642chr13995 911 431 --1217 --
NM_001013690chr1272464 2222 1986 1774 1571 576 512 12493 11803 --
NM_001013693chr1122920 2708 2555 2236 2216 2141 1827 902 750 614 392 231 ------
NM_001013693chr1122920 2708 2555 2236 2216 2141 1827 902 750 614 392 231 ------
NM_001013839chr1772422 720 647 307 168 117 73 ------
NM_001014283chr1381822 1679 1519 1474 1382 735 202 163 11854 ----
NM_001014380chr1394545 4041 2357 2331 1760 1604 871 845 657 14209 ----
NM_001014445chr1761079 999 993 788 742 54 --1760 --
NM_001014765chr1101799 1773 1327 642 633 535 509 418 330 48 ------
NM_001014794chr11188 ------
NM_001014795chr11188 ------
NM_001014797chr1097509 7441 7107 6215 5816 2837 826 285 247 57921 7864 7026 6289 2846 ----
NM_001014809chr43971 797 680 ------
NM_001014831chr192788 267 --1734 --
NM_001014832chr192788 267 --1734 --
NM_001014834chr192788 267 --1734 --
NM_001014835chr192788 267 --1734 --
NM_001014839chr13861 743 727 --1368 --
NM_001014841chr13861 743 727 --1368 --
NM_001015045chr44514 508 120 51 2686 393 1157 --
NM_001015508chr8----1517 --
NM_001015877chrX32398 1209 107 --22549 2408 1137
NM_001015880chr1021646 1158 21120 1075 11547 --
NM_001015887chr331647 673 297 --11365 --
NM_001017368chr1792822 2302 2179 1014 777 740 721 303 159 ----1495
NM_001017395chr3113621 3418 3277 2955 2643 2451 2218 1357 1067 1009 395 11407 22502 2327 --
NM_001017405chr41692 ------
NM_001017415chr1------1751
NM_001017416chr1------1751
NM_001017440chr7228166 7834 7725 7268 6879 6759 6306 5355 5112 3058 2779 2587 2347 1991 1936 1912 1610 1263 903 757 632 206 --21637 616 --
NM_001017523chr127754 719 687 281 268 127 118 11570 11681 --
NM_001017916chr1762028 1615 1524 171 141 44 ------
NM_001017917chr1762028 1615 1524 171 141 44 ------
NM_001017923chr1431240 1225 303 1530 ----
NM_001017926chr811331 --1392 --
NM_001017979chr4136 --2246 146 --
NM_001017981chr223511 500 44 --1550 --
NM_001017989chr1981248 1054 945 905 899 80 59 35 ------
NM_001017995chr5174616 4556 4146 4101 3846 3772 3674 3667 1857 1467 1416 1197 1024 644 291 259 134 23145 790 2486 346 --
NM_001017999chr13748 421 25 11565 ----
NM_001017999chr13748 421 25 11565 ----
NM_001018000chr13748 421 25 11565 ----
NM_001018000chr13748 421 25 11565 ----
NM_001018001chr13748 421 25 11565 ----
NM_001018003chr86701 692 682 594 474 255 ------
NM_001018004chr152218 100 164 ----
NM_001018006chr152218 100 164 ----
NM_001018007chr152218 100 164 ----
NM_001018009chr31114 --1980 --
NM_001018020chr152218 100 164 ----
NM_001018025chrX2264 125 ------
NM_001018050chr2262810 2775 2492 1222 708 668 22147 449 1892 --
NM_001018052chr2262810 2775 2492 1222 708 668 22147 449 1892 --
NM_001018054chr11276 --11446 --
NM_001018056chr91481 ------
NM_001018057chr1141358 954 395 264 ------
NM_001018064chr93440 289 75 ------
NM_001018065chr986076 5032 4965 3710 1455 617 431 166 35841 4502 1389 14694 --
NM_001018066chr986076 5032 4965 3710 1455 617 431 166 35841 4502 1389 14694 --
NM_001018067chr174837 4074 3952 2060 442 287 107 15318 14234 --
NM_001018068chr174837 4074 3952 2060 442 287 107 15318 14234 --
NM_001018069chr174837 4074 3952 2060 442 287 107 15318 14234 --
NM_001018072chr127754 719 687 281 268 127 118 11570 11681 --
NM_001018074chr543950 932 794 24 --22405 515 --
NM_001018075chr543950 932 794 24 --22405 515 --
NM_001018076chr543950 932 794 24 --22405 515 --
NM_001018077chr543950 932 794 24 --22405 515 --
NM_001018108chr1531926 615 330 12248 ----
NM_001018676chr8190 ------
NM_001018677chr8190 ------
NM_001020658chr131477 411 226 ------
NM_001020658chr131477 411 226 ------
NM_001020818chr19101738 1731 1491 1463 657 574 513 493 432 113 --11404 --
NM_001020819chr19101738 1731 1491 1463 657 574 513 493 432 113 --11404 --
NM_001020820chr19101738 1731 1491 1463 657 574 513 493 432 113 --11404 --
NM_001020821chr19101738 1731 1491 1463 657 574 513 493 432 113 --11404 --
NM_001022chr19----130 --
NM_001023567chr1542365 2305 2078 847 12285 --11599
NM_001023587chr3158 ------
NM_001024094chr543950 932 794 24 --22405 515 --
NM_001024226chr1291 40 --11090 --
NM_001024227chr1291 40 --11090 --
NM_001024228chr1291 40 --11090 --
NM_001024401chr1692665 2529 2345 2260 1902 1873 1842 930 858 ------
NM_001024455chrX72324 2245 1982 1897 779 226 68 1846 ----
NM_001024463chr153776 451 38 ------
NM_001024465chr6157 ------
NM_001024666chrX2474 102 ------
NM_001024668chr123832 788 744 --1972 --
NM_001024680chr251666 1451 1424 1363 1244 11416 ----
NM_001024808chr1282392 1797 1034 1026 912 830 517 218 --2858 268 --
NM_001024809chr1751042 969 885 418 55 --1193 --
NM_001024845chr141058 820 139 85 ------
NM_001024855chr33159 122 58 ------
NM_001024934chr61528 1593 ----
NM_001024935chr61528 1593 ----
NM_001024936chr61528 1593 ----
NM_001024947chr5181 --1750 --
NM_001024948chr192636 2285 2258 2198 2166 2150 1346 384 274 --22921 2839 --
NM_001024956chr1185754 4721 3790 2266 1717 913 343 143 11490 --14233
NM_001024957chr112290 24 ------
NM_001025068chr321131 485 1188 11590 --
NM_001025069chr321131 485 1188 11590 --
NM_001025070chr5----139 --
NM_001025071chr5----139 --
NM_001025076chr10145697 5205 4908 4840 4767 4687 4325 4160 3922 2431 2160 2111 1483 1261 25558 78 24207 488 15254
NM_001025077chr10147055 6563 6266 6198 6125 6045 5683 5518 5280 2841 2619 1069 101 69 36916 1436 954 45565 1846 884 424 26612 913
NM_001025079chr363442 3337 1478 1121 729 375 12624 ----
NM_001025081chr182382 217 --151 --
NM_001025090chr182382 217 --151 --
NM_001025092chr182382 217 --151 --
NM_001025101chr182382 217 --151 --
NM_001025105chr541521 1348 1170 1145 1584 1360 --
NM_001025108chr284178 3251 3159 3144 2829 2707 1166 457 --23334 2555 --
NM_001025205chr33400 108 101 ------
NM_001025252chr873205 3019 1100 819 310 78 31 12732 22873 2760 11194
NM_001025253chr873205 3019 1100 819 310 78 31 12732 22873 2760 11194
NM_001025266chr3144559 3824 3798 3788 1691 1665 1617 1384 1259 1093 907 660 534 432 --24917 3251 --
NM_001025356chr1232706 985 118 1345 21987 733 --
NM_001025389chr1141393 417 280 147 ------
NM_001025390chr1141393 417 280 147 ------
NM_001025579chr173758 191 73 --11042 --
NM_001025580chrX73476 3463 3388 1677 388 325 291 --1737 --
NM_001025595chr41628 ------
NM_001025596chr111114 ------
NM_001025603chr141073 1055 510 164 149 ----
NM_001025616chr43608 195 21 --31845 1543 1525 1713
NM_001025777chr281413 1376 1201 1188 1155 1131 1074 88 178 21021 342 --
NM_001025780chr961391 1370 1024 998 301 106 ------
NM_001029858chr643324 2981 1303 374 --2695 558 --
NM_001029863chr642770 2507 2226 1133 12840 --12857
NM_001029875chr562582 2163 2024 779 177 134 --12649 --
NM_001029882chr11118 ------
NM_001029882chr11118 ------
NM_001029891chrX2745 23 ------
NM_001029998chr441124 921 198 90 ------
NM_001030006chr1732420 2331 475 --21071 201 --
NM_001030007chr1673434 3056 932 528 208 149 122 --23995 3131 --
NM_001030055chr1433206 1213 383 14437 ----
NM_001030287chr12211 85 ----11070
NM_001031677chr51131 ----1374
NM_001031679chr1223453 2982 ------
NM_001031685chr1--1296 --1866
NM_001031690chr7113039 2648 2388 2335 1175 989 938 571 534 398 23 ------
NM_001031692chr7--190 1306 --
NM_001031695chr22185127 5001 4760 4344 4318 3891 3599 3568 3314 2013 1889 1731 1457 1379 1291 1057 616 203 --15414 --
NM_001031702chr35809 275 256 116 33 ------
NM_001031716chr21395 ------
NM_001031723chr4----1369 --
NM_001031732chr433253 1169 355 1101 1502 --
NM_001031738chr22201 182 ------
NM_001031740chr131191 384 263 ------
NM_001031803chr171202 --1290 --
NM_001031804chr1642733 1384 1342 278 13468 21179 1095 --
NM_001031806chr1771943 424 416 404 272 198 29 21832 1757 ----
NM_001031812chr541774 926 584 52 --12290 --
NM_001032221chr961713 1578 1171 688 589 94 ------
NM_001032280chr681659 1402 1106 184 172 142 121 109 --11679 --
NM_001032288chr2041231 487 375 234 --21603 1085 --
NM_001032289chrX4842 761 620 94 ------
NM_001032293chr17----1624 --
NM_001032296chr13112818 2720 2639 2532 2483 2439 2425 1159 886 805 373 --1566 --
NM_001032363chr172278 2113 1793 1523 563 297 85 --1401 --
NM_001032363chr172278 2113 1793 1523 563 297 85 --1401 --
NM_001033025chr141509 494 363 303 11106 136 --
NM_001033044chr131477 1419 1280 --31193 622 274 --
NM_001033045chr233009 1720 1491 ------
NM_001033047chr452180 920 521 241 157 ------
NM_001033049chr2111951 1539 21966 275 --
NM_001033056chr131477 1419 1280 --31193 622 274 --
NM_001033057chr331801 1580 414 11369 --11313
NM_001033081chr141909 544 491 28 1280 11891 --
NM_001033082chr141909 544 491 28 1280 11891 --
NM_001033087chr2093261 3149 3007 2864 2450 1014 935 336 263 12164 23205 2770 --
NM_001033088chr151323 ------
NM_001033112chr52822 113 ------
NM_001033117chr384756 4464 4348 3807 3543 3413 1423 1287 14230 1671 --
NM_001033518chr782421 2300 2155 1906 1076 712 464 425 22705 207 12680 --
NM_001033519chr782421 2300 2155 1906 1076 712 464 425 22705 207 12680 --
NM_001033520chr782421 2300 2155 1906 1076 712 464 425 22705 207 12680 --
NM_001033551chr17163968 3799 3578 3548 3371 3335 3139 2981 2961 2625 1602 943 866 782 610 383 12884 23793 322 11392
NM_001033557chr22579 27 --21079 49 --
NM_001033566chr171983 ------
NM_001033568chr171983 ------
NM_001033602chr1352509 2480 2417 979 159 --1634 --
NM_001033677chr123121 68 27 ------
NM_001033723chr842542 2535 2085 1003 --1906 --
NM_001033925chr1032192 1485 174 ------
NM_001033952chr111253 ------
NM_001034025chr1241004 876 763 172 ------
NM_001034837chr55719 686 584 271 188 1296 ----
NM_001034838chr55719 686 584 271 188 1296 ----
NM_001034841chr1684645 4128 1808 1689 1489 1347 985 125 34873 1122 800 13528 --
NM_001034845chr43385 275 200 ------
NM_001034915chr851565 1473 1157 993 452 ------
NM_001034954chr1063127 1206 631 523 492 341 1160 ----
NM_001034955chr1063127 1206 631 523 492 341 1160 ----
NM_001034956chr1063127 1206 631 523 492 341 1160 ----
NM_001034957chr1063127 1206 631 523 492 341 1160 ----
NM_001035chr141293 435 265 103 --1394 --
NM_001035003chr411334 --11277 1995
NM_001035004chr411334 --11277 1995
NM_001035005chr181487 ------
NM_001035254chr982400 1879 981 822 668 641 162 35 --32485 769 526 1535
NM_001035511chr131763 1728 476 1139 21748 313 --
NM_001035512chr131870 1835 583 1246 21855 420 --
NM_001035513chr131870 1835 583 1246 21855 420 --
NM_001035521chr23747 290 128 1592 ----
NM_001035534chr991346 1189 1005 921 438 334 270 248 21 ------
NM_001037132chr721951 1917 11784 ----
NM_001037133chr721951 1917 11784 ----
NM_001037164chr731900 154 87 31914 1745 327 ----
NM_001037174chr221949 653 ------
NM_001037324chr36565 492 293 244 193 176 ------
NM_001037331chr182962 177 --1685 --
NM_001037332chr562367 2267 1956 1796 1673 749 --12577 1844
NM_001037333chr562367 2267 1956 1796 1673 749 --12577 1844
NM_001037334chr1852202 904 430 321 201 --12333 --
NM_001037339chr141505 1210 685 194 ------
NM_001037340chr141505 1210 685 194 ------
NM_001037341chr141505 1210 685 194 ------
NM_001037341chr141505 1210 685 194 ------
NM_001037553chr2163872 3833 3519 1621 641 305 24216 3721 1409 --
NM_001037582chr431106 619 314 --11078 --
NM_001037631chr2----21101 938 --
NM_001037637chr5--1254 170 --
NM_001037738chr52255 205 ------
NM_001037954chr1183477 1332 1283 1261 653 643 590 52 --23278 2722 --
NM_001038493chr24581 566 422 28 ------
NM_001038702chr572589 2031 1039 509 296 284 96 ------
NM_001038707chr172228 1768 1647 1626 708 318 69 1128 ----
NM_001038707chr172228 1768 1647 1626 708 318 69 1128 ----
NM_001039348chr2----21053 419 --
NM_001039349chr2----21053 419 --
NM_001039459chr73408 360 269 --2739 213 --
NM_001039479chr1482126 2048 1753 1685 1652 1520 978 580 --2568 466 --
NM_001039547chr397788 7627 7484 5755 4884 2920 2724 2162 1066 --46187 3044 943 612 --
NM_001039550chr24761 714 681 552 --1745 --
NM_001039574chr141013 996 746 408 ------
NM_001039577chr184172 4162 3511 3117 3096 925 696 248 13448 1218 11788
NM_001039583chr223433 358 119 ------
NM_001039584chr223433 358 119 ------
NM_001039590chrX43597 3509 2563 372 11350 33543 596 137 --
NM_001039591chrX43597 3509 2563 372 11350 33543 596 137 --
NM_001039618chr1155843 5713 5026 1411 330 21753 602 11305 --
NM_001039671chr19299 74 ------
NM_001039672chr19299 74 ------
NM_001039673chr19299 74 ------
NM_001039690chr1662137 2053 1970 1635 1512 58 1426 ----
NM_001039693chr263948 3223 3072 2632 1200 424 34031 2762 760 ----
NM_001039711chr11106 ------
NM_001039712chr11106 ------
NM_001039762chr1041539 1519 673 570 12035 ----
NM_001039771chr144968 874 829 245 ------
NM_001039772chr113505 81 24 ------
NM_001039802chr111065 ------
NM_001039840chrX136016 5997 5329 5016 4328 4146 4011 3708 1762 700 634 446 318 35058 4581 4344 21471 567 --
NM_001039877chr194749 285 175 111 ------
NM_001039888chr15731 641 613 605 519 ------
NM_001039937chr1344129 3903 2671 1226 1750 21649 692 --
NM_001040001chr632059 1910 193 --11436 1218
NM_001040002chr1761382 1247 1233 1153 313 140 --1293 --
NM_001040056chr165698 493 217 210 34 ------
NM_001040057chr761400 1296 1150 997 183 176 ------
NM_001040092chr81349 ------
NM_001040100chr341006 414 145 137 ------
NM_001040101chr451116 472 365 158 138 ----1202
NM_001040110chr761856 1359 1308 1239 571 224 --11866 --
NM_001040142chr231726 373 238 11502 ----
NM_001040143chr231726 373 238 11502 ----
NM_001040144chr1662137 2053 1970 1635 1512 58 1426 ----
NM_001040146chr1662137 2053 1970 1635 1512 58 1426 ----
NM_001040151chr11104488 4417 3570 3526 3225 2974 2927 1083 952 161 1550 13022 12966
NM_001040152chr785042 4924 1504 1404 813 673 444 432 ------
NM_001040153chr134970 690 257 181 ------
NM_001040172chr581272 1091 514 460 436 313 252 68 ------
NM_001040173chr581272 1091 514 460 436 313 252 68 ------
NM_001040181chr32811 28 1968 ----
NM_001040182chr32811 28 1968 ----
NM_001040183chr32811 28 1968 ----
NM_001040199chr32811 28 1968 ----
NM_001040200chr32811 28 1968 ----
NM_001040202chr442067 1574 933 206 12383 21707 173 --
NM_001040214chr642045 637 560 415 ------
NM_001040260chr441143 892 830 190 ------
NM_001040261chr441143 892 830 190 ------
NM_001040284chr1665867 5057 4325 3942 2322 2021 22071 232 45414 4344 1268 24 --
NM_001040402chr482888 2681 2646 2350 452 192 159 93 --12325 --
NM_001040409chr231034 905 895 ------
NM_001040424chr2141992 917 865 276 --12328 --
NM_001040429chr1351199 1158 372 165 112 --22893 2218 --
NM_001040440chr51175 ------
NM_001040441chr1--1710 13328 24259 3547
NM_001040445chr2125234 5112 5089 4762 4345 3986 3586 2191 942 805 767 132 --24984 728 --
NM_001040446chr57883 802 762 732 669 625 538 --22108 1965 --
NM_001040450chr1542756 2331 2252 1143 ------
NM_001040453chr1542756 2331 2252 1143 ------
NM_001040455chr11101265 1215 1112 913 859 512 503 249 189 103 ------
NM_001040619chr12661 535 ----11520
NM_001040633chr72881 64 ------
NM_001040665chr7114954 4838 4807 4510 4352 4228 2016 1785 1482 758 24 --44695 4592 1854 1288 --
NM_001040666chr75656 540 509 212 54 --1294 --
NM_001040694chr113896 72 54 21153 908 ----
NM_001040697chr11----1116 --
NM_001040708chr831022 930 329 ------
NM_001040712chr973031 2681 2545 527 441 413 347 --13088 --
NM_001040876chr421659 408 ------
NM_001042355chr16125024 4829 4568 4510 3365 3302 1549 1468 728 515 418 90 ----1926
NM_001042361chr1041139 610 140 49 ------
NM_001042364chr1041139 610 140 49 ------
NM_001042365chr1041139 610 140 49 ------
NM_001042387chr1041139 610 140 49 ------
NM_001042388chr182270 30 1142 ----
NM_001042393chr1041139 610 140 49 ------
NM_001042396chr1041139 610 140 49 ------
NM_001042397chr1041139 610 140 49 ------
NM_001042404chr11121 21840 1617 ----
NM_001042406chr621011 836 ------
NM_001042410chr2----1171 --
NM_001042412chr16125024 4829 4568 4510 3365 3302 1549 1468 728 515 418 90 ----1926
NM_001042413chr943198 1081 748 412 23813 2852 43263 927 236 81 --
NM_001042424chr452897 2796 1205 489 56 1977 ----
NM_001042425chr681659 1402 1106 184 172 142 121 109 --11679 --
NM_001042430chr146487 410 375 127 115 88 ------
NM_001042453chrX--11163 ----
NM_001042473chr1072105 1631 1601 1456 808 541 342 11739 ----
NM_001042479chrX41565 1536 1400 348 1295 1307 --
NM_001042480chrX41565 1536 1400 348 1295 1307 --
NM_001042481chr1432693 2312 1727 1868 32500 2163 1775 --
NM_001042486chr20--1103 ----
NM_001042492chr1763376 3285 2745 371 328 184 1170 ----
NM_001042494chr1593455 3397 3347 3261 3146 2617 2591 1186 529 33105 2857 1469 13033 --
NM_001042495chr1593455 3397 3347 3261 3146 2617 2591 1186 529 33105 2857 1469 13033 --
NM_001042496chr1593455 3397 3347 3261 3146 2617 2591 1186 529 33105 2857 1469 13033 --
NM_001042497chr1593455 3397 3347 3261 3146 2617 2591 1186 529 33105 2857 1469 13033 --
NM_001042498chrX4979 898 757 231 ------
NM_001042506chrX41386 577 467 278 ------
NM_001042510chr84640 542 370 78 --147 --
NM_001042511chr84640 542 370 78 --147 --
NM_001042533chr342824 2816 1296 753 1553 --12602
NM_001042537chrX32155 1963 465 1890 ----
NM_001042555chr1274728 4567 4272 3903 3153 887 558 ------
NM_001042599chr297821 7156 6713 6649 6297 6289 5504 5255 5136 1290 17767 --
NM_001042603chr12134916 4853 4655 3705 3504 3446 3388 3330 3272 1850 1456 967 757 --21821 1677 --
NM_001042604chr394422 3997 3622 3167 3152 1781 1394 592 540 --24436 1627 21011 663
NM_001042616chr41210 ------
NM_001042632chr2072529 1739 473 259 164 110 24 22593 666 ----
NM_001042633chr2072529 1739 473 259 164 110 24 22593 666 ----
NM_001042669chr43608 195 21 --31845 1543 1525 1713
NM_001042681chr121888 802 ------
NM_001042682chr121888 802 ------
NM_001042682chr121888 802 ------
NM_001042728chr122964 279 1805 ----
NM_001042749chrX31670 662 166 ----11633
NM_001042750chrX31670 662 166 ----11633
NM_001042751chrX31670 662 166 ----11633
NM_001043318chr14113933 3388 2716 1619 1381 1311 1269 1105 1023 779 398 13481 23916 3513 --
NM_001043351chr192066 1642 1505 1433 879 781 452 171 115 --1165 1725
NM_001044385chr253871 2922 2520 1426 1189 ------
NM_001044722chr541774 926 584 52 --12290 --
NM_001044723chr541774 926 584 52 --12290 --
NM_001045556chr831398 685 332 --157 --
NM_001045557chr831398 685 332 --157 --
NM_001046chr543001 1166 832 402 --22440 456 --
NM_001065chr123457 429 157 ------
NM_001066chr161951 1924 1464 1352 460 210 12179 ----
NM_001068chr33286 235 64 --1205 --
NM_001070chr17254 30 ------
NM_001071775chr1321482 1204 1310 ----
NM_001076778chr381685 1602 1559 1546 661 474 119 28 ------
NM_001077628chr11122 --1260 --
NM_001079874chr132075 1740 535 1198 ----
NM_001080418chr1--1432 ----
NM_001083620chr4--12312 ----
NM_001083621chr1224343 4180 4065 3854 3280 3174 2888 2867 1782 1561 1416 1339 1235 980 962 947 932 905 833 728 434 269 14575 1441 --
NM_001087chr2162 ------
NM_001092chr17122375 2345 1944 1903 1808 663 651 611 598 503 410 181 1794 1830 --
NM_001095chr1291294 1201 501 345 313 272 252 169 69 1302 ----
NM_001096chr174826 753 289 89 ------
NM_001099678chr336116 5782 377 --56433 2349 2202 2101 499 11796
NM_001100108chr1218325 8265 7902 7121 6919 6503 5987 5943 5834 5285 5235 3342 2954 2716 2614 2560 2324 1694 831 812 753 12566 48316 2961 2832 1529 --
NM_001106chr3209657 9363 8391 8175 7245 6957 6764 6738 6645 6591 3835 3800 3175 3145 2187 1673 1163 1104 504 390 18593 ----
NM_001107chr14--1207 ----
NM_001109977chr42608 576 181 ----
NM_001113490chrX63333 2964 1339 1282 1182 954 --12768 --
NM_001116chr1652099 1233 1117 600 213 1448 ----
NM_001117chr1852086 1928 963 638 572 ------
NM_001119chr441298 380 374 21 ------
NM_001121chr103363 324 277 ------
NM_001122631chr114647 569 524 107 ------
NM_001122679chr52162 108 ------
NM_001123chr103687 338 42 ------
NM_001128chr1673434 3056 932 528 208 149 122 --23995 3131 --
NM_001144chr1661012 450 329 303 109 25 --1261 --
NM_001146chr861863 1580 1469 266 240 55 1593 ----
NM_001148chr43801 763 178 ----1604
NM_001149chr104948 438 115 39 --1552 --
NM_001153chr22123 72 --1143 --
NM_001156chr10--1478 1163 --
NM_001160chr1282794 2514 1118 982 684 657 402 281 --1351 --
NM_001167chrX86123 5892 5846 5593 5286 4295 2199 1053 11224 22250 1316 --
NM_001172chr14----1101 1741
NM_001173chr1433206 1213 383 14437 ----
NM_001174chrX1144 ------
NM_001186chr2132479 639 192 ----12800
NM_001187chr212408 233 ------
NM_001189chr441025 921 316 246 ------
NM_001191chr2051146 1076 1024 539 76 --1402 --
NM_001197chr222142 49 ------
NM_001198chr632253 801 590 11704 ----
NM_001201chr493378 3308 3265 3037 2916 1442 1436 161 93 --23746 422 --
NM_001202chr14----1108 --
NM_001204chr247505 5212 3118 2634 --185 --
NM_001206chr952368 2134 595 470 122 42165 2115 2082 886 ----
NM_001207chr5--1254 170 --
NM_001220chr7273 53 ------
NM_001222chr1021231 187 1482 1659 --
NM_001227chr103903 412 153 11299 ----
NM_001241chr25833 635 382 231 203 --1210 --
NM_001241chr25833 635 382 231 203 --1210 --
NM_001249chr141149 1154 ----
NM_001253chr62291 39 ------
NM_001256chr1721055 510 1491 1740 --
NM_001259chr7136384 6355 6243 5471 4994 2460 2199 1652 375 316 287 140 122 --11095 --
NM_001265chr13----1284 --
NM_001270chr51282 --171 --
NM_001271chr1553242 3171 3050 3009 2544 --32039 692 657 --
NM_001277chr114826 786 754 85 ------
NM_001278chr103999 974 289 ------
NM_001282chr1732420 2331 475 --21071 201 --
NM_001283chr76668 435 273 115 101 59 ------
NM_001284chr51512 ------
NM_001286chr172915 2906 2729 2143 2001 383 30 ------
NM_001290chr42432 26 ------
NM_001300chr101116 ------
NM_001304chr1742549 1317 1272 1229 22417 812 --1866
NM_001310chr1262993 981 417 231 217 103 --12251 --
NM_001313chr43971 797 680 ------
NM_001315chr632033 701 172 1817 ----
NM_001326chr112409 49 ------
NM_001328chr42631 484 ------
NM_001329chr101490 1177 ----
NM_001331chr11122192 2080 1828 1128 1065 1052 972 708 270 143 114 106 ------
NM_001332chr521362 475 ------
NM_001343chr53317 283 130 1180 1145 --
NM_001346chr342013 1842 997 721 1400 ----
NM_001350chr6122 ------
NM_001351chr3--11814 11829 --
NM_001356chrX12549 ------
NM_001357chr11251 ------
NM_001358chr41407 ------
NM_001362chr144743 290 218 191 --21041 203 --
NM_001364chr1193877 3807 3604 3594 3034 3020 2983 1871 366 34535 3889 2971 11438 1657
NM_001365chr174754 554 70 35 ------
NM_001378chr2--181 ----
NM_001382chr11----182 --
NM_001383chr172816 608 ------
NM_001385chr82170 44 ------
NM_001386chr861799 1728 1568 819 394 384 --12360 --
NM_001387chr552969 2149 928 808 682 1162 12589 12795
NM_001389chr214618 181 170 104 ------
NM_001390chr1843305 3164 2518 2451 --11150 --
NM_001395chrX3373 190 144 ------
NM_001396chr2152265 2156 1749 1107 82 ------
NM_001397chr1122511 2304 2281 2101 2006 1821 1683 911 721 703 576 109 ------
NM_001399chrX93730 3557 3538 2414 1098 990 856 828 167 13020 ----
NM_001400chr13918 424 90 --11238 --
NM_001401chr931365 1082 70 --31496 1258 472 --
NM_001406chr1771695 1506 1327 1204 370 222 177 ------
NM_001407chr321684 274 --1639 --
NM_001408chr1171 --21325 595 --
NM_001412chrX53200 2788 2612 334 283 --12899 --
NM_001416chr171520 ------
NM_001417chr1231381 511 200 ------
NM_001418chr111301 --1472 --
NM_001418chr111301 --1472 --
NM_001419chr1933183 1913 1319 --24408 1100 1325
NM_001420chr1912565 ------
NM_001421chrX51464 1356 1209 1177 138 --11425 --
NM_001422chr1131219 910 40 ------
NM_001423chr1251803 1360 1354 309 168 21544 1466 2409 291 --
NM_001426chr22625 469 ------
NM_001427chr721758 1638 21882 269 11601 --
NM_001431chr621141 316 ------
NM_001438chr183693 3241 1417 1365 1347 783 641 329 13316 11392 13381
NM_001439chr141509 494 363 303 11106 136 --
NM_001447chr541331 906 539 66 --21257 1028 --
NM_001448chrX31550 1540 520 --21426 699 --
NM_001453chr64390 378 348 228 --1584 --
NM_001454chr176865 625 386 211 156 56 ------
NM_001458chr71127 1715 1598 --
NM_001463chr23647 604 164 ------
NM_001494chr102727 87 ------
NM_001495chr84901 410 398 138 ------
NM_001497chr952766 2606 2349 2264 1784 11737 11858 --
NM_001498chr611227 --11130 2976 292
NM_001521chr23747 290 128 1592 ----
NM_001525chr11107 ------
NM_001530chr14--1842 --1919
NM_001542chr142584 2007 1931 838 12196 2773 165 --
NM_001543chr5194856 4403 4349 4204 3798 3747 3634 2986 2936 1723 1599 1588 1422 1381 1126 853 380 351 323 13780 44119 1823 1462 658 --
NM_001546chr651485 1428 1239 1197 247 ------
NM_001552chr174971 693 105 99 ------
NM_001553chr4--170 ----
NM_001554chr11162 --1246 --
NM_001567chr112610 156 1111 1594 --
NM_001584chr11147 ------
NM_001587chrX52080 1994 1954 780 196 1860 21850 539 --
NM_001608chr2--2631 259 1597 --
NM_001613chr10125 ------
NM_001616chr263395 2600 2577 1168 373 173 --21269 1130 171
NM_001619chr115952 341 216 184 153 ------
NM_001620chr113278 239 126 --1101 --
NM_001621chr752761 2083 459 225 73 ----22986 706
NM_001621chr752761 2083 459 225 73 ----22986 706
NM_001626chr19123482 3439 3348 1284 732 684 432 392 362 326 178 36 ------
NM_001635chr72884 349 1680 ----
NM_001642chr1141136 422 91 74 --11130 --
NM_001649chrX52470 2192 650 448 312 12367 1362 --
NM_001650chr1893589 3466 3332 2604 1518 1332 538 312 44 12933 12691 11391
NM_001656chr52427 413 ------
NM_001658chr1291 40 --11090 --
NM_001659chr12142558 2354 2344 2214 2202 2120 1066 822 646 564 396 151 142 53 --12073 --
NM_001661chr171569 ------
NM_001662chr71141 ------
NM_001663chr142513 86 ------
NM_001664chr33875 641 207 1355 ----
NM_001665chr113579 202 26 ------
NM_001668chr152200 851 485 345 161 --1220 --
NM_001674chr12211 85 ----11070
NM_001677chr141093 716 315 87 ------
NM_001678chr1751557 1483 658 309 63 1503 ----
NM_001679chr34296 196 188 45 --3764 635 181 --
NM_001682chr121543 1605 12598 --
NM_001683chr352213 1660 949 739 47 ------
NM_001686chr12----125 --
NM_001688chr14738 258 240 199 ------
NM_001690chr32882 731 --12540 --
NM_001693chr82953 169 ------
NM_001695chr894067 3682 2716 1642 1522 1490 1275 614 496 ------
NM_001699chr1941455 523 115 50 ------
NM_001701chr931331 1135 91 ------
NM_001706chr31197 ------
NM_001707chr73716 700 34 ------
NM_001709chr1161900 1877 940 817 333 307 --1457 --
NM_001726chr11118 ------
NM_001730chr1311125 1530 ----
NM_001730chr1311125 1530 ----
NM_001731chr12----1634 --
NM_001741chr111253 ------
NM_001742chr721132 366 --11392 --
NM_001743chr25554 464 164 97 52 1539 ----
NM_001744chr5----1168 1391
NM_001748chr141081 930 922 148 11122 ----
NM_001753chr761505 1494 1430 1379 560 496 ----1369
NM_001754chr21114219 4130 4033 3206 3108 3038 3019 2604 1671 1560 1377 ----12706
NM_001755chr1682236 2065 2059 772 611 559 198 73 ------
NM_001759chr12105201 4837 4599 3869 3279 3243 2076 1596 1529 705 23290 614 13784 11810
NM_001760chr63353 67 51 1880 ----
NM_001773chr141382 1299 1293 1265 1146 --1179
NM_001777chr363442 3337 1478 1121 729 375 12624 ----
NM_001788chr72702 372 --1651 --
NM_001791chr111065 ------
NM_001792chr1811111 ------
NM_001797chr161540 --1605 --
NM_001800chr19198 ------
NM_001802chr161109 132 --139
NM_001806chr1922863 948 --11193 --
NM_001823chr143198 165 35 --150 --
NM_001825chr5134 1112 ----
NM_001826chr1185 --1151 --
NM_001829chr41981 ------
NM_001830chrX43003 2992 1624 245 --32905 1595 1516 --
NM_001834chr52228 64 ------
NM_001839chr12180 161 --1131 --
NM_001845chr1341335 543 156 99 ----1414
NM_001851chr62511 25 ------
NM_001855chr91563 ------
NM_001858chr664145 3498 3359 2062 1622 867 ----11638
NM_001859chr973330 2837 2683 1435 1358 1166 344 --11343 --
NM_001860chr941122 454 401 76 --1788 1942
NM_001874chr12135064 5054 4961 4924 4898 3866 1665 1561 1068 1042 679 521 232 --14756 --
NM_001892chr541521 1348 1170 1145 1584 1360 --
NM_001894chr224782 329 241 223 --1867 --
NM_001901chr61388 ------
NM_001904chr321006 722 162 ----
NM_001907chr16174 ------
NM_001913chr74627 129 105 53 ------
NM_001915chr1762028 1615 1524 171 141 44 ------
NM_001918chr178481 8253 6578 6554 6408 5647 2630 26508 6189 12552 19098
NM_001921chr42356 319 --1155 --
NM_001923chr113524 116 54 --2606 492 --
NM_001927chr22179 52 ------
NM_001932chr172748 648 --1301 --
NM_001933chr1441336 512 276 202 --1924 --
NM_001935chr23649 176 74 ------
NM_001938chr121213 713 --1176 --
NM_001939chrX83849 3808 3681 3400 2920 1472 940 320 11363 ----
NM_001945chr5137 1914 ----
NM_001946chr122120 77 ------
NM_001949chr682756 2736 2130 2123 827 709 552 224 ------
NM_001950chr164611 305 276 58 --142 --
NM_001951chr81430 ------
NM_001955chr611081 --1209 --
NM_001956chr14520 511 197 85 ------
NM_001957chr441970 1826 1575 926 --11428 --
NM_001962chr52188 71 ------
NM_001964chr521170 221 ------
NM_001967chr32570 383 ------
NM_001970chr172466 230 1408 ----
NM_001977chr41582 11776 ----
NM_001978chr851034 863 661 341 44 ------
NM_001981chr152116 1559 862 314 267 ------
NM_001991chr1752194 1639 1432 689 69 --2169 44 --
NM_001995chr45968 516 460 397 318 --1173 --
NM_001999chr531008 963 125 ------
NM_002006chr483632 3611 1572 1498 1394 1370 974 513 --54786 4415 4032 1718 1703 --
NM_002009chr1511799 1363 11039 --
NM_002014chr123645 455 33 ------
NM_002015chr1352868 2730 2441 2182 1139 ------
NM_002017chr1121362 1012 ------
NM_002024chrX31667 1514 1377 ------
NM_002025chrX89280 9094 8932 8730 7880 6254 6247 912 --33631 3004 2283 --
NM_002026chr23905 380 225 --21068 216 --
NM_002027chr8190 ------
NM_002028chr1441266 506 422 352 11169 ----
NM_002031chr6----1219 --
NM_002035chr18123410 2924 1452 1427 944 560 499 491 483 475 467 459 --12516 --
NM_002036chr1----143 --
NM_002037chr62359 41 ------
NM_002040chr2143083 2989 2299 407 --12848 --
NM_002041chr15195 ------
NM_002045chr3153 ------
NM_002046chr12159 ------
NM_002048chr9--1428 21250 887 --
NM_002051chr1041073 965 774 432 --21112 791 --
NM_002056chr22847 709 ------
NM_002063chrX41123 1035 348 33 ------
NM_002065chr131477 1419 1280 --31193 622 274 --
NM_002069chr71633 ------
NM_002074chr121280 602 ------
NM_002076chr1273256 2710 2506 2369 850 732 211 ------
NM_002077chr952102 1780 1514 537 424 --1687 --
NM_002078chr3297 82 --1197 --
NM_002080chr16139 --1640 --
NM_002085chr19178 ------
NM_002086chr1782055 1786 1687 1653 601 527 236 74 --11873 --
NM_002088chr191135 ------
NM_002092chr4144635 4392 4047 3656 3483 3186 1182 1154 1029 725 635 391 239 104 14863 13578 11524
NM_002094chr16------1287
NM_002095chr8193 --181 --
NM_002103chr1951014 847 812 718 34 ------
NM_002106chr41106 ------
NM_002107chr11477 ------
NM_002111chr4123855 3724 3611 2869 2849 2524 1506 1465 1429 1272 897 76 23647 1045 13700 --
NM_002126chr17124145 3503 3146 2838 2794 1662 1005 757 628 392 339 54 13663 2811 714 --
NM_002130chr521634 685 ------
NM_002135chr121432 ------
NM_002136chr121456 ------
NM_002137chr721747 727 --11761 --
NM_002139chrX1564 ------
NM_002140chr93980 136 107 ------
NM_002141chr72248 41 ------
NM_002146chr172884 200 ------
NM_002147chr175885 870 644 251 114 ------
NM_002156chr21177 --1280 --
NM_002158chr273662 3524 3410 2609 883 779 280 11245 ----
NM_002166chr2----1653 --
NM_002167chr1153 ------
NM_002181chr22539 32 ------
NM_002187chr51889 ------
NM_002193chr241495 1231 558 542 ------
NM_002196chr202982 847 1922 ----
NM_002196chr202982 847 1922 ----
NM_002199chr41404 --2651 282 --
NM_002202chr5----1417 --
NM_002205chr123916 895 867 ------
NM_002210chr243556 2563 2239 104 ------
NM_002211chr102939 85 ------
NM_002214chr794926 4527 2059 1891 1273 1247 951 737 654 ------
NM_002221chr182646 2534 2203 1091 901 400 369 312 --42515 1070 1049 197 12486
NM_002222chr321322 484 11129 ----
NM_002223chr1243730 3220 611 46 13972 31350 899 645 --
NM_002224chr63612 534 68 1194 1760 --
NM_002226chr144855 827 670 182 ------
NM_002230chr173920 292 163 ------
NM_002232chr11154 2465 63 ----
NM_002233chr11123 ------
NM_002240chr212609 79 ------
NM_002241chr172338 2240 2041 1969 1128 337 182 12104 ----
NM_002246chr241266 154 79 70 ------
NM_002247chr1032316 797 595 --1904 --
NM_002254chr2102310 2042 1908 1516 1506 865 659 330 153 21 1895 22391 460 --
NM_002264chr384910 4874 3231 3104 1967 1406 1293 133 34477 3243 1175 14751 --
NM_002265chr171335 ------
NM_002268chr331900 1296 411 ------
NM_002270chr521201 569 24062 3960 35686 1767 1396 --
NM_002271chr1311575 12123 1691 --
NM_002282chr124285 211 55 37 ------
NM_002283chr123722 523 40 1604 2800 515 1786
NM_002285chr284178 3251 3159 3144 2829 2707 1166 457 --23334 2555 --
NM_002290chr631387 1003 957 ------
NM_002293chr182685 2609 2310 2158 2093 1022 354 122 ------
NM_002296chr121136 46 --1699 1547
NM_002298chr1331511 489 47 --11609 --
NM_002306chr141149 ------
NM_002310chr5106353 5950 2076 1933 1916 1876 1645 1170 440 50 11377 25037 1250 --
NM_002314chr771030 967 350 320 238 164 133 ------
NM_002315chr112219 57 ------
NM_002332chr124578 220 196 22 ------
NM_002334chr1131687 337 24 11351 2636 403 1273
NM_002336chr1284792 4535 1788 1667 1554 892 741 208 13548 127 --
NM_002351chrX11366 1560 11068 --
NM_002355chr121484 --1162 --
NM_002356chr63497 459 261 ----12567
NM_002359chr17113984 3914 3613 3525 3510 3317 3280 1644 1511 1134 63 13994 1815 --
NM_002360chr782607 2507 2355 2250 2006 574 474 340 --12632 --
NM_002361chr193282 252 235 ------
NM_002373chr1561221 1179 973 553 279 63 --1883 --
NM_002375chr3102324 1996 1804 1561 1547 716 688 402 373 300 --1619 --
NM_002376chr141419 ------
NM_002381chr23940 805 82 ------
NM_002382chr1441278 1083 1070 442 --134 --
NM_002385chr182382 217 --151 --
NM_002387chr5114890 4739 4459 4197 1779 1565 1368 953 478 430 276 --13381 --
NM_002390chr17101980 1973 1907 1716 1607 1435 687 289 255 62 ------
NM_002395chr64987 561 218 194 2462 233 ----
NM_002397chr532234 2112 2029 --1155 --
NM_002401chr17122291 1760 1733 975 804 674 641 623 592 517 80 23 ------
NM_002406chr551018 923 820 710 84 ------
NM_002408chr14196 ------
NM_002429chr1241572 1151 279 111 ------
NM_002430chr2242102 946 528 50 1154 --1485
NM_002442chr1241339 1268 253 170 --1132 --
NM_002449chr5--2929 486 ----
NM_002460chr693619 3257 1516 1181 535 423 264 156 80 11250 1570 --
NM_002467chr8----1144 --
NM_002469chr12--1346 ----
NM_002473chr221100 --11039 --
NM_002480chr1221216 101 11132 11414 --
NM_002482chr12166 154 1245 ----
NM_002488chr51212 ------
NM_002489chr72300 27 ------
NM_002495chr5125 ------
NM_002499chr1572298 2100 1881 1875 1762 222 171 --42354 2065 1520 481 --
NM_002500chr23882 94 58 --1152 --
NM_002501chr1954110 2955 1090 1011 490 --33987 3407 349 --
NM_002507chr1791916 1505 1238 1211 774 762 697 296 233 ------
NM_002509chr203688 290 164 ------
NM_002515chr1442018 1288 1253 422 1445 ----
NM_002522chr1751548 1501 1327 1278 44 --2905 625 --
NM_002530chr15252 37 ------
NM_002537chr153914 746 364 2131 93 1321 1303
NM_002539chr2179 ------
NM_002544chr171328 ------
NM_002545chr11124730 4325 4189 3683 1951 1850 1809 1719 1432 884 288 35 --14159 --
NM_002546chr82593 202 --1249 --
NM_002547chrX62749 1196 921 906 354 206 12976 ----
NM_002552chr221273 152 --1136 --
NM_002556chr1162122 1973 1827 1668 1344 180 1371 ----
NM_002576chr112430 95 1874 11208 --
NM_002577chr384021 3737 3509 3082 2972 2690 1238 801 --23099 2805 --
NM_002581chr995057 4888 4644 2117 929 820 673 485 131 --24271 3718 --
NM_002583chr122559 460 ------
NM_002586chr651467 1399 1244 311 210 ------
NM_002588chr531440 1315 235 ------
NM_002589chr4----1109 --
NM_002590chr131454 --1367 --
NM_002594chr2021616 140 ------
NM_002595chr1241574 1238 431 115 --21522 336 --
NM_002600chr141505 1210 685 194 ------
NM_002603chr8----128 --
NM_002606chr21177 --1189 --
NM_002607chr761125 1074 1064 901 440 108 ------
NM_002608chr2291535 1347 1268 1221 475 417 380 108 59 ------
NM_002609chr571541 1495 1231 529 212 99 27 ------
NM_002612chr73803 689 56 ------
NM_002622chr53627 287 191 1608 1683 --
NM_002623chr20--1154 ----
NM_002628chr32930 805 --132 --
NM_002632chr143833 689 535 ------
NM_002633chr12507 156 ------
NM_002634chr173908 853 234 1362 ----
NM_002635chr122187 33 ------
NM_002636chr61343 ------
NM_002641chrX41851 1737 1731 1691 11984 ----
NM_002646chr171999 1851 1631 1476 677 631 178 ------
NM_002648chr67958 829 524 508 492 167 63 ------
NM_002651chr12842 268 ------
NM_002655chr844836 4493 222 104 13362 13910 --
NM_002656chr6--2879 853 --1352
NM_002657chr20103359 3171 2594 2505 2471 2458 1488 1295 873 383 --2833 474 --
NM_002660chr2081185 1166 1124 963 913 780 738 328 ------
NM_002667chr61327 ------
NM_002670chr311375 ----1489
NM_002673chr36534 528 517 445 424 388 ------
NM_002687chr1431203 510 90 ----11088
NM_002693chr15--1104 ----
NM_002697chr1258 21 1210 1232 --
NM_002698chr1972318 750 648 517 350 337 96 ------
NM_002703chr4--1460 11845 --
NM_002709chr233137 2703 1122 --11021 11114
NM_002710chr1231028 733 285 ------
NM_002711chr71715 ------
NM_002713chr141131 1125 240 185 ------
NM_002714chr62718 234 --1829 --
NM_002715chr52956 28 ------
NM_002716chr1173682 3567 3555 3279 2943 2519 869 --13353 --
NM_002717chr81487 2258 38 ----
NM_002718chr352419 833 482 328 191 --183 --
NM_002721chr92120 112 ------
NM_002730chr1931079 478 290 ------
NM_002731chr192977 2912 2882 2839 1209 1158 1145 403 135 --1518 --
NM_002733chr12----151 --
NM_002734chr1762169 758 697 619 505 118 --2235 65 --
NM_002738chr164922 328 303 83 1436 ----
NM_002742chr145639 541 276 84 72 ------
NM_002745chr22134504 4473 4464 4451 4202 3581 3517 1412 1351 1329 1185 1172 84 14408 23570 1600 1266
NM_002746chr163529 48 41 ------
NM_002747chr182719 98 --1163 --
NM_002748chr151315 1782 11206 --
NM_002752chr51414 --1154 --
NM_002753chr44729 627 293 145 ------
NM_002755chr154579 345 320 81 1609 1171 --
NM_002758chr171112 ----1196
NM_002760chrY85781 5394 4428 3749 2002 1992 1033 230 25981 4538 ----
NM_002761chr16135 ------
NM_002763chr12431 205 ------
NM_002776chr1931959 777 198 ------
NM_002788chr14181 ------
NM_002823chr21229 ------
NM_002826chr15959 739 346 314 34 ------
NM_002827chr2021477 35 ------
NM_002828chr18--1211 ----
NM_002830chr21305 --140 --
NM_002833chr1551331 1207 407 353 182 11182 ----
NM_002835chr72243 149 --1212 --
NM_002836chr20----136 --
NM_002837chr1243545 3154 1364 895 --24359 3808 --
NM_002839chr973031 2681 2545 527 441 413 347 --13088 --
NM_002841chr3----1620 1248
NM_002843chr1153194 2906 2296 2131 1325 ------
NM_002844chr621374 1142 ------
NM_002846chr24430 411 84 49 ------
NM_002849chr1231085 426 411 ------
NM_002850chr1921036 962 ------
NM_002851chr72811 498 ------
NM_002855chr11183543 3403 3391 3385 3343 3264 3116 2655 2592 2486 2385 864 820 809 769 275 114 23 1925 11002 --
NM_002858chr12535 26 1261 1926 --
NM_002859chr1271250 1162 1155 581 574 228 165 --11227 --
NM_002861chr174496 128 82 40 1141 ----
NM_002866chr19135 ------
NM_002867chr14146 107 73 54 ------
NM_002868chr1272447 2400 2260 2229 827 379 125 --11842 --
NM_002869chr1132227 1404 134 --22127 42 --
NM_002871chr171976 1931 1780 683 410 162 90 1193 ----
NM_002874chr992333 2189 1812 934 879 613 503 340 179 12007 ----
NM_002880chr34690 158 132 28 ------
NM_002885chr14893 172 135 127 ----1753
NM_002890chr51353 1889 ----
NM_002892chr1451659 1205 499 387 36 ------
NM_002893chrX----1250 --
NM_002895chr201772 ------
NM_002897chr22610 555 ------
NM_002902chr15--1507 ----
NM_002906chr1111677 1738 1234 --
NM_002911chr1981574 1568 1282 1242 1143 1109 496 100 ------
NM_002912chr61627 --2368 107 --
NM_002918chr19185 ------
NM_002922chr12443 229 ------
NM_002923chr11609 ------
NM_002924chr11196 ------
NM_002930chr182174 73 --1264 --
NM_002931chr62219 207 ------
NM_002938chr481984 1649 1295 702 531 395 127 69 ------
NM_002940chr421659 408 ------
NM_002941chr31454 ----1353
NM_002948chr311102 161 1466 --
NM_002953chr12289 124 ------
NM_002955chr621631 1277 --11500 --
NM_002956chr121154 ------
NM_002957chr9103573 2667 1138 746 673 586 424 136 99 47 1143 ----
NM_002958chr31657 --1358 --
NM_002959chr194168 3613 3091 3046 1021 974 647 257 123 11011 ----
NM_002968chr161756 ------
NM_002971chr3--1850 1196 --
NM_002973chr12----152 1494
NM_002977chr282855 2722 2501 1304 928 878 420 304 --12189 --
NM_002985chr174719 677 50 40 ------
NM_002997chr261826 1304 771 191 176 54 --21291 337 --
NM_002998chr842168 2114 1861 1399 --11624 --
NM_003001chr131870 1835 583 1246 21855 420 --
NM_003002chr114289 233 53 47 ------
NM_003010chr1762437 2023 1883 1800 1711 806 --32329 2288 464 --
NM_003011chr941430 1365 1358 246 1465 ----
NM_003013chr41134 ------
NM_003016chr17----11409 --
NM_003020chr151170 ------
NM_003026chr931262 419 254 175 160 11320
NM_003028chr953829 3396 2794 1547 372 --43584 1422 1356 1288 --
NM_003030chr32455 72 ------
NM_003031chr162765 72 ------
NM_003032chr3102571 2550 2179 2144 2120 2051 1930 1681 1081 313 22442 2173 22030 1844 --
NM_003034chr12116830 6076 6039 5593 5583 5541 5314 5119 2377 548 418 17482 ----
NM_003036chr121214 261 ------
NM_003038chr252638 798 281 84 24 12500 22671 426 --
NM_003042chr351600 865 768 754 370 ------
NM_003043chr363995 3619 3496 3289 1254 1055 --11694 --
NM_003045chr13134940 4934 4871 3635 3070 1511 1330 1036 706 640 594 304 211 14571 13318 --
NM_003046chr8105354 5047 4652 4203 4069 3965 3815 3651 1266 658 ------
NM_003047chr1101438 1427 1115 908 589 480 428 314 227 201 11015 ----
NM_003054chr10----180 --
NM_003063chr113327 75 48 ------
NM_003069chrX2215 181 ------
NM_003074chr331673 1652 533 --1672 --
NM_003076chr1251599 1319 1048 78 59 ------
NM_003081chr2041152 886 454 380 ------
NM_003082chr144961 478 308 85 ------
NM_003088chr741036 918 394 111 ------
NM_003091chr201204 ------
NM_003098chr202488 197 --173 --
NM_003099chr15176155 6090 5685 5594 5071 4927 2576 1870 1574 1220 948 772 526 212 139 54 39 195 25895 1008 --
NM_003107chr622413 2019 --12582 --
NM_003108chr286047 5659 5106 2798 2739 2587 1869 1504 15752 11517 --
NM_003110chr1761117 708 373 188 127 87 --11007 --
NM_003112chr712639 ------
NM_003113chr22208 49 ------
NM_003114chr83779 599 172 ----2657 577
NM_003127chr92215 33 1106 ----
NM_003130chr731280 1207 70 --1923 --
NM_003131chr671865 1717 686 589 515 172 59 --11585 --
NM_003133chr14873 842 798 229 ------
NM_003137chr652136 2128 848 608 397 --1545 --
NM_003139chr113929 205 93 1266 ----
NM_003142chr2----1241 --
NM_003144chr641857 878 525 399 ------
NM_003146chr112287 31 ------
NM_003149chr371660 493 403 310 196 88 55 1666 11620 --
NM_003155chr841993 1923 667 221 1787 12028 --
NM_003156chr115357 316 209 200 54 --11320 --
NM_003161chr1753550 3512 1409 805 749 21136 1073 --1388
NM_003162chr221088 752 ------
NM_003164chr116565 480 161 139 123 70 ------
NM_003165chr961812 1677 1270 688 193 50 ------
NM_003170chr176577 563 543 536 524 55 --163 --
NM_003173chrX101435 1316 1189 1087 398 358 352 105 89 65 11154 ----
NM_003174chr10----3590 283 146 --
NM_003178chr352127 2022 1496 1440 160 ------
NM_003179chrX3430 165 115 ------
NM_003184chr81398 ------
NM_003185chr2021228 297 ------
NM_003186chr112316 72 ------
NM_003188chr6------1123
NM_003189chr1102579 2573 2530 2392 2229 690 669 465 385 330 --1303 --
NM_003198chr12313 223 ------
NM_003199chr1835130 846 527 --11378 14825
NM_003200chr1942073 2012 583 306 --21881 1629 --
NM_003202chr5111389 1161 596 512 490 463 418 392 364 122 52 11367 --175
NM_003204chr1731577 1493 1358 ------
NM_003211chr1221395 405 125 ----
NM_003214chr631004 967 58 11040 ----
NM_003216chr22103287 2719 2361 2061 1318 1129 733 684 362 51 12513 132 --
NM_003220chr681659 1402 1106 184 172 142 121 109 --11679 --
NM_003221chr663739 3508 3183 2998 2750 1317 ------
NM_003223chr162641 606 ------
NM_003234chr32980 814 11907 1270 --
NM_003236chr282998 2815 2597 2463 1363 993 176 76 1439 12903 --
NM_003239chr142703 53 --146 --
NM_003243chr131200 320 58 1501 11186 --
NM_003244chr18143 ----1378
NM_003246chr1541766 747 303 157 --21831 754 --
NM_003247chr631746 1493 799 ------
NM_003248chr5----126 --
NM_003253chr2111504 ------
NM_003255chr1742474 869 822 295 ------
NM_003257chr15------1281
NM_003263chr4146 ------
NM_003269chr62296 240 ------
NM_003284chr2175 ------
NM_003292chr132190 1794 1784 --11405 1454
NM_003295chr13155 ------
NM_003298chr3125669 4649 4267 2181 2118 1940 1627 1360 1146 848 462 118 12350 ----
NM_003300chr14165 ------
NM_003304chr32325 252 11090 ----
NM_003305chr42421 297 ------
NM_003314chr53429 362 48 ------
NM_003317chr142161 37 ------
NM_003319chr22904 640 ------
NM_003320chr1194283 3669 3266 1265 1023 937 733 165 50 177 13082 --
NM_003324chr1211393 --21301 566 --
NM_003325chr22----1189 --
NM_003330chr1251488 1440 1267 542 296 --1724 --
NM_003334chrX----1151 --
NM_003338chr101697 ------
NM_003339chr5----31622 205 85 --
NM_003340chr41337 11178 1199 --
NM_003341chr3--154 ----
NM_003342chr1753117 2698 2103 989 865 ------
NM_003345chr163449 173 138 ------
NM_003347chr2262339 2209 1920 1884 1736 457 --1237 --
NM_003348chr122255 179 11088 ----
NM_003349chr2041231 487 375 234 --21603 1085 --
NM_003350chr81223 ------
NM_003352chr21671 ------
NM_003368chr1------1751
NM_003369chr1162484 2147 1845 569 521 291 143 ----
NM_003370chr19268 59 ------
NM_003371chr981599 799 787 717 449 172 120 66 ------
NM_003373chr1091945 1637 1481 1404 751 693 660 482 75 ------
NM_003380chr101300 --1260 --
NM_003383chr91481 ------
NM_003387chr241122 229 79 40 ----1325
NM_003390chr111200 1273 ----
NM_003392chr334223 1716 1145 23594 1527 ----
NM_003399chrX21060 328 1835 --1110
NM_003403chr142757 725 ------
NM_003404chr2031831 1358 507 11885 --11916
NM_003405chr223800 544 138 ------
NM_003406chr851721 1591 1500 1429 25 --1314 1341
NM_003407chr191559 ------
NM_003410chrX42385 2361 2015 725 ------
NM_003411chrY41235 1147 723 425 --1685 --
NM_003412chr331111 1058 818 ----12898
NM_003413chrX21220 575 11285 1727 --
NM_003427chr62620 567 ----1145
NM_003432chr52175 70 ------
NM_003439chr733252 2788 156 1431 1799 --
NM_003457chr17----1624 --
NM_003458chr3133700 3579 3553 3369 3046 2666 2625 2594 1568 971 756 441 203 --23236 660 11259
NM_003459chr2267 28 1455 ----
NM_003462chr151685 1239 1109 368 289 --21759 317 1567
NM_003463chr643378 3300 801 490 --11165 --
NM_003468chr284131 3701 3582 3550 3317 3196 3158 3051 11726 33483 3403 220 1509
NM_003469chr21151 --1370 --
NM_003470chr1671665 1556 712 553 350 259 173 --21175 601 --
NM_003471chr331761 903 822 11791 1920 --
NM_003472chr61127 --21243 959 --
NM_003474chr1071824 1609 1463 858 803 323 138 1172 1893 --
NM_003478chr1143067 2947 656 124 ----13311
NM_003482chr1292377 2094 1992 768 742 552 520 468 113 1627 ----
NM_003483chr1252202 1905 692 237 88 12835 12895 --
NM_003485chr1441315 342 277 78 ------
NM_003486chr16102750 2426 2197 2159 1898 1093 527 468 104 21 --22489 1996 --
NM_003487chr175278 237 71 64 52 ------
NM_003498chr1661002 765 719 593 199 84 ------
NM_003513chr6124 ------
NM_003528chr121506 47 1264 11734 --
NM_003557chr181581 1396 1383 1314 1145 1103 1027 283 ----11351
NM_003558chr93504 274 260 ------
NM_003559chr17113903 3719 3197 3188 3121 2562 1374 1125 856 815 652 1229 ----
NM_003563chr1741385 1134 313 59 ------
NM_003565chr12101659 1429 1281 1202 1162 1156 620 522 336 256 1365 ----
NM_003566chr1243003 2674 751 495 ------
NM_003569chr62206 22 ----1627
NM_003574chr1854685 3881 1652 1487 137 --25129 1674 --
NM_003576chr13112818 2720 2639 2532 2483 2439 2425 1159 886 805 373 --1566 --
NM_003583chr12103622 3501 2924 2468 2438 1474 788 592 444 304 13635 ----
NM_003586chr166537 490 455 195 144 94 ------
NM_003590chr223268 765 12953 ----
NM_003591chr102420 39 ------
NM_003592chr71166 ------
NM_003595chr222117 31 --1323 --
NM_003597chr222041 885 --22160 83 --
NM_003603chr421943 541 1485 ----
NM_003607chr152754 1700 1693 1559 741 --14175 --
NM_003612chr15194 --1423 --
NM_003615chr333953 1202 821 ------
NM_003618chr21100 ------
NM_003620chr17--1695 ----
NM_003622chr1232636 912 471 --12680 --
NM_003624chr1931354 404 36 --2910 174 --
NM_003626chr1131404 1239 1220 ------
NM_003628chr21700 ------
NM_003629chr173151 3140 3133 3118 2269 1334 820 --32808 2577 92 --
NM_003632chr173778 593 55 --1351 1196
NM_003633chr532403 1011 716 --11637 --
NM_003635chr10138 ------
NM_003637chr14619 487 422 230 1321 ----
NM_003644chr17115519 4478 4390 4229 1080 1052 940 747 595 412 318 26395 5224 14983 --
NM_003654chr114615 542 521 75 ------
NM_003663chr362948 2342 987 391 307 301 --12495 --
NM_003664chr54523 223 140 63 ------
NM_003670chr331203 483 24 ------
NM_003671chr973105 1359 1248 1027 1008 772 548 --12225 --
NM_003672chr121968 107 11207 11221 --
NM_003673chr17192 ------
NM_003677chr1272072 544 471 356 331 317 277 ------
NM_003681chr21186122 6103 5418 5124 4902 4734 4475 4049 3888 1897 1866 1238 1030 881 477 405 352 79 --35449 5063 2421 --
NM_003685chr193784 390 103 ------
NM_003693chr172602 221 ------
NM_003701chr131849 --11047 --
NM_003704chr42623 125 --1461 --
NM_003709chr2--1305 195 --
NM_003711chr5156 ------
NM_003713chr12420 41 21534 176 ----
NM_003714chr542118 1193 662 419 12545 42447 920 704 642 --
NM_003716chr33985 638 129 --1699 --
NM_003718chr72486 469 ------
NM_003726chr172264 35 ------
NM_003728chr41154 ------
NM_003732chr5156 ----1297
NM_003735chr531440 1315 235 ------
NM_003736chr531440 1315 235 ------
NM_003743chr272256 2210 1845 1525 792 559 426 ------
NM_003744chr1451335 508 476 394 200 ------
NM_003745chr16165 ------
NM_003749chr1362310 2151 1599 583 182 90 ------
NM_003750chr10----1722 --
NM_003758chr1521120 185 ----2653 505
NM_003758chr1521120 185 ----2653 505
NM_003760chr11545 ------
NM_003766chr17127 ------
NM_003768chr181831 1809 1630 1565 1531 1495 1481 1152 ------
NM_003769chr122260 50 ------
NM_003773chr3--122 ----
NM_003779chr11146 1424 ----
NM_003780chr14631 554 267 184 --138 --
NM_003787chr1821320 614 1675 ----
NM_003794chr32763 436 ------
NM_003796chr192241 218 --1172 --
NM_003797chr11----2190 168 --
NM_003799chr18104412 3343 2917 1826 1308 256 211 158 122 88 --1957 --
NM_003800chr631841 1805 819 ------
NM_003818chr201895 11039 1108 --
NM_003822chr173033 2757 2543 2423 2271 98 25 --12893 --
NM_003825chr153313 188 179 --11551 --
NM_003831chr1831792 1464 50 ------
NM_003846chr1--1624 ----
NM_003860chr111334 ------
NM_003870chr1542095 2066 1980 749 --21663 1433 --
NM_003872chr282792 2717 2695 1992 863 660 630 592 ------
NM_003873chr1061689 943 801 689 583 479 ------
NM_003877chr123977 951 302 ------
NM_003884chr3--1663 1589 --
NM_003885chr1782454 1735 1720 1627 855 460 350 308 ------
NM_003888chr1561620 1463 1260 1132 370 53 ------
NM_003901chr1092681 2614 2265 1677 926 883 823 795 595 --12572 --
NM_003902chr11703 ------
NM_003907chr31335 1227 ----
NM_003908chr2081320 1302 1292 1054 974 958 449 106 --1527 1182
NM_003909chr852788 2121 2070 1199 687 1514 --1943
NM_003913chr642670 1074 477 218 --33562 3087 970 --
NM_003914chr13----1196 --
NM_003916chrX11507 --11212 1969
NM_003924chr441529 361 247 107 --11374 --
NM_003927chr182728 86 ------
NM_003930chr742529 1999 823 30 --12236 --
NM_003931chr61528 1593 ----
NM_003932chr2231815 1354 369 ------
NM_003934chr91492 ------
NM_003936chr281061 995 831 488 432 367 336 254 --11181 --
NM_003939chr1083600 3336 2847 1633 1389 695 626 108 11428 34048 1488 212 --
NM_003941chr732213 122 61 --1621 --
NM_003942chr115528 509 288 105 76 --2673 254 --
NM_003947chr321335 349 --21264 1025 --
NM_003948chr422571 970 11741 21704 123 --
NM_003949chr1761865 1680 1472 641 458 289 ------
NM_003951chrX1282 ------
NM_003953chr152484 1935 1853 830 333 12664 12196 --
NM_003954chr1771393 1202 1050 1003 515 66 31 ------
NM_003956chr10138 ------
NM_003957chr115846 437 401 243 83 ------
NM_003958chr6133828 3818 3408 3141 2710 2538 1237 674 384 249 180 156 33 22684 1145 23177 225 --
NM_003966chr5167722 7669 7587 5771 5555 5284 2700 2535 1844 1224 1162 807 554 488 144 65 37312 4755 1880 26549 6518 --
NM_003980chr611264 ------
NM_003983chr16114039 4030 3589 3440 3359 3187 1749 1510 1338 1068 384 13055 ----
NM_003988chr10111816 1762 1733 1727 1449 892 823 658 612 340 56 2839 64 ----
NM_003992chr151274 ------
NM_003994chr1263927 3769 1535 1467 661 100 ------
NM_004006chrX3827 640 625 --12655 --
NM_004007chrX3827 640 625 --12655 --
NM_004009chrX3827 640 625 --12655 --
NM_004010chrX3827 640 625 --12655 --
NM_004011chrX3827 640 625 --12655 --
NM_004012chrX3827 640 625 --12655 --
NM_004013chrX3827 640 625 --12655 --
NM_004014chrX3827 640 625 --12655 --
NM_004015chrX3827 640 625 --12655 --
NM_004016chrX3741 554 539 --12569 --
NM_004017chrX3827 640 625 --12655 --
NM_004018chrX3741 554 539 --12569 --
NM_004020chrX3827 640 625 --12655 --
NM_004021chrX3741 554 539 --12569 --
NM_004022chrX3741 554 539 --12569 --
NM_004023chrX3741 554 539 --12569 --
NM_004024chr12570 444 ----11429
NM_004028chr1893589 3466 3332 2604 1518 1332 538 312 44 12933 12691 11391
NM_004034chr10--1478 1163 --
NM_004035chr17104754 4615 4415 4390 3409 3308 2051 542 526 29 14464 14947 --
NM_004037chr16684 601 276 138 112 106 ------
NM_004050chr1482425 1887 1798 857 786 680 506 457 --11766 --
NM_004055chr1181441 1396 696 634 346 300 254 245 ------
NM_004067chr731482 989 627 11590 ----
NM_004068chr33400 108 101 ------
NM_004071chr21112 ------
NM_004075chr121576 ------
NM_004077chr1241320 1247 1061 202 --11074 --
NM_004081chrY----21850 31 --
NM_004085chrX1643 --1299 --
NM_004086chr144812 618 204 162 --1552 1733
NM_004090chr1743306 3015 477 68 --32679 2493 926 --
NM_004093chr1383181 2640 1101 772 766 693 401 246 --1498 12781
NM_004096chr1061606 798 672 544 448 194 --1376 --
NM_004099chr961976 1944 1340 704 550 336 11527 ----
NM_004102chr15514 444 434 249 241 --168 --
NM_004103chr87265 254 248 168 62 42 23 ------
NM_004104chr175713 687 605 208 125 ------
NM_004105chr2----21053 419 --
NM_004107chr192147 21 ------
NM_004112chr1751732 544 386 92 65 11478 ----
NM_004114chrX1247 ----1408
NM_004115chr131127 ------
NM_004116chr2182 --2306 118 --
NM_004117chr642144 1926 888 169 ------
NM_004123chr17154 ------
NM_004124chr1452824 2678 965 840 349 --22899 2168 --
NM_004132chr1071132 1064 1027 959 465 198 139 --1300 --
NM_004133chr832446 2392 246 --11961 --
NM_004156chr83232 120 22 ------
NM_004157chr33925 593 113 ------
NM_004161chr2----171 --
NM_004162chr321246 37 --1295 --
NM_004170chr931848 1800 1350 ----169
NM_004171chr11139161 8956 6823 6481 6360 6338 3479 2480 2052 1001 840 649 530 --16137 --
NM_004176chr172478 32 ------
NM_004181chr41284 ------
NM_004183chr111304 --2626 555 --
NM_004186chr34902 589 368 157 1224 ----
NM_004187chrX21256 80 11306 --11231
NM_004188chr95614 479 442 199 176 ------
NM_004197chr64393 374 293 155 ------
NM_004200chr1153268 1069 1045 758 229 --11194 --
NM_004202chrY3186 170 125 ------
NM_004210chr10102123 1954 1879 1617 1541 799 631 545 483 239 ------
NM_004215chr8----1101 --
NM_004225chr821466 1285 1935 11325 --
NM_004227chr762662 2642 1973 991 925 358 ------
NM_004229chrX32119 1547 1523 ------
NM_004232chr1873884 1429 1247 754 660 96 77 12908 13271 --
NM_004235chr93753 544 31 --169 --
NM_004236chr152558 86 ------
NM_004238chr2127 ------
NM_004240chr19143 ------
NM_004253chr92954 167 ------
NM_004272chr53490 446 377 21326 1317 145 --
NM_004274chr1463055 2950 782 325 252 122 42926 2820 2671 395 13136 --
NM_004276chr123121 68 27 ------
NM_004277chr621407 642 21077 332 ----
NM_004281chr101105 ------
NM_004283chr194269 166 118 38 ------
NM_004286chr22122439 2428 2107 1930 848 830 566 421 405 298 216 131 12475 12673 --
NM_004293chr92941 621 --13456 --
NM_004301chr3----1313 1341
NM_004302chr1272169 1102 655 511 500 375 54 ------
NM_004304chr23381 342 318 ------
NM_004311chr1062510 2250 1905 1195 688 71 ------
NM_004316chr1221072 1031 --11095 --
NM_004319chr172848 2297 2166 2051 1204 1124 26 ------
NM_004323chr9122552 2322 2290 2236 2043 1776 1053 896 322 219 203 27 12143 11982 --
NM_004326chr15831 779 299 128 62 ------
NM_004327chr2282386 2217 1973 1903 1733 1680 1556 426 12107 ----
NM_004329chr1031303 561 401 --1323 1482
NM_004330chr154946 914 398 165 ------
NM_004331chr852248 1926 1787 1755 724 ------
NM_004337chr841639 1589 215 195 ------
NM_004338chr18117038 6922 4962 4647 4615 4572 4422 2523 1950 1845 967 --22689 1134 --
NM_004342chr712019 --2335 200 --
NM_004349chr821235 890 ------
NM_004359chr193497 423 183 ------
NM_004360chr1621540 462 ------
NM_004364chr1921222 374 ----1866
NM_004370chr632126 1556 564 129 22162 1947 --
NM_004377chr223466 383 23 ------
NM_004379chr251272 1193 459 244 188 --2366 120 --
NM_004380chr1632175 2169 1697 ------
NM_004384chr541774 926 584 52 --12290 --
NM_004385chr53505 459 259 ------
NM_004391chr3122027 2021 1757 1672 1642 1600 1414 820 607 581 295 138 ------
NM_004392chr13----12681 --
NM_004393chr382129 1797 1746 1533 1465 916 375 92 1223 ----
NM_004395chr51544 ------
NM_004397chr1143034 1660 1243 241 --23459 1252 --
NM_004404chr241967 1899 1858 1409 1471 ----
NM_004405chr23308 282 92 ------
NM_004408chr9145 ------
NM_004411chr72261 221 ------
NM_004414chr211317 --1260 --
NM_004416chr124986 714 140 31 ------
NM_004418chr22479 22 ------
NM_004420chr1182353 1937 1923 1739 864 590 332 313 --42237 2127 2017 202 --
NM_004421chr14812 643 79 27 1830 ----
NM_004423chr3132572 2155 2059 1973 1855 1811 893 634 594 535 529 198 136 ------
NM_004426chr1251399 775 399 295 48 ------
NM_004427chr151242 1095 948 902 402 11027 ----
NM_004428chr13514 267 69 1654 ----
NM_004429chrX31287 1194 1125 --21273 348 --
NM_004430chr841098 871 760 460 ------
NM_004432chr932077 1807 879 --2326 252 --
NM_004436chr12574 86 ------
NM_004437chr141411 1064 968 648 ------
NM_004438chr292801 2237 2212 1178 930 540 412 318 189 11278 21088 291 --
NM_004439chr41127 ------
NM_004440chr6----11599 --
NM_004441chr3--11309 ----
NM_004442chr121192 591 11069 ----
NM_004447chr1231171 1150 384 1440 ----
NM_004451chr111221 143 1582 --
NM_004454chr341988 1641 1479 137 --11605 --
NM_004456chr7139 --1167 --
NM_004457chr221669 183 --11281 --
NM_004458chrX42278 1919 1699 682 12427 1769 --
NM_004459chr172691 430 ------
NM_004469chrX2448 50 ------
NM_004472chr51153 ------
NM_004475chr1791177 1011 856 456 266 212 168 159 151 --11186 --
NM_004480chr141302 ------
NM_004481chr172577 1902 1803 1036 795 193 30 ------
NM_004486chr92989 163 1123 ----
NM_004491chr19123885 3700 3441 3059 2981 2965 1590 1353 993 440 327 173 --23355 1675 --
NM_004494chr12320 47 1533 ----
NM_004496chr1441064 854 838 532 ------
NM_004499chr5----1102 --
NM_004501chr163519 2611 2580 1469 1456 468 24093 2805 12820 13911
NM_004502chr173523 423 385 ------
NM_004504chr22781 562 ------
NM_004505chr1732010 1364 191 ------
NM_004514chr1752637 2316 774 656 596 11054 ----
NM_004516chr192903 188 ------
NM_004517chr11188 ------
NM_004524chr17----1262 --
NM_004525chr211154 1122 ----
NM_004527chr1761382 1247 1233 1153 313 140 --1293 --
NM_004530chr165478 471 308 297 288 --2379 40 --
NM_004537chr1221379 52 ------
NM_004538chrX1334 --1534 --
NM_004543chr2--199 ----
NM_004549chr1161558 1433 1300 426 335 273 1577 ----
NM_004554chr14101783 1744 1610 1482 1336 1214 1157 339 189 129 --1141 --
NM_004566chr1042055 1027 644 214 12189 --12032
NM_004569chr141567 1211 ----
NM_004571chr2163211 2798 2367 2245 431 315 --22545 2108 --
NM_004573chr156816 712 596 584 550 119 ------
NM_004575chr421625 66 --11317 --
NM_004576chr51277 ------
NM_004578chr11628 --1901 --
NM_004583chr173596 273 23 ------
NM_004586chrX85255 4904 4240 3402 2141 1759 148 102 21395 1289 32151 1238 496 --
NM_004588chr11114001 3986 3239 3185 2967 2508 2458 1453 1040 831 70 --13340 --
NM_004593chr32863 259 ------
NM_004598chr543328 1033 1004 503 22223 926 1146 --
NM_004602chr2031392 265 245 --31269 556 64 --
NM_004603chr771154 1096 1086 448 308 78 62 ------
NM_004607chr5176 ------
NM_004612chr974619 4517 4100 3262 2966 1275 1050 34600 4470 1043 --11382
NM_004615chrX1673 1913 ----
NM_004626chr112142 97 ------
NM_004630chr112918 278 ------
NM_004631chr11276 --11446 --
NM_004634chr32657 64 ------
NM_004637chr341184 955 253 120 ----1881
NM_004639chr6195 ------
NM_004640chr6180 ------
NM_004642chr122287 211 1464 ----
NM_004643chr144732 279 183 167 1228 ----
NM_004650chrX2743 516 --11310 --
NM_004654chrY199 11179 1371 --
NM_004655chr173420 281 263 --156 --
NM_004658chr12183 ------
NM_004663chr151450 ------
NM_004670chr1021646 1158 21120 1075 11547 --
NM_004671chr18----144 --
NM_004673chr121195 1056 ----11180
NM_004687chr1751924 1845 1792 1464 312 11896 1535 --
NM_004690chr62767 740 ------
NM_004698chr1235 21 ------
NM_004703chr1742582 2004 1031 286 ------
NM_004705chr111729 195 1755 --
NM_004709chrX21390 1228 ------
NM_004711chr22173300 3185 3033 3027 2991 2753 2424 2317 2266 1389 1132 997 990 716 633 108 80 --13390 1173
NM_004713chr141757 --1118 1185
NM_004716chr117764 709 683 603 559 196 163 1301 ----
NM_004717chr741549 1249 341 105 ------
NM_004718chr22520 481 ------
NM_004719chr1232796 2749 636 12845 --1543
NM_004723chr11818 ------
NM_004725chr1021333 429 --1439 --
NM_004726chrX75520 5314 4585 3795 1689 1336 766 --65675 4309 3815 1780 1223 775 --
NM_004730chr531461 362 92 11542 11639 --
NM_004733chr32609 183 ------
NM_004734chr1352271 1053 983 840 707 --22301 2153 --
NM_004737chr2221086 140 ------
NM_004738chr2072512 1830 931 893 836 463 120 ------
NM_004742chr351832 1613 1563 1253 92 11780 11842 --
NM_004745chr8105054 4993 4901 4271 2501 1671 1156 546 197 84 12330 15126 --
NM_004746chr183249 121 72 ------
NM_004747chr101478 --1585 --
NM_004748chr1543768 1500 828 731 --23085 985 --
NM_004755chr143368 295 113 ------
NM_004760chr722171 706 1582 1543 --
NM_004768chr12367 252 ------
NM_004772chr531502 530 327 --31624 1262 354 --
NM_004774chr1742642 2495 2296 2157 12381 12286 --
NM_004775chr1832170 1712 518 12335 ----
NM_004776chr2052760 2401 1049 978 297 1986 --12686
NM_004781chr131106 296 25 ----1410
NM_004781chr131106 296 25 ----1410
NM_004788chr1152720 2606 1839 389 144 11678 ----
NM_004789chr91302 ------
NM_004792chr21189 ------
NM_004794chrX187 ------
NM_004796chr1432201 686 96 11869 22378 1638 --
NM_004798chr20143415 3206 3113 3104 3030 1468 1103 924 918 686 638 596 300 41 ------
NM_004800chr13----176 --
NM_004801chr241475 452 439 252 ------
NM_004807chr2112451 2269 988 940 897 802 742 638 496 454 81 ------
NM_004808chr10113337 3261 3212 2413 2327 2185 1360 1237 883 267 68 --13387 12404
NM_004817chr9132 ----1633
NM_004821chr52598 291 ------
NM_004824chr631329 1071 275 ------
NM_004826chr22110 32 ------
NM_004831chr193940 895 89 ------
NM_004834chr232222 1108 345 2963 718 1847 --
NM_004835chr33827 572 309 ------
NM_004835chr33827 572 309 ------
NM_004836chr2--1277 ----
NM_004839chr152570 553 ------
NM_004840chrX72342 1771 1655 628 574 408 379 1833 1346 --
NM_004842chr641444 1241 339 46 --11552 1126
NM_004844chr31114 --1980 --
NM_004845chrX84028 3374 3074 805 795 410 313 67 13415 ----
NM_004857chr1464086 3650 3262 1880 1590 1031 ------
NM_004859chr1793026 2738 2650 2472 1910 1153 562 472 275 12539 11951 --
NM_004861chr222263 25 ------
NM_004862chr1671607 494 392 343 291 249 186 --11080 --
NM_004863chr14104978 4934 4127 4080 4024 3803 1998 576 376 306 11197 41327 941 177 115 --
NM_004866chr533948 3936 1091 13478 --1649
NM_004871chr17124100 2716 1511 1313 1129 1054 1002 730 553 540 509 398 11726 3606 384 87 --
NM_004872chr11322 ------
NM_004874chr8----1426 --
NM_004879chr112818 341 ------
NM_004884chr1551192 394 253 247 74 --1128 --
NM_004887chr541071 1044 776 264 ------
NM_004897chr101117 ------
NM_004898chr462734 2722 2671 1961 395 275 22631 160 22290 922 --
NM_004899chr21306 --1116 --
NM_004902chr202222 104 ------
NM_004904chr7116050 6028 5539 5206 4750 4651 4442 1534 1367 1290 322 11035 16063 --
NM_004905chr13367 182 46 ------
NM_004906chr63445 91 55 ------
NM_004912chr71198 11408 ----
NM_004925chr93195 58 32 ------
NM_004926chr1431190 711 656 128 ----
NM_004929chr831514 1489 418 --1569 11303
NM_004939chr2----174 --
NM_004947chr352605 1816 1015 640 148 ------
NM_004948chr1831428 1087 444 ------
NM_004949chr1832017 1666 460 ------
NM_004953chr33389 334 165 ------
NM_004955chr62116 41 --2537 25 --
NM_004956chr773837 3152 3106 1118 1060 873 428 ------
NM_004958chr11788 ------
NM_004959chr971387 1365 1358 1258 234 227 142 ------
NM_004961chrX41387 1245 962 162 1460 1397 --
NM_004963chr122136 130 ------
NM_004965chr21136 --1260 --
NM_004968chr71514 1256 1629 --
NM_004973chr641462 268 216 90 21626 1281 1700 --
NM_004976chr11124741 3979 3970 3666 3330 2020 1987 1582 758 549 509 285 --152 --
NM_004977chr194556 512 476 204 ------
NM_004978chr161676 1659 1409 1161 1102 1071 --21178 188 --
NM_004979chrX11134 ------
NM_004981chr222324 27 ------
NM_004982chr122468 61 ----1514
NM_004985chr124931 865 561 258 --14166 --
NM_004992chrX188545 8465 8181 8125 6058 5655 5371 3194 3187 3028 2811 2189 2179 1455 1385 1364 1237 637 --26826 1896 12282
NM_004992chrX188545 8465 8181 8125 6058 5655 5371 3194 3187 3028 2811 2189 2179 1455 1385 1364 1237 637 --26826 1896 12282
NM_004993chr1431459 1050 372 ------
NM_004995chr1451494 1290 1083 550 44 ------
NM_004996chr1621571 174 --1387 --
NM_004998chr152888 334 --1915 --
NM_004999chr674422 3938 3733 3545 3130 2978 910 --21368 1237 --
NM_005010chr721951 1917 11784 ----
NM_005011chr761856 1359 1308 1239 571 224 --11866 --
NM_005020chr73424 410 32 ------
NM_005026chr151780 1606 1536 390 123 --1352 --
NM_005028chr1031839 1785 836 --11675 1819
NM_005030chr161263 ------
NM_005036chr22178339 8009 7591 6197 5732 5652 5339 5085 2890 2050 1673 1148 1038 864 699 549 359 15787 ----
NM_005044chrX64472 4337 4256 3352 2947 47 34538 3057 1546 13008 --
NM_005045chr71783 ------
NM_005056chr12135160 5097 4899 3949 3748 3690 3632 3574 3516 2094 1700 1211 1001 --32065 1921 27 --
NM_005057chr131819 1538 378 ------
NM_005060chr15994 531 525 236 23 ------
NM_005063chr1053711 3124 2641 1207 170 1630 21505 276 --
NM_005065chr1475089 4787 4228 2157 1849 1000 465 1144 24373 1509 11171
NM_005067chr32378 330 ----1765
NM_005070chr21250 ------
NM_005076chr1154005 3757 3706 3635 3615 3497 3068 1417 1082 999 929 765 562 268 73 --11143 --
NM_005077chr9--1187 ----
NM_005079chr873205 3019 1100 819 310 78 31 12732 22873 2760 11194
NM_005080chr224765 305 216 200 1236 ----
NM_005094chr95720 596 446 144 126 --1160 --
NM_005095chr141587 834 619 548 ------
NM_005096chrX51254 1133 411 139 113 --1810 11003
NM_005097chr103328 122 22 ------
NM_005099chr151163 883 511 238 79 ------
NM_005105chr152115 1977 1664 381 374 1727 11800 --
NM_005109chr372185 979 972 373 313 244 84 ------
NM_005112chr43770 651 398 ------
NM_005113chr141394 ----172
NM_005117chr114686 289 226 30 --1278 --
NM_005119chr141203 1183 1090 163 ------
NM_005121chr1743736 2702 2509 1343 --1527 --
NM_005124chr62166 50 2806 103 ----
NM_005126chr322023 488 --11584 --
NM_005134chr182270 30 1142 ----
NM_005135chr1593455 3397 3347 3261 3146 2617 2591 1186 529 33105 2857 1469 13033 --
NM_005137chr22112200 2185 1589 878 864 835 827 496 422 111 41 --21620 237 --
NM_005151chr1852202 904 430 321 201 --12333 --
NM_005153chr162741 636 ----1562
NM_005156chr984791 4242 3909 3829 3735 3517 3342 90 ------
NM_005161chr1192166 2124 1742 1607 1548 427 410 339 113 1490 22222 150 --
NM_005171chr1221214 1025 ------
NM_005174chr10144 ------
NM_005180chr1011546 ------
NM_005183chrX123 ------
NM_005187chr1661491 368 350 211 158 149 --21663 1287 --
NM_005188chr11147885 6920 6185 5709 5581 5349 2863 2511 2236 1680 1302 960 606 382 16009 56633 6578 6077 2681 2183 --
NM_005189chr17102390 2260 2173 842 826 687 441 395 351 260 147 3564 300 203 --
NM_005194chr201394 ------
NM_005197chr14106113 5933 5651 4426 4210 4116 2351 1744 1147 912 34914 2165 992 25373 1679 --
NM_005201chr32897 307 1902 ----
NM_005202chr151491 732 719 632 23 ------
NM_005204chr102995 62 ------
NM_005206chr174898 405 278 191 ----1476
NM_005207chr22153450 3404 3214 3044 2820 2715 2559 1380 684 407 304 164 102 40 27 12429 ----
NM_005214chr2----21064 901 --
NM_005219chr591755 1508 726 332 283 271 174 125 48 ------
NM_005220chr1731461 1090 395 1206 11070 --
NM_005222chr72243 63 ------
NM_005225chr2051021 960 950 823 126 ------
NM_005229chrX41090 814 801 445 ------
NM_005230chr12----1565 --
NM_005233chr31881 ------
NM_005235chr297821 7156 6713 6649 6297 6289 5504 5255 5136 1290 17767 --
NM_005238chr1111371 13007 13198 --
NM_005241chr3179 ------
NM_005245chr43488 235 175 ------
NM_005249chr141605 --2646 255 --
NM_005257chr182283 62 --1879 --
NM_005259chr211254 ------
NM_005263chr151107 866 173 82 60 ------
NM_005266chr141531 1288 1260 93 --1103 11778
NM_005276chr1291656 1573 1550 1316 668 648 372 294 175 11708 ----
NM_005276chr1291656 1573 1550 1316 668 648 372 294 175 11708 ----
NM_005277chr41729 --11758 --
NM_005278chrX----1348 --
NM_005281chr11773 1383 ----
NM_005284chr61377 ----1343
NM_005295chr7175 ------
NM_005296chrX3429 221 207 ------
NM_005308chr10194 --1354 --
NM_005313chr1511347 --1328 --
NM_005316chr112978 349 --1328 --
NM_005318chr2221261 37 ------
NM_005324chr1711305 11855 --11558
NM_005328chr81107 ------
NM_005329chr1652312 2043 1802 1443 756 --2642 239 --
NM_005334chrX71522 1407 1222 697 690 255 46 ------
NM_005339chr454037 3848 3580 799 35 23058 109 13661 --
NM_005342chrX42130 1790 1739 599 --12609 --
NM_005346chr63248 104 88 ------
NM_005347chr931511 1396 127 --1153 --
NM_005359chr18156485 6421 6129 5251 4827 4224 2483 2366 2275 2190 2164 1636 961 136 99 --24068 1717 14397
NM_005370chr192913 324 --1171 --
NM_005374chr17112330 2134 2089 2046 1968 1825 680 355 325 216 172 1908 ----
NM_005375chr6----21157 1092 --
NM_005376chr12233 33 ------
NM_005378chr2129 --1588 --
NM_005384chr91186 ------
NM_005386chr201885 --1600 --
NM_005387chr111154 ------
NM_005392chr951273 122 109 88 66 --11234 --
NM_005393chrX1252 ------
NM_005398chr10--11135 ----
NM_005399chr1164291 3476 2812 1580 1521 1321 1167 1153 892 886 876 450 434 392 270 145 ------
NM_005400chr252254 2215 1104 590 255 ----1129
NM_005402chr74742 671 532 62 --1395 1222
NM_005406chr182571 276 1188 ----
NM_005407chr1421389 384 11312 ----
NM_005409chr44971 435 418 227 ------
NM_005410chr52673 637 ------
NM_005412chr121498 ------
NM_005414chr3--1270 ----
NM_005415chr2----1153 --
NM_005417chr20111850 1640 1319 1268 560 532 508 455 119 81 59 11701 --11818
NM_005424chr12258 98 154 ----
NM_005426chr1--1296 --1866
NM_005429chr41120 --168 --
NM_005430chr127878 664 375 346 277 269 180 ------
NM_005433chr1822456 793 22135 290 ----
NM_005436chr1083938 3879 3579 3564 2992 2671 1641 1516 13249 12804 --
NM_005437chr1041481 1211 1124 404 1124 11160 --
NM_005439chr121513 ------
NM_005442chr31101 178 1595 --
NM_005443chr42150 92 --1462 --
NM_005447chr12127 ------
NM_005455chr121620 455 ------
NM_005456chr113741 634 229 --182 --
NM_005458chr962389 2191 2158 2104 509 78 --1418 --
NM_005461chr2061482 1385 1234 507 394 387 11907 1597 --
NM_005465chr121952 28 --1248 --
NM_005475chr12103006 2878 2825 2021 1313 774 501 356 123 32 --22406 1174 1626
NM_005476chr91350 1311 ----
NM_005477chr1532072 430 375 11955 ----
NM_005477chr1532072 430 375 11955 ----
NM_005479chr1011508 1531 1611 --
NM_005483chr19199 ------
NM_005487chr2251894 1356 417 408 279 1830 ----
NM_005488chr227641 630 304 224 142 92 40 ------
NM_005493chr61305 ------
NM_005497chr1765399 4052 1696 1167 917 365 24900 893 15576 --
NM_005499chr191264 ------
NM_005502chr963094 2556 1991 1137 825 632 --1916 --
NM_005503chr152462 397 --1257 --
NM_005504chr1245870 5033 1976 1320 ----12097
NM_005506chr462768 2492 2089 2063 1109 94 ------
NM_005509chr531553 1197 695 ----1194
NM_005523chr731497 1209 481 ------
NM_005529chr12291 282 ------
NM_005537chr1351055 993 434 159 63 ------
NM_005539chr1051274 903 555 483 331 1197 21000 187 --
NM_005540chr171575 1067 508 416 377 351 34 ------
NM_005552chr142529 101 --148 --
NM_005558chr14844 380 116 68 ------
NM_005561chr133317 292 110 --1974 --
NM_005563chr11893 --1633 --
NM_005565chr52165 37 ------
NM_005566chr11------132
NM_005569chr2241231 392 230 47 --1211 --
NM_005576chr151266 ------
NM_005578chr384040 3764 2059 1329 1026 879 431 123 23981 1276 33150 1932 945 --
NM_005584chr131591 1322 ----
NM_005593chr12------1485
NM_005596chr9106371 6299 5896 5067 4909 2371 1982 1493 1404 391 22157 1864 14343 --
NM_005598chr141590 1554 1275 336 11350 --161
NM_005602chr33500 183 132 --11337 --
NM_005603chr182482 317 11376 ----
NM_005604chr642349 2248 2004 1952 ------
NM_005610chr12738 622 ------
NM_005611chr1621294 225 1236 1195 --
NM_005613chr142102 1973 695 124 --11620 --
NM_005614chr73833 824 58 ------
NM_005617chr5----139 --
NM_005618chr61108 --1204 --
NM_005619chr19--1257 ----
NM_005625chr811119 1742 1435 --
NM_005626chr1193 ------
NM_005627chr61325 ------
NM_005634chrX2110 97 ------
NM_005637chr1811729 11386 ----
NM_005638chrX1503 ------
NM_005639chr1261565 1544 1468 1447 688 194 ------
NM_005647chrX63124 2977 695 681 668 619 ------
NM_005648chr8190 ------
NM_005650chr2221034 545 ------
NM_005652chr1641195 1007 860 196 --11221 --
NM_005664chr15----286 56 --
NM_005665chr184651 4144 3873 1861 606 365 205 164 24779 440 11120 --
NM_005667chr22160 49 ------
NM_005668chr542858 768 324 316 ------
NM_005669chr532269 237 99 --32079 851 466 1167
NM_005678chr151665 ------
NM_005688chr351235 930 95 53 42 1962 1852 --
NM_005708chr132187 141 ------
NM_005715chr652134 1974 1789 694 617 --22599 1016 --
NM_005717chr171266 1035 868 531 114 80 26 ------
NM_005719chr12174 ------
NM_005720chr7121 --1258 --
NM_005722chr292276 1678 944 702 486 303 242 235 55 --1201 --
NM_005724chr151300 ------
NM_005725chr131831 1607 62 --11548 --
NM_005730chr12173495 3357 3278 3237 3148 3094 3024 2916 2336 2305 1296 1241 1114 966 679 615 406 12689 11442 --
NM_005734chr111753 --1279 --
NM_005736chr1061355 1237 1144 1000 492 432 --21587 88 --
NM_005737chr252883 2869 2049 1991 414 11929 2762 645 --
NM_005738chr731900 154 87 31914 1745 327 ----
NM_005742chr23862 631 284 ------
NM_005746chr73828 602 122 --2766 491 --
NM_005748chr1243377 2425 1251 1056 1370 ----
NM_005751chr71315 1380 ----
NM_005752chr1611013 1999 ----
NM_005754chr5------1111
NM_005756chrX51303 1225 1215 1070 975 ------
NM_005759chr293678 3408 3139 1835 1505 879 688 216 24 --23972 396 --
NM_005761chr12----1124 --
NM_005766chr1371359 1142 1115 999 133 94 34 ------
NM_005768chr123656 279 139 --1533 --
NM_005775chr86701 692 682 594 474 255 ------
NM_005776chr141321 ------
NM_005779chr583140 3131 2956 2634 2553 1418 623 396 --2521 376 11198
NM_005781chr34780 296 269 30 ------
NM_005786chr1821146 900 ------
NM_005789chr1761972 1910 1567 1416 1334 1328 22133 1834 155 --
NM_005795chr242134 1973 765 395 ----12014
NM_005801chr171708 1182 ----
NM_005802chr92553 228 ------
NM_005803chr6145 ------
NM_005808chr3113324 3227 2876 2399 1412 1083 1009 842 604 312 63 11394 ----
NM_005822chr622105 907 --180 --
NM_005828chr17174801 4173 3877 3868 3785 3507 3479 2001 1932 1850 1618 1115 801 633 535 363 49 --1649 --
NM_005833chr9----1175 --
NM_005840chrX146456 5564 4695 2823 2643 2458 2452 2358 1798 1642 1482 625 549 474 13062 16857 --
NM_005841chr42932 438 1844 ----
NM_005842chr131498 ------
NM_005845chr1321426 346 ------
NM_005851chr111353 ------
NM_005852chr1761072 1053 401 372 285 77 ------
NM_005853chr161595 --1603 --
NM_005857chr111499 --21434 1135 --
NM_005859chr511574 --11106 --
NM_005860chr1961655 1310 1220 1115 281 63 --1391 --
NM_005862chr31426 ------
NM_005866chr91876 ------
NM_005870chr1341410 505 402 82 ------
NM_005871chr101167 ------
NM_005876chr23805 765 677 ------
NM_005877chr2292212 2155 1943 1815 581 542 93 48 39 ------
NM_005880chr16147 ------
NM_005882chr41692 ------
NM_005884chr192788 267 --1734 --
NM_005885chr51190 --1614 --
NM_005888chr122187 33 ------
NM_005892chr171301 ------
NM_005895chr1252970 2731 659 115 32 --1911 13340
NM_005899chr1721496 307 --128 --
NM_005901chr18137483 7356 7131 6439 2326 2195 1828 1615 1579 816 688 552 396 38546 5600 3490 ----
NM_005903chr551571 1405 795 540 288 15061 ----
NM_005906chr641479 1441 496 192 ------
NM_005907chr631658 1512 375 ------
NM_005909chr553968 3589 2930 2782 941 ------
NM_005910chr17134066 3628 2960 2626 2525 1659 1482 1455 1419 1150 957 359 142 12667 13447 11195
NM_005911chr21413 --11393 1253
NM_005920chr143502 2844 2392 1496 ------
NM_005927chr541289 1156 868 143 ------
NM_005928chr155528 481 225 49 32 ------
NM_005930chr14163 ------
NM_005933chr1192861 2787 2673 2475 2308 2075 1928 740 285 --2794 754 --
NM_005934chr1962336 2267 1619 459 355 330 --31740 571 101 --
NM_005935chr4115102 4750 4265 4094 3691 3569 3283 1290 1061 825 792 --24234 1980 1659
NM_005937chr17103408 3365 3010 1618 1268 1214 1040 810 741 214 --23250 1175 --
NM_005938chrX4357 164 102 29 ------
NM_005941chr863598 2983 2734 1400 1377 881 --1563 --
NM_005943chr641258 1220 1149 270 --11558 --
NM_005944chr331097 501 153 ------
NM_005955chr1154780 4240 3915 3815 1954 1765 1706 1575 1472 1314 882 755 748 697 353 --11334 --
NM_005962chr1042238 1780 719 700 --11713 --
NM_005962chr1042238 1780 719 700 --11713 --
NM_005964chr171155 ------
NM_005966chr231558 452 91 ------
NM_005967chr122250 120 ------
NM_005969chr1131027 985 896 ------
NM_005994chr17260 46 ------
NM_005996chr1231025 171 46 11418 ----
NM_006007chr944167 1025 334 127 --13088 --
NM_006009chr122207 27 ------
NM_006011chr15144181 3688 3438 3408 3078 3012 2910 2653 1180 1138 959 924 845 399 --33995 1047 338 1597
NM_006015chr131053 848 460 1269 ----
NM_006016chr632237 1975 227 --11513 --
NM_006017chr41375 1247 121 --
NM_006022chr134786 742 355 77 ------
NM_006024chr72896 214 --1273 --
NM_006030chr371655 1423 1161 1143 359 318 247 21606 339 ----
NM_006037chr243040 337 44 34 --14039 --
NM_006038chr203745 338 192 ------
NM_006040chr1651385 1201 443 360 52 1432 1138 --
NM_006041chr174424 396 386 344 1133 ----
NM_006047chr2073477 3380 2422 1410 1291 575 560 --13491 --
NM_006048chr131080 453 80 ------
NM_006060chr7104265 3815 3677 3615 3140 1614 759 656 231 60 13877 1778 --
NM_006062chr231180 984 195 --2491 101 --
NM_006068chr41277 --178 --
NM_006076chr7123135 3067 2636 2043 2024 1215 1155 1120 746 154 76 32 --32345 1100 894 --
NM_006079chr62701 172 ----1341
NM_006080chr742969 769 326 295 144 ----
NM_006085chr12895 294 ------
NM_006089chrX11367 ------
NM_006091chr1561789 1547 630 558 517 383 ------
NM_006094chr831907 804 162 ----12332
NM_006095chr474297 3921 3780 1481 1462 1075 332 11150 12882 --
NM_006096chr851346 1270 1129 295 80 --11366 --
NM_006099chr12593 150 ------
NM_006100chr31118 --1109 --
NM_006106chr1142431 1360 1000 653 --12711 --
NM_006113chr132075 1740 535 1198 ----
NM_006135chr131054 205 185 --1505 --
NM_006136chr7282 74 ------
NM_006139chr252013 1944 1844 987 60 11957 1510 --
NM_006141chr1662635 2583 2364 1026 858 701 ----12826
NM_006145chr1921103 120 ------
NM_006147chr1----1432 --
NM_006148chr1792758 2645 2322 1935 1189 814 713 383 23 --22585 1863 --
NM_006153chr3124 ------
NM_006154chr1562466 897 751 534 215 34 1236 --1552
NM_006155chr241967 1899 1858 1409 1471 ----
NM_006156chr14187 ------
NM_006157chr113426 158 121 ------
NM_006158chr841400 1115 696 221 11684 ----
NM_006160chr1731033 432 35 ------
NM_006162chr1851747 1709 1439 1186 615 ------
NM_006163chr123190 167 25 ------
NM_006166chr1252547 1607 1053 433 295 --11964 --
NM_006167chr831823 1573 790 --140 11604
NM_006177chr141944 ------
NM_006178chr1721490 532 11190 174 --
NM_006180chr93440 289 75 ------
NM_006185chr112239 71 ------
NM_006186chr241139 453 110 50 --11200 --
NM_006191chr122314 36 ------
NM_006192chr2041150 1046 365 351 --2907 396 --
NM_006194chr142110 44 --1271 --
NM_006196chr21385 ------
NM_006197chr821841 1493 1879 1113 --
NM_006201chrX8456 443 431 245 235 189 140 104 297 86 ----
NM_006203chr535433 1283 96 14593 ----
NM_006206chr442675 1894 946 196 --12706 11940
NM_006209chr81349 ------
NM_006211chr8198 ------
NM_006212chr195274 4787 4490 4452 4224 3659 3500 1129 753 24544 548 34237 1658 481 11103
NM_006216chr22596 431 ------
NM_006224chr1752245 1679 943 889 354 --1830 --
NM_006226chr21444 ------
NM_006228chr82369 165 ------
NM_006237chr1372048 1620 830 679 168 109 72 1868 11937 --
NM_006241chr361767 1649 881 813 800 125 ------
NM_006243chr131091 713 388 --1862 --
NM_006245chr63683 88 53 --1744 --
NM_006246chr143976 438 145 ------
NM_006251chr523032 2101 23024 382 ----
NM_006252chr1127561 6896 6297 6265 5632 5015 2812 2110 1924 1761 807 506 15185 15135 1559
NM_006253chr1231254 490 141 ------
NM_006256chr132525 2197 661 --1613 12615
NM_006257chr103773 345 35 --2419 68 --
NM_006258chr103639 60 26 ------
NM_006259chr441013 880 835 234 --124 --
NM_006265chr83364 120 53 ------
NM_006267chr21696 11881 11173 --
NM_006268chr1151137 365 275 215 136 11042 ----
NM_006270chr193277 236 48 ------
NM_006275chr2022183 2086 22443 1859 1499 --
NM_006282chr20134763 4646 4267 3324 3165 3145 2994 2967 1335 1011 792 452 65 ----1770
NM_006283chr8194830 4751 4485 4426 4399 3358 3056 1900 1425 1419 898 817 580 373 155 135 87 69 43 --24980 3610 --
NM_006285chr9----1269 --
NM_006293chr152397 366 1377 ----
NM_006301chr123638 605 523 ------
NM_006304chr71109 143 ----
NM_006305chr151207 ------
NM_006306chrX95892 5846 4929 4741 4687 4460 1958 130 27 14390 1520 --
NM_006307chrX1239 ------
NM_006310chr1721012 35 --11274 --
NM_006312chr123843 747 80 2770 166 1358 --
NM_006313chr1241590 1217 640 432 --11272 --
NM_006315chr4144507 4297 4288 3433 3156 3133 3088 3044 1802 1503 974 658 472 317 11781 178 13684
NM_006317chr52343 171 ------
NM_006320chr43892 177 66 11010 ----
NM_006321chr381944 1871 1431 830 621 498 83 58 1451 ----
NM_006322chr132933 48 1833 ----
NM_006323chr41127 ------
NM_006325chr122301 254 ------
NM_006328chr112467 245 ------
NM_006329chr143680 602 28 ------
NM_006330chr81289 ------
NM_006333chr21562 --1498 --
NM_006335chr11334 1945 ----
NM_006352chr111501 --21373 609 --
NM_006357chr21119 ------
NM_006359chrX32155 1963 465 1890 ----
NM_006361chr1771875 1698 1629 1382 672 564 294 ------
NM_006364chr141284 ------
NM_006366chr62503 199 --199 --
NM_006367chr14938 806 261 137 1856 2815 107 --
NM_006369chr13380 306 67 ------
NM_006371chr3175206 4972 4870 4854 4596 4351 4213 3988 3921 1884 1582 1374 610 569 529 456 167 11024 ----
NM_006372chr61435 --1165 --
NM_006373chr1781419 1385 1297 1040 445 346 289 251 --11111 --
NM_006378chr921183 1092 --11058 --
NM_006379chr732237 351 47 11749 ----
NM_006380chr1773551 3303 3263 2968 2962 1561 578 ------
NM_006386chr2262228 2088 1751 626 490 178 1780 158 --
NM_006390chr1231484 683 91 11153 ----
NM_006400chr12----1274 --
NM_006401chr92460 51 ------
NM_006403chr621561 1207 --163 --
NM_006407chr331292 1157 75 ------
NM_006408chr72986 29 1905 ----
NM_006411chr63927 265 205 --1245 --
NM_006416chr61169 ------
NM_006421chr81261 ------
NM_006430chr24528 425 367 134 ------
NM_006434chr1063127 1206 631 523 492 341 1160 ----
NM_006439chr42545 397 ------
NM_006445chr17121 ------
NM_006451chr531045 808 706 ------
NM_006454chr4172855 2803 2707 2441 2418 2329 1991 1932 986 844 652 431 178 148 138 101 29 --12894 --
NM_006457chr484021 3995 3190 2532 1247 982 837 801 13225 ----
NM_006459chr104788 776 236 168 11867 1275 --
NM_006461chr17124 ------
NM_006465chr1562048 773 705 687 450 388 1523 ----
NM_006469chr121162 641 11561 1526 --
NM_006472chr141209 1164 1067 923 ------
NM_006476chr11174 ------
NM_006482chr12103622 3501 2924 2468 2438 1474 788 592 444 304 13635 ----
NM_006489chr1442018 1288 1253 422 1445 ----
NM_006491chr141307 ------
NM_006494chr194765 211 109 55 ------
NM_006496chr141253 806 751 66 --11236 --
NM_006497chr17----1160 --
NM_006500chr1151218 1069 534 519 31 ------
NM_006516chr151418 1392 1274 625 358 --11447 --
NM_006517chrX51960 1477 649 422 350 ------
NM_006526chr202545 435 11713 ----
NM_006527chr41141 ------
NM_006532chr1981732 1681 1309 468 455 357 316 275 1207 1236 --
NM_006534chr2063051 2679 2557 2253 619 326 32598 860 796 13408 --
NM_006537chr155580 511 490 398 214 --2560 392 --
NM_006538chr274146 4124 3592 2921 1037 838 468 23415 2880 1546 --
NM_006539chr161537 ------
NM_006540chr821054 182 11464 ----
NM_006544chr1486048 4554 4383 4361 1632 1562 666 506 15309 11357 --
NM_006546chr17166131 5898 5116 4450 4298 4144 4109 2631 2509 2501 2488 1918 1233 1008 864 568 12292 36385 2222 209 --
NM_006547chr71156 --11581 --
NM_006549chr1242481 2235 1914 1037 ------
NM_006555chr781988 1949 1821 1612 1555 1535 1420 1404 11954 ----
NM_006557chr921696 1438 11510 11764 --
NM_006559chr1--11180 ----
NM_006560chr111114 ------
NM_006561chr10145697 5205 4908 4840 4767 4687 4325 4160 3922 2431 2160 2111 1483 1261 25558 78 24207 488 15254
NM_006565chr1641270 1040 517 183 ------
NM_006571chr82312 256 --147 --
NM_006574chr31228 ------
NM_006575chr141923 ------
NM_006577chr21900 2959 920 2950 104 --
NM_006578chr1531465 606 164 --11731 --
NM_006585chr211146 ------
NM_006589chr11161 --1481 --
NM_006595chr1131672 152 126 --11383 --
NM_006599chr1677591 7529 7282 5726 5635 1389 163 17837 28048 996 26766 6502
NM_006601chr121721 1115 ----
NM_006602chr201595 ------
NM_006603chrX31670 662 166 ----11633
NM_006608chr1196 ------
NM_006609chr242572 2366 2232 2216 2700 547 ----
NM_006614chr353311 2647 2573 2494 307 --1836 --
NM_006618chr131306 1167 1058 ------
NM_006621chr121878 1341 ------
NM_006624chr1021834 1508 ------
NM_006625chr13972 419 344 1451 ----
NM_006625chr13972 419 344 1451 ----
NM_006625chr13972 419 344 1451 ----
NM_006626chr931016 1003 198 ------
NM_006628chr15114388 4232 4211 4009 3851 3801 3545 3519 1723 1166 610 14031 ----
NM_006631chr191615 ------
NM_006633chr5----1605 197
NM_006634chr21224 ------
NM_006636chr231034 905 895 ------
NM_006640chr1771475 1387 1373 1337 609 580 133 --1657 --
NM_006646chr1352689 2626 528 352 259 ------
NM_006650chr5113817 3170 2820 2721 2694 2505 860 777 742 334 319 ------
NM_006653chr62309 52 ------
NM_006654chr1274728 4567 4272 3903 3153 887 558 ------
NM_006656chr111154 ------
NM_006662chr161280 ------
NM_006667chrX166 --1731 --
NM_006670chr6----1455 --
NM_006675chr1293350 3342 3274 2768 2382 1098 141 76 37 ------
NM_006677chr33182 61 41 ------
NM_006690chr2092203 1589 1576 951 725 705 507 482 214 --1756 --
NM_006691chr113351 199 143 ------
NM_006695chr172235 117 ------
NM_006698chr2061422 1323 1267 1211 1200 314 ------
NM_006699chr142510 1003 828 718 ------
NM_006704chr13----2424 316 --
NM_006706chr51217 ------
NM_006713chr52584 53 ------
NM_006717chr942593 2297 1053 581 21147 218 22236 371 --
NM_006718chr6--2879 853 --1352
NM_006721chr103687 338 42 ------
NM_006722chr332659 2350 2341 --42919 2375 489 36 --
NM_006726chr41771 ------
NM_006727chr5154 ------
NM_006729chrX114923 4882 4840 4270 3541 2033 1592 1582 1216 596 535 11300 25487 1013 --
NM_006732chr1951846 1790 1723 193 157 --11698 1671
NM_006734chr61323 ------
NM_006735chr7162 ------
NM_006736chr261771 1724 1691 1562 757 582 --21755 98 --
NM_006738chr15144331 4290 3961 3743 3339 3049 1266 998 967 438 220 199 102 29 --13921 --
NM_006742chr1672023 2005 1505 1407 1314 1246 585 --21275 315 --
NM_006744chr101164 ------
NM_006748chr831398 685 332 --157 --
NM_006749chr82456 127 ----1342
NM_006750chr16197091 7041 5630 5356 2721 2501 2193 1995 1276 1261 1183 1108 1039 916 665 502 280 131 33 17710 57734 4959 3062 725 632 25166 1856
NM_006751chr21342 ------
NM_006754chr741210 419 276 135 ------
NM_006755chr11--1143 ----
NM_006761chr17--1616 ----
NM_006762chr161250 1176 921 125 58 45 ------
NM_006763chr1122000 1887 1752 1707 1643 1337 762 587 576 428 188 43 1259 11738 --
NM_006766chr832487 1897 1043 ------
NM_006769chr11146 ------
NM_006772chr661689 1574 1214 310 219 138 --1103 --
NM_006775chr642894 1924 94 58 1857 22170 585 12727
NM_006777chrX31990 633 378 ------
NM_006790chr5----1352 --
NM_006791chr151207 ----1262
NM_006800chrX2662 30 137 1566 --
NM_006802chr151159 1092 1026 394 56 1919 ----
NM_006803chr851995 1949 1721 1472 83 1800 1725 --
NM_006805chr531416 1306 169 1142 11512 --
NM_006813chr62929 88 ------
NM_006819chr112358 261 ------
NM_006823chr82525 475 ------
NM_006825chr124990 705 329 192 1810 ----
NM_006827chr1463138 2726 2595 2309 754 429 --22340 638 --
NM_006828chr62196 88 ------
NM_006832chr141125 176 ----
NM_006838chr1221520 320 1229 11239 --
NM_006841chr31677 125 ----
NM_006846chr51254 --1266 --
NM_006851chr1272831 2574 2540 2472 865 386 357 11141 ----
NM_006852chr1732470 1986 521 --12691 --
NM_006854chr771751 1719 1653 1534 754 711 187 ------
NM_006856chr1251071 1031 869 311 86 ------
NM_006861chr1262143 1711 1529 691 342 256 ------
NM_006870chr202741 107 --1521 --
NM_006874chr4----1207 --
NM_006884chr32455 72 ------
NM_006885chr1663818 3349 2958 2863 1573 1143 --1655 --
NM_006888chr1463244 2677 2648 2356 1246 1040 ------
NM_006896chr71237 1790 ----
NM_006897chr12121 ------
NM_006901chr151111 ------
NM_006902chr153145 2891 1266 564 93 --2786 556 --
NM_006906chr113353 71 35 ------
NM_006908chr711227 11295 11206 --
NM_006910chr161130 --1306 --
NM_006912chr122132 2060 --2828 198 12313
NM_006914chr921512 448 ------
NM_006918chr1185754 4721 3790 2266 1717 913 343 143 11490 --14233
NM_006920chr231605 370 237 ----11383
NM_006922chr231665 479 231 ------
NM_006924chr1763744 3647 2792 1375 853 666 --12742 --
NM_006930chr541970 754 438 130 --1446 11301
NM_006937chr171508 ------
NM_006939chr142785 229 --2889 206 --
NM_006940chr1231765 1592 1231 ----11686
NM_006941chr224994 980 154 143 --11086 --
NM_006943chr2083293 3027 2617 2587 2434 949 815 692 --22943 2351 --
NM_006946chr114518 385 140 50 --194 --
NM_006947chr431309 1140 189 2454 164 ----
NM_006950chrX3885 659 646 ------
NM_006951chr104768 757 333 130 ------
NM_006952chr341072 906 356 119 1272 ----
NM_006965chr182908 108 1189 ----
NM_006981chr952637 819 628 47 27 ----11857
NM_006990chr182423 2192 1787 1755 1697 655 535 49 --22299 500 --
NM_006996chr131544 1267 454 --153 --
NM_006997chr102372 60 ------
NM_006999chr54784 434 227 45 11325 11284 --
NM_007005chr921372 339 1213 ----
NM_007006chr1622973 124 ------
NM_007007chr1251615 1538 1226 685 536 ------
NM_007008chr22176 168 ------
NM_007011chr15166613 6521 6040 4553 4526 4416 4314 2671 2605 2533 1252 1143 943 867 562 144 --11532 --
NM_007014chr16101768 1758 1472 628 532 455 345 220 127 58 ------
NM_007023chr2185 ------
NM_007027chr31115 ------
NM_007030chr5165170 5101 4340 4222 4028 3539 3360 1398 1242 1236 1148 1118 943 517 238 28 1765 ----
NM_007034chr1--1957 ----
NM_007038chr2185222 4935 4758 4659 4493 3934 3749 2183 15787 46090 727 296 175 --
NM_007039chr1411753 168 --1837
NM_007040chr192122 59 --3917 770 141 1442
NM_007050chr20167251 6943 6923 6348 5827 5260 5187 5087 2860 2495 2415 2338 466 458 305 108 16961 27648 5316 --
NM_007051chr11121 ------
NM_007054chr572751 2725 2431 1277 947 788 773 11122 ----
NM_007067chr1751307 399 210 136 64 ------
NM_007073chr694236 4032 3736 2928 2605 1252 1053 677 95 13989 13906 --
NM_007084chr131515 ------
NM_007097chr52228 64 ------
NM_007106chr133307 140 102 12524 12380 --
NM_007107chr312000 --21741 1690 --
NM_007108chr164539 151 62 52 1199 ----
NM_007111chr132758 689 --1716 --
NM_007112chr11230 ------
NM_007118chr54733 635 609 97 ------
NM_007124chr611810 --11641 --
NM_007125chrY51321 1315 241 161 154 --1461 --
NM_007144chr1731113 956 506 ------
NM_007146chr1732752 2609 2120 ------
NM_007150chrX61973 1768 1412 1393 859 84 11383 ----
NM_007158chr12410 304 1796 ----
NM_007159chr321508 1383 1166 11154 --
NM_007162chr66576 561 539 417 158 116 ------
NM_007166chr113350 237 83 ------
NM_007167chr13839 746 626 ------
NM_007170chr14715 364 357 244 ------
NM_007172chr2281078 992 739 595 511 482 45 30 --12790 1204
NM_007174chr1231516 625 154 --22027 671 --
NM_007175chr873454 3442 3316 2567 2420 856 396 22511 2241 23213 100 --
NM_007177chr381685 1602 1559 1546 661 474 119 28 ------
NM_007178chr12----2448 83 --
NM_007185chr15744 337 286 170 122 11031 ----
NM_007187chr132898 236 ------
NM_007189chr761236 978 610 188 148 115 --11535 --
NM_007191chr121712 ------
NM_007200chr15144331 4290 3961 3743 3339 3049 1266 998 967 438 220 199 102 29 --13921 --
NM_007203chr963930 3771 3473 3213 2927 943 33175 2947 733 ----
NM_007212chr11494 12228 --11700
NM_007217chr31138 --151 --
NM_007219chr206803 749 726 240 118 105 --1810 --
NM_007221chr12365 163 ------
NM_007222chr811331 --1392 --
NM_007224chr122632 480 ------
NM_007232chr206998 981 758 378 278 71 ------
NM_007235chr121192 ------
NM_007236chr15101914 1873 1720 1559 625 481 441 369 159 114 ------
NM_007245chr16154 --2205 177 --
NM_007249chr13118143 7007 6617 5952 3665 3379 3300 2394 1166 932 804 1791 12212 --
NM_007260chr15736 667 592 214 194 ------
NM_007269chr11193 ------
NM_007271chr681630 1443 1401 1284 745 669 617 227 ------
NM_007275chr33339 323 314 1789 ----
NM_007277chr52117 49 1340 ----
NM_007283chr352314 2114 741 470 299 21965 1100 13050 --
NM_007285chr161427 --135 --
NM_007286chr562129 2076 2069 2019 766 492 --12058 --
NM_007292chr17104754 4615 4415 4390 3409 3308 2051 542 526 29 14464 14947 --
NM_007294chr172185 106 ------
NM_007295chr172185 106 ------
NM_007296chr172185 106 ------
NM_007297chr172185 106 ------
NM_007298chr172185 106 ------
NM_007299chr172185 106 ------
NM_007300chr172185 106 ------
NM_007302chr172185 106 ------
NM_007303chr172185 106 ------
NM_007304chr172185 106 ------
NM_007305chr172185 106 ------
NM_007322chr192404 36 --1174 --
NM_007327chr92461 419 --1985 --
NM_007345chr1832353 2151 1758 --11585 --
NM_007347chr1553044 2854 2337 2311 248 12141 ----
NM_007349chr72107 53 ------
NM_007350chr1254327 3218 3211 1815 1558 14021 ----
NM_007353chr792439 1942 1108 1038 851 798 577 365 186 1460 ----
NM_007358chr111679 --11911 --
NM_007363chrX3807 430 118 ------
NM_007365chr1102115 1756 1682 806 689 680 460 368 298 26 --1854 --
NM_007368chr1361216 984 950 396 164 38 ------
NM_007371chr92519 109 ------
NM_007372chr171890 ------
NM_007373chr1031589 1482 43 --11344 --
NM_007375chr152007 1101 769 245 237 ----1620
NM_009585chr33827 572 309 ------
NM_009585chr33827 572 309 ------
NM_012062chr123362 308 238 ----156
NM_012069chrX42067 710 608 585 2448 137 12698 --
NM_012074chr1411102 ------
NM_012081chr583265 3200 2290 1376 1264 1067 637 458 12534 23341 691 --
NM_012082chr81687 ------
NM_012084chrX1230 --1569 --
NM_012090chr141036 334 193 129 ------
NM_012095chr10103409 3402 3273 2699 2645 1345 976 788 574 494 --1478 --
NM_012096chr363028 2293 1294 822 726 253 22479 2309 --11243
NM_012097chr221949 653 ------
NM_012098chr941439 1347 417 36 ------
NM_012102chr121888 802 ------
NM_012104chr1173482 3008 1349 1149 995 274 137 --43530 1332 1217 529 --
NM_012104chr1173482 3008 1349 1149 995 274 137 --43530 1332 1217 529 --
NM_012105chr21----1153 --
NM_012115chr6--1533 1401 --
NM_012120chr632909 2389 2279 1893 ----
NM_012123chr6--2328 309 ----
NM_012124chr111828 ------
NM_012127chr9130 ------
NM_012134chr1111734 1721 1605 1431 1420 1384 1360 1296 373 285 41 ------
NM_012141chr1344129 3903 2671 1226 1750 21649 692 --
NM_012142chr152271 64 ------
NM_012155chr19162 ------
NM_012156chr2042871 711 209 117 12278 ----
NM_012164chr9117464 7285 7103 6056 6025 6014 2452 2317 1662 1153 546 22102 349 --15889
NM_012166chr981564 1513 1365 1045 591 487 441 411 --31267 1074 68 --
NM_012174chr1282933 2916 2859 2246 2149 1119 725 214 22115 318 1759 --
NM_012175chr11----2818 784 --
NM_012176chr52258 95 ------
NM_012191chr3145 --125 --
NM_012193chr11135339 4982 4831 4548 4011 3424 3357 2165 2143 1643 1566 679 537 1298 43590 1659 1442 142 12110
NM_012197chr931461 472 53 11312 ----
NM_012199chr1134547 4074 3163 2998 2978 2943 2918 1723 1537 1490 1286 746 611 13031 11833 --
NM_012200chr111154 ------
NM_012207chr102945 269 ------
NM_012210chr921555 215 --11463 --
NM_012214chr2176145 5957 5830 5801 5145 5086 5011 4861 4782 4690 4376 2280 1899 1711 1585 1367 607 15070 14023 --
NM_012215chr102540 24 ------
NM_012218chr1942995 2236 1204 1096 1280 ----
NM_012234chr3113746 3714 3622 3103 2962 2461 1116 750 137 121 72 1684 11447 12288
NM_012238chr1031439 1215 1105 ------
NM_012242chr10------1278
NM_012244chr1461222 698 311 231 106 59 11451 1340 --
NM_012247chr1011007 --2747 164 --
NM_012249chr263449 2399 1389 1197 998 30 --42749 2697 2588 323 --
NM_012250chr111204 1424 --1372
NM_012257chr72915 374 --1218 2880 401
NM_012261chr201548 ------
NM_012262chr1114680 3891 3688 1614 1476 1276 662 392 383 239 48 14098 11814 --
NM_012264chr22102054 1720 1706 1645 812 754 700 427 269 221 ------
NM_012264chr22102054 1720 1706 1645 812 754 700 427 269 221 ------
NM_012281chr722147 1946 ------
NM_012285chr175449 398 84 41 26 ------
NM_012286chrX------1251
NM_012287chr351538 1479 1345 410 404 13020 181 --
NM_012288chr6145688 4475 4167 3947 945 609 387 340 326 319 310 125 91 77 35255 2177 1633 --1776
NM_012290chr2--1583 21324 246 --
NM_012297chr442156 595 410 357 ------
NM_012300chr522256 741 ------
NM_012301chr742217 671 613 89 ------
NM_012302chr141172 867 822 89 11102 ----
NM_012306chr12153468 3327 3221 3206 3118 2896 2356 974 937 858 639 632 439 412 99 ----1128
NM_012307chr181801 ------
NM_012308chr1192582 2483 1994 953 857 831 818 415 184 ----1734
NM_012311chr101626 --1522 --
NM_012316chr1154417 3875 3554 2191 1912 1754 1603 1562 1507 1478 1465 1322 1073 644 116 24411 1997 45287 1741 1224 654 --
NM_012320chr1661317 1152 1094 924 307 247 1354 ----
NM_012323chr2281521 1495 1033 1024 604 400 340 145 ------
NM_012324chr222763 211 ------
NM_012327chr1811570 ------
NM_012329chr1751652 1290 1040 640 170 --11314 --
NM_012330chr1031632 540 302 ------
NM_012333chr131260 591 518 1674 11060 --
NM_012334chr5154349 4185 3704 1857 1849 1704 1587 1561 1316 776 591 276 159 103 24 --23616 354 --
NM_012340chr201173 ------
NM_012341chr101426 ------
NM_012382chr5114266 3714 3581 3546 2749 1437 1164 802 424 346 32 13607 22840 44 --
NM_012384chr2092450 2311 2069 1811 1780 1746 1505 612 45 ------
NM_012388chr1532367 783 379 --43163 2950 805 416 --
NM_012395chr732362 2274 1268 1653 23044 2950 --
NM_012398chr1972574 1120 744 490 381 67 52 --12601 --
NM_012399chr2231514 1347 1267 --11425 --
NM_012405chr1133673 3563 3538 3198 3133 3094 2755 2729 2532 2501 1309 304 78 13502 ----
NM_012407chr223433 358 119 ------
NM_012416chr9----1223 --
NM_012417chr172638 444 --189 --
NM_012419chr63622 417 207 ------
NM_012423chr19136 --1156 --
NM_012426chr162444 66 1309 ----
NM_012428chr152360 67 ----1121
NM_012430chr31107 --124 --
NM_012431chr753158 2853 2572 2476 277 --123 --
NM_012434chr671363 1245 673 510 451 233 24 ------
NM_012446chr51214 --2618 471 --
NM_012448chr17122477 2062 1864 1795 1680 1621 1613 901 870 719 494 456 --2520 252 --
NM_012460chr14249 38 ------
NM_012463chr122740 604 --21822 109 --
NM_012464chr472864 2795 2563 2293 2171 883 762 --21953 856 --
NM_012465chr1062530 2475 2446 735 391 212 ------
NM_012471chrX51860 1847 492 196 91 ------
NM_012479chr762048 1869 957 425 266 136 12173 12184 --
NM_012482chr1165 ------
NM_012484chr51110 --1698 --
NM_012486chr11470 --1428 --
NM_013229chr1282794 2514 1118 982 684 657 402 281 --1351 --
NM_013231chr1484175 3805 3081 2928 2745 2729 2718 1302 13203 ----
NM_013233chr221153 201 --21338 453 --
NM_013236chr224931 907 475 216 11274 ----
NM_013253chr1141358 954 395 264 ------
NM_013254chr12--1691 ----
NM_013255chr7178075 7976 7566 6705 6454 6409 6096 5495 5347 3099 2297 1953 1485 1296 1014 450 425 17581 ----
NM_013261chr443562 2737 1186 744 --13136 11277
NM_013262chr631463 1236 508 --11275 --
NM_013266chr10--145 157 --
NM_013269chr1254038 1707 1497 478 205 ------
NM_013272chr151310 ------
NM_013275chr164742 207 56 46 ------
NM_013279chr11112293 1979 1972 1914 1884 1763 1659 665 555 367 233 --22366 850 --
NM_013281chr2041484 1140 1130 186 ------
NM_013283chr52779 667 ------
NM_013286chr3143679 3372 3337 3224 2684 2664 2550 2418 1499 1360 872 628 540 427 22482 957 1242 --
NM_013302chr16154745 4245 4109 4082 3941 3809 3543 2892 1656 1307 803 658 535 400 200 --11689 --
NM_013305chr181111 ------
NM_013306chr113521 208 43 ------
NM_013309chr1552193 957 917 443 27 ------
NM_013313chr2243482 2363 2244 325 1276 22799 2204 --
NM_013316chr72914 865 1337 ----
NM_013336chr361948 1699 1693 1235 687 230 11527 ----
NM_013341chr232802 2425 722 ------
NM_013346chrX175 ------
NM_013354chr82568 132 ------
NM_013357chr82234 226 ------
NM_013363chr3----141 --
NM_013365chr222527 47 ------
NM_013368chr192545 404 --1147 --
NM_013372chr1561127 940 815 248 136 117 13221 11282 --
NM_013373chr225980 778 650 326 172 ------
NM_013374chr3--1136 --22347 524
NM_013377chr12----2492 69 --
NM_013381chr121369 1972 ----
NM_013388chr23258 197 39 --1134 --
NM_013396chr21158 --11036 --
NM_013399chr1661271 1165 1145 637 562 251 --11386 --
NM_013400chr75989 880 792 370 253 183 ----
NM_013403chr194749 285 175 111 ------
NM_013410chr12795 181 ------
NM_013433chr1931698 1351 30 ------
NM_013436chr2142 ----1545
NM_013437chr811196 --21421 1226 1543
NM_013438chr921696 71 11321 ----
NM_013444chrX11093 1117 ----
NM_013446chr751421 1085 364 248 143 --11339 --
NM_013449chr12122938 2906 2274 2102 1984 881 693 547 537 513 333 84 12850 ----
NM_013450chr221059 886 ------
NM_013943chr122448 1196 2767 624 ----
NM_013958chr82103 24 --197 --
NM_013959chr82103 24 --197 --
NM_013960chr81566 1641 ----
NM_013961chr82103 24 --197 --
NM_013962chr82103 24 --197 --
NM_013995chrX42593 2372 1616 169 --1263 --
NM_014000chr1091945 1637 1481 1404 751 693 660 482 75 ------
NM_014001chr17101626 1372 1199 1021 557 479 368 267 156 46 --11395 --
NM_014007chr931099 907 889 11274 ----
NM_014010chr91550 ------
NM_014011chr2--21760 232 1477 12106
NM_014016chr351609 1596 1201 627 600 --1169 --
NM_014021chr143068 2749 1246 134 --13028 22879 2642
NM_014023chr10132585 2401 2296 2134 1943 1868 1797 1177 1154 955 628 421 396 --12770 --
NM_014028chr622586 665 --22390 2184 --
NM_014039chr1131003 544 329 1215 1867 --
NM_014043chr351192 602 526 511 461 --11145 --
NM_014048chr1695006 4655 4154 3549 3282 1988 1909 1628 693 23298 1557 15069 --
NM_014057chr92361 53 ----11584
NM_014062chr161172 1357 ----
NM_014079chr32161 80 ------
NM_014089chr1322037 838 --11577 --
NM_014109chr81462 ------
NM_014110chr141131 1125 240 185 ------
NM_014112chr894971 4160 4037 4011 3916 1426 1235 643 110 21613 434 14071 1344
NM_014117chr163692 408 33 1938 ----
NM_014141chr7105016 4209 3933 3299 1854 1540 1162 1113 288 76 ------
NM_014153chr162217 98 --1699 --
NM_014155chr11125741 5634 2883 2822 2395 2264 1512 1358 1117 1058 688 254 26703 4699 36136 5894 998 --
NM_014171chr22783 48 ------
NM_014176chr1--161 ----
NM_014181chr242913 2774 727 671 12119 1776 --
NM_014189chr441298 380 374 21 ------
NM_014190chr471650 1141 732 726 373 217 43 ------
NM_014191chr121306 1137 ----
NM_014214chr181351 ------
NM_014231chr1241757 344 241 33 11719 2862 454 --
NM_014232chr1761297 1261 1244 1163 616 270 125 11118 --
NM_014232chr1761297 1261 1244 1163 616 270 125 11118 --
NM_014240chr382603 1594 1552 1352 930 390 176 60 --53949 3784 3207 2697 1110 --
NM_014243chr4--11708 2762 586 --
NM_014245chr31815 11119 ----
NM_014246chr2251838 795 705 574 68 ------
NM_014250chr2251894 1356 417 408 279 1830 ----
NM_014251chr74911 796 720 28 ----1751
NM_014253chrX41771 532 437 423 1621 52484 2302 1697 129 38 --
NM_014267chr111570 1695 --169
NM_014268chr1841286 913 322 255 ------
NM_014271chrX2696 81 --1677 --
NM_014278chr4--1181 ----
NM_014280chr14899 641 257 53 ----1364
NM_014283chr131374 1329 1062 11259 ----
NM_014284chr13861 743 727 --1368 --
NM_014289chrX1511 --11435 --
NM_014293chr2283837 3403 3262 3027 2790 1322 505 33 ------
NM_014294chr82212 44 ------
NM_014296chr31451 ------
NM_014309chr22185117 4991 4750 4334 4308 3881 3589 3558 3304 2003 1879 1721 1447 1369 1281 1047 606 193 --15404 --
NM_014322chr14983 833 363 136 ------
NM_014323chr222120 44 ------
NM_014325chr1231766 1558 102 ------
NM_014333chr1132816 631 411 --2772 489 --
NM_014335chr152995 364 11221 ----
NM_014338chr223844 715 101 1227 ----
NM_014342chr1131252 1224 141 11469 ----
NM_014345chr61747 ------
NM_014350chr53927 183 55 ------
NM_014352chr1131405 1164 267 1256 187 --
NM_014363chr13181 ------
NM_014368chr941888 1609 538 46 ------
NM_014372chr1----1530 --
NM_014374chr75989 880 792 370 253 183 ----
NM_014376chr562367 2267 1956 1796 1673 749 --12577 1844
NM_014382chr31567 ------
NM_014390chr74532 386 371 219 ------
NM_014392chr451116 472 365 158 138 ----1202
NM_014393chr871710 865 627 332 310 208 82 --1266 11470
NM_014399chr71254 ------
NM_014400chr19----1409 --
NM_014405chr1792363 1969 1828 1641 1491 725 461 392 292 ------
NM_014415chr311380 --184 --
NM_014417chr191125 ------
NM_014423chr564717 4346 1634 943 68 22 1365 34899 4628 1969 --
NM_014426chr201620 ------
NM_014431chr1061587 1237 482 471 453 269 11628 ----
NM_014432chr631228 1133 21 ------
NM_014445chr341545 857 478 105 ------
NM_014447chr41628 ------
NM_014454chr66877 871 838 781 218 161 ------
NM_014455chr12321 309 ------
NM_014456chr1021542 312 ----11190
NM_014472chr103513 271 167 ------
NM_014480chr192680 539 --1819 --
NM_014489chr113830 819 38 ------
NM_014491chr71380 ------
NM_014494chr16--1514 11499 --
NM_014498chr31359 170 ----
NM_014504chr722010 537 --1311 --
NM_014506chr951433 1376 629 98 60 ----11221
NM_014507chr2211172 1132 1977 --
NM_014515chr124850 185 167 53 ------
NM_014517chr36782 731 314 259 177 171 --1399 --
NM_014520chr173112 42 32 ------
NM_014548chr1531250 1211 464 11390 ----
NM_014554chr1252128 2057 2007 598 159 1798 21618 252 --
NM_014562chr22149 91 --1141 --
NM_014563chrX51671 1397 1371 362 164 ------
NM_014572chr1341663 1138 561 32 ------
NM_014573chr1741831 1719 635 76 --21438 1392 11617
NM_014574chr143374 104 63 ------
NM_014575chr31408 ------
NM_014584chr1421601 472 ------
NM_014591chr101239 --11305 --
NM_014592chr55719 686 584 271 188 1296 ----
NM_014603chr1731605 1441 179 --1496 --
NM_014607chr251876 640 628 258 219 1130 185 --
NM_014612chr941489 1469 1071 587 ------
NM_014613chr5102706 2241 2111 1985 1075 1001 501 440 181 148 12290 ----
NM_014614chr2--11228 196 --
NM_014615chr1673386 3113 2760 1150 1104 980 225 --22455 2331 11129
NM_014616chr382743 2617 2595 2583 2523 2513 426 400 13406 ----
NM_014618chr91394 ------
NM_014629chr841342 1003 903 287 ------
NM_014630chr15143272 2635 2623 1399 1345 824 798 747 538 426 365 305 237 142 32881 490 285 13140 22867 1027
NM_014634chr22123371 3038 2913 2888 2531 2436 2296 2258 1387 1216 1150 1122 --13575 --
NM_014636chr9124133 3674 3591 3454 3175 3146 1031 1023 828 753 590 441 23357 2655 ----
NM_014637chr81531 --1999 --
NM_014646chr18142621 2568 2533 2291 1304 1077 902 872 866 795 470 436 410 144 12659 ----
NM_014647chr1621927 1674 11888 142 --
NM_014653chr1272068 1722 1524 677 271 180 132 --32052 1986 659 --
NM_014655chr161576 1507 892 486 468 157 ----11742
NM_014659chr153776 451 38 ------
NM_014660chr72233 160 ------
NM_014661chr10163335 3277 3009 2942 2932 2827 2769 2559 2551 2398 1282 1049 749 520 290 153 12456 ----
NM_014663chr12988 304 ------
NM_014665chr8172887 2588 2546 2534 2431 2367 2342 2296 1442 1389 1365 685 636 418 278 250 158 ------
NM_014667chr382328 946 551 508 468 292 255 45 1231 ----
NM_014670chr231593 1197 1144 ------
NM_014671chr741206 622 503 255 1441 ----
NM_014674chr373298 2737 1239 1159 705 465 238 --12600 11556
NM_014676chr131477 411 226 ------
NM_014678chr222176 42 --1573 --
NM_014682chr8179 22115 1825 21756 1432 --
NM_014683chr1732156 1725 185 --11561 --
NM_014686chr1951899 841 807 742 22 1509 ----
NM_014690chr7113039 2648 2388 2335 1175 989 938 571 534 398 23 ------
NM_014693chr36565 492 293 244 193 176 ------
NM_014699chr162390 299 ------
NM_014701chr1562646 1381 1026 819 711 86 33297 1234 667 ----
NM_014702chr673507 3310 3232 2950 2116 1296 941 --23069 2734 --
NM_014705chr7--1599 ----
NM_014707chr742269 1608 645 334 ----1685
NM_014709chr21111 ------
NM_014712chr162467 175 ------
NM_014719chr731101 1031 370 ------
NM_014720chr1041324 1291 276 105 ------
NM_014723chr20142970 2832 2473 2136 2055 1129 1093 1086 1022 970 797 679 578 337 12627 ----
NM_014726chr174909 449 428 293 1231 ----
NM_014729chr851973 1636 1527 869 789 --1288 --
NM_014730chr12185277 5202 4886 4694 4334 4058 3790 3729 3434 2115 2103 2065 1976 1930 1707 1002 881 652 24266 3247 ----
NM_014730chr12185277 5202 4886 4694 4334 4058 3790 3729 3434 2115 2103 2065 1976 1930 1707 1002 881 652 24266 3247 ----
NM_014731chr2061591 1221 1113 722 542 177 ------
NM_014732chr16195620 4866 4779 4656 4529 3918 3733 1963 1914 1704 1602 1279 1270 1263 1240 1019 421 178 126 --21441 1110 --
NM_014733chr52576 385 ------
NM_014735chrX52161 1534 495 418 34 --1510 --
NM_014739chr654183 4089 3538 1264 279 ------
NM_014742chr2051523 1459 1114 722 596 --21145 384 --
NM_014743chr422548 1086 --1288 --
NM_014746chr2113999 3223 3197 3028 2757 1189 902 766 386 98 32 --1869 --
NM_014747chr1255724 5468 5296 5117 5079 5002 4596 4044 3963 3955 3827 3792 3664 3516 2199 1947 1294 1288 1248 1231 1125 801 457 445 380 11199 14061 --
NM_014751chr831981 1586 824 ------
NM_014752chr112651 541 ------
NM_014755chr243838 3509 534 94 13876 11026 --
NM_014756chr111169 ------
NM_014757chr562322 1967 1825 936 369 321 ------
NM_014758chr1172083 1867 900 893 823 683 634 ------
NM_014759chr891585 1540 1420 1128 1115 1030 390 297 122 ------
NM_014761chr162829 173 --1985 --
NM_014764chr121455 --170 --
NM_014767chr10183608 3550 3431 3170 3112 3085 3028 2850 2485 2375 1382 1242 1058 1031 790 479 259 22 33629 3349 567 23329 2509 --
NM_014770chr1231176 1146 515 ------
NM_014771chr165919 773 309 247 228 1388 ----
NM_014772chr1883597 3547 3339 2855 2794 2565 1165 972 12375 22811 2391 --
NM_014774chr182809 2605 2552 2271 888 611 372 244 --22581 861 134
NM_014776chr1252747 2266 2204 1136 187 21255 330 ----
NM_014779chr32820 805 1411 --11030
NM_014781chr81512 --1325 --
NM_014782chrX2255 121 --181 --
NM_014795chr2269 57 ------
NM_014800chr73408 360 269 --2739 213 --
NM_014802chr1241083 454 182 131 ------
NM_014806chr91173 ------
NM_014807chr113595 521 278 ------
NM_014810chr183357 2558 2275 1380 1266 575 178 57 --12316 --
NM_014812chr11121 21840 1617 ----
NM_014819chr521941 328 ------
NM_014820chr332042 1972 73 --11999 --
NM_014822chr4----1593 --
NM_014824chr1131742 558 27 --11240 --
NM_014826chr152754 1700 1693 1559 741 --14175 --
NM_014827chr121354 1274 ------
NM_014828chr1432541 1996 997 1330 1459 11841
NM_014830chr1263305 2658 2649 1412 907 100 1551 11061 13449
NM_014832chr1351702 1375 843 610 518 --11403 --
NM_014835chr2041840 777 666 168 --2742 478 --
NM_014838chr2262751 2706 2663 2276 828 39 11133 12792 --
NM_014839chr181869 1817 1547 976 775 666 571 142 1749 ----
NM_014840chr12112985 2920 2721 2594 2539 2105 1081 1032 849 510 385 --23018 123 --
NM_014841chr6--11211 11095 --
NM_014846chr8--1115 1246 --
NM_014849chr151244 1215 964 340 238 1362 ----
NM_014850chr384756 4464 4348 3807 3543 3413 1423 1287 14230 1671 --
NM_014853chr1781483 1434 1348 1128 1008 317 292 235 --1493 --
NM_014857chr12213 207 ------
NM_014858chr13362 155 111 ------
NM_014859chr175958 364 237 117 22 ------
NM_014862chr1573708 2898 1648 1417 1319 544 89 --14193 --
NM_014868chr125777 612 363 254 191 1855 ----
NM_014869chr371285 1181 1112 965 571 526 22 ------
NM_014870chr1224343 4180 4065 3854 3280 3174 2888 2867 1782 1561 1416 1339 1235 980 962 947 932 905 833 728 434 269 14575 1441 --
NM_014871chr124584 568 527 490 --1417 --
NM_014872chr962048 2038 1877 471 440 96 ------
NM_014873chr164546 3662 1312 1286 1125 841 13447 1818 --
NM_014874chr161597 1451 729 179 107 44 ------
NM_014876chr2271895 1776 1438 516 388 369 342 ------
NM_014877chr17107768 7053 6636 6618 6014 5681 5615 5360 2487 1041 --25248 4998 26521 2193
NM_014883chr44514 508 120 51 2686 393 1157 --
NM_014893chrY141 12219 21468 242 --
NM_014897chr1752573 2500 2094 934 190 1885 12759 --
NM_014898chr1932141 2042 1882 ------
NM_014899chr542812 2697 953 554 ------
NM_014901chr562231 434 237 211 113 35 ------
NM_014902chr20--1103 ----
NM_014903chr1241949 817 603 80 12452 31653 893 825 --
NM_014904chr1053072 1085 671 646 417 23190 1342 2990 567 --
NM_014906chr1723351 2769 11152 21232 831 --
NM_014907chr9140 1129 ----
NM_014909chr14143894 3674 3456 3447 3153 2622 2615 2463 2432 1303 989 750 474 341 --12956 --
NM_014912chr1043085 804 304 250 --2335 67 --
NM_014917chr12758 247 ------
NM_014918chr1521077 173 1217 ----
NM_014921chr1982885 2851 2835 2410 1915 1251 662 455 ------
NM_014925chr124746 651 370 24 ------
NM_014926chr31772 1718 ----
NM_014931chr192210 93 ------
NM_014932chr3----11875 --
NM_014933chr42160 31 ------
NM_014934chr1353813 3750 3681 93 70 1233 12706 --
NM_014935chr163354 3348 2976 1058 598 168 13020 52473 1018 905 513 442 --
NM_014937chr1031143 1108 911 --183 --
NM_014938chr1292602 2511 2269 2185 2119 2112 2001 570 435 ------
NM_014942chr621613 107 --1933 11878
NM_014944chr151279 1136 181 48 31 ------
NM_014945chr541937 725 337 131 --1103 --
NM_014946chr241133 1088 880 211 ------
NM_014947chr1103110 3029 2966 2644 1971 1154 1116 1023 697 216 --1168 --
NM_014949chr14960 803 684 667 ------
NM_014950chr141107 --11362 --
NM_014952chr1541823 1752 1659 837 --164 --
NM_014956chr116967 890 850 373 312 68 ------
NM_014961chr431638 871 601 ------
NM_014962chr2052177 2154 1134 459 58 1197 ----
NM_014964chr1772297 1961 1664 1551 965 326 142 ----1704
NM_014969chr1--1334 11110 --
NM_014970chr1--177 ----
NM_014974chr1021755 1644 --1229 --
NM_014978chr1041662 1339 1312 494 ------
NM_014982chr1483845 3620 2134 1987 891 848 378 225 35038 4410 3627 3995 645 182 24572 301
NM_014988chr442699 2245 957 851 ----166
NM_014989chr631953 1892 116 --11809 --
NM_014991chr472737 2619 2433 2087 917 839 273 --1469 11113
NM_014992chr141791 --176 --
NM_014994chr1562328 1466 497 212 190 89 11693 ----
NM_014997chr752586 2578 1925 1138 1122 ------
NM_014999chr1271647 1144 1105 1030 344 69 51 ------
NM_015000chr1253017 2717 878 483 305 ----1279
NM_015001chr13803 112 90 --1351 --
NM_015002chr1271693 1542 1495 1483 347 284 136 ------
NM_015005chr14101717 1641 1468 1428 1191 637 264 218 75 49 --2586 513 --
NM_015008chr3113621 3418 3277 2955 2643 2451 2218 1357 1067 1009 395 11407 22502 2327 --
NM_015009chr3162 ------
NM_015015chr1942046 1835 1533 1261 12034 ----
NM_015017chr131151 933 333 ------
NM_015018chr6163 ------
NM_015020chr1683641 2925 2745 2590 634 359 216 73 --11288 13486
NM_015023chr1131774 1726 1712 1680 1548 1518 1254 1145 673 354 313 296 267 --1342 --
NM_015024chr851234 904 591 319 144 ------
NM_015025chr232157 2074 466 --1926 --
NM_015026chr1294659 4580 3736 3576 1702 1027 906 886 636 13594 1977 --
NM_015032chr1332250 1164 110 ------
NM_015033chr953244 3078 2548 1067 55 --1484 --
NM_015035chr20126303 4747 4633 4410 2411 1908 1708 1482 745 631 369 83 ------
NM_015037chr101203 ------
NM_015039chr164016 3519 1615 1589 434 68 --11415 --
NM_015040chr263171 2933 2278 596 205 142 --23378 1345 --
NM_015042chr15104001 3763 3630 3528 3305 2847 907 822 694 332 23975 1123 1924 --
NM_015044chr16123233 3012 3006 2921 2746 2630 2615 1276 1127 614 329 322 158 11076 --
NM_015045chr1021420 355 ----1566
NM_015046chr932468 2392 1752 ------
NM_015049chr232421 2079 1153 ------
NM_015051chr942963 1032 863 289 ----12213
NM_015052chr72250 218 --1166 --
NM_015056chr2142550 2309 892 482 --2850 32 --
NM_015057chr13----139 --
NM_015059chr1593656 3426 3042 3027 2960 2919 2701 993 580 1946 ----
NM_015064chr1293058 2809 1343 1210 1019 621 548 540 373 1916 22771 906 --
NM_015068chr783894 3776 1590 1552 1344 1068 356 256 --21468 1226 --
NM_015069chr161604 ------
NM_015071chr5124632 4549 4528 4206 2282 1839 1245 1110 1036 692 53 23 15188 24297 1404 16019
NM_015074chr1114645 3824 3573 3135 1810 1798 1700 1347 1241 936 568 24558 3581 23509 1267 --
NM_015075chrX112088 1982 1722 1641 1540 1492 591 302 258 191 176 ------
NM_015076chr684454 3623 3600 2982 2847 1369 1053 525 --14433 24236 628
NM_015077chr17144241 4023 3856 3720 3482 3389 3351 3256 3023 2952 1830 1702 1450 254 ----1854
NM_015080chr117882 642 354 219 106 32 25 ------
NM_015082chr5112140 2101 2088 1813 944 784 775 683 496 366 340 ------
NM_015084chr541223 485 155 27 ------
NM_015087chr1352550 2208 2026 783 334 11930 ----
NM_015092chr1654130 4010 3288 3191 2943 ----12964
NM_015093chr63659 455 81 ----1240
NM_015097chr332349 1664 726 --11955 --
NM_015100chr151991 1888 1780 1732 1580 ------
NM_015107chrX82392 1779 1507 928 788 293 200 119 --21761 43 --
NM_015110chr942512 2323 2010 119 --1642 --
NM_015115chr482888 2681 2646 2350 452 192 159 93 --12325 --
NM_015116chr132319 79 --21073 562 --
NM_015132chr731772 1244 242 --11516 11321
NM_015138chr1562738 1727 1032 774 272 126 12705 32772 2073 401 --
NM_015143chr431112 323 294 ------
NM_015144chr1683402 3358 3346 3260 3112 3073 298 175 13150 ----
NM_015149chr132227 641 576 ------
NM_015153chr6----177 --
NM_015155chr1053253 3101 2476 1320 369 ----23334 2506
NM_015156chr1483870 3526 3306 1474 722 673 521 155 --12536 13926
NM_015157chr1161135 1060 751 328 310 148 ------
NM_015161chr1631457 404 43 1422 1433 --
NM_015162chr154597 542 536 386 ------
NM_015163chr1431324 199 27 ------
NM_015170chr832171 199 153 --11532 --
NM_015171chr164391 163 129 39 --1429 --
NM_015172chr121390 1115 ------
NM_015173chr441547 1489 1270 40 ------
NM_015176chr121465 161 --11347 1683
NM_015185chrX62142 1920 1889 1006 955 688 --1400 --
NM_015192chr2052844 2483 2356 451 78 --12089 --
NM_015194chr1781769 1572 1476 1355 843 187 157 68 ------
NM_015197chr14103068 2914 2837 2131 1176 580 514 348 311 184 42575 2296 2249 191 12949 --
NM_015199chr312211 1306 12618 --
NM_015200chr432008 843 127 2554 310 21813 1778 --
NM_015206chr152869 746 --13712 --
NM_015208chr181144 --23134 70 --
NM_015209chr13748 421 25 11565 ----
NM_015215chr163137 2172 2135 1956 917 813 ------
NM_015219chr1772422 720 647 307 168 117 73 ------
NM_015221chr1041003 562 105 32 ------
NM_015229chr1761033 774 480 456 448 159 ------
NM_015230chr411748 2510 104 11820 --
NM_015233chr1352509 2480 2417 979 159 --1634 --
NM_015236chr43362 191 35 ------
NM_015245chr6122611 2447 1888 1851 1723 1103 800 571 529 341 184 62 --1826 --
NM_015246chr1681990 1451 675 513 325 298 163 92 ------
NM_015247chr16125024 4829 4568 4510 3365 3302 1549 1468 728 515 418 90 ----1926
NM_015251chr165619 519 468 234 138 21942 225 42321 2014 585 416 --
NM_015252chr23899 844 601 ------
NM_015256chr52727 216 ----139
NM_015263chr152899 72 ------
NM_015264chr2294761 4152 3405 3083 1751 1356 1014 416 55 14440 13807 --
NM_015265chr272328 2306 2116 1033 726 310 51 ------
NM_015267chr1231461 593 567 --1196 1795
NM_015268chr3----2739 88 --
NM_015269chr1162 ------
NM_015270chr1282154 1725 1654 1648 901 470 355 311 ------
NM_015271chr454266 3608 2885 775 539 ----14151
NM_015272chr1622143 202 11588 ----
NM_015275chr1231801 665 220 ------
NM_015277chr1831696 187 46 165 11341 --
NM_015278chr693177 3085 2942 2865 2679 1367 595 382 307 --1895 --
NM_015282chr2102610 2499 2483 2407 2401 2320 2225 835 608 84 22416 948 ----
NM_015284chr1102062 1870 1794 1366 730 478 430 373 342 159 --161 --
NM_015288chr5163482 3210 3156 2735 2640 2623 2521 1148 927 752 617 506 352 332 111 69 ------
NM_015291chr1113320 3270 3091 2969 2936 2663 1205 1070 820 437 263 ------
NM_015292chr126517 246 153 41 33 27 --1547 --
NM_015296chr1311204 ------
NM_015299chr14133689 3646 3604 3475 3346 3266 1589 1309 1297 1121 691 231 24 1590 --12509
NM_015305chr1481738 1698 1469 1284 1271 497 392 179 11716 --11761
NM_015310chr8147899 7428 7229 7083 6659 6253 5469 2515 2440 2277 1982 1842 1741 705 32580 2027 1274 15649 15517
NM_015313chr11134064 3596 3565 3454 2957 1274 1235 1102 933 599 459 391 112 14081 11366 --
NM_015315chr593427 3387 2326 1200 1190 1164 918 692 453 12981 1464 --
NM_015317chr232344 2220 653 ------
NM_015319chr122149 38 --1398 --
NM_015320chr23685 285 95 --1808 --
NM_015321chr19154890 4731 4667 3922 3568 3079 1979 1818 1762 1714 1511 983 704 682 575 --1433 --
NM_015326chr192941 2294 2157 1925 778 633 373 198 190 ------
NM_015327chr151249 1187 972 279 262 --11114 --
NM_015328chr7142770 2612 2552 2458 2166 2147 2069 1147 710 400 255 195 106 89 --2863 502 1887
NM_015332chr7133479 3184 2888 2465 2239 1258 1249 1237 960 573 366 340 59 --11086 13040
NM_015335chr121505 ------
NM_015336chr1221637 187 ------
NM_015338chr20131917 1577 1565 1510 1291 1285 757 655 602 486 214 141 120 --21934 297 --
NM_015339chr202282 74 --191 --
NM_015344chr832081 1962 1592 ----11692
NM_015345chr642716 2434 910 244 1711 ----
NM_015346chr1431640 1622 146 --21215 515 --
NM_015347chr1252223 2153 853 780 523 --12792 12252
NM_015349chr63587 118 107 ------
NM_015353chr17142624 2535 2438 2418 2408 2097 1922 1786 1047 825 675 656 439 226 ------
NM_015354chr92358 285 ------
NM_015355chr1711567 ------
NM_015358chr2121226 280 ------
NM_015359chr8112619 2348 2223 1928 858 832 780 729 615 182 47 ----1517
NM_015365chrX73476 3463 3388 1677 388 325 291 --1737 --
NM_015374chr226992 935 504 402 232 24 ------
NM_015375chr164102 3805 3484 1092 967 503 11774 ----
NM_015378chr192879 2790 2670 2533 2176 2082 2022 936 279 --22521 1880 1451
NM_015379chr7----1211 --
NM_015381chr2251870 1443 521 434 396 ------
NM_015382chr141107 ------
NM_015385chr1063127 1206 631 523 492 341 1160 ----
NM_015387chr221536 134 ------
NM_015393chr463603 2646 2341 1370 692 526 22777 568 21002 994 --
NM_015396chr321216 962 1290 ----
NM_015397chr931420 734 297 1125 11291 --
NM_015401chr122763 132 ------
NM_015407chr31173 ------
NM_015416chr123832 788 744 --1972 --
NM_015435chr811494 --11162 --
NM_015443chr1751425 1388 1049 973 529 ----11144
NM_015446chr131700 1373 1299 --21614 1122 --
NM_015447chr95778 686 570 272 260 ------
NM_015453chr352001 1562 835 451 284 ------
NM_015455chr541189 698 231 201 2947 887 41573 1163 972 349 --
NM_015458chr885270 4337 3389 1511 1490 1379 882 797 --24656 2105 13797
NM_015460chr352117 2104 807 391 207 --135 --
NM_015461chr181593 ------
NM_015464chr761017 997 140 117 84 43 ------
NM_015470chr2111247 1188 1157 1111 1036 844 477 239 134 99 48 ----1804
NM_015472chr3----1153 --
NM_015472chr3----1153 --
NM_015475chr22263 119 --1254 --
NM_015481chr1221034 220 ------
NM_015488chr271530 1521 1158 670 626 222 133 ------
NM_015496chr8--1278 ----
NM_015497chr1541111 979 827 230 --1398 --
NM_015508chr321414 988 --1469 --
NM_015509chr1211201 --11408 --
NM_015514chr143413 405 197 ------
NM_015516chr1161400 1184 953 265 49 36 11415 ----
NM_015520chr342499 2278 1865 1112 12067 --12011
NM_015525chr611071 ------
NM_015526chr1921432 388 ------
NM_015530chr24829 634 267 253 ------
NM_015534chr131001 807 92 --11125 1852
NM_015535chr2103765 3549 2769 2650 2590 1386 1287 1139 1122 71 23555 2893 ----
NM_015541chr341308 1209 581 545 ------
NM_015542chr1031214 1029 887 ------
NM_015549chr143632 233 172 ------
NM_015553chr6145059 4716 4526 4381 4270 4260 4145 4119 3621 3291 1796 794 513 360 23643 1563 ----
NM_015554chr1562270 2244 2158 1816 250 60 --21987 1873 2790 339
NM_015556chr142240 173 ------
NM_015557chr1132774 2762 2577 1210 1144 1105 1040 895 880 867 532 454 96 --12227 --
NM_015564chr573129 2573 2246 1046 807 565 389 23283 424 12678 --
NM_015568chr20164292 3913 3519 3217 3181 3074 2996 1563 1515 1251 1173 490 253 189 152 114 ------
NM_015569chr154468 4197 4114 512 195 24457 275 14712 1471
NM_015575chr2123387 2649 2426 2280 1407 1393 1304 1268 1059 549 543 36 --1307 --
NM_015576chr322692 123 --11981 --
NM_015577chr581430 710 559 419 166 76 41 26 2582 493 --1183
NM_015578chr192629 361 ------
NM_015584chr1751372 1302 423 407 261 1213 1396 --
NM_015589chr14145 ------
NM_015595chr33865 839 125 --1364 --
NM_015599chr6157 ------
NM_015601chr101733 ------
NM_015605chr1041139 610 140 49 ------
NM_015609chr1122914 2439 2426 2413 1982 1842 1055 1032 770 668 73 33 ------
NM_015610chr782421 2300 2155 1906 1076 712 464 425 22705 207 12680 --
NM_015626chr1751154 1148 927 921 495 ------
NM_015634chr10----1201 --
NM_015635chr982010 2000 1896 1614 1438 737 389 75 --1604 --
NM_015640chr174837 4074 3952 2060 442 287 107 15318 14234 --
NM_015645chr111310 ------
NM_015646chr1231252 908 262 ------
NM_015649chr193260 54 26 ------
NM_015651chr9112223 2165 1952 1916 1817 1741 1483 1384 681 628 137 ------
NM_015652chr102493 74 ------
NM_015670chr17190 --1336 --
NM_015680chr23509 192 81 --1629 --
NM_015686chrX72432 2239 2193 900 893 788 735 11821 22469 1987 --
NM_015691chrX132967 2689 2569 2375 2367 2307 2117 1939 809 787 765 748 670 ------
NM_015695chr671429 1338 822 516 336 295 35 --12136 --
NM_015702chr2166 ------
NM_015704chr22126 ------
NM_015711chr192700 160 1118 ----
NM_015713chr852884 2779 2768 1425 778 167 ----
NM_015723chr7----1478 --
NM_015726chr161877 1327 1308 1193 50 35 ------
NM_015832chr18148 ------
NM_015833chr2111951 1539 21966 275 --
NM_015845chr182199 93 ------
NM_015850chr8102293 2059 2000 1905 1869 1769 896 374 228 148 1121 1289 --
NM_015866chr14568 370 180 150 ------
NM_015878chr831671 1660 1401 ------
NM_015879chr18138581 8460 8429 8386 7887 6645 5667 3288 3220 1724 1708 1625 145 22962 2451 38589 5870 297 --
NM_015881chr1141358 954 395 264 ------
NM_015885chr11----1175 --
NM_015889chr224810 648 130 117 ------
NM_015891chr631807 1792 746 --11939 11783
NM_015892chr1042192 2185 2024 829 --1476 --
NM_015902chr81322 ------
NM_015904chr22568 530 --1578 --
NM_015906chr134735 4562 1603 44043 3700 1094 106 13685 13437
NM_015908chr7194 ------
NM_015912chr842212 2135 939 67 ------
NM_015915chr141283 ------
NM_015957chr111265 ------
NM_015964chr16135 1130 1288 --
NM_015975chrX2405 274 11740 ----
NM_015980chr511219 --21323 1079 1290
NM_015981chr593117 2965 2561 2096 1986 634 523 312 155 --12395 --
NM_015984chr13549 127 32 ------
NM_015994chr142740 478 1285 ----
NM_015999chr1--1492 ----
NM_016003chr782421 2300 2155 1906 1076 712 464 425 22705 207 12680 --
NM_016009chr164251 3465 3230 3148 1658 1136 1966 14820 --
NM_016018chr82998 903 22309 2126 32802 1750 461 --
NM_016019chr72331 298 ------
NM_016021chr673007 2099 2004 811 672 308 233 22586 187 21125 38 --
NM_016022chr1497 83 47 37 ------
NM_016032chrX41356 1097 524 323 ------
NM_016037chr11890 ------
NM_016045chr2031577 1287 390 ------
NM_016047chr21118 ------
NM_016048chr51998 1209 ----
NM_016057chr1261290 1186 1000 959 881 382 ------
NM_016059chr62322 272 1343 ----
NM_016061chr241381 651 267 72 ------
NM_016070chr171119 1231 ----
NM_016072chr1232376 2355 2200 1733 12079 --
NM_016073chr151330 ------
NM_016075chr1332219 2106 1265 --11018 --
NM_016076chr193123 1290 1215 1179 908 645 458 393 201 --22824 32 --
NM_016079chr272049 1663 737 588 409 377 48 --2727 284 --
NM_016081chr441488 1474 766 426 --31541 250 182 --
NM_016083chr663498 3179 2938 1393 574 369 13103 ----
NM_016096chr84640 542 370 78 --147 --
NM_016097chr18--1991 ----
NM_016098chr62171 43 ------
NM_016100chr201336 ------
NM_016118chr76785 437 426 411 392 221 134 ----
NM_016120chrX2841 308 --1790 --
NM_016121chr121123 779 ------
NM_016131chr221869 781 --1160 1916
NM_016132chr1523276 698 1672 ----
NM_016133chr221431 93 ------
NM_016140chr16135 1130 1288 --
NM_016141chr33746 220 59 ----1649
NM_016144chr53297 277 69 1307 ----
NM_016147chr116986 954 941 852 413 262 1281 21052 80 --
NM_016151chr161341 ------
NM_016152chr311055 186 1474 --
NM_016156chr1132145 2122 590 --22246 2098 --
NM_016162chr123907 265 256 ------
NM_016166chr15----1209 --
NM_016185chr172123 32 --2643 533 --
NM_016192chr21100 ------
NM_016194chr1531465 606 164 --11731 --
NM_016201chr351779 828 729 404 213 --1508 --
NM_016203chr72881 64 ------
NM_016206chr3157626 7497 7184 7014 3549 3053 2812 2766 2365 2141 2070 1477 1433 570 66 28174 856 11517 16970
NM_016211chr42160 31 ------
NM_016217chr672866 2492 2324 2290 897 161 149 13419 ----
NM_016221chr592358 2074 1731 843 790 765 510 498 75 --2445 334 --
NM_016227chr131374 1329 1062 11259 ----
NM_016231chr171468 1604 ----
NM_016250chr141703 ------
NM_016252chr21269 ------
NM_016257chr1103293 3059 2859 2499 1401 1387 1206 1012 989 210 ------
NM_016258chr1----1770 --
NM_016260chr256799 2021 1860 1748 1656 1168 17511 --
NM_016269chr441121 407 196 164 --2744 101 --
NM_016272chr2242117 1930 1728 340 --1473 --
NM_016275chr321998 1812 --1639 --
NM_016279chr51431 ----143
NM_016281chr1211155 --1941 --
NM_016284chr161155 ------
NM_016287chr161870 1488 826 451 309 271 ------
NM_016289chr22176 96 --21733 756 --
NM_016312chr122387 88 ------
NM_016319chr123591 239 44 ------
NM_016320chr115934 761 751 128 61 ------
NM_016322chr992568 2549 2192 2026 1051 1005 543 159 45 --32533 475 71 --
NM_016329chr32393 63 ------
NM_016337chr141494 --1444 --
NM_016338chr531165 388 22 1273 ----
NM_016339chr1761659 1577 1462 695 663 344 11714 ----
NM_016352chr731338 1166 1089 21445 1281 ----
NM_016357chr1231216 816 55 --1877 --
NM_016374chr1----2279 183 --
NM_016374chr1----2279 183 --
NM_016376chr1754315 3992 3576 1218 730 21576 423 13478 --
NM_016377chr641444 1241 339 46 --11552 1126
NM_016395chr1521922 1381 1284 ----
NM_016396chr1563051 1973 942 618 609 73 ------
NM_016399chr124836 720 574 329 ------
NM_016401chr11------1115
NM_016406chr11355 --190 --
NM_016424chr171484 --2758 530 --
NM_016427chr181165 ------
NM_016431chr222763 211 ------
NM_016433chr1221137 90 --11429 --
NM_016436chr2031874 531 525 11042 ----
NM_016441chr23680 491 251 1151 ----
NM_016454chr151299 ------
NM_016472chr1431358 962 303 --2507 313 --
NM_016480chr52822 113 ------
NM_016486chr13180 79 49 ------
NM_016506chr112172 27 ------
NM_016507chr1732830 2048 831 --1308 --
NM_016516chr2--1855 ----
NM_016522chr1121187 35 --1204 --
NM_016525chr92211 134 --1811 --
NM_016526chr11102468 2226 2110 1883 1828 1697 1610 956 324 223 134 ----
NM_016530chr1553104 1321 1176 605 50 2983 673 1476 --
NM_016531chr444098 3221 386 62 23405 1029 ----
NM_016538chr171161 ------
NM_016542chrX--11163 ----
NM_016544chr263783 3363 1368 1061 466 101 1690 11248 --
NM_016561chr1621007 121 ------
NM_016562chrX1118 11036 --127
NM_016569chr1231025 171 46 11418 ----
NM_016570chr12134 ------
NM_016574chr114954 730 160 31 --2948 863 --
NM_016575chr12215489 5265 5221 5033 5006 4893 4406 4280 4227 4120 4106 3815 3370 2005 1550 1362 1336 1288 429 242 31 ------
NM_016577chr3104536 4233 3970 3920 1409 1258 687 432 249 126 23813 1686 23738 2853 --
NM_016588chr6----1718 --
NM_016596chr122763 132 ------
NM_016603chr531993 413 216 1724 ----
NM_016604chr51154 --1267 --
NM_016605chr592713 2594 2574 2555 2293 2159 2044 1068 832 ------
NM_016607chrX21121 92 2683 227 ----
NM_016612chr82275 43 1105 ----
NM_016620chr111423 ------
NM_016621chr11144465 4192 4099 3742 3637 3617 3398 3237 3099 3032 2816 1700 763 727 --12982 --
NM_016626chr1851416 1338 600 440 426 --1686 --
NM_016628chr102790 337 ------
NM_016631chr211725 --1210 --
NM_016641chr1641470 1376 1344 37 ------
NM_016645chr151323 ------
NM_016651chr1411140 ------
NM_016655chr15195 ------
NM_016733chr2241231 392 230 47 --1211 --
NM_016823chr173275 148 61 ----1346
NM_016824chr103363 324 277 ------
NM_016830chr121119 181 ----
NM_016831chr141946 1876 1503 542 --1947 --
NM_016834chr17134066 3628 2960 2626 2525 1659 1482 1455 1419 1150 957 359 142 12667 13447 11195
NM_016835chr17134066 3628 2960 2626 2525 1659 1482 1455 1419 1150 957 359 142 12667 13447 11195
NM_016836chr22610 555 ------
NM_016839chr22610 555 ------
NM_016841chr17134066 3628 2960 2626 2525 1659 1482 1455 1419 1150 957 359 142 12667 13447 11195
NM_016929chr694140 3450 2969 1666 1305 1132 1082 1020 302 --189 12952
NM_016932chr27934 371 364 313 285 264 27 1156 ----
NM_016936chr1681892 1546 1347 518 396 351 204 95 ------
NM_016937chrX2348 199 --1220 --
NM_016938chr111402 ------
NM_016953chr2135588 5250 4873 4570 4435 4277 2321 2184 1800 1633 1083 453 363 --1409 1537
NM_017409chr123727 582 552 --1575 --
NM_017410chr1231285 1102 387 11053 ----
NM_017412chr821007 60 --1320 --
NM_017413chrX72528 1962 1838 652 313 149 69 21725 1659 ----
NM_017415chr573888 3375 3349 2903 727 484 46 21195 914 33794 2966 1281 --
NM_017420chr14----13047 --
NM_017423chr462024 1994 1521 663 510 465 --1201 --
NM_017437chr1472346 2278 2102 2076 888 542 28 ------
NM_017447chr2174377 4277 3943 3181 1399 993 925 11168 23722 1678 --
NM_017449chr121192 591 11069 ----
NM_017452chr2031392 265 245 --31269 556 64 --
NM_017453chr2031392 265 245 --31269 556 64 --
NM_017454chr2031392 265 245 --31269 556 64 --
NM_017455chr152360 67 ----1121
NM_017491chr43770 651 398 ------
NM_017519chr61193 1257 ----
NM_017522chr11276 --11446 --
NM_017544chrX1922 ------
NM_017548chr331755 604 163 ------
NM_017550chr196443 370 253 232 124 49 --11069 --
NM_017551chr1052225 2207 605 431 411 22408 2267 12176 --
NM_017563chr3166198 5803 5639 5043 4839 4037 3902 1680 1476 1154 841 765 519 368 41 26 --22123 1586 --
NM_017580chr1031801 1477 880 1270 ----
NM_017582chr161790 1550 1283 1215 1169 82 1129 21432 377 --
NM_017583chr1121561 284 1397 ----
NM_017593chr41458 ------
NM_017596chr1154014 3779 3599 3466 3142 1392 1340 1256 1017 759 395 163 141 84 22 --14143 --
NM_017599chr1221314 228 ------
NM_017602chrX6838 653 195 181 175 91 ------
NM_017607chr192467 41 --1486 --
NM_017610chr1541862 1489 697 318 --11419 --
NM_017628chr474546 4498 4266 4206 3312 2019 1025 ------
NM_017629chr131690 1680 735 --1157 --
NM_017633chr683751 3718 3707 3135 2507 1490 1383 831 12436 2899 510 --
NM_017634chr82678 242 ------
NM_017637chr9158763 8755 8727 8486 6565 6438 6358 6049 6020 5989 1701 992 884 406 60 11376 37958 6132 3636 19349
NM_017640chr63780 341 151 ------
NM_017641chr1231040 316 134 ------
NM_017643chr1742445 2339 976 382 ------
NM_017644chr354991 3773 3421 607 292 --44357 4029 1335 1004 --
NM_017649chr1071256 1227 1205 1150 1116 402 62 ------
NM_017650chr7104915 4694 4081 3871 1875 1843 1713 1084 810 607 1966 15594 15231
NM_017657chr2----1345 --
NM_017658chr1464348 4296 3128 1763 500 324 --1443 13835
NM_017660chr1992655 2346 2199 1205 893 826 730 448 265 --22567 472 --
NM_017662chr932035 472 39 --11793 --
NM_017664chr1351064 819 744 294 281 --1159 --
NM_017666chrX51900 1412 336 323 275 ------
NM_017668chr162329 58 ------
NM_017670chr1115866 860 765 728 712 702 664 329 314 238 210 204 186 32 24 --1753 --
NM_017672chr152379 31 ------
NM_017684chr152487 69 --1513 --
NM_017686chr11889 11023 ----
NM_017693chr1331290 535 43 ------
NM_017697chr81452 ------
NM_017700chr41123 142 ----
NM_017709chr163913 2832 1520 1182 850 122 13259 23328 1162 --
NM_017712chr19186300 6044 5961 5771 5690 5541 5158 5123 4891 4548 1597 1237 1134 1029 863 712 346 240 --11701 15131
NM_017714chr201126 ------
NM_017719chr312229 1785 ----
NM_017724chr32810 288 1738 ----
NM_017728chr17142734 2659 2526 2478 2383 1970 1955 908 767 758 501 453 368 225 --11149 --
NM_017730chr31129 ------
NM_017737chr15875 859 605 418 55 1278 21630 1548 --
NM_017738chr941163 841 396 231 ------
NM_017742chr1831295 517 462 ------
NM_017744chr152487 957 869 625 437 ------
NM_017747chr51125 ------
NM_017748chr172854 131 --2788 344 --
NM_017749chr111185 ------
NM_017754chr6154903 4893 4030 3676 3530 3459 3229 1190 1017 916 890 855 569 253 78 24097 3332 14215 13447
NM_017758chr172571 153 ------
NM_017761chr121467 435 ------
NM_017769chr1413234 ----12403
NM_017772chr621371 190 --131 --
NM_017778chr831168 435 137 ------
NM_017779chr152733 2305 718 569 465 --12453 --
NM_017780chr83919 889 268 ------
NM_017784chr321187 446 ------
NM_017789chr24691 168 118 103 ------
NM_017790chr9126 ------
NM_017793chr151843 1226 ----
NM_017798chr201118 --11204 --
NM_017799chr1431435 1276 740 --1562 --
NM_017801chr332056 1695 1034 ------
NM_017811chr922335 28 23119 1086 ----
NM_017813chr875720 5201 5166 5043 3818 2051 2025 --21249 941 14426
NM_017824chr1032076 1857 813 --12659 --
NM_017831chr1873815 3782 3055 1516 1296 1251 57 --24531 159 --
NM_017842chr126692 676 619 534 477 52 ------
NM_017845chr41252 ------
NM_017847chr14468 178 163 114 ------
NM_017848chrX84480 4012 3871 2990 1149 770 708 157 --11279 --
NM_017849chr283074 2916 2386 2360 2181 1214 1172 145 ------
NM_017856chrX41565 1536 1400 348 1295 1307 --
NM_017857chr111217 ------
NM_017860chr11689 ------
NM_017866chr831000 456 442 1982 165 --
NM_017880chr21109 132 ----
NM_017893chr1031304 941 565 1959 165 --
NM_017902chr10105446 4778 4487 4462 4376 1560 611 523 205 37 24495 3645 24390 1059 11011
NM_017905chr131531 ------
NM_017910chr2----175 --
NM_017913chr91430 ------
NM_017919chr9115057 4132 3914 3538 2277 1687 1462 1399 702 621 244 11572 13761 --
NM_017921chr17102273 2191 1632 1583 1545 909 566 467 346 88 --1448 --
NM_017922chr142505 107 ------
NM_017925chr931528 533 239 1372 21830 231 --
NM_017926chr141265 --1344 --
NM_017933chr231149 362 97 ------
NM_017934chr6177 ------
NM_017935chr41175 --179 --
NM_017938chrX62157 2071 1969 533 363 52 --22179 2054 --
NM_017943chr1411035 --1259 --
NM_017944chr1142281 2108 1931 129 11895 ----
NM_017952chr2134379 4104 3814 3581 3408 3377 2984 1287 1013 853 611 369 344 --23935 1554 --
NM_017972chr141265 --1344 --
NM_017983chr17------1132
NM_017988chr121673 ------
NM_017994chr72893 53 --1778 --
NM_018004chr31306 ------
NM_018009chr121117 ------
NM_018014chr2--21384 473 11181 11408
NM_018018chr122763 276 --1743 --
NM_018026chr1191001 931 883 467 446 261 148 117 38 ------
NM_018027chr1093234 2040 1221 1052 894 790 695 233 172 --22823 161 13012
NM_018028chr194876 519 337 312 --21109 260 --
NM_018030chr1841063 1039 1017 256 ------
NM_018032chr163968 219 211 1294 ----
NM_018045chr182649 2502 2239 2061 1202 1192 767 332 --2535 133 1146
NM_018047chr53858 216 194 ------
NM_018051chr71306 ------
NM_018054chr161556 ------
NM_018061chr13475 337 54 ------
NM_018070chr11508 ------
NM_018071chr144545 227 152 114 ------
NM_018083chr19----172 --
NM_018084chr232706 356 222 ------
NM_018086chr261758 1724 1396 687 522 382 ------
NM_018087chr1133 --1193 --
NM_018089chr2----1171 --
NM_018092chr164614 333 305 254 --11687 --
NM_018094chrX179 ----1271
NM_018095chr112172 27 ------
NM_018096chr1761079 999 993 788 742 54 --1760 --
NM_018100chr693428 3363 3230 3069 2689 1344 797 759 484 --13408 --
NM_018103chr12318 289 ------
NM_018107chr14----123 --
NM_018110chr1671393 476 417 406 122 40 30 ------
NM_018111chr19122 ------
NM_018113chr123398 184 40 152 ----
NM_018114chr31109 ------
NM_018115chr42744 123 --1693 --
NM_018121chr1042669 2488 2253 161 1195 23208 2501 --
NM_018126chr421301 507 ------
NM_018128chr173367 112 22 --11110 --
NM_018133chr342168 2105 878 426 ------
NM_018144chr103373 337 232 ------
NM_018155chr352955 1322 1036 587 250 --11095 --
NM_018156chr192879 2790 2670 2533 2176 2082 2022 936 279 --22521 1880 1451
NM_018157chr1233246 2207 852 --11228 --
NM_018164chr12199 ------
NM_018172chr1171111 628 576 524 472 420 368 --21504 1178 --
NM_018178chr152025 1562 792 467 47 ------
NM_018181chr18------199
NM_018182chr1762137 2013 1735 1512 758 93 --21767 244 --
NM_018184chr381994 1488 1355 746 657 632 235 141 11345 1110 --
NM_018192chr33887 699 149 11009 1980 --
NM_018195chr1141828 1351 826 109 1707 ----
NM_018200chr1592234 2200 2176 1935 1593 1054 926 695 573 12395 22001 735 11863
NM_018202chr13889 279 170 ------
NM_018207chr141617 1099 508 40 ------
NM_018214chr63812 142 59 --11146 --
NM_018216chr13205 103 29 ------
NM_018221chr2----1123 --
NM_018222chr1131176 92 26 183 21775 72 11791
NM_018243chr4113848 3555 3531 3376 3074 2878 1437 1321 1227 644 39 1815 2607 458 --
NM_018245chr101152 ------
NM_018246chr862708 2702 2361 1964 682 277 ------
NM_018247chr632891 821 227 1650 22908 799 1313
NM_018252chr1129 ------
NM_018254chr12861 342 22223 879 ----
NM_018263chr252491 2239 1741 690 382 --12508 --
NM_018270chr204597 300 265 126 ------
NM_018285chr15127 --1510 --
NM_018286chr172806 354 ------
NM_018287chr101180 ------
NM_018293chr332235 2045 1897 --12169 --
NM_018299chr832611 622 352 ----23250 925
NM_018307chr171983 ------
NM_018312chr1161954 1721 1707 1655 849 95 ------
NM_018313chr31675 --11066 --
NM_018315chr451349 1084 990 569 216 ------
NM_018323chr431630 1394 464 --21594 734 --
NM_018330chr1031647 1068 209 ------
NM_018332chr164508 461 449 39 11367 ----
NM_018334chr71519 ------
NM_018351chr1284170 3803 3748 3325 1636 1272 452 97 --13311 --
NM_018354chr20