TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4503
miRNA Sequence: UUUAAGCAGGAAAUAGAAUUUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr521315 914 ----11308
NM_000038chr521861 295 ------
NM_000041chr191119 ------
NM_000052chrX128 13219 --23153 513
NM_000081chr121283 377 ----11331
NM_000084chrX76491 4952 2137 1295 672 581 259 26932 5340 35998 4574 2745 --
NM_000089chr7------2786 124
NM_000091chr232683 722 686 ----11132
NM_000092chr223901 1615 --13203 24411 4395
NM_000098chr13600 590 429 --1573 --
NM_000109chrX42227 828 661 435 ----1371
NM_000110chr11944 ----1952
NM_000112chr545507 2112 1677 691 34638 4286 3684 45394 4200 2169 1366 --
NM_000115chr131177 3912 423 304 --12617
NM_000125chr633887 3456 149 13321 24193 3184 --
NM_000127chr81246 1297 1343 --
NM_000129chr611473 11515 ----
NM_000138chr1541901 1816 1713 679 12434 --12532
NM_000161chr1451529 1508 1370 663 491 --21934 1573 --
NM_000163chr552382 1976 657 242 67 11905 1182 22043 85
NM_000165chr6--2587 129 --21240 1172
NM_000168chr731206 541 404 --12743 --
NM_000173chr171401 ------
NM_000176chr511302 --43819 3533 2718 606 23703 2408
NM_000183chr21464 ------
NM_000189chr232360 2195 106 22064 1569 ----
NM_000192chr1211118 1174 11448 11596
NM_000194chrX1177 --2231 94 --
NM_000212chr173803 184 70 --1297 --
NM_000214chr2021285 696 ----11791
NM_000216chrX11175 --1247 22716 902
NM_000217chr1234993 4329 938 1265 23900 1651 --
NM_000222chr421918 486 12066 ----
NM_000230chr731891 1873 489 12727 1955 1180
NM_000232chr463230 1011 720 576 323 29 ----1261
NM_000240chrX32149 1964 125 170 3804 698 95 --
NM_000245chr731517 1428 889 ------
NM_000248chr332933 520 378 ------
NM_000252chrX31298 965 321 --2500 391 --
NM_000255chr61319 ------
NM_000259chr1555620 5501 4412 2145 707 15105 36340 3927 817 26395 5560
NM_000264chr942844 2449 1355 405 22524 1206 22790 533 3441 362 76
NM_000267chr17--12342 1481 12358
NM_000275chr151105 --1343 --
NM_000276chrX1118 ------
NM_000278chr1012057 ------
NM_000314chr1052844 2838 2343 1290 646 1854 ----
NM_000321chr132599 90 ------
NM_000328chrX1416 ------
NM_000329chr1----2817 618 2933 743
NM_000332chr677064 7029 6254 5372 2375 2334 1009 11318 12422 --
NM_000337chr556373 5682 5551 4241 1007 44332 4002 1593 860 56635 5739 1837 843 139 12332
NM_000344chr51443 ----1543
NM_000346chr1712004 --1699 --
NM_000351chrX42866 1377 712 608 --14330 --
NM_000362chr2273534 2404 1299 1123 1096 977 661 12733 12543 --
NM_000368chr934845 4293 3889 34597 3095 1792 14852 1750
NM_000378chr11------21108 1013
NM_000408chr21300 13298 --11119
NM_000430chr1743457 1420 1091 1050 1226 32409 1491 459 185
NM_000439chr542522 1577 1023 102 11728 --11818
NM_000449chr12183 26 1342 ----
NM_000456chr12----1490 --
NM_000461chr333175 1182 613 14642 ----
NM_000462chr152346 340 --1357 --
NM_000489chrX43227 2984 2586 2226 --12304 --
NM_000503chr8----11876 21728 1689
NM_000522chr731056 794 407 --184 --
NM_000533chrX11362 ------
NM_000551chr32332 175 --11885 2560 137
NM_000555chrX76476 4865 2752 2276 1201 359 292 26770 6606 37338 6305 608 16152
NM_000596chr71154 ------
NM_000601chr71146 ------
NM_000610chr1122386 980 1656 ----
NM_000615chr112879 726 ----1762
NM_000618chr1265388 4914 2251 1776 1404 665 11340 46540 4892 2505 1974 --
NM_000618chr1265388 4914 2251 1776 1404 665 11340 46540 4892 2505 1974 --
NM_000633chr1854899 4372 3455 3308 2053 11378 21775 106 --
NM_000684chr10163 ------
NM_000693chr153698 439 166 11766 11294 1336
NM_000719chr1264570 4536 2224 1900 818 363 15169 --25809 4690
NM_000724chr1031428 1334 451 --21684 794 1142
NM_000735chr6270 63 ------
NM_000747chr172881 729 --1670 --
NM_000756chr81100 1117 ----
NM_000806chr521647 486 ------
NM_000809chr4128588 7770 6915 6222 6048 3532 3483 1447 1300 695 646 405 22414 2321 13511 --
NM_000810chr15----1123 --
NM_000812chr42253 159 ------
NM_000813chr575203 4117 4044 3712 1361 930 269 14739 1599 25249 4946
NM_000814chr152640 200 33603 498 437 24122 4015 --
NM_000826chr452422 2369 2219 1743 218 22068 918 2885 825 --
NM_000828chrX11853 --11511 21949 235
NM_000833chr16--11566 ----
NM_000838chr632377 1972 385 ------
NM_000844chr331009 773 192 ------
NM_000845chr7----1374 --
NM_000861chr322353 660 ----11787
NM_000868chrX2243 193 --11756 --
NM_000870chr561567 1534 1486 474 466 69 ------
NM_000875chr1577063 6865 6253 6109 5803 4714 2268 --11740 --
NM_000876chr631242 952 182 ------
NM_000877chr252992 2211 1957 782 621 1851 --22268 428
NM_000880chr83893 808 65 ----1316
NM_000899chr1223897 868 13499 --33378 1105 490
NM_000901chr4--32491 232 130 22323 1654 --
NM_000905chr7------1154
NM_000910chr41410 --21766 134 11306
NM_000912chr853057 3038 648 356 64 --12819 --
NM_000917chr101156 2859 250 ----
NM_000919chr5--173 ----
NM_000922chr112757 750 ------
NM_000926chr11139360 8876 8385 8134 7958 7631 7015 6363 6041 6014 5828 1613 204 26303 542 48335 2804 2182 192 12812
NM_000937chr171286 1412 ----
NM_000938chr4----1118 --
NM_000944chr442308 639 619 244 ----21753 665
NM_000945chr242019 1868 1612 1552 --1692 --
NM_000950chrX33602 3562 610 ----22825 2506
NM_000956chr14--1826 11086 --
NM_000963chr142501 2331 856 685 1959 22302 1813 --
NM_000965chr321266 869 --21237 87 --
NM_000966chr1231033 860 353 --1806 --
NM_001001132chr2111053 134 ----
NM_001001323chr1263209 3123 3012 737 716 674 --52817 2637 2076 1154 1093 32472 1190 968
NM_001001331chr382502 2432 2172 1033 845 804 545 485 1753 ----
NM_001001342chr1011212 ----11129
NM_001001344chrX12288 ----12065
NM_001001389chr1122386 980 1656 ----
NM_001001390chr1122386 980 1656 ----
NM_001001391chr1122386 980 1656 ----
NM_001001392chr1122432 1026 1702 ----
NM_001001394chr22687 640 ------
NM_001001395chr1282394 2193 2174 998 745 275 239 192 12735 12775 22112 401
NM_001001396chr144252 2810 1484 473 ------
NM_001001419chr545086 5061 3535 921 1498 13679 11939
NM_001001420chr545086 5061 3535 921 1498 13679 11939
NM_001001433chr2032902 2796 811 12270 --23093 1219
NM_001001436chr161197 --1351 --
NM_001001481chr861278 1208 1137 770 611 507 12321 13251 12800
NM_001001484chr1032232 899 744 --1432 --
NM_001001521chr21305 --1236 --
NM_001001549chr752468 2095 1150 372 294 ------
NM_001001550chr752468 2095 1150 372 294 ------
NM_001001555chr752468 2095 1150 372 294 ------
NM_001001557chr821862 1698 1435 11614 --
NM_001001664chr262981 2739 1645 1603 423 138 23454 3285 ----
NM_001001668chr1943715 3428 1710 1668 --44307 759 624 145 13819
NM_001001715chr131437 ------
NM_001001791chr1031688 1661 1247 11225 ----
NM_001001890chr2173657 3370 3039 2987 2706 960 405 ------
NM_001001933chr12584 202 ------
NM_001001938chr953636 3364 3133 1484 819 12554 ----
NM_001001971chr1031048 357 150 --21300 1138 --
NM_001001974chr102915 343 21729 311 21982 318 1943
NM_001001995chrX31868 1545 1274 --11702 --
NM_001002243chr2--1629 --1648
NM_001002257chr253109 2614 2541 933 717 --1750 --
NM_001002258chr22763 334 ----11977
NM_001002295chr101364 ------
NM_001002759chr10--1579 --1461
NM_001002838chrX1295 ----1418
NM_001002843chr15----1959 1521
NM_001002860chr1474488 4141 3445 1221 1032 468 146 ------
NM_001002914chr1731022 918 880 --1292 --
NM_001003407chr1094982 4899 4648 4493 4419 4377 4287 2051 1999 --11612 11233
NM_001003408chr1094982 4899 4648 4493 4419 4377 4287 2051 1999 --11612 11233
NM_001003652chr1898724 8561 8204 7181 3426 3047 2327 350 85 37219 1491 635 38547 7146 5601 25823 5285
NM_001003665chr173486 2811 2275 2200 1149 728 464 ------
NM_001003674chr18107039 6861 6742 6692 6623 5920 5747 2108 1158 219 26584 2779 --11071
NM_001003675chr18107039 6861 6742 6692 6623 5920 5747 2108 1158 219 26584 2779 --11071
NM_001003679chr132156 1948 629 22014 250 1790 --
NM_001003688chr431229 476 205 ----1943
NM_001003698chr611606 11902 --11387
NM_001003699chr611606 11902 --11387
NM_001003712chr1263492 3161 2851 1215 1099 852 13793 13805 --
NM_001003792chr321019 996 1849 ----
NM_001003793chr321019 996 1849 ----
NM_001003810chr42858 165 --1640 --
NM_001004019chr3----1409 --
NM_001004051chrX------1290
NM_001004065chr963332 3279 2686 979 733 35 --11591 12774
NM_001004304chr1222959 390 ------
NM_001004317chr654309 4052 3715 3423 1288 54506 4077 3012 2867 1750 21515 764 1941
NM_001004329chr1231404 180 40 ----193
NM_001004342chr155522 5489 3796 2048 1738 --25713 595 --
NM_001004346chr461244 1160 456 332 236 45 ------
NM_001004360chr2--11465 2778 474 --
NM_001004419chr1264634 4609 4597 4410 1631 1599 11444 ----
NM_001004720chr21931 1985 ----
NM_001004722chr211100 11154 ----
NM_001005266chr15159 ------
NM_001005267chr15159 ------
NM_001005268chr15159 ------
NM_001005269chr15159 ------
NM_001005366chr122985 141 ----1321
NM_001005375chrY2682 267 1304 1291 21361 390
NM_001005386chr24915 885 761 190 11584 22138 993 --
NM_001005463chr1011603 11633 1581 1144
NM_001005502chr1234480 4379 4027 21484 602 14220 --
NM_001005739chr21766 ------
NM_001005751chr101159 --1169 --
NM_001005849chr17------2605 588
NM_001005861chr34967 949 629 316 --1894 --
NM_001005910chr32599 487 ------
NM_001005911chr32599 487 ------
NM_001006118chrY1226 ------
NM_001006120chrY1226 ------
NM_001006600chr511593 11636 ----
NM_001006610chr161795 ----2977 35
NM_001006612chrX2390 150 ------
NM_001006613chrX2390 150 ------
NM_001006614chrX2390 150 ------
NM_001006617chr93543 233 207 ----1582
NM_001006618chr91273 ----1258
NM_001006619chr93543 233 207 ----1582
NM_001006620chr93543 233 207 ----1582
NM_001006621chr93543 233 207 ----1582
NM_001006657chr231143 894 254 --23153 2238 --
NM_001007075chr41432 11004 1441 --
NM_001007094chr1034395 4155 3321 --34362 3186 880 14500
NM_001007097chr974283 1303 647 641 382 111 42 24977 739 11709 --
NM_001007099chr12777 329 1575 1879 --
NM_001007100chr12777 329 1575 1879 --
NM_001007156chr1531791 1664 405 11566 ----
NM_001007189chr52154 28 ------
NM_001007214chr131473 343 178 ----1436
NM_001007224chr732230 465 143 ------
NM_001007226chr17129 --11163 --
NM_001007227chr17129 --11163 --
NM_001007228chr17129 --11163 --
NM_001007229chr17129 --11163 --
NM_001007230chr17129 --11163 --
NM_001007246chr211728 2423 222 1163 --
NM_001007257chr11993 1162 ----
NM_001007267chr23847 250 223 ------
NM_001007466chr6114899 4716 4610 4563 3351 2042 2023 1613 1365 1345 1161 --15206 --
NM_001007526chrY1226 ------
NM_001007553chr1------2798 160
NM_001007559chr1832008 430 329 --1523 --
NM_001008239chr181628 11297 1960 23635 3320
NM_001008392chr333286 928 285 12725 ----
NM_001008401chr1931345 942 375 ------
NM_001008405chr731831 1192 29 11470 ----
NM_001008408chr765738 4876 4098 857 452 276 14366 35969 5348 1560 12055
NM_001008495chr842033 1780 1766 650 1608 31890 485 315 --
NM_001008539chr884253 3739 3618 3604 3507 1597 592 278 11438 24391 3895 1929
NM_001008540chr23320 148 105 ------
NM_001008541chr1032020 1595 915 ------
NM_001008541chr1032020 1595 915 ------
NM_001008564chr1321667 905 12201 11380 --
NM_001008660chr1121299 1257 ------
NM_001008707chr1421262 143 ----189
NM_001008708chr2--2427 412 --1441
NM_001008726chr142146 59 --1434 183
NM_001008738chr532567 1128 787 --22196 988 --
NM_001008779chr22272 35 ------
NM_001008801chr1921953 1917 ------
NM_001008895chr1311451 ----11155
NM_001008897chr62417 210 2440 183 1518 --
NM_001008925chr453513 3374 3188 2873 393 ------
NM_001008938chr11--166 ----
NM_001009554chr474531 4250 3609 3350 1707 1224 770 --1872 --
NM_001009554chr474531 4250 3609 3350 1707 1224 770 --1872 --
NM_001009880chr2244277 1540 1261 1205 14119 ----
NM_001009899chr396377 5905 5689 2477 1619 857 760 492 398 11670 --16444
NM_001009909chr1163827 3537 1140 495 260 70 12932 --12763
NM_001009959chr222038 317 ------
NM_001009960chr742213 676 543 382 ----11874
NM_001009993chr233634 921 634 21257 956 --2706 300
NM_001010853chr6113295 3111 2496 2299 2160 1994 993 923 873 381 78 1941 ----
NM_001010861chr11731 1777 1108 --
NM_001010862chrX72766 2709 2558 2162 1182 696 114 ------
NM_001010888chrX34115 133 115 --14376 --
NM_001010891chr586964 5910 5824 4311 1736 1148 925 450 ----12098
NM_001010927chr61484 ------
NM_001010932chr71146 ------
NM_001010935chr131046 1028 742 ------
NM_001010980chr113069 23576 2855 11207 23546 2289
NM_001010989chr16------1399
NM_001010990chr16------1399
NM_001011513chr463583 3231 3225 2523 821 518 ----23959 3707
NM_001011537chr321563 646 1633 1732 155
NM_001011546chr20----138 --
NM_001011553chr72317 263 ------
NM_001011666chr765939 5457 5431 2508 2342 261 16084 46424 2370 1839 840 35448 4230 717
NM_001011713chr1411241 ------
NM_001011885chr1551784 1348 600 424 351 1433 ----
NM_001012267chr92568 235 ----190
NM_001012279chr62128 45 ------
NM_001012393chr1163877 3356 3308 1514 912 140 1171 12032 --
NM_001012398chr162928 254 ------
NM_001012420chr151141 32079 1136 884 --22385 545
NM_001012423chr151141 42079 1136 1029 884 --22385 545
NM_001012426chr61369 ----13308
NM_001012427chr61369 ----13308
NM_001012732chr4--1207 ----
NM_001012751chr101224 --11325 1453
NM_001012755chrX44952 4773 4657 705 24493 3658 1414 23967 3610
NM_001012968chrX42743 1946 880 871 --12127 1836
NM_001012977chrX21134 329 ------
NM_001013031chr1053533 3444 3273 3078 2832 --11417 --
NM_001013399chr63828 732 434 ----1350
NM_001013406chr711408 1285 ----
NM_001013415chr421435 1396 1496 ----
NM_001013437chr182325 40 ------
NM_001013620chr12138376 8244 6801 5191 5124 3320 2171 1666 1610 1115 792 621 189 --37178 3159 1450 --
NM_001013632chr1129 ------
NM_001013659chr1945284 4955 4065 1293 1835 11976 11395
NM_001013699chr123152 86 56 --1358 --
NM_001013746chr7--11703 12207 --
NM_001013843chr151317 --2268 94 1166
NM_001014380chr1365855 5165 4804 3994 3750 1114 21433 114 --15297
NM_001014431chr141792 1621 ----
NM_001014432chr141792 1621 ----
NM_001014797chr1067538 7413 7026 5873 2987 95 --17922 21953 1164
NM_001014809chr42180 146 ------
NM_001014812chr15------1175
NM_001014972chr2137 ------
NM_001015053chr1731387 1297 47 ------
NM_001015508chr83782 715 528 2692 685 ----
NM_001015877chrX2344 325 1715 ----
NM_001015881chrX1348 11261 ----
NM_001015882chr92338 274 ------
NM_001017368chr1722290 377 ------
NM_001017371chr211177 11359 ----
NM_001017395chr342930 2736 1115 120 21042 321 ----
NM_001017405chr41892 1312 ----
NM_001017415chr1----2752 647 --
NM_001017416chr1----2752 647 --
NM_001017420chr81953 --21423 257 1959
NM_001017424chr121419 192 ------
NM_001017425chr121419 192 ------
NM_001017523chr123589 561 201 1541 ----
NM_001017923chr1451348 1250 1136 678 509 1582 1136 --
NM_001017926chr841224 1174 356 317 21527 421 ----
NM_001017930chrX51361 1249 1129 947 349 11447 --31420 1308 1196
NM_001017962chr101156 2859 250 ----
NM_001017969chr92564 72 ----1252
NM_001018057chr113524 199 130 11261 ----
NM_001018067chr145037 3632 1829 288 24646 344 2747 66 25282 801
NM_001018068chr145037 3632 1829 288 24646 344 2747 66 25282 801
NM_001018069chr145037 3632 1829 288 24646 344 2747 66 25282 801
NM_001018072chr123589 561 201 1541 ----
NM_001018074chr511302 --43819 3533 2718 606 23703 2408
NM_001018075chr511302 --43819 3533 2718 606 23703 2408
NM_001018076chr511302 --43819 3533 2718 606 23703 2408
NM_001018077chr511302 --43819 3533 2718 606 23703 2408
NM_001018089chr1522529 1459 --52745 1515 1404 611 52 --
NM_001018090chr1552644 2285 2018 843 183 --2529 203 22182 175
NM_001018091chr1552754 2395 2128 953 293 --2639 313 22292 285
NM_001018100chr151620 --1839 --
NM_001018102chr1552644 2285 2018 843 183 --2529 203 22182 175
NM_001018108chr151574 --12134 1618
NM_001018111chr743616 2845 2811 739 --23115 777 --
NM_001020658chr131613 538 350 ----11189
NM_001020658chr131613 538 350 ----11189
NM_001020825chr5----31294 1008 193 11178
NM_001023567chr1552497 2440 1621 499 141 32135 2022 887 --1548
NM_001024094chr511302 --43819 3533 2718 606 23703 2408
NM_001024380chr811518 22431 2043 ----
NM_001024381chr811518 22431 2043 ----
NM_001024647chr1275222 3072 2810 2405 1091 922 175 1740 77505 4796 4762 4749 2923 2284 2160 36884 5077 4712
NM_001024649chr52603 335 21953 486 ----
NM_001024660chr321508 1065 ------
NM_001024847chr342476 2237 1564 995 ------
NM_001024934chr63589 542 57 ----1489
NM_001024935chr63589 542 57 ----1489
NM_001024936chr63589 542 57 ----1489
NM_001024947chr521105 222 ------
NM_001024948chr163205 3167 2583 243 213 142 13363 ----
NM_001024956chr1155735 5727 5712 1280 360 --34309 3731 380 22074 212
NM_001025076chr1076098 5935 5369 3805 2488 2423 710 ----25560 916
NM_001025077chr1087456 7293 6727 5163 5000 4979 4616 2068 1728 --36918 2274 483
NM_001025079chr324078 2809 1343 22625 67 23878 2949
NM_001025108chr263012 2657 1323 1247 1167 452 ------
NM_001025201chr21215 ------
NM_001025252chr862827 2761 2432 1290 1194 706 ------
NM_001025253chr862827 2761 2432 1290 1194 706 ------
NM_001025366chr621756 1603 ------
NM_001025366chr621756 1603 ------
NM_001025367chr621756 1603 ------
NM_001025367chr621756 1603 ------
NM_001025368chr621756 1603 ------
NM_001025368chr621756 1603 ------
NM_001025369chr621772 1619 ------
NM_001025369chr621772 1619 ------
NM_001025370chr621756 1603 ------
NM_001025370chr621756 1603 ------
NM_001025579chr1711001 ------
NM_001025603chr12183 26 1342 ----
NM_001025780chr921302 1058 1518 11537 --
NM_001029839chr321292 539 ----11025
NM_001029840chr321292 539 ----11025
NM_001029851chr5----1120 --
NM_001029852chr5----1120 --
NM_001029853chr5----1120 --
NM_001029854chr5----1120 --
NM_001029858chr643085 2215 1076 805 --12244 --
NM_001029863chr61233 23206 2747 12962 13102
NM_001029875chr522164 1914 12759 --22943 1020
NM_001029884chr621739 440 22701 733 --22519 24
NM_001029891chrX1303 1268 1826 --
NM_001029989chr151172 1105 1641 1291
NM_001030001chr14--1453 ----
NM_001030007chr1613435 23393 2995 ----
NM_001030055chr1474345 2870 1777 1086 652 507 202 --13082 --
NM_001030287chr1----11111 --
NM_001031623chr641305 1274 492 486 --21663 1363 1680
NM_001031679chr1263543 3429 2952 2929 2779 196 11051 --33377 3294 142
NM_001031684chr2141 ------
NM_001031692chr7167 ------
NM_001031695chr2285128 5051 4761 4659 4613 3600 848 566 23325 1077 23532 308 --
NM_001031700chr452188 2160 2132 2123 216 --1320 11982
NM_001031723chr42395 141 1420 ----
NM_001031732chr442335 2270 650 68 --13399 129
NM_001031804chr1654411 1685 1611 1571 899 23608 2943 13569 11658
NM_001031812chr552256 2007 1657 1597 1464 ----12325
NM_001032280chr611469 ------
NM_001032282chr831326 817 333 1107 --11151
NM_001032283chr122843 727 ------
NM_001032284chr122843 727 ------
NM_001032288chr2021556 1302 ------
NM_001032293chr172510 61 ------
NM_001032386chr12----1490 --
NM_001032387chr12----1490 --
NM_001032393chrX4579 229 195 82 1708 ----
NM_001032394chr642647 2615 1968 662 --32110 909 736 --
NM_001032395chr642514 2482 1835 529 --31977 776 603 --
NM_001032999chr2064944 4259 3794 1760 726 50 11800 24161 3867 13481
NM_001033025chr141205 1156 257 37 ------
NM_001033047chr432588 1846 455 ------
NM_001033049chr2111981 ------
NM_001033057chr361802 1644 1369 1335 1298 394 ------
NM_001033059chr632076 766 213 --11769 --
NM_001033087chr2063107 2255 1048 1003 950 302 --12866 11032
NM_001033112chr51216 --2850 141 --
NM_001033117chr344917 4623 3164 1047 ------
NM_001033506chr11199 ------
NM_001033507chr151816 1240 579 239 195 --1522 --
NM_001033557chr231416 1228 124 --21438 99 2302 220
NM_001033566chr171363 1743 ----
NM_001033568chr171363 1743 ----
NM_001033578chr831993 1721 975 32091 1944 794 2447 210 --
NM_001033602chr1312014 ----12707
NM_001033756chr621690 1537 ------
NM_001033756chr621690 1537 ------
NM_001033925chr1021907 1384 1777 12064 1817
NM_001034845chr461355 1026 1007 950 489 430 21046 115 ----
NM_001034954chr1032549 1238 1207 --12706 1145
NM_001034955chr1032549 1238 1207 --12706 1145
NM_001034956chr1032549 1238 1207 --12706 1145
NM_001034957chr1032549 1238 1207 --12706 1145
NM_001035chr131294 956 852 1867 ----
NM_001035003chr42938 97 ------
NM_001035004chr42938 97 ------
NM_001035267chr121239 ------
NM_001035512chr11106 21924 438 ----
NM_001035513chr11106 21924 438 ----
NM_001037132chr761608 1574 1497 594 376 43 ------
NM_001037133chr761608 1574 1497 594 376 43 ------
NM_001037164chr751579 1521 1250 576 341 1728 1593 11747
NM_001037165chr738163 711 179 38841 7988 5473 --25577 590
NM_001037174chr251961 1560 783 654 327 --21932 450 22032 660
NM_001037317chr11731 1777 1108 --
NM_001037332chr542326 2240 897 790 --1751 --
NM_001037333chr542326 2240 897 790 --1751 --
NM_001037334chr1862454 2367 2084 1857 714 354 --22335 824 126
NM_001037535chrX21527 263 --11110 --
NM_001037536chrX21527 263 --11110 --
NM_001037540chrX21527 263 --11110 --
NM_001037637chr52317 89 ------
NM_001037808chr16------180
NM_001037954chr1133356 2197 572 --22865 2724 23309 2553
NM_001039091chrX31346 1239 1076 11358 ----
NM_001039348chr2----1323 11041
NM_001039349chr2----1323 11041
NM_001039395chr992195 2087 1799 1754 805 494 474 289 22 31942 1847 625 ----
NM_001039465chr143438 423 365 ------
NM_001039538chr243707 2423 1321 1135 12781 ----
NM_001039547chr3126441 6256 6235 6139 5400 4917 3232 1680 1659 900 853 544 --16560 45678 2251 1125 505
NM_001039573chr172202 54 ------
NM_001039577chr123818 1082 13604 13551 --
NM_001039580chr464095 1907 1891 1458 995 470 ----13179
NM_001039590chrX43147 2564 1185 980 ------
NM_001039591chrX43147 2564 1185 980 ------
NM_001039618chr1165375 4602 4546 1753 602 138 14367 11307 15529
NM_001039709chr2064944 4259 3794 1760 726 50 11800 24161 3867 13481
NM_001039762chr1032217 668 53 ------
NM_001039771chr142810 151 ------
NM_001039802chr121197 321 --1918 2306 63
NM_001039840chrX55248 4562 4247 1213 859 11602 14582 1289
NM_001039916chr1221000 955 ------
NM_001039917chr1221000 955 ------
NM_001039918chr1221000 955 ------
NM_001039919chr1221000 955 ------
NM_001039920chr1221000 955 ------
NM_001039937chr1374064 3770 3154 3082 1580 971 260 --23108 2552 --
NM_001040001chr651600 1585 715 580 462 1434 ----
NM_001040020chr721449 242 --1548 11414
NM_001040031chr19----180 --
NM_001040057chr731306 967 953 11229 21018 215 1186
NM_001040100chr33970 436 48 ----1349
NM_001040101chr411106 ------
NM_001040113chr162944 712 ----1963
NM_001040142chr251937 1794 444 360 40 11837 --41876 1514 1504 657
NM_001040143chr251937 1794 444 360 40 11837 --41876 1514 1504 657
NM_001040152chr734606 3661 3404 --24322 1519 --
NM_001040158chr51150 151 ----
NM_001040159chr441501 1157 545 327 ----1167
NM_001040172chr561567 1534 1486 474 466 69 ------
NM_001040173chr561567 1534 1486 474 466 69 ------
NM_001040202chr442514 395 313 207 --2435 368 --
NM_001040214chr61921 1100 11847 11738
NM_001040272chr911646 --11938 11727
NM_001040284chr1695916 4911 4423 4333 4256 2016 1533 781 232 1283 11124 1583
NM_001040402chr463139 2641 2367 899 649 160 2931 680 1473 1269
NM_001040429chr1353213 2916 2472 1003 402 --22767 1254 22337 239
NM_001040440chr52425 98 --1460 --
NM_001040441chr174075 3360 2079 1568 549 229 219 54653 3843 1830 1615 615 44907 4763 4447 423 25207 3622
NM_001040450chr1532247 603 463 12845 ----
NM_001040453chr1532247 603 463 12845 ----
NM_001040458chr521636 326 --1292 --
NM_001040633chr71110 2428 151 --1175
NM_001040694chr1121123 811 --11154 1867
NM_001040708chr8--136 1431 --
NM_001040712chr923184 185 ----31348 482 327
NM_001040875chr882372 2068 1931 1899 1800 915 519 481 --11034 --
NM_001040876chr431276 615 477 ------
NM_001042355chr1663930 3908 3624 3303 1477 1092 1325 11070 1145
NM_001042357chr1031409 1208 187 1510 11252 --
NM_001042358chr1031409 1208 187 1510 11252 --
NM_001042360chr1031409 1208 187 1510 11252 --
NM_001042363chr1031409 1208 187 1510 11252 --
NM_001042388chr18------1825
NM_001042389chr1031409 1208 187 1510 11252 --
NM_001042390chr1031409 1208 187 1510 11252 --
NM_001042392chr1031409 1208 187 1510 11252 --
NM_001042395chr1031409 1208 187 1510 11252 --
NM_001042406chr62923 353 ------
NM_001042412chr1663930 3908 3624 3303 1477 1092 1325 11070 1145
NM_001042413chr973610 2791 2598 2495 1540 864 47 13841 183 12557
NM_001042425chr611469 ------
NM_001042453chrX11690 --21234 77 --
NM_001042473chr1032175 1559 307 1703 22112 785 --
NM_001042475chr6------141
NM_001042481chr1432171 809 381 --32011 869 829 1939
NM_001042486chr201359 ------
NM_001042492chr17--12342 1481 12358
NM_001042494chr1543813 3134 2468 2335 --33399 2458 24 --
NM_001042495chr1543813 3134 2468 2335 --33399 2458 24 --
NM_001042496chr1543813 3134 2468 2335 --33399 2458 24 --
NM_001042497chr1543813 3134 2468 2335 --33399 2458 24 --
NM_001042506chrX21144 329 1303 ----
NM_001042510chr821670 1418 --22138 766 --
NM_001042511chr821670 1418 --22138 766 --
NM_001042533chr322115 833 1647 --33213 2481 555
NM_001042537chrX32001 1946 719 22208 868 1891 --
NM_001042550chr951662 726 656 602 78 12065 1356 --
NM_001042552chr111357 11028 ----
NM_001042555chr1274594 4399 3026 1873 1107 1063 961 13450 ----
NM_001042573chr1712193 ------
NM_001042599chr256997 3105 1476 728 152 11372 36116 5681 4889 --
NM_001042601chr312962 23229 2551 1777 1567
NM_001042603chr1244917 3616 580 410 11699 1273 --
NM_001042604chr364461 3380 1541 1208 1165 865 34844 3776 1410 1944 2665 163
NM_001042632chr2032551 1959 474 11643 ----
NM_001042633chr2032551 1959 474 11643 ----
NM_001042683chr641672 1362 152 127 --21477 1282 --
NM_001042728chr1231033 860 353 --1806 --
NM_001042749chrX71419 1298 719 690 403 128 122 21318 1246 --1499
NM_001042750chrX71419 1298 719 690 403 128 122 21318 1246 --1499
NM_001042751chrX71419 1298 719 690 403 128 122 21318 1246 --1499
NM_001043351chr132172 1725 725 ----12029
NM_001044305chr62584 74 11597 2524 418 1596
NM_001044385chr252762 1379 464 251 168 2507 359 ----
NM_001044722chr552256 2007 1657 1597 1464 ----12325
NM_001044723chr552256 2007 1657 1597 1464 ----12325
NM_001046chr521049 457 ----1767
NM_001049chr141211 --42088 1954 709 422 12273
NM_001071775chr1341920 1805 426 194 --1706 --
NM_001078chr11721 ----1300
NM_001079874chr141981 1883 1845 847 ----193
NM_001083620chr452420 2367 2217 1742 217 22066 917 2884 824 --
NM_001099678chr3106403 5760 5474 4270 2086 2056 1852 1623 1379 186 24934 72 25979 2103 1855
NM_001100108chr187934 7618 6810 5200 2851 1632 1249 113 27950 2778 12963 37183 6245 2663
NM_001102566chr11771 --1922 --
NM_001105518chr13851 782 740 ------
NM_001106chr388960 8593 8195 7890 6114 3093 2693 544 49054 1926 1566 1399 13719 29660 9313
NM_001113490chrX83419 3247 2899 2769 1106 904 898 873 33636 3557 3166 1190 2317 307
NM_001115chr8174 ------
NM_001117chr1822305 333 11831 ----
NM_001119chr421419 381 ------
NM_001121chr1021350 705 --11622 --
NM_001122631chr111590 --1254 --
NM_001122679chr521315 914 ----11308
NM_001123chr102198 157 ------
NM_001128chr1613435 23393 2995 ----
NM_001144chr163976 262 99 11233 11060 --
NM_001146chr822217 593 ----11543
NM_001151chr4174 ------
NM_001167chrX105374 4871 2603 2508 2133 1884 1317 1215 929 352 24217 1623 --26210 1567
NM_001173chr1474345 2870 1777 1086 652 507 202 --13082 --
NM_001174chrX11742 --11923 --
NM_001186chr212948 393 32153 2126 345 12801 --
NM_001198chr612375 --11655 --
NM_001201chr41490 12440 33644 613 29 --
NM_001204chr267157 7041 6989 5680 1086 218 17746 27056 5360 22424 66
NM_001206chr952648 2115 886 526 464 --13023 12696
NM_001207chr52317 89 ------
NM_001219chr732301 1954 257 ----12137
NM_001222chr1031594 665 482 21724 109 --1249
NM_001233chr71143 11999 --31688 1473 664
NM_001241chr271696 1513 636 600 558 452 111 1891 ----
NM_001241chr271696 1513 636 600 558 452 111 1891 ----
NM_001257chr1631329 1167 24 ----1235
NM_001259chr795368 2485 2014 1886 1849 1788 1526 1324 1209 --22129 1180 --
NM_001270chr53761 354 257 1958 ----
NM_001271chr1513203 11124 ----
NM_001280chr191599 ----147
NM_001284chr5171 1466 ----
NM_001293chr112541 21 ------
NM_001294chr19----1434 --
NM_001304chr1783643 2877 2688 1380 1071 812 506 330 ------
NM_001310chr1232843 2524 509 12828 --22046 264
NM_001313chr42180 146 ------
NM_001316chr201391 ------
NM_001326chr111394 ----166
NM_001329chr1041620 1353 1125 177 --11245 --
NM_001330chr16------1999
NM_001331chr1121970 183 ------
NM_001332chr52987 401 ------
NM_001351chr32586 172 11335 --1288
NM_001356chrX22410 2173 21858 826 11964 --
NM_001357chr12286 83 ------
NM_001364chr1114744 11810 --12973
NM_001378chr21126 ------
NM_001385chr81283 ----1331
NM_001386chr842402 2117 1844 1672 ------
NM_001396chr2132841 2270 2121 --11929 2181 85
NM_001400chr11940 ------
NM_001401chr92655 540 ------
NM_001402chr621998 1742 ------
NM_001407chr371347 1188 1155 1119 694 610 250 ------
NM_001412chrX63295 3201 2827 2518 1158 644 ----13543
NM_001418chr111219 ------
NM_001418chr111219 ------
NM_001420chr192762 718 1451 13155 --
NM_001423chr1222044 1668 ------
NM_001427chr742051 1609 533 215 --21883 270 --
NM_001430chr221982 748 --1546 --
NM_001431chr621248 294 1837 ----
NM_001438chr153381 3308 2870 2698 902 1416 --12663
NM_001439chr141205 1156 257 37 ------
NM_001448chrX21772 136 ------
NM_001451chr161956 ------
NM_001452chr62641 535 ------
NM_001453chr621725 690 ------
NM_001455chr654258 1939 1629 1209 121 34232 3815 3541 34528 1612 1339 --
NM_001463chr23630 563 107 --1803 --
NM_001482chr153839 744 51 1343 ----
NM_001490chr91582 33623 982 572 --1615
NM_001491chr622578 1752 22471 2336 ----
NM_001498chr641329 1243 976 353 --11048 11251
NM_001518chr71322 123 ----
NM_001526chr6--1162 ----
NM_001527chr664703 3897 3289 3197 550 359 2742 454 ----
NM_001546chr651198 1131 1103 1046 301 ----1447
NM_001560chrX22649 1624 --12629 --
NM_001587chrX1118 ------
NM_001609chr1074389 4197 3050 2998 1434 1017 1003 --1181 12940
NM_001616chr231169 498 71 13443 1715 --
NM_001621chr742986 2560 1005 706 21901 175 --13015
NM_001621chr742986 2560 1005 706 21901 175 --13015
NM_001634chr632076 766 213 --11769 --
NM_001642chr1111103 11331 ----
NM_001650chr182892 413 13203 --13780
NM_001655chr1132061 1858 811 ----11816
NM_001656chr531606 1587 527 --1476 11363
NM_001659chr1222525 922 1869 12654 --
NM_001660chr33737 182 148 ------
NM_001663chr1411693 --32661 2590 503 --
NM_001664chr3151 ------
NM_001668chr112020 ------
NM_001674chr1----11111 --
NM_001679chr32313 291 ------
NM_001682chr1262923 2837 2726 451 430 388 --52531 2351 1790 868 807 32186 904 682
NM_001683chr382502 2432 2172 1033 845 804 545 485 1753 ----
NM_001688chr1--1288 --1828
NM_001689chr22763 334 ----11977
NM_001690chr322236 459 --12020 21881 1597
NM_001694chr161291 ------
NM_001695chr844250 1491 1466 101 --22778 1364 --
NM_001699chr19--1282 ----
NM_001701chr91628 ------
NM_001707chr71859 ------
NM_001709chr1132315 1119 524 11097 12506 --
NM_001730chr1341604 1454 1297 205 ------
NM_001730chr1341604 1454 1297 205 ------
NM_001740chr161515 ------
NM_001742chr751775 1769 1605 1518 746 --11164 --
NM_001743chr23539 520 45 ------
NM_001744chr52490 476 --1392 --
NM_001746chr52603 335 21953 486 ----
NM_001752chr114593 496 490 34 ------
NM_001753chr711812 --41884 1757 1496 476 --
NM_001754chr2173657 3370 3039 2987 2706 960 405 ------
NM_001755chr1611792 --12292 11686
NM_001759chr1244295 3903 2077 279 15273 --23292 1812
NM_001774chr19----180 --
NM_001777chr324078 2809 1343 22625 67 23878 2949
NM_001788chr72317 263 ------
NM_001791chr121197 321 --1918 2306 63
NM_001792chr182805 110 --1284 --
NM_001797chr162310 216 ------
NM_001822chr21215 ------
NM_001827chr9----1182 --
NM_001854chr1--11254 1369 --
NM_001855chr91622 --177 --
NM_001858chr654140 3696 2051 1472 844 ----33413 3210 419
NM_001866chrX------134
NM_001874chr1234480 4379 4027 21484 602 14220 --
NM_001882chr51435 ------
NM_001902chr11318 ------
NM_001904chr3------1887
NM_001912chr9------1265
NM_001918chr119187 39054 494 268 39099 1820 1385 22555 931
NM_001921chr4--1207 ----
NM_001935chr2--1780 --1236
NM_001938chr161665 1263 1214 543 239 75 --1587 --
NM_001949chr652873 2622 2338 875 566 13105 ----
NM_001951chr81579 ------
NM_001955chr61833 ------
NM_001957chr432069 707 624 ----11947
NM_001964chr51804 1753 --11123
NM_001967chr31553 ------
NM_001969chr1473834 3186 2852 2548 211 100 24 1902 ----
NM_001970chr171639 ------
NM_001977chr461741 1307 530 169 130 23 1400 11161 --
NM_001981chr152177 1726 1647 1485 885 11529 11913 22096 1810
NM_001987chr1234193 4174 2716 --13406 --
NM_001995chr41204 1294 ----
NM_001998chr3----1409 --
NM_001999chr521178 391 ------
NM_002009chr1542720 2020 614 363 ------
NM_002015chr131687 --1941 23285 2820
NM_002017chr11----21082 548 --
NM_002024chrX12231 --11955 12065
NM_002025chrX78185 7794 3632 2485 2151 1914 1779 11062 16464 13638
NM_002033chr1163812 1163 1135 926 301 242 ------
NM_002039chr41222 ------
NM_002040chr2142735 367 255 45 1628 11282 --
NM_002041chr15186 ------
NM_002048chr91207 ----1864
NM_002051chr101364 ------
NM_002069chr7----21291 1205 --
NM_002077chr921585 131 --11389 --
NM_002078chr32556 87 --123 1278
NM_002086chr1731654 490 308 1826 --12200
NM_002092chr473779 3694 3476 3168 1503 588 168 --24956 3580 2944 234
NM_002106chr41141 ------
NM_002114chr61529 ------
NM_002126chr17134088 3659 3053 2863 2594 1599 1421 1415 1379 597 465 393 168 ------
NM_002128chr1321655 563 22273 928 ----
NM_002134chr161115 ------
NM_002137chr732253 1842 1522 ------
NM_002138chr42858 165 --1640 --
NM_002139chrX----1179 --
NM_002140chr91770 1311 --1116
NM_002145chr171135 ------
NM_002156chr21342 ----1457
NM_002158chr233776 1245 558 --13473 --
NM_002163chr162454 161 31197 979 377 ----
NM_002187chr511260 ----160
NM_002190chr61239 --1439 --
NM_002193chr241907 1805 1700 318 ------
NM_002196chr20------1924
NM_002196chr20------1924
NM_002199chr41894 ----1684
NM_002203chr523784 2891 1670 21108 426 33069 744 656
NM_002207chr3------1498
NM_002211chr1011038 --1825 --
NM_002214chr775698 5636 4173 3589 1860 608 597 ----24136 4124
NM_002222chr3--11193 ----
NM_002226chr142329 137 ------
NM_002228chr131234 1132 972 ------
NM_002232chr1----1349 --
NM_002239chr2------21143 751
NM_002240chr212466 105 ------
NM_002245chr12553 60 ------
NM_002247chr1041774 755 596 472 12208 ----
NM_002264chr374660 4513 4477 1401 1376 442 130 --25073 1176 --
NM_002267chr1322437 632 22373 589 1838 22337 1691
NM_002268chr32619 267 11837 --21714 1216
NM_002270chr574934 4289 3825 1589 1375 932 863 --35710 5688 1446 35382 5239 3667
NM_002271chr1322210 955 11828 ----
NM_002285chr263012 2657 1323 1247 1167 452 ------
NM_002290chr62920 545 ------
NM_002293chr112094 1154 ----
NM_002296chr161741 1178 621 576 318 174 ----1549
NM_002310chr5136522 6065 6039 5911 5690 5333 4669 4477 2295 1917 1225 741 586 14337 16205 12357
NM_002313chr1094982 4899 4648 4493 4419 4377 4287 2051 1999 --11612 11233
NM_002333chr1911107 ------
NM_002336chr1274803 3453 1733 1451 874 731 209 --23743 997 13898
NM_002349chr23507 178 123 --1255 --
NM_002351chrX31587 1564 644 11594 2536 391 --
NM_002356chr642865 1140 961 743 1243 ----
NM_002358chr4----1586 --
NM_002359chr1741679 686 636 461 21025 509 --1773
NM_002373chr1511083 --1859 --
NM_002374chr243707 2423 1321 1135 12781 ----
NM_002376chr141545 1522 ----
NM_002381chr21322 1839 --1127
NM_002395chr621459 566 ------
NM_002397chr53697 430 201 ----11907
NM_002398chr231369 1018 326 ------
NM_002399chr1511232 ------
NM_002402chr711204 --1951 --
NM_002408chr141747 1620 ----
NM_002409chr2211143 ----13202
NM_002430chr2242476 2273 1670 485 --32070 282 155 --
NM_002449chr531220 486 37 ----1931
NM_002451chr921132 1120 --31112 545 67 --
NM_002460chr631250 571 466 13659 11364 --
NM_002469chr121405 ------
NM_002473chr2211046 1939 ----
NM_002480chr121284 --1160 --
NM_002486chr92879 80 22117 1850 ----
NM_002487chr152759 206 ------
NM_002500chr2265 47 21120 248 1884 --
NM_002501chr1922915 1115 12695 ----
NM_002515chr1441892 806 294 223 --22059 446 11898
NM_002519chr1131504 1489 414 11149 ----
NM_002526chr631447 685 333 ------
NM_002527chr12171 ------
NM_002544chr171321 ------
NM_002545chr1163877 3356 3308 1514 912 140 1171 12032 --
NM_002546chr82522 250 --1684 --
NM_002547chrX2453 185 ------
NM_002553chr71374 ------
NM_002556chr112536 494 11472 ----
NM_002577chr3--189 --13335
NM_002581chr995366 4471 4395 3924 3813 3641 773 727 335 --1766 15197
NM_002591chr20------1552
NM_002595chr1221954 341 --21836 494 --
NM_002601chr22402 61 ------
NM_002607chr711241 --1191 --
NM_002613chr1635318 2091 225 1956 13795 --
NM_002623chr202661 154 --131 2571 52
NM_002628chr321231 890 ------
NM_002629chr101303 1268 1829 --
NM_002641chrX2638 384 --11657 --
NM_002645chr1112517 ------
NM_002646chr122142 285 11957 ----
NM_002655chr854399 4004 3373 1774 952 1437 ----
NM_002657chr2043924 2763 747 660 ----12421
NM_002670chr331385 516 417 --1586 1266
NM_002687chr1431162 380 144 11072 21089 897 --
NM_002703chr441243 1216 121 115 --11839 --
NM_002706chr22699 511 --1721 --
NM_002709chr243043 2305 514 364 12793 41107 872 535 373 12230
NM_002710chr12----1797 --
NM_002715chr531064 492 405 11048 ----
NM_002716chr1173645 3354 3263 3079 2813 1477 435 12566 --11282
NM_002729chr102768 599 ------
NM_002734chr1751973 1800 1737 523 123 11794 --11817
NM_002736chr731956 1479 493 --31819 1591 298 --
NM_002737chr1755009 2654 1257 961 231 26424 618 26158 5699 12637
NM_002742chr14163 ------
NM_002745chr2294408 3957 3851 3694 3533 3316 3260 3113 266 ------
NM_002748chr151974 --2902 72 --
NM_002753chr41746 ------
NM_002755chr151221 --1868 --
NM_002763chr1------1524
NM_002765chrX31346 1239 1076 11358 ----
NM_002787chr7--1111 --3685 622 60
NM_002811chr163548 520 95 ------
NM_002813chr1221456 1094 ----11475
NM_002815chr17------1213
NM_002822chr1231390 1327 455 --1220 --
NM_002823chr21604 ------
NM_002828chr181861 ------
NM_002834chr1273852 3622 3238 2523 1556 1413 385 22890 847 ----
NM_002835chr72289 244 ------
NM_002837chr1254266 4190 3809 1005 581 --23555 227 1137
NM_002838chr121099 197 1402 31228 1160 762 11033
NM_002839chr923184 185 ----31348 482 327
NM_002843chr111622 --23248 3145 12613
NM_002844chr621394 1172 ------
NM_002845chr184635 460 158 98 ------
NM_002851chr72596 590 ------
NM_002852chr31238 ------
NM_002858chr131335 209 91 --1484 1949
NM_002868chr1232307 1900 1518 ------
NM_002869chr1111846 189 --2898 636
NM_002874chr942182 909 755 703 --12256 22449 1768
NM_002876chr17133 ------
NM_002884chr131046 1028 742 ------
NM_002886chr385120 5018 1880 1425 1186 778 308 276 14126 --11278
NM_002890chr52705 65 ------
NM_002892chr1431107 667 657 --11444 --
NM_002902chr151260 --1508 1443
NM_002906chr1142124 1808 1565 183 --1607 1499
NM_002912chr63739 299 46 ------
NM_002918chr191932 ------
NM_002923chr11435 ------
NM_002924chr11609 ------
NM_002940chr431276 615 477 ------
NM_002941chr321200 353 ------
NM_002942chr311415 ----21252 428
NM_002945chr171601 ------
NM_002948chr32268 61 ------
NM_002955chr611606 11902 --11387
NM_002957chr933207 2812 383 13949 ----
NM_002958chr34967 949 629 316 --1894 --
NM_002959chr143825 3088 2730 1766 11359 24394 622 --
NM_002968chr162958 364 ------
NM_002976chr2--1211 ----
NM_002977chr263342 1135 947 502 475 25 12429 1443 1549
NM_002979chr12777 329 1575 1879 --
NM_002998chr831911 1529 1474 2842 265 ----
NM_002999chr2021721 1579 ----11418
NM_003001chr11106 21924 438 ----
NM_003010chr1732413 1534 426 ----11742
NM_003011chr921664 633 --1600 1481
NM_003013chr4--1276 --1695
NM_003016chr1742011 1972 1668 1552 1189 ----
NM_003020chr15--1307 ----
NM_003022chrX2478 96 1900 ----
NM_003026chr941252 1048 259 75 --21321 1040 --
NM_003029chr121040 295 ----1425
NM_003031chr161795 ----2977 35
NM_003034chr12157317 7019 6213 5767 5623 4981 3171 2486 2166 1729 1583 1355 1113 905 396 --17483 --
NM_003046chr884253 3739 3618 3604 3507 1597 592 278 11438 24391 3895 1929
NM_003051chr12762 675 --1699 11239
NM_003054chr10----133 --
NM_003068chr81891 1219 --1192
NM_003071chr332095 1878 1699 ----21821 676
NM_003074chr321802 1582 ------
NM_003075chr122278 212 ------
NM_003079chr172412 344 ------
NM_003081chr2011050 11198 11014 --
NM_003099chr1566251 4276 2419 2053 1851 1524 --24989 423 16551
NM_003100chr51350 ------
NM_003106chr3------1718
NM_003107chr611869 32133 1841 94 12382 22301 353
NM_003108chr247178 6594 6338 799 66276 1410 1273 1159 1107 713 ----
NM_003110chr171947 --11009 1934
NM_003111chr211177 11359 ----
NM_003112chr753010 1268 862 474 42 --12736 1308
NM_003115chr11123 198 ----
NM_003128chr232796 2553 2022 --1342 --
NM_003149chr321182 250 ------
NM_003150chr1722239 1955 22009 788 ----
NM_003151chr2--150 --1190
NM_003155chr812753 --21724 579 1789
NM_003157chr31256 160 1879 --
NM_003161chr1721287 820 12556 ----
NM_003162chr23794 360 33 ------
NM_003178chr342259 464 189 169 --12078 --
NM_003179chrX2273 125 ------
NM_003182chr71134 ------
NM_003182chr71134 ------
NM_003183chr21697 ------
NM_003184chr81886 --41130 1121 1014 787 1714
NM_003185chr20------179
NM_003188chr61150 1818 ----
NM_003199chr1834700 1105 489 12027 ----
NM_003202chr52723 75 ------
NM_003211chr1211400 ----127
NM_003220chr611469 ------
NM_003221chr623653 3021 13798 23998 1370 --
NM_003234chr32885 770 11511 ----
NM_003236chr241169 1131 1043 177 --1474 --
NM_003242chr342476 2237 1564 995 ------
NM_003253chr2151924 1788 1568 674 211 11325 ----
NM_003255chr1742539 2333 2306 1006 --12444 --
NM_003257chr1521334 946 --1282 --
NM_003262chr321438 1210 1191 ----
NM_003270chrX178 ----21159 1014
NM_003274chr2142172 1981 1971 1086 ----12595
NM_003288chr2011048 1613 ----
NM_003291chr132732 165 ------
NM_003298chr396215 6034 5413 5379 4060 2418 2119 1361 993 35975 2015 1456 21823 562 12352
NM_003304chr341437 1066 457 253 --21091 296 --
NM_003309chr641619 316 305 63 ----21833 1694
NM_003315chr17149 --1247 --
NM_003317chr14--1818 1603 --
NM_003338chr1031471 1462 83 11724 11707 --
NM_003339chr541079 547 340 126 11431 ----
NM_003340chr431146 1136 129 --21013 437 --
NM_003341chr3154 ----1539
NM_003342chr1733224 2838 2227 22888 421 ----
NM_003344chr721652 1134 11372 ----
NM_003345chr164551 533 505 57 ------
NM_003347chr22--2523 322 ----
NM_003348chr1251723 1531 514 387 282 1234 ----
NM_003349chr2021556 1302 ------
NM_003350chr82914 647 ----1408
NM_003358chr9157 ------
NM_003368chr1----2752 647 --
NM_003373chr1021634 619 ----11965
NM_003374chr51753 --123 --
NM_003376chr621756 1603 ------
NM_003376chr621756 1603 ------
NM_003387chr25851 393 325 210 191 --22604 2290 1825
NM_003392chr352910 1660 1391 1289 1146 22749 838 --13248
NM_003400chr21826 --1177 --
NM_003404chr201362 11798 21534 256 --
NM_003405chr22----2642 512 --
NM_003406chr841672 1601 724 90 --1158 --
NM_003409chr1831190 1012 135 ------
NM_003410chrX53040 901 697 601 311 --32055 509 198 1945
NM_003411chrY2605 222 ----1548
NM_003412chr333055 3020 779 1383 12409 --
NM_003413chrX31980 1890 1375 ----1402
NM_003418chr31192 ------
NM_003421chr1034395 4155 3321 --34362 3186 880 14500
NM_003442chr112837 739 --1688 --
NM_003443chr1124 ------
NM_003457chr172510 61 ------
NM_003463chr64941 506 234 83 23210 3199 1547 11302
NM_003467chr23320 148 105 ------
NM_003468chr264112 3920 2843 1342 688 653 23107 815 31579 1481 623 21182 511
NM_003471chr352211 921 675 534 258 1946 --11827
NM_003472chr611285 1204 1331 --
NM_003473chr102907 85 ------
NM_003474chr1031768 894 407 --2753 325 1105
NM_003477chr114588 171 114 33 ------
NM_003478chr1162632 2210 875 856 836 48 22551 763 13312 --
NM_003483chr1252861 2758 1189 504 261 --11966 --
NM_003488chr171389 1981 2394 211 3896 681 249
NM_003489chr2173438 3297 3096 2624 2482 550 509 12892 2219 172 --
NM_003490chr2221035 288 ------
NM_003558chr93644 550 219 1467 ----
NM_003563chr17129 --11163 --
NM_003566chr1253276 2950 2785 986 685 ----13471
NM_003567chr1--1352 ----
NM_003574chr1895399 4796 4578 4301 3989 2194 1576 1293 64 11780 13614 24553 4328
NM_003581chr21931 1985 ----
NM_003583chr1223880 832 1587 ----
NM_003586chr161606 1529 ----
NM_003589chr1311451 ----11155
NM_003590chr263335 3186 2902 2894 2485 933 11358 1387 11434
NM_003591chr102425 126 ------
NM_003603chr432096 1338 413 ------
NM_003607chr113418 3535 293 217 11675 --
NM_003615chr3103260 3183 2954 2602 2519 1152 1136 355 347 97 33739 3413 3387 13728 33136 1071 598
NM_003618chr211115 --1201 172
NM_003620chr1721000 160 ----2787 308
NM_003626chr111340 ----11047
NM_003629chr1103119 1293 1287 1085 1000 896 458 306 274 93 11055 23462 2400 --
NM_003630chr61674 ------
NM_003631chr101256 --1826 --
NM_003632chr172879 243 ------
NM_003644chr1756255 4301 1903 327 253 16558 --16549
NM_003648chr242299 2234 359 343 ----12197
NM_003651chr121161 ------
NM_003659chr221092 1067 1120 1443 --
NM_003663chr353363 2856 2567 1184 515 --23391 3039 --
NM_003670chr331375 1272 939 --1253 --
NM_003671chr953461 2723 1225 549 483 ----13193
NM_003672chr12461 208 --11208 --
NM_003677chr1232035 1643 318 ------
NM_003685chr19----11004 1854
NM_003692chr92368 164 1813 2922 648 1885
NM_003705chr22782 149 ------
NM_003713chr11236 ----11536
NM_003716chr33806 207 115 ------
NM_003718chr7--1149 --1175
NM_003719chr5----1120 --
NM_003722chr342658 2361 623 523 --167 1394
NM_003749chr134849 616 584 91 11975 1828 --
NM_003750chr10--1806 ----
NM_003752chr16------180
NM_003758chr1521289 505 --11040 --
NM_003758chr1521289 505 --11040 --
NM_003759chr43640 526 210 --13351 1834
NM_003760chr11300 ----1657
NM_003762chr111424 --1206 --
NM_003763chr2032902 2796 811 12270 --23093 1219
NM_003766chr171103 ----1483
NM_003769chr122343 322 ------
NM_003772chr1131206 1114 64 --1352 --
NM_003774chr1263220 3071 2276 1180 904 527 --2849 188 12884
NM_003787chr1831717 1657 1275 ------
NM_003791chr16--189 ----
NM_003797chr112151 142 ------
NM_003800chr631929 314 101 1279 ----
NM_003816chr821191 952 --1351 --
NM_003822chr133059 2951 2101 ------
NM_003825chr1561367 1230 526 364 249 77 21159 226 11553 --
NM_003828chrX1515 ------
NM_003858chr141605 ------
NM_003861chr1442417 971 427 62 --12806 --
NM_003862chr51245 ----1123
NM_003870chr151208 --1337 --
NM_003872chr233016 2159 1966 1766 ----
NM_003873chr1042169 932 629 568 ------
NM_003877chr121968 1150 --1170
NM_003887chr222150 928 --12288 1510
NM_003895chr2122106 2084 ------
NM_003902chr1--1111 ----
NM_003909chr832061 943 291 --1320 1139
NM_003916chrX--1249 ----
NM_003924chr421472 437 1531 ----
NM_003927chr182836 195 --1950 --
NM_003930chr722587 31 --22494 2407 2904 726
NM_003931chr63589 542 57 ----1489
NM_003932chr2231833 1542 1355 ----11504
NM_003934chr911025 ----11189
NM_003941chr722478 1742 1279 ----
NM_003956chr101117 ------
NM_003958chr663819 3272 3182 1559 1515 711 ----12576
NM_003966chr577378 6825 6041 5186 2375 2325 537 12074 37338 6074 1702 --
NM_003968chr32575 180 ----1638
NM_003971chr172549 242 ------
NM_003972chr1021226 848 1215 11270 --
NM_003980chr63945 451 353 --11439 21449 1203
NM_003983chr1631541 1172 673 --13827 13057
NM_003987chr1012057 ------
NM_003988chr1012134 ------
NM_003989chr1011993 ------
NM_003990chr1011993 ------
NM_003994chr1223897 868 13499 --33378 1105 490
NM_004006chrX42227 828 661 435 ----1371
NM_004007chrX42227 828 661 435 ----1371
NM_004009chrX42227 828 661 435 ----1371
NM_004010chrX42227 828 661 435 ----1371
NM_004011chrX42227 828 661 435 ----1371
NM_004012chrX42227 828 661 435 ----1371
NM_004013chrX42227 828 661 435 ----1371
NM_004014chrX42227 828 661 435 ----1371
NM_004015chrX42227 828 661 435 ----1371
NM_004016chrX42141 742 575 349 ----1285
NM_004017chrX42227 828 661 435 ----1371
NM_004018chrX42141 742 575 349 ----1285
NM_004020chrX42227 828 661 435 ----1371
NM_004021chrX42141 742 575 349 ----1285
NM_004022chrX42141 742 575 349 ----1285
NM_004023chrX42141 742 575 349 ----1285
NM_004028chr182892 413 13203 --13780
NM_004035chr1765060 1263 547 527 229 22 21912 455 ----
NM_004040chr221313 416 ------
NM_004050chr1462780 2502 1767 841 458 410 32265 2216 643 ----
NM_004055chr111333 ------
NM_004056chr83702 285 278 ------
NM_004080chr721227 120 ----11296
NM_004081chrY2682 267 1304 1291 21361 390
NM_004085chrX2187 169 ----1535
NM_004087chr321565 421 --1292 --
NM_004089chrX1348 11261 ----
NM_004090chr1733414 3294 75 ------
NM_004094chr1422689 1068 ------
NM_004105chr2----1323 11041
NM_004109chr1192361 1903 1780 1741 723 698 387 308 267 --1552 --
NM_004111chr111243 ------
NM_004112chr171688 ------
NM_004113chr32688 188 1411 21902 446 --
NM_004114chrX2483 463 11206 21218 1027 1410
NM_004124chr1453570 3537 3468 966 825 43582 3417 3185 2970 22651 2572 --
NM_004132chr1011114 ------
NM_004136chr1542952 2368 387 344 12467 12724 --
NM_004145chr191285 ------
NM_004152chr191237 ------
NM_004157chr3----2798 615 --
NM_004161chr231104 328 314 --21081 590 --
NM_004162chr321304 403 --1436 1958
NM_004170chr921677 1351 --31510 1423 70 --
NM_004171chr11118511 7487 6722 6491 3626 2972 2307 1661 1566 799 113 37871 7697 138 48421 6965 1320 897 39398 7718 7267
NM_004180chr21258 ------
NM_004181chr41312 ------
NM_004185chr12680 566 --1729 --
NM_004202chrY--1214 176 --
NM_004209chr1611084 ------
NM_004215chr81523 --1103 --
NM_004225chr831276 451 128 --1936 --
NM_004226chr2192 ------
NM_004227chr742768 2694 1004 912 12547 ----
NM_004229chrX32031 1989 307 22068 75 --1206
NM_004232chr1841385 997 919 141 11148 ----
NM_004238chr2------1236
NM_004242chr6--1418 ----
NM_004261chr12181 84 ----1795
NM_004267chr31356 ----166
NM_004268chr112475 133 2337 254 ----
NM_004272chr521326 64 --11415 --
NM_004274chr1453214 2166 1119 474 253 --22672 1110 --
NM_004277chr621507 1103 --21617 415 1334
NM_004279chr72666 251 11910 12082 --
NM_004286chr2232572 2475 282 --12776 --
NM_004293chr933877 1425 1134 13199 22876 1118 --
NM_004301chr32278 97 ------
NM_004311chr1021906 776 ----1950
NM_004319chr142873 2774 2275 1057 ----13147
NM_004326chr12491 334 ------
NM_004330chr1521038 288 ------
NM_004331chr822355 243 1775 --12337
NM_004337chr8--2544 79 ----
NM_004338chr18107039 6861 6742 6692 6623 5920 5747 2108 1158 219 26584 2779 --11071
NM_004342chr712111 1328 ----
NM_004349chr821169 100 ------
NM_004370chr641574 532 80 29 1634 ----
NM_004379chr21283 ----11710
NM_004380chr1612631 11040 --2395 133
NM_004384chr552256 2007 1657 1597 1464 ----12325
NM_004392chr1321753 139 ------
NM_004393chr33917 511 500 ------
NM_004397chr1143339 3260 1661 1538 --23246 2664 --
NM_004405chr2156 ----1731
NM_004415chr66780 724 625 616 118 89 ------
NM_004430chr81607 --22561 578 12340
NM_004432chr922042 1486 32100 648 508 1465 11635
NM_004434chr1421262 143 ----189
NM_004437chr163168 3047 2830 1225 1201 415 ------
NM_004440chr641451 796 467 432 --1616 --
NM_004447chr122853 440 --1787 --
NM_004449chr2111300 --21426 1294 --
NM_004457chr241282 1248 689 469 ------
NM_004458chrX52614 2601 2065 1767 780 1396 --12151
NM_004459chr1731937 1694 260 ----11747
NM_004464chr472750 2724 1212 1079 627 531 512 --32933 2639 251 31508 985 651
NM_004466chr131752 1179 ----
NM_004469chrX1471 ------
NM_004481chr112307 --12636 --
NM_004482chr21246 ------
NM_004485chr153878 3556 3363 3310 228 24194 282 ----
NM_004496chr1421076 251 ------
NM_004497chr19----1711 --
NM_004499chr51181 ------
NM_004500chr1431945 1394 713 --21834 1791 --
NM_004501chr133692 3249 876 22884 185 14044 --
NM_004503chr122743 652 ------
NM_004504chr232501 2273 1101 12746 11229 --
NM_004505chr1741967 1330 583 285 ------
NM_004506chr61712 --1106 --
NM_004514chr17------1909
NM_004521chr101364 1384 ----
NM_004529chr931233 1225 91 ------
NM_004535chr2021569 1090 ------
NM_004537chr1241483 521 491 120 ----1457
NM_004538chrX1646 ----1537
NM_004571chr2183129 2704 2470 2246 1086 681 503 240 1126 ----
NM_004575chr411318 1389 2600 464 1320
NM_004586chrX55411 5273 5244 4037 3605 21682 402 1523 44499 3859 1291 1028
NM_004591chr22382 104 --1178 --
NM_004593chr32901 591 --1585 2949 79
NM_004598chr542129 250 221 147 --23298 2027 11007
NM_004602chr2021460 1283 ------
NM_004607chr51184 ------
NM_004612chr964281 4007 3682 1382 1051 985 --34561 3914 846 21922 1898
NM_004621chr1141260 1242 1109 234 ----1494
NM_004622chr252467 2347 1859 681 294 --32337 1743 364 --
NM_004630chr11--155 ----
NM_004637chr31375 --11271 --
NM_004643chr142800 228 ------
NM_004650chrX31607 563 124 ------
NM_004654chrY21179 939 ----11313
NM_004660chrY32322 2280 763 21788 816 ----
NM_004661chr5--1507 ----
NM_004663chr152255 220 21122 482 --11358
NM_004667chr153461 279 259 ------
NM_004673chr131308 1087 1045 --11249 11182
NM_004685chr1332232 730 110 2886 766 22836 1158 --
NM_004686chr821597 533 ------
NM_004687chr171244 12108 ----
NM_004690chr6--1184 --1290
NM_004697chr941020 883 338 80 ----11074
NM_004705chr111597 ----1142
NM_004708chr19178 ------
NM_004709chrX31391 485 284 11714 --21430 1346
NM_004713chr141621 1704 --1630
NM_004716chr11180 --1843 --
NM_004717chr71979 ------
NM_004718chr23587 151 99 ----1205
NM_004723chr11273 ----11051
NM_004726chrX21532 382 11730 1692 25059 4270
NM_004730chr521890 690 1481 1544 --
NM_004736chr151691 1639 284 191 21 12038 12018 --
NM_004737chr2211235 ------
NM_004738chr20----22142 702 --
NM_004744chr453497 2806 1178 150 48 ------
NM_004745chr8126828 5963 5767 4488 4421 2697 2233 2117 1734 1491 1025 992 21064 777 --36355 2332 998
NM_004747chr101355 ------
NM_004748chr1554004 3659 3079 438 190 13589 14235 14193
NM_004755chr141296 ----1804
NM_004762chr172624 323 ----11884
NM_004768chr11303 ------
NM_004770chr81159 ----1171
NM_004774chr1723155 2656 22984 823 22262 254 --
NM_004775chr1851725 879 729 686 134 1327 --21593 376
NM_004781chr121778 567 11316 ----
NM_004781chr121778 567 11316 ----
NM_004788chr1122009 948 12148 12329 --
NM_004795chr13------11834
NM_004796chr1452039 1662 1580 617 420 --22433 445 11871
NM_004798chr201700 ----13033
NM_004799chr11289 ------
NM_004801chr221003 253 ------
NM_004805chr21355 ------
NM_004807chr222384 179 --12495 12517
NM_004808chr1033388 1353 884 23105 912 1539 --
NM_004815chr151692 1327 564 395 59 24723 1349 --14760
NM_004820chr8------1106
NM_004822chr1723790 3501 ------
NM_004824chr61927 ------
NM_004831chr191703 ------
NM_004834chr2113133 2837 2782 2655 2581 2572 2242 2223 948 862 547 --11033 22514 874
NM_004839chr152487 276 --1712 --
NM_004842chr611331 1421 2354 89 --
NM_004849chr641652 1446 530 409 ------
NM_004850chr2--21707 683 1657 --
NM_004859chr1742539 2360 1139 755 12676 11868 1326
NM_004863chr1455272 4407 3499 1989 1391 24582 1715 14720 34857 4331 3987
NM_004866chr584730 4528 3558 3478 3435 1970 1594 649 ----13720
NM_004867chrX3194 181 116 ------
NM_004893chr51150 151 ----
NM_004898chr432510 702 413 ----12633
NM_004902chr201792 ----1638
NM_004904chr765939 5457 5431 2508 2342 261 16084 46424 2370 1839 840 35448 4230 717
NM_004906chr6----1577 --
NM_004912chr711408 1285 ----
NM_004926chr1421134 312 21843 222 ----
NM_004947chr312354 11933 11630 12404
NM_004949chr1832080 1903 625 21325 148 ----
NM_004956chr764412 4316 3168 744 505 359 ----21782 1233
NM_004958chr12757 208 ------
NM_004965chr212275 200 ------
NM_004966chr102271 262 ------
NM_004973chr641748 1720 1281 1245 ------
NM_004985chr1284449 4251 4004 3296 3201 3121 932 143 ------
NM_004987chr21170 ------
NM_004992chrX55783 5522 2733 2345 2058 31929 1043 970 27721 5573 17200
NM_004992chrX55783 5522 2733 2345 2058 31929 1043 970 27721 5573 17200
NM_004995chr1411245 --11518 --
NM_004998chr151335 ----1696
NM_004999chr643727 2898 1029 810 --1152 1737
NM_005010chr761608 1574 1497 594 376 43 ------
NM_005017chr31265 ------
NM_005023chr541565 1350 598 229 158 11481 --
NM_005025chr3------1221
NM_005026chr141246 499 167 132 11939 ----
NM_005027chr191376 ------
NM_005028chr102819 121 11494 --21569 1511
NM_005032chrX4787 168 85 77 ----1357
NM_005037chr31146 ------
NM_005045chr71284 --1659 21001 334
NM_005053chr19189 ------
NM_005054chr231375 490 80 1219 ----
NM_005056chr1255161 3860 824 654 254 11943 1517 --
NM_005057chr111269 --21200 282 2545 146
NM_005058chrY1226 ------
NM_005063chr1031307 419 63 --12643 11105
NM_005065chr1454363 1608 1493 1426 775 21311 433 11172 24931 146
NM_005066chr1147 ------
NM_005079chr862827 2761 2432 1290 1194 706 ------
NM_005086chr1211518 41760 1259 727 531 11152 --
NM_005093chr2064944 4259 3794 1760 726 50 11800 24161 3867 13481
NM_005097chr102342 251 ------
NM_005105chr121346 92 21923 527 ----
NM_005110chr53222 163 125 1756 1683 --
NM_005116chr2024498 1326 --11117 --
NM_005117chr111103 ----1292
NM_005119chr141263 1087 307 69 --11027 --
NM_005121chr1753656 3560 868 770 667 13404 11016 32538 1031 999
NM_005124chr63998 981 757 ------
NM_005126chr342108 1540 1486 521 11409 11702 --
NM_005128chr21--1671 124 --
NM_005134chr18------1825
NM_005135chr1543813 3134 2468 2335 --33399 2458 24 --
NM_005151chr1862454 2367 2084 1857 714 354 --22335 824 126
NM_005153chr161562 --3730 313 223 --
NM_005154chr152453 65 ------
NM_005156chr943620 3612 1237 1092 13995 11070 24427 2061
NM_005159chr152565 110 11850 32228 2197 2147 --
NM_005160chr2225882 1906 24740 1555 15483 16222
NM_005163chr141792 1621 ----
NM_005171chr1231231 1093 833 11262 ----
NM_005180chr1031499 1394 680 ----1642
NM_005188chr1198235 7441 6832 6470 6005 5594 5414 3305 1610 --15359 25678 2093
NM_005189chr1722495 2330 ------
NM_005190chr63828 732 434 ----1350
NM_005197chr1436063 4048 1577 21437 434 35824 1756 1570 --
NM_005201chr32997 200 ------
NM_005203chr101173 ------
NM_005207chr2273290 3179 2593 2347 1167 402 352 ----12846
NM_005215chr182558 259 ------
NM_005231chr111187 ------
NM_005233chr332492 2285 358 ----2986 524
NM_005235chr256997 3105 1476 728 152 11372 36116 5681 4889 --
NM_005238chr1143480 2402 710 275 23401 262 ----
NM_005239chr2132060 1798 1594 ------
NM_005243chr221354 ------
NM_005249chr142879 140 ------
NM_005254chr15----11269 --
NM_005256chr111688 ------
NM_005259chr2----1359 11266
NM_005264chr102926 592 ------
NM_005277chr451923 1888 681 417 155 1597 146 11617
NM_005311chr752468 2095 1150 372 294 ------
NM_005313chr1521294 174 ------
NM_005316chr111305 1872 11104 --
NM_005324chr1741990 1855 86 56 --21307 358 11560
NM_005328chr81235 ------
NM_005336chr251978 1839 1696 1626 1558 --1212 --
NM_005338chr753466 3425 3336 1323 376 13808 22719 2580 22973 1016
NM_005339chr4124057 3849 3733 3452 3308 3281 3009 1693 1023 858 453 289 23441 2996 13059 --
NM_005342chrX42586 2580 805 102 ------
NM_005349chr4----1551 --
NM_005358chr1341826 625 421 185 --1561 --
NM_005359chr18126258 6130 5744 5590 5416 4172 4020 4011 2542 1769 1627 65 24544 218 25795 2416 41099 1073 924 514
NM_005378chr21882 1901 2820 343 --
NM_005382chr81354 ------
NM_005385chr342618 2468 756 55 11876 ----
NM_005386chr20----1792 --
NM_005387chr112550 434 ------
NM_005388chr93601 227 60 --11131 1496
NM_005392chr921493 475 1428 ----
NM_005397chr743616 2845 2811 739 --23115 777 --
NM_005402chr741828 1167 342 75 1356 ----
NM_005406chr1831288 1043 246 ------
NM_005409chr43821 381 60 11054 ----
NM_005433chr1832122 898 290 --22136 1071 --
NM_005436chr1043782 1004 434 304 --1543 --
NM_005450chr17----1183 --
NM_005455chr131769 1285 254 11205 ----
NM_005461chr2041998 1907 1763 1329 --1702 --
NM_005471chr531307 912 867 ----1988
NM_005474chr1731387 1297 47 ------
NM_005475chr1232730 626 215 ------
NM_005477chr1541818 949 652 63 ------
NM_005477chr1541818 949 652 63 ------
NM_005493chr61666 --1630 1797
NM_005494chr72568 479 1575 --1549
NM_005497chr17--23892 1377 34177 2132 894 14659
NM_005507chr112381 373 ------
NM_005509chr521772 1295 --21792 1338 --
NM_005520chr53597 232 197 ------
NM_005521chr102832 259 ------
NM_005522chr72567 456 --21144 73 --
NM_005530chr1561133 1121 1115 204 95 62 --11455 --
NM_005542chr731321 629 587 11374 1400 1471
NM_005544chr21159 1862 ----
NM_005563chr12800 683 ------
NM_005573chr5------1711
NM_005578chr353509 1553 1385 1320 912 33523 1105 402 14558 23263 766
NM_005587chr151959 ------
NM_005596chr986331 5999 5858 5655 4111 2444 479 140 22302 1726 22427 1049 26437 4211
NM_005599chr111201 1592 ----
NM_005600chr11231 ------
NM_005602chr31277 --11197 --
NM_005603chr18--31284 648 405 --12011
NM_005604chr622501 443 12272 12239 1420
NM_005607chr81160 ------
NM_005610chr12612 177 ----1922
NM_005611chr16140 11001 --1238
NM_005614chr72778 361 ----1291
NM_005627chr61125 ----2751 650
NM_005637chr1832008 430 329 --1523 --
NM_005638chrX51485 1342 1118 672 241 11643 ----
NM_005644chr11390 ------
NM_005655chr831326 817 333 1107 --11151
NM_005664chr153687 433 285 ------
NM_005665chr164914 4709 4553 1858 413 282 34641 4499 3605 21207 965 --
NM_005667chr2195 ------
NM_005668chr533593 1514 259 ----1570
NM_005686chr111553 ------
NM_005688chr31356 ------
NM_005711chr52953 701 ------
NM_005715chr642754 2558 502 93 --1173 --
NM_005717chr141102 1055 285 246 --11173 --
NM_005721chr21376 ----1338
NM_005722chr24915 885 761 190 11584 22138 993 --
NM_005730chr1263607 3536 3431 2942 2230 612 23660 152 ----
NM_005737chr2----11894 21994 935
NM_005738chr751579 1521 1250 576 341 1728 1593 11747
NM_005739chr1521492 135 2975 817 31689 920 845 --
NM_005744chr151151 ------
NM_005746chr742112 351 151 47 ----12042
NM_005748chr1242997 1166 667 635 --11271 --
NM_005749chr17--1582 ----
NM_005752chr1631203 1014 350 --31050 1019 900 11145
NM_005754chr51274 --1112 1840
NM_005765chrX----1262 1217
NM_005776chr143749 346 161 1547 ----
NM_005780chr131733 ------
NM_005789chr171167 ------
NM_005801chr17125 183 ----
NM_005802chr91542 ------
NM_005806chr2111109 ------
NM_005807chr12215 184 ------
NM_005808chr333286 928 285 12725 ----
NM_005813chr232442 2040 515 ------
NM_005826chr1181 1571 ----
NM_005828chr1732002 1841 783 24336 3589 34011 1620 463 --
NM_005829chr1531434 1390 778 11188 ----
NM_005832chr31392 --1950 --
NM_005839chr1--1271 1761 --
NM_005840chrX55923 2546 1912 1612 896 25976 1549 23063 2360 22472 1887
NM_005841chr4----1406 1415
NM_005842chr132608 174 ------
NM_005853chr161403 ------
NM_005857chr141339 1205 1076 200 ------
NM_005859chr52373 336 ------
NM_005862chr311012 ------
NM_005863chr10143 ------
NM_005868chr731884 853 135 ------
NM_005871chr102990 728 --11077 --
NM_005875chr32327 254 ------
NM_005880chr1611091 11487 1290 --
NM_005882chr41892 1312 ----
NM_005885chr511119 --11332 --
NM_005896chr22577 113 ------
NM_005898chr1132824 2414 1991 32280 963 326 32985 264 24 13214
NM_005899chr1741344 1145 1090 86 ----1984
NM_005900chr431229 476 205 ----1943
NM_005901chr1898724 8561 8204 7181 3426 3047 2327 350 85 37219 1491 635 38547 7146 5601 25823 5285
NM_005902chr1543747 3507 3254 261 --24544 3246 --
NM_005903chr545086 5061 3535 921 1498 13679 11939
NM_005904chr1821112 84 11153 1966 --
NM_005905chr131365 1446 ----
NM_005906chr62406 332 11649 --11371
NM_005907chr641580 1319 224 143 11505 ----
NM_005909chr5------13123
NM_005911chr251473 1394 1379 1371 1098 ------
NM_005924chr72435 282 1852 21154 104 --
NM_005930chr142104 54 ----1364
NM_005935chr483766 3692 3618 3240 1819 1717 582 499 1267 34910 4543 952 25243 4518
NM_005941chr843281 2798 2785 1193 1479 --13091
NM_005955chr175556 3743 1110 933 631 456 266 14767 25436 561 --
NM_005962chr1032020 1595 915 ------
NM_005962chr1032020 1595 915 ------
NM_005966chr252078 1739 774 540 476 --2591 420 --
NM_005968chr19------199
NM_005975chr20--1814 ----
NM_005985chr201711 ------
NM_005986chr1332775 2205 1850 ----11952
NM_005996chr122962 553 11467 ----
NM_006007chr934287 1142 758 13296 --1907
NM_006015chr121268 312 ------
NM_006016chr622328 688 1350 1501 11669
NM_006017chr41794 --123 --
NM_006033chr1832316 1807 523 12216 ----
NM_006036chr242223 2121 671 166 --1147 12213
NM_006037chr231663 1315 637 14550 21949 908 21113 420
NM_006041chr17----1188 --
NM_006047chr2053520 2906 2436 1134 152 2804 414 1865 --
NM_006054chr1121486 99 31627 1170 286 ----
NM_006055chr21721 --12257 31146 1029 346
NM_006060chr713706 ------
NM_006080chr722220 109 1382 12663 11145
NM_006086chr161248 ------
NM_006089chrX31873 1622 1586 --11184 --
NM_006094chr822176 568 --22233 868 11884
NM_006095chr494369 4007 3913 3771 3282 1588 1482 1150 744 --14143 11358
NM_006100chr33470 417 143 168 ----
NM_006106chr1123450 2319 11082 23141 2705 --
NM_006113chr141981 1883 1845 847 ----193
NM_006114chr191443 ------
NM_006135chr121377 1190 ----1316
NM_006136chr72410 150 21290 213 11332 1534
NM_006143chr121135 ------
NM_006147chr12339 66 ------
NM_006158chr851684 1282 1216 286 196 ------
NM_006164chr21414 ------
NM_006166chr1242526 754 646 549 --1138 --
NM_006178chr1741553 1232 423 182 --11599 11192
NM_006186chr231284 1033 360 2811 295 ----
NM_006194chr1431347 1039 310 --1538 11067
NM_006195chr9--1901 1505 --
NM_006197chr811921 1153 ----
NM_006203chr555476 5253 3380 2077 1885 15010 --12223
NM_006206chr432224 656 385 --21941 599 1111
NM_006212chr175063 5031 1378 1203 1103 1019 166 --11705 --
NM_006224chr1712485 ----11790
NM_006226chr211404 1909 1428 --
NM_006241chr322411 573 --22260 494 11760
NM_006246chr14--11258 11300 --
NM_006252chr187570 5627 5332 5016 2180 1745 1738 414 ----47058 6664 6216 4771
NM_006256chr172615 1840 1722 683 662 532 230 32499 2109 1781 --1143
NM_006259chr4--1356 ----
NM_006264chr42465 443 ------
NM_006265chr851495 1485 1178 386 44 ------
NM_006267chr231442 225 56 1194 --21883 1723
NM_006275chr2062399 1771 823 454 364 69 --22268 993 1738
NM_006277chr23753 586 248 ------
NM_006281chr8----11158 --
NM_006281chr8----11158 --
NM_006282chr2024555 675 24499 4475 12912 --
NM_006283chr854996 3794 1983 1777 532 --21695 395 --
NM_006287chr22183 122 12451 12459 11972
NM_006291chr1422057 187 ------
NM_006293chr151222 --1378 11031
NM_006298chr653416 3075 294 274 190 21334 286 1530 --
NM_006301chr12----1595 --
NM_006306chrX94965 4390 4041 3983 3747 1648 1582 604 445 25491 3800 21670 1623 --
NM_006310chr1721237 1023 11047 ----
NM_006311chr17159 ------
NM_006312chr122770 229 ------
NM_006313chr1211708 11487 ----
NM_006315chr484298 4010 3985 3677 3185 3075 318 67 --23825 3295 23922 2853
NM_006317chr51717 ------
NM_006325chr12--1173 1873 --
NM_006330chr821484 543 --31337 427 334 --
NM_006335chr1------3769 266 235
NM_006346chr132114 79 ------
NM_006352chr132034 625 295 --11631 21584 675
NM_006357chr2------1205
NM_006359chrX32001 1946 719 22208 868 1891 --
NM_006363chr202224 65 ------
NM_006364chr1451220 1057 525 431 207 11244 31142 970 265 --
NM_006366chr611113 ----11338
NM_006372chr61513 ------
NM_006375chrX21830 675 ----11768
NM_006378chr921048 505 ------
NM_006379chr732125 1931 1833 ----11751
NM_006380chr1754113 3304 2969 1470 1233 1345 ----
NM_006386chr2252295 2077 1973 798 731 ------
NM_006393chr1033245 2982 1666 --24166 915 14062
NM_006401chr9------174
NM_006413chr101201 ----11481
NM_006415chr921128 170 1326 11200 1258
NM_006416chr6----1723 --
NM_006420chr2023285 520 ------
NM_006421chr82947 395 ----2225 130
NM_006434chr1032549 1238 1207 --12706 1145
NM_006449chr2--21876 1807 1446 --
NM_006451chr531046 949 303 11092 1145 --
NM_006457chr463583 3231 3225 2523 821 518 ----23959 3707
NM_006459chr1021319 348 --1803 11869
NM_006460chr173683 618 551 11203 11223 --
NM_006465chr1522326 1642 ------
NM_006467chr522311 2213 12083 2948 331 11619
NM_006469chr141220 1163 1088 34 1372 ----
NM_006475chr132443 28 ------
NM_006482chr1223880 832 1587 ----
NM_006489chr1441892 806 294 223 --22059 446 11898
NM_006493chr1321243 1149 ------
NM_006504chr10----32762 2747 1113 --
NM_006520chrX41505 1374 550 80 1203 21646 1475 --
NM_006526chr2052067 1338 436 390 46 12168 ----
NM_006532chr1931931 1762 207 ------
NM_006534chr2022990 1250 ----13327
NM_006538chr242880 1158 293 44 12568 ----
NM_006540chr841533 1464 1068 1027 ----11125
NM_006544chr1474394 3952 1889 1622 1471 1114 886 14576 44850 3713 1877 1435 --
NM_006546chr1766386 4401 1368 1346 1324 539 1681 35839 5622 4300 26051 267
NM_006547chr71351 11930 21835 58 --
NM_006548chr311541 ------
NM_006557chr911334 ----11512
NM_006559chr11360 11195 1480 2366 266
NM_006561chr1076098 5935 5369 3805 2488 2423 710 ----25560 916
NM_006565chr161454 ----21051 47
NM_006570chr91116 ----189
NM_006575chr141575 1544 1217 --
NM_006577chr231244 920 448 11179 ----
NM_006595chr1122012 94 --21269 508 12026
NM_006599chr16137837 7620 7530 7192 6710 6648 6450 5476 5162 1658 1421 366 164 2787 310 28021 7513 15671
NM_006601chr121362 --1750 --
NM_006602chr201186 1611 ----
NM_006603chrX71419 1298 719 690 403 128 122 21318 1246 --1499
NM_006609chr242004 1032 870 608 12776 1155 1702
NM_006614chr383622 3334 2983 2481 1225 872 856 203 --12724 --
NM_006618chr131448 437 353 11581 ----
NM_006621chr11663 --1761 --
NM_006624chr1052026 758 463 342 82 2652 151 1842 11891
NM_006625chr13964 480 426 --1452 --
NM_006625chr13964 480 426 --1452 --
NM_006625chr13964 480 426 --1452 --
NM_006628chr1564031 3758 1789 1618 425 176 --2992 602 21449 505
NM_006633chr5197 --160 --
NM_006654chr1274594 4399 3026 1873 1107 1063 961 13450 ----
NM_006660chr15148 ------
NM_006698chr20----11475 --
NM_006699chr142209 647 442 41 --12478 --
NM_006706chr53802 587 42 1342 ----
NM_006713chr52709 561 --2739 291 --
NM_006716chr71103 ----2834 436
NM_006717chr962758 2410 2216 1194 536 84 23249 96 --1641
NM_006720chr1094982 4899 4648 4493 4419 4377 4287 2051 1999 --11612 11233
NM_006721chr102198 157 ------
NM_006722chr332933 520 378 ------
NM_006726chr41344 --1157 1486
NM_006729chrX2818 690 14709 ----
NM_006735chr71142 ------
NM_006738chr1554412 4305 1512 810 681 11586 12816 --
NM_006744chr103192 165 78 ------
NM_006746chrX21527 263 --11110 --
NM_006750chr16107710 7549 6342 6277 5563 5495 4922 2502 846 745 --45167 1515 1041 395 21858 151
NM_006754chr731183 496 289 1123 1790 1428
NM_006759chr21305 --1236 --
NM_006766chr812492 --1997 12225
NM_006772chr6----11762 --
NM_006775chr663110 2361 2157 853 533 91 --13129 --
NM_006777chrX1209 ----22556 2382
NM_006791chr15------1442
NM_006803chr882101 1473 1450 1442 1329 314 305 256 --22095 2067 --
NM_006805chr541473 1417 1220 142 --31645 1148 594 11137
NM_006807chr17195 ----11320
NM_006809chr202968 161 --1859 1670
NM_006811chr201201 1311 2353 160 1242
NM_006813chr6--1123 ----
NM_006815chr12142 11042 ----
NM_006823chr82543 277 1392 ----
NM_006827chr1423260 491 13086 11113 1641
NM_006828chr6----1532 --
NM_006832chr141339 2791 92 2393 77 --
NM_006836chr12----1558 --
NM_006838chr1241854 1819 1417 1254 --11899 1129
NM_006845chr11531 --1577 --
NM_006851chr1212832 --21063 1045 --
NM_006854chr711524 --2175 81 11656
NM_006868chr1833188 1066 835 ------
NM_006870chr20----138 --
NM_006874chr41771 ------
NM_006885chr1643858 3316 2791 1648 2793 322 --13658
NM_006888chr1433317 419 327 ------
NM_006892chr203453 422 217 --21433 1296 --
NM_006892chr203453 422 217 --21433 1296 --
NM_006895chr2--1888 22075 1820 --
NM_006902chr142205 2101 1167 394 22611 862 1426 --
NM_006912chr152429 2199 278 84 21 11790 1797 --
NM_006914chr93971 959 289 1542 ----
NM_006915chrX42551 900 683 393 22208 207 --12450
NM_006916chr21445 --11050 --
NM_006918chr1155735 5727 5712 1280 360 --34309 3731 380 22074 212
NM_006920chr241765 1403 433 39 11710 21384 318 11368
NM_006922chr221879 37 12068 12098 --
NM_006924chr1784236 4107 4100 3988 3571 3170 1790 337 --1760 43458 3233 1027 215
NM_006925chr143438 423 365 ------
NM_006931chr1231593 492 411 12019 1213 1660
NM_006936chr2131265 1184 1126 ----11190
NM_006937chr17------2605 588
NM_006938chr182302 65 ------
NM_006939chr1421130 761 1289 ----
NM_006943chr2023325 44 --1544 --
NM_006946chr11----1192 --
NM_006947chr421319 606 ----1456
NM_006952chr331067 999 272 ------
NM_006963chr101920 --1928 1995
NM_006965chr181249 ------
NM_006981chr92644 48 ------
NM_006996chr131391 665 371 ------
NM_007005chr91128 1424 11428 1300
NM_007007chr1284716 4189 3122 1674 1149 467 359 324 13421 44710 4495 426 199 11472
NM_007008chr21891 --1608 --
NM_007011chr1536107 6073 4280 --26710 192 25940 5580
NM_007013chr81729 ------
NM_007018chr9------2387 266
NM_007026chr171225 --1417 --
NM_007029chr8--1102 ----
NM_007033chr1--1175 --1535
NM_007034chr13957 774 249 1761 --1647
NM_007038chr2125787 1047 --11376 15872
NM_007064chr321508 1065 ------
NM_007084chr1321217 516 11570 ----
NM_007087chr162751 22 ------
NM_007106chr1342231 1008 913 720 --22811 1963 1635
NM_007107chr362135 1882 903 460 454 150 12032 ----
NM_007111chr132806 743 ------
NM_007114chr343126 3039 2864 367 ------
NM_007124chr63650 624 505 21473 1330 11238 --
NM_007125chrY21322 1206 ------
NM_007126chr91430 ------
NM_007146chr1752753 1780 1766 459 206 ----1241
NM_007150chrX3461 326 197 2644 222 12138 --
NM_007157chrX22813 807 22449 2128 ----
NM_007158chr1------2798 160
NM_007159chr321408 219 11319 21630 1156 --
NM_007166chr1121299 1257 ------
NM_007172chr22--1754 12379 11202
NM_007175chr863379 2724 1411 671 290 245 ------
NM_007178chr121304 --189 --
NM_007200chr1554412 4305 1512 810 681 11586 12816 --
NM_007203chr963332 3279 2686 979 733 35 --11591 12774
NM_007207chr11613 ----1135
NM_007214chr631305 1129 423 ------
NM_007218chr8------2204 40
NM_007222chr841224 1174 356 317 21527 421 ----
NM_007231chrX42297 822 534 188 1359 --1559
NM_007236chr1552117 2015 1904 878 777 --1891 --
NM_007246chr42786 764 --1669 --
NM_007249chr1389009 7221 7201 5693 3551 3494 2395 1167 59324 8715 8258 2524 1718 13302 18119
NM_007269chr11142 ----1589
NM_007276chr711089 ------
NM_007282chr31122 --1860 --
NM_007292chr1765060 1263 547 527 229 22 21912 455 ----
NM_007294chr1751250 1200 1021 459 338 ----1188
NM_007295chr1751250 1200 1021 459 338 ----1188
NM_007296chr1751250 1200 1021 459 338 ----1188
NM_007297chr1751250 1200 1021 459 338 ----1188
NM_007298chr1751250 1200 1021 459 338 ----1188
NM_007299chr1751250 1200 1021 459 338 ----1188
NM_007300chr1751250 1200 1021 459 338 ----1188
NM_007302chr1751250 1200 1021 459 338 ----1188
NM_007303chr1751250 1200 1021 459 338 ----1188
NM_007304chr1751250 1200 1021 459 338 ----1188
NM_007305chr1751250 1200 1021 459 338 ----1188
NM_007324chr11289 ------
NM_007325chrX11853 --11511 21949 235
NM_007345chr1821639 859 --31998 1941 604 --
NM_007347chr1533009 2042 207 ----1490
NM_007351chr4167 --1175 11117
NM_007358chr141743 1631 1465 755 ------
NM_007359chr1721655 1181 ------
NM_007363chrX1348 --1203 --
NM_007372chr172891 803 ------
NM_007373chr1051832 1815 1483 612 480 ----21711 255
NM_007374chr141412 ------
NM_007375chr132666 2584 560 12722 ----
NM_012069chrX32436 1828 732 ----1435
NM_012081chr563372 3266 3201 3008 2314 1402 ----1371
NM_012082chr8138 ------
NM_012084chrX1514 ------
NM_012090chr121181 1147 --2509 436 --
NM_012096chr331250 643 116 2436 360 12677 1926
NM_012097chr251961 1560 783 654 327 --21932 450 22032 660
NM_012110chr4160 --1209 --
NM_012120chr672847 2552 1999 1966 893 699 574 ----1254
NM_012129chr722522 470 ----1571
NM_012137chr11119 --12066 11139
NM_012141chr1374064 3770 3154 3082 1580 971 260 --23108 2552 --
NM_012154chr82639 246 ------
NM_012158chr1331826 657 140 --1424 21779 524
NM_012164chr947441 2064 2019 1050 11091 35143 2103 634 14752
NM_012180chr41210 ------
NM_012183chr11550 ------
NM_012186chr11750 ------
NM_012193chr1133722 2144 545 15057 23426 1337 1792
NM_012199chr193558 3467 3095 2979 2855 2819 1834 1621 425 --2492 336 --
NM_012214chr255337 5070 4377 2141 1586 16410 ----
NM_012215chr1031617 705 500 --11358 --
NM_012224chr421197 488 1761 ----
NM_012234chr383747 3372 3218 3196 2288 1405 138 73 --22964 543 --
NM_012238chr1021208 72 --11689 --
NM_012247chr10----1858 --
NM_012249chr252622 2466 601 324 172 1263 --11200
NM_012250chr111272 --11264 --
NM_012255chr201157 ------
NM_012257chr731091 401 379 1269 ----
NM_012259chr631199 898 414 160 --11255
NM_012261chr202520 138 ----1157
NM_012262chr155067 3753 3429 1758 1477 --34953 1616 502 --
NM_012281chr741695 1632 1575 712 ----12469
NM_012288chr645197 4778 4253 311 11554 13824 25449 778
NM_012290chr21299 ------
NM_012297chr432559 1935 596 --1339 --
NM_012300chr541908 1762 794 738 --32417 2060 831 --
NM_012301chr752192 1752 1584 298 160 --1849 --
NM_012302chr131239 973 269 ----192
NM_012309chr1124990 4550 11692 1692 --
NM_012316chr165509 1997 1479 1323 952 888 13505 ----
NM_012319chr1821062 361 295 29 ----
NM_012322chr71313 ----187
NM_012323chr2221282 1048 1292 11216 --
NM_012329chr1721431 259 ------
NM_012330chr10----1435 --
NM_012333chr121375 266 --21072 112 --
NM_012347chr622711 696 --42636 1079 373 272 --
NM_012388chr1522103 959 --2454 214 32459 1968 1180
NM_012399chr2241852 1686 142 41 11385 ----
NM_012412chr7--1838 ----
NM_012414chr12852 251 --1567 --
NM_012419chr61521 ------
NM_012420chr1032251 644 90 ------
NM_012421chr12186 99 ------
NM_012425chr1022050 309 --1986 --
NM_012431chr773163 2299 1417 1254 954 829 234 --2499 215 --
NM_012433chr2----2296 24 1284
NM_012434chr6--31535 1390 1113 31589 330 181 --
NM_012437chr11399 1478 ----
NM_012454chr61484 ------
NM_012464chr432294 591 311 1282 1207 --
NM_012482chr11233 ------
NM_013231chr1474277 4079 3914 3609 3082 2921 1179 11106 24155 1581 --
NM_013233chr211411 --11155 --
NM_013253chr113524 199 130 11261 ----
NM_013257chr831993 1721 975 32091 1944 794 2447 210 --
NM_013261chr442412 1277 343 241 1451 12417 --
NM_013262chr611297 --11035 1932
NM_013269chr1264561 4536 4524 4337 1558 1526 11371 ----
NM_013282chr193896 224 87 ------
NM_013283chr51928 --1795 --
NM_013286chr343242 3022 2840 348 11274 --12496
NM_013302chr1633626 1835 812 23191 234 11608 21734 1310
NM_013322chr731303 618 142 21267 574 ----
NM_013372chr1532589 456 137 2722 88 --13223
NM_013374chr32409 351 ------
NM_013377chr12--1119 ----
NM_013381chr121386 ----12358
NM_013396chr21179 --31096 1008 581 --
NM_013423chrX1293 --1885 --
NM_013427chrX1293 --1885 --
NM_013437chr831241 901 565 191 ----
NM_013438chr921543 401 21717 1160 ----
NM_013444chrX2830 194 ------
NM_013449chr1232768 2651 1063 12337 --11141
NM_013986chr221354 ------
NM_013995chrX21952 789 12035 1679 12556
NM_013996chr71134 ------
NM_013996chr71134 ------
NM_013997chr71134 ------
NM_013997chr71134 ------
NM_013998chr71134 ------
NM_013998chr71134 ------
NM_014000chr1021634 619 ----11965
NM_014007chr9--1108 --11276
NM_014011chr232275 1760 115 12461 1982 --
NM_014016chr31487 21402 622 --11226
NM_014028chr633156 917 430 --13322 13137
NM_014034chr6------1109
NM_014043chr351599 1533 413 220 27 --21036 593 --
NM_014048chr1695024 5007 4891 4825 4290 3251 1764 199 38 13602 14438 --
NM_014089chr1321667 905 12201 11380 --
NM_014106chr1542166 1832 1012 122 --12946 --
NM_014112chr874674 3926 3706 1621 1308 958 950 --11879 14447
NM_014117chr1622027 332 --42651 2007 939 109 136
NM_014141chr741281 483 305 255 ------
NM_014153chr16199 ----1634
NM_014154chr341479 445 406 367 ------
NM_014155chr1196101 6002 3012 1953 1563 1020 660 320 211 37404 5411 5383 27383 4735 --
NM_014159chr32504 485 1241 --1593
NM_014189chr421419 381 ------
NM_014190chr421771 733 ------
NM_014191chr123222 137 58 --1942 --
NM_014217chr121419 192 ------
NM_014240chr3--13872 23209 1122 1592
NM_014241chr101332 ------
NM_014243chr42537 74 11809 --180
NM_014245chr331119 1055 366 2419 260 ----
NM_014251chr7------1110
NM_014253chrX42523 2242 1950 561 ----1172
NM_014278chr41181 1420 ----
NM_014280chr1--1190 --1366
NM_014282chr931184 834 473 ----1255
NM_014283chr12959 558 --21319 1206 --
NM_014290chr91231 168 ----
NM_014294chr811306 1197 ----
NM_014296chr341590 1058 1033 142 --1453 --
NM_014305chr131608 ----1617
NM_014309chr2285118 5041 4751 4649 4603 3590 838 556 23315 1067 23522 298 --
NM_014317chr101264 ------
NM_014319chr1251680 1522 1220 523 471 ------
NM_014325chr1231516 524 51 --11828 --
NM_014333chr1121870 471 1536 21111 223 --
NM_014344chr11--1910 ----
NM_014345chr621041 840 ------
NM_014365chr122825 198 --1680 --
NM_014372chr131739 1341 751 ----51729 1622 583 308 226
NM_014376chr542326 2240 897 790 --1751 --
NM_014392chr411106 ------
NM_014393chr862275 1756 1570 1470 922 684 ------
NM_014395chr451932 1909 1884 789 559 1429 --31666 1227 240
NM_014415chr34444 291 89 65 11654 ----
NM_014418chr1431922 1592 774 ------
NM_014423chr595635 5490 5020 3707 3594 3580 1460 1157 345 21732 1296 ----
NM_014445chr362303 2033 1885 774 591 495 1384 ----
NM_014456chr1051733 1520 1383 1190 271 ----21630 1361
NM_014458chr131373 1313 75 ------
NM_014469chr111543 ------
NM_014470chr12----1805 --
NM_014487chr41214 --156 --
NM_014494chr1661967 1557 791 751 460 276 1541 ----
NM_014496chrX1209 ------
NM_014497chr2137 ------
NM_014503chr121449 ------
NM_014504chr741786 1617 589 96 1513 1723 --
NM_014505chr12--1408 --1393
NM_014517chr331839 1786 1716 2612 49 ----
NM_014548chr1531683 1364 393 --11469 --
NM_014552chr21532 --1979 --
NM_014554chr1212303 1891 ----
NM_014572chr1321758 278 11224 --11578
NM_014574chr142459 36 11090 11287 11166
NM_014585chr231191 139 54 1227 ----
NM_014602chr31282 --191 --
NM_014606chr421518 1183 ----11214
NM_014607chr251461 1453 1328 326 203 --3438 155 131 --
NM_014608chr151384 ------
NM_014612chr911204 2361 276 11545 --
NM_014614chr2--11485 1916 --
NM_014615chr1611129 12599 23441 3361 11363
NM_014616chr352940 926 733 372 263 13376 1977 --
NM_014633chr11183 ------
NM_014635chr221632 1343 1183 21763 454 --
NM_014636chr944368 3592 2927 829 --11687 --
NM_014637chr821282 83 11364 1948 11296
NM_014646chr1822970 867 ----22209 968
NM_014647chr1622024 415 --11889 12120
NM_014671chr73598 458 441 11357 ----
NM_014674chr342802 2752 1225 1181 13602 23891 742 --
NM_014676chr131613 538 350 ----11189
NM_014679chr1131277 1109 385 1348 --1391
NM_014682chr861945 1780 1591 1535 1507 385 ------
NM_014683chr172499 66 ----2662 456
NM_014685chr16------1399
NM_014686chr1911950 11638 1562 --
NM_014689chr22119 81 ------
NM_014701chr1552706 2174 526 290 159 32894 2719 1089 11235 23105 2324
NM_014702chr65682 651 453 420 71 11127 ----
NM_014705chr761951 1672 1315 746 296 132 ------
NM_014707chr711561 11682 183 --
NM_014709chr22139 72 ----1114
NM_014711chr1632022 220 196 --1836 --
NM_014713chr2150 --1119 --
NM_014720chr1021832 1319 11239 --21131 308
NM_014721chr6117061 6359 5716 4728 2957 2449 2406 1308 1135 706 108 26516 2363 36150 5110 2040 15757
NM_014725chrX41188 953 857 293 ------
NM_014729chr872209 2029 1851 1789 798 387 353 --11626 --
NM_014730chr1231151 1103 621 --11651 1884
NM_014730chr1231151 1103 621 --11651 1884
NM_014735chrX4735 684 615 582 ------
NM_014736chr152197 39 1130 1666 1316
NM_014739chr694175 4128 3461 3144 2631 1503 1341 534 405 24162 3553 33218 553 447 --
NM_014742chr2021146 283 ------
NM_014743chr453089 1970 460 268 150 ----131
NM_014746chr233799 439 422 ----23954 737
NM_014747chr155611 4571 4410 2168 1295 1687 13836 --
NM_014751chr821982 1890 1435 31772 1364 747 --
NM_014755chr283876 2922 1658 1642 979 609 524 91 13594 21263 1213 --
NM_014756chr11--166 ----
NM_014757chr512119 1507 ----
NM_014764chr1221067 881 1841 ----
NM_014765chr1102681 2224 1832 1028 1016 883 591 253 133 95 --12697 21933 578
NM_014766chr753793 2788 2618 1119 648 --12710 --
NM_014772chr1822856 693 13630 --12394
NM_014773chr5----11369 --
NM_014774chr163196 2999 2628 2348 2229 2156 ------
NM_014781chr81997 1347 ----
NM_014783chr1561749 1577 1547 1527 1427 554 ------
NM_014787chr141746 851 834 399 32306 1946 804 146 --
NM_014790chr5152 ------
NM_014795chr21522 --1259 160
NM_014803chr1031960 939 815 --12123 32491 1895 576
NM_014806chr91456 ------
NM_014810chr133258 979 650 --13379 --
NM_014819chr531530 848 836 12014 32331 827 662 1525
NM_014820chr321431 764 --21590 1351 --
NM_014824chr1121700 1606 11629 ----
NM_014826chr113418 3535 293 217 11675 --
NM_014827chr11216 ------
NM_014828chr1442278 1879 1804 1541 12267 11984 11688
NM_014830chr1243795 3617 1084 551 13356 23450 2857 22692 132
NM_014832chr1321920 1742 11897 ----
NM_014835chr2031951 1608 297 ----1906
NM_014839chr132218 1622 749 ----12435
NM_014841chr621115 551 11352 ----
NM_014850chr344917 4623 3164 1047 ------
NM_014859chr171431 11110 21254 1195 --
NM_014873chr164645 2997 1358 1000 834 646 14356 ----
NM_014877chr1746816 2526 1270 990 --36560 5724 810 1459
NM_014887chr132671 72 --1775 1135
NM_014888chr721449 242 --1548 11414
NM_014897chr173935 316 233 --32424 1123 886 --
NM_014899chr52132 124 11218 23064 2339 22532 308
NM_014900chr21834 ------
NM_014902chr201359 ------
NM_014903chr122851 187 1864 ----
NM_014904chr1043211 2570 1555 1342 --1865 34077 2545 205
NM_014905chr221388 438 --32007 1661 592 1479
NM_014906chr1743337 1482 1152 1118 13633 ----
NM_014907chr9197 --1130 --
NM_014909chr1453790 2789 2616 903 242 --21305 302 --
NM_014912chr1053509 2319 1331 870 251 ----11240
NM_014923chr1331667 676 143 22289 530 12246 --
NM_014926chr31861 --21114 719 --
NM_014932chr331795 1348 637 1531 --1203
NM_014934chr1344015 3855 3826 513 --23181 215 1235
NM_014938chr1222400 1614 1869 ----
NM_014946chr243028 2919 1089 947 --1201 12653
NM_014947chr153065 2286 760 669 65 12654 22232 856 12200
NM_014950chr1411120 21601 444 ----
NM_014951chr1062118 1863 1774 983 658 155 ----12539
NM_014953chr1344270 3420 2948 2672 --14101 --
NM_014961chr452209 1509 1450 586 520 11715 ----
NM_014962chr2052701 2414 906 637 25 1787 167 32768 2715 199
NM_014964chr1742040 917 616 591 1771 ----
NM_014967chr1511500 21342 1052 ----
NM_014969chr11297 1863 ----
NM_014974chr1011126 ------
NM_014978chr1041473 1273 586 105 1272 ----
NM_014982chr1445063 5038 4984 476 --13628 35345 4489 1880
NM_014988chr462305 1921 809 387 176 161 1297 167 12437
NM_014989chr621548 435 --12071 --
NM_014990chr142827 333 ------
NM_014991chr412167 ----11115
NM_014992chr142803 595 ------
NM_014999chr1221426 293 ----11054
NM_015000chr1262736 1219 879 653 109 62 ------
NM_015001chr11196 ------
NM_015008chr342930 2736 1115 120 21042 321 ----
NM_015009chr31114 1660 --2331 280
NM_015015chr1921559 1298 --11455 1373
NM_015017chr121183 88 --11161 --
NM_015018chr6--1179 ----
NM_015024chr8--1382 ----
NM_015025chr242114 568 244 121 1753 --133
NM_015026chr1244515 4041 689 614 13054 13830 21387 579
NM_015032chr1372398 2392 2062 541 347 301 72 --12629 12843
NM_015035chr2086667 5780 5713 5630 5601 4411 1973 1353 15131 --12626
NM_015049chr253079 2015 1097 417 238 23330 2332 ----
NM_015051chr932155 2093 510 33242 2233 1213 ----
NM_015052chr741182 1036 951 344 ------
NM_015055chr1132712 2315 547 --22458 1829 --
NM_015057chr13--171 ----
NM_015061chr91338 1811 --1896
NM_015068chr723458 2513 --33174 1537 371 --
NM_015071chr565529 5404 4241 1287 547 442 11224 36164 6086 1793 --
NM_015074chr184847 4177 3581 3310 1484 1242 852 110 24040 496 --11270
NM_015076chr6--13862 --11151
NM_015090chr164920 4528 3987 2111 1849 737 15073 24433 1824 --
NM_015091chr142541 39 1647 ----
NM_015092chr1643305 2994 952 487 14354 11210 1805
NM_015093chr61432 11190 --11470
NM_015094chr2264713 3628 1543 1236 891 417 --14428 --
NM_015097chr372282 2141 2092 1945 1585 788 375 ----1360
NM_015100chr142051 2002 1323 66 --11483 --
NM_015106chr3----1164 --
NM_015110chr942476 1594 1580 50 ------
NM_015115chr463139 2641 2367 899 649 160 2931 680 1473 1269
NM_015124chr22----12287 12474
NM_015125chr19----1601 --
NM_015129chrX41790 1537 1105 554 ------
NM_015130chr41867 2331 119 1347 --
NM_015137chr862588 2423 2323 1999 1004 359 1388 1684 --
NM_015138chr1512719 ------
NM_015141chr342774 2739 2016 282 ------
NM_015144chr16192 --23348 2847 --
NM_015150chr33940 824 120 ------
NM_015156chr1433618 2679 833 33715 693 621 13927 --
NM_015170chr832172 2068 1994 11683 --22373 2042
NM_015173chr421736 1271 --1675 --
NM_015176chr141486 360 49 41 ------
NM_015185chrX22274 1884 --12988 --
NM_015191chr1162608 2401 2392 2003 1995 1865 1983 22173 1882 --
NM_015192chr2022765 1076 ------
NM_015199chr332568 1014 306 1820 1251 --
NM_015200chr442245 2095 1040 724 21903 323 21704 287 --
NM_015206chr1533285 3199 2530 --23759 1140 --
NM_015208chr1862917 2481 1220 1110 1044 763 23375 2972 22581 1096 13047
NM_015214chr81600 --125 --
NM_015215chr122173 559 32632 720 507 ----
NM_015216chr531227 235 118 31216 1124 965 --1161
NM_015225chr941273 541 309 153 2904 402 ----
NM_015230chr41649 11780 1131 1354
NM_015233chr1312014 ----12707
NM_015236chr421336 1062 ------
NM_015239chr92424 72 ------
NM_015245chr621973 878 ----21891 1863
NM_015247chr1663930 3908 3624 3303 1477 1092 1325 11070 1145
NM_015251chr1622064 417 12106 1117 --
NM_015252chr21925 --1766 --
NM_015262chr101159 --1169 --
NM_015264chr2244277 1540 1261 1205 14119 ----
NM_015265chr241769 1034 680 521 11074 --11990
NM_015266chr2043100 1657 1338 655 13945 ----
NM_015267chr122795 698 ----12170
NM_015268chr31269 ------
NM_015271chr431717 1710 255 23510 1281 21568 1092 13708
NM_015272chr1622138 172 --1831 --
NM_015275chr1221517 1376 --1417 --
NM_015277chr184484 363 177 47 ------
NM_015278chr632233 669 420 --12261 12564
NM_015285chr1841841 512 492 302 22270 725 --2701 403
NM_015286chr152501 394 11776 12422 --
NM_015291chr133352 2603 956 ------
NM_015310chr8108251 7505 6660 6317 6166 5517 5295 2035 1177 554 25425 2124 --38071 5639 650
NM_015313chr1134716 4081 3005 13949 14620 --
NM_015317chr221076 840 ------
NM_015323chr621711 1401 ------
NM_015329chr1911819 1848 --12892
NM_015335chr1222364 600 ------
NM_015336chr12----22636 2292 --
NM_015344chr852068 1877 1527 758 208 ------
NM_015347chr1262401 2203 2150 954 384 316 1755 1872 --
NM_015349chr643055 1106 290 275 11080 2170 120 12867
NM_015354chr91412 ------
NM_015355chr1731987 1686 772 11958 21389 1302 21723 1470
NM_015358chr21--1440 11140 --
NM_015360chr51161 ------
NM_015361chr21969 ------
NM_015375chr164747 4015 1143 594 439 117 23355 890 23799 1604 14315
NM_015384chr51133 ------
NM_015385chr1032549 1238 1207 --12706 1145
NM_015387chr261873 814 494 342 229 105 --11779 --
NM_015393chr443511 3120 532 54 ----11030
NM_015396chr32477 467 1144 146 --
NM_015415chr1199 ------
NM_015429chr33426 137 89 --1937 --
NM_015432chr162648 468 ------
NM_015435chr841401 1364 1114 531 1422 11440 1272
NM_015436chr453332 3193 3007 2692 212 ------
NM_015443chr17----11145 11511
NM_015446chr111374 21687 627 --1311
NM_015455chr533504 1190 95 --43000 1027 888 100 13101
NM_015458chr833797 1781 798 1391 1476 14757
NM_015460chr332027 597 448 --1276 --
NM_015461chr182718 311 ------
NM_015469chr92759 186 --1699 165
NM_015472chr31144 ------
NM_015472chr31144 ------
NM_015488chr211669 ------
NM_015497chr152934 340 ------
NM_015506chr111852 ------
NM_015508chr321523 1347 --11303 --
NM_015509chr1231332 624 486 1275 11615 --
NM_015520chr362500 2342 2067 2033 1996 1092 ------
NM_015523chr11------1262
NM_015525chr611123 --2802 384 1960
NM_015532chr1552644 2285 2018 843 183 --2529 203 22182 175
NM_015535chr232914 1673 553 12742 23096 190 13557
NM_015548chr62730 221 1109 1674 --
NM_015550chr773595 2885 887 441 193 75 46 12211 1115 --
NM_015554chr1532809 2752 2319 12336 22912 216 --
NM_015555chr641305 1274 492 486 --21663 1363 1680
NM_015556chr141235 ------
NM_015560chr342879 2729 2310 327 12547 --1419
NM_015564chr543283 1107 841 238 11030 --1426
NM_015565chr2141954 1844 660 257 22088 581 --11620
NM_015567chr13----11118 --
NM_015569chr144577 4002 839 413 1375 --14130
NM_015571chr642334 1772 496 116 32084 779 738 2943 350 12449
NM_015575chr222833 877 ----12597
NM_015576chr332618 727 366 11007 ----
NM_015578chr1942067 1572 789 150 ------
NM_015601chr10----3999 885 328 --
NM_015602chr121528 123 ------
NM_015609chr14988 649 550 496 21103 964 ----
NM_015626chr1721165 1035 1820 ----
NM_015630chr221108 364 ------
NM_015640chr145037 3632 1829 288 24646 344 2747 66 25282 801
NM_015652chr101507 ------
NM_015659chr1633349 3099 1211 --1579 22197 340
NM_015660chr7------1112
NM_015678chr133555 350 269 11563 ----
NM_015695chr632091 2043 286 11514 ----
NM_015723chr72590 40 ------
NM_015833chr2111981 ------
NM_015850chr811870 ----12177
NM_015866chr11993 1162 ----
NM_015869chr31146 ------
NM_015874chr4----1551 --
NM_015878chr821854 484 1247 21578 798 1363
NM_015879chr18117978 7224 6689 6428 3169 2451 2009 1567 968 577 540 --35677 2963 608 36964 1591 36
NM_015881chr113524 199 130 11261 ----
NM_015886chr8115402 4898 3879 3683 3517 3492 2038 1255 963 718 678 --1165 33838 3580 1694
NM_015888chr143231 2604 2169 977 --1392 1699
NM_015895chr61221 ------
NM_015906chr113437 11273 --130
NM_015912chr831696 770 34 ----1211
NM_015990chr41432 11004 1441 --
NM_015995chr1555556 5148 4800 2177 2109 14095 ----
NM_016002chr12544 201 --1594 --
NM_016009chr154168 3919 3057 966 516 11178 14412 24363 3728
NM_016010chr82165 57 ------
NM_016018chr852309 893 378 305 94 ----11902
NM_016019chr7159 ------
NM_016023chr832173 2114 456 ----21945 613
NM_016025chr1621956 438 ------
NM_016037chr1------1384
NM_016038chr71666 ----193
NM_016061chr21242 ------
NM_016072chr121967 1121 1250 --
NM_016075chr1352878 2441 2115 250 38 12837 11000 12067
NM_016076chr133137 298 276 12091 11989 --
NM_016083chr652520 977 941 482 461 12591 21340 220 --
NM_016087chr721508 635 --11251 --
NM_016090chr1131016 925 145 --1967 --
NM_016096chr821670 1418 --22138 766 --
NM_016097chr1821095 820 ------
NM_016120chrX21169 1106 ----1774
NM_016121chr11462 ------
NM_016124chr121480 1100 --11361 11179
NM_016129chr4--1127 ----
NM_016131chr251845 1534 860 619 161 --22236 406 --
NM_016132chr1553153 2585 914 762 87 1218 ----
NM_016133chr211650 11182 11108 --
NM_016144chr51588 --1308 --
NM_016147chr11------11168
NM_016152chr321266 869 --21237 87 --
NM_016162chr121618 ------
NM_016179chr13------174
NM_016195chr10----121 --
NM_016203chr71110 2428 151 --1175
NM_016206chr368814 8648 8174 6596 540 204 32957 1414 728 27202 2543 31225 533 494
NM_016213chr15------1231
NM_016219chr91460 ------
NM_016220chr7--11703 12207 --
NM_016224chr621554 552 ----11658
NM_016227chr12959 558 --21319 1206 --
NM_016231chr1731602 1149 86 ------
NM_016242chr42443 45 ----1355
NM_016248chr1343774 3158 2530 67 --23980 3726 --
NM_016252chr23314 303 139 ------
NM_016258chr11132 ------
NM_016260chr276021 5662 5061 2809 935 558 237 1408 16965 27082 6484
NM_016271chr1841891 1843 1795 1664 11762 11680 12110
NM_016272chr2222715 1005 12731 ----
NM_016275chr332497 2460 2100 32045 1771 425 --1814
NM_016281chr121156 ------
NM_016284chr16--1181 ----
NM_016287chr1172 11976 --11441
NM_016289chr242195 1798 811 177 ------
NM_016297chr223546 3113 23481 2609 1114 --
NM_016300chr3----1477 --
NM_016303chrX2390 150 ------
NM_016306chr31113 ----128
NM_016308chr152005 1601 712 509 196 ----137
NM_016315chr231577 1458 1396 ------
NM_016322chr962534 2281 952 355 142 102 --22612 591 12629
NM_016338chr51839 --1274 --
NM_016351chr73424 184 38 ------
NM_016357chr12--2854 401 ----
NM_016374chr121416 591 ------
NM_016374chr121416 591 ------
NM_016376chr1734278 3112 683 12651 1424 21756 1688
NM_016377chr611331 1421 2354 89 --
NM_016396chr1532373 1876 929 ----1640
NM_016401chr11--2213 106 --1117
NM_016410chr92166 122 1232 ----
NM_016422chr1133046 2316 415 --12670 23177 1140
NM_016424chr171775 --11831 --
NM_016436chr2022627 945 --11043 11915
NM_016441chr232127 1726 917 --21758 87 --
NM_016472chr1411521 160 21469 1424 --
NM_016480chr51216 --2850 141 --
NM_016488chr1241802 1686 1301 276 11525 ----
NM_016505chr1------1707
NM_016507chr1711127 12879 ----
NM_016516chr21766 ------
NM_016522chr1111449 ------
NM_016525chr92692 307 ------
NM_016530chr1543980 1636 1587 1315 --14033 13951
NM_016531chr442897 1417 1029 274 --33617 3406 440 13856
NM_016542chrX11690 --21234 77 --
NM_016545chr13647 310 186 --1759 --
NM_016559chr3----1974 1504
NM_016562chrX1484 1661 --21038 57
NM_016569chr122962 553 11467 ----
NM_016578chr111569 --178 1663
NM_016587chr711089 ------
NM_016591chr521116 206 --1437 188
NM_016592chr2021280 109 ----11257
NM_016598chr321355 482 ----181
NM_016603chr52760 664 1902 1549 --
NM_016604chr511186 ----1418
NM_016607chrX2162 65 ----21229 685
NM_016612chr83639 493 446 ------
NM_016613chr462755 2188 2160 2132 2123 216 --1320 11982
NM_016618chr22149 140 ------
NM_016620chr131037 358 86 11489 ----
NM_016623chr8----1557 2504 438
NM_016631chr212893 225 --131 --
NM_016651chr1411177 ------
NM_016654chr15----11269 --
NM_016655chr15186 ------
NM_016824chr1021350 705 --11622 --
NM_016936chr1641942 1650 303 96 ------
NM_016946chr143603 2665 933 234 ----32843 2688 227
NM_016950chr441501 1157 545 327 ----1167
NM_016952chr1163877 3542 2871 2580 1538 781 11101 ----
NM_016953chr246158 5604 4117 3716 ------
NM_017411chr51443 ----1543
NM_017412chr821213 1078 --11308 21229 38
NM_017416chrX1148 ------
NM_017420chr1423567 402 --33722 1419 748 22994 2810
NM_017423chr442210 1587 226 190 1697 11716 11413
NM_017437chr1442444 2328 1560 782 --130 --
NM_017447chr2184397 4378 3679 3395 3066 3043 1484 1302 13964 11776 11334
NM_017452chr2021460 1283 ------
NM_017453chr2021460 1283 ------
NM_017454chr2021460 1283 ------
NM_017456chr172624 323 ----11884
NM_017488chr211327 --11133 --
NM_017489chr8--11291 --21171 101
NM_017519chr621293 76 11240 ----
NM_017545chr201377 ------
NM_017546chr23569 94 88 ------
NM_017549chr721130 175 ------
NM_017551chr1052633 2453 2408 1920 479 --12714 12269
NM_017558chr161345 ------
NM_017580chr101628 --2960 308 --
NM_017599chr1242093 1596 450 54 ------
NM_017610chr151433 --11374 11365
NM_017612chr122581 543 ----1107
NM_017617chr91309 ----11285
NM_017626chr1011805 ----11291
NM_017628chr465245 4111 3631 1941 145 77 35224 3652 1681 --15262
NM_017629chr1--11808 --11725
NM_017633chr663910 3324 2984 2704 2684 870 --22437 1442 21535 1134
NM_017634chr831884 583 138 ----11771
NM_017637chr999068 9051 8610 6137 3023 2826 2388 1689 1151 23749 2923 47537 2836 594 581 13202
NM_017641chr1231147 1076 444 11174 1183 --
NM_017643chr17--12517 ----
NM_017644chr375226 5149 4624 4478 3406 3290 344 --31726 927 432 15128
NM_017645chr933001 1200 551 33126 2706 118 --12751
NM_017649chr101264 ------
NM_017650chr795880 5218 5014 4522 2300 2153 2063 2034 608 --35532 4670 1177 --
NM_017655chr131468 1349 106 11652 1197 11284
NM_017657chr2--1629 --1648
NM_017658chr14104557 3746 2867 1707 1313 1046 1032 829 751 670 14485 11420 24686 3837
NM_017661chr15----1959 1521
NM_017666chrX42155 1926 782 366 ------
NM_017672chr1521381 496 --11275 11265
NM_017673chr13851 782 740 ------
NM_017694chr241774 1694 1656 257 31528 693 470 ----
NM_017706chr531161 138 52 ------
NM_017709chr193902 3853 3259 2833 1669 1395 1339 546 540 --23109 749 --
NM_017714chr202338 159 1693 --1867
NM_017715chr71297 2168 141 1550 --
NM_017719chr312087 ----11708
NM_017724chr32738 265 ------
NM_017730chr31716 ----1138
NM_017737chr131914 1876 436 12072 1441 --
NM_017742chr1841881 1511 636 311 ------
NM_017745chrX2710 607 ----1617
NM_017746chr9134 ------
NM_017747chr51317 --133 --
NM_017754chr684496 3619 3447 3091 1688 1682 1418 856 33668 2010 1796 21611 1361 14689
NM_017761chr121038 550 11357 --11317
NM_017768chr13922 786 277 ------
NM_017769chr1423293 641 1781 --1533
NM_017780chr8160 ----130
NM_017786chr81622 ----1157
NM_017787chr1032123 1832 399 ------
NM_017799chr1441385 617 356 197 --1149 --
NM_017811chr933036 2558 1086 --1372 1382
NM_017816chr4160 ------
NM_017819chr31221 170 ----
NM_017824chr1042589 2237 1858 368 ------
NM_017831chr1824616 132 1177 14545 160
NM_017847chr122246 170 12027 ----
NM_017848chrX84670 4424 3696 3649 3465 1317 885 92 13620 ----
NM_017866chr81147 --1853 --
NM_017890chr831830 1271 29 11868 1592 11740
NM_017902chr1064800 4779 4665 4377 1764 1011 --13646 15532
NM_017913chr91316 ------
NM_017915chr1221143 193 1433 162 2442 149
NM_017919chr935655 5298 1165 ----25825 3580
NM_017922chr141137 ------
NM_017925chr941574 1445 1348 326 21549 611 --11207
NM_017938chrX21525 508 1821 --12142
NM_017943chr142918 189 ------
NM_017944chr1162878 1895 1065 1015 418 372 --12103 --
NM_017953chr121119 133 --2273 265 --
NM_017964chr2----184 --
NM_017988chr121311 1609 ----
NM_017998chr911172 ----2950 254
NM_018000chr221906 786 --21947 106 21814 1751
NM_018003chr151867 21845 1732 --1339
NM_018004chr31377 ------
NM_018014chr261384 1339 1182 473 453 432 --1389 --
NM_018015chrX2239 150 1721 ----
NM_018017chr1062751 2231 1074 729 452 259 12864 ----
NM_018025chr191228 ------
NM_018027chr1023091 2606 12407 23013 1216 --
NM_018028chr19----1152 --
NM_018030chr181445 ----1391
NM_018036chr1474101 3623 2803 1399 803 609 86 1369 11493 --
NM_018046chr521918 1329 ------
NM_018062chr21361 ------
NM_018063chr10----1409 --
NM_018078chr41942 --2954 132 --
NM_018084chr223180 2021 --2884 397 1331
NM_018085chr167529 6666 3173 2339 2102 330 37569 1791 1370 35500 1074 844 28140 6299
NM_018086chr221554 738 195 ----
NM_018103chr12315 304 ------
NM_018115chr43801 323 84 ------
NM_018120chr831072 527 208 ------
NM_018121chr1042758 2463 1207 441 11040 1196 1484
NM_018126chr421438 984 1174 --11244
NM_018133chr33638 298 77 --1593 --
NM_018137chr12230 188 --11311 --
NM_018155chr363259 2966 2503 2263 606 599 --1402 12448
NM_018157chr1242345 1045 978 853 12630 22127 1219 --
NM_018158chr21203 ----1195
NM_018169chr121161 1525 1147 --
NM_018171chr121674 --1942 --
NM_018179chr122270 139 1496 ----
NM_018181chr18--21700 189 --1611
NM_018184chr351989 1738 1345 512 404 ------
NM_018211chr141734 1487 761 614 --11876 --
NM_018227chr473211 3035 2624 2250 568 396 372 ------
NM_018230chr12537 26 ------
NM_018247chr662544 2399 2312 2186 800 568 --2849 651 2503 315
NM_018254chr112216 --22224 2184 1716
NM_018257chr2052527 2024 1793 403 192 11981 12557 --
NM_018266chr311002 ------
NM_018268chr5--1622 1780 1133
NM_018287chr10159 ------
NM_018290chr421267 53 ----1353
NM_018293chr352732 2688 1919 490 296 1179 1913 --
NM_018299chr861278 1208 1137 770 611 507 12321 13251 12800
NM_018302chr4102178 1807 1795 1764 723 499 408 329 168 122 --22007 289 --
NM_018303chr611348 11441 11368 1472
NM_018307chr171363 1743 ----
NM_018312chr1121708 223 ----2719 599
NM_018313chr322344 828 52541 2385 2287 436 239 2809 601 --
NM_018315chr421435 1396 1496 ----
NM_018323chr431269 1210 32 21186 255 ----
NM_018325chr931417 655 232 1489 1534 --
NM_018328chr2131 ------
NM_018330chr1041661 1243 568 385 11462 11535 --
NM_018339chr931750 1145 52 1123 1465 --
NM_018343chr5----127 --
NM_018348chr162842 280 --1317 --
NM_018351chr1254100 3700 3398 421 209 21472 1251 24224 1138 --
NM_018353chr142813 281 1690 ----
NM_018359chr4166 ------
NM_018361chr883840 3195 3051 2506 1454 1252 544 450 1689 22682 634 1794
NM_018362chr1153747 3565 1591 1143 408 ----13025
NM_018364chr193936 3313 3230 3150 2995 2975 2733 1226 74 --23018 1086 --
NM_018371chr83576 284 241 ----21475 1061
NM_018374chr785149 5047 4927 4364 4013 3884 3206 1454 14198 14238 --
NM_018383chr221572 427 11823 --11549
NM_018388chrX2939 408 11020 1584 --
NM_018403chr333093 1283 1153 12784 23636 2686 --
NM_018416chr1212659 11810 ----
NM_018424chr931365 538 271 ------
NM_018427chr1631184 470 265 --21609 270 --
NM_018429chr562776 613 603 487 261 137 --11139 12826
NM_018431chr202571 419 1110 ----
NM_018433chr21153 ------
NM_018439chr18----2692 101 --
NM_018440chr888580 8387 7516 7298 5955 1927 1528 1481 68396 7079 7050 5449 2873 2803 1841 11244
NM_018444chr832335 1616 1462 1754 ----
NM_018448chr121320 ------
NM_018460chr2----1147 --
NM_018464chr101179 --155 --
NM_018469chr1711039 ----11106
NM_018471chr22409 94 ----1564
NM_018482chr812224 1731 22534 1620 --
NM_018490chr1141462 1361 1171 48 --1570 --
NM_018492chr83430 160 43 1588 ----
NM_018534chr21592 ------
NM_018557chr211221 --11626 21584 421
NM_018566chr184678 4079 4048 3174 3121 1792 1467 1149 --31315 733 639 1107
NM_018569chr44568 280 125 24 --179 11260
NM_018584chr131005 865 448 --1817 --
NM_018590chr103647 580 103 21675 471 ----
NM_018593chr6------1748
NM_018602chr1541603 1203 356 181 11675 1556 --
NM_018638chr12115589 5181 4801 4585 4284 4082 1211 939 542 252 41 15171 21231 99 15068
NM_018640chr1282394 2193 2174 998 745 275 239 192 12735 12775 22112 401
NM_018650chr131922 618 560 21424 197 --1286
NM_018652chr15--2954 218 ----
NM_018689chr1542558 1085 896 766 --11791 12475
NM_018693chr2189 ------
NM_018695chr511593 11636 ----
NM_018708chr191617 --11669 --
NM_018710chr83455 415 349 --11150 2448 421
NM_018712chr1131510 1164 437 --167 21330 1051
NM_018715chr152193 2128 1881 659 125 12015 ----
NM_018719chr751298 440 419 156 148 1274 ----
NM_018834chr53954 925 713 ------
NM_018841chr112472 --21155 252 --
NM_018844chr732073 1434 271 11712 ----
NM_018847chr931672 225 142 ------
NM_018933chr54892 876 303 62 ------
NM_018945chr673508 3393 3158 1263 1135 771 671 12972 23174 1150 12428
NM_018948chr131278 471 440 11287 11363 --
NM_018951chr731263 804 189 --1481 --
NM_018958chr1563733 3454 3274 2869 1383 1292 ------
NM_018959chr191599 1236 1570 --
NM_018970chr721159 1062 ----12223
NM_018972chr882372 2068 1931 1899 1800 915 519 481 --11034 --
NM_018975chr161235 ------
NM_018976chr1221116 302 --22917 319 12593
NM_018979chr1252253 2111 1773 890 257 1742 --12384
NM_018992chr1621655 1503 11393 ----
NM_018993chr2021006 355 182 175 1950
NM_018999chr1074002 3504 3494 3407 3349 1492 950 11577 14480 24571 4011
NM_019001chr364461 3380 1541 1208 1165 865 34844 3776 1410 1944 2665 163
NM_019006chr151715 ----1579
NM_019021chr111851 ------
NM_019022chr1853046 2842 2217 2033 1215 --12694 --
NM_019026chr11243 1684 ----
NM_019036chr62923 353 ------
NM_019042chr7--2295 147 --1244
NM_019045chrX1768 ------
NM_019049chr12718 605 --1269 1228
NM_019050chr411511 ----12219
NM_019058chr103746 630 234 ------
NM_019063chr221720 191 --12141 --
NM_019071chr71744 ------
NM_019072chr584190 3976 3684 1246 1219 1024 561 168 ----14090
NM_019074chr15164 ------
NM_019084chr101377 1504 12360 11653
NM_019087chr521518 227 1600 ----
NM_019091chr21457 --21144 1079 --
NM_019094chr1253724 3231 3055 552 217 ----13071
NM_019102chr71149 --1374 --
NM_019102chr71149 --1374 --
NM_019116chr1633759 2420 176 ----1776
NM_019117chrX43412 3124 2492 1294 22583 448 23403 1149 --
NM_019556chrX1541 --11294 --
NM_019557chr11861 1256 ----
NM_019590chr1021161 112 ------
NM_019592chr91257 1900 ----
NM_019593chr2052811 2464 2375 902 789 ------
NM_019595chr23753 586 248 ------
NM_019596chr2122905 358 1621 21998 265 22055 1002
NM_019597chrX4579 229 195 82 1708 ----
NM_019600chr152535 263 ------
NM_019610chr12771 713 --22124 183 --
NM_019842chr61164 ------
NM_019857chrX2634 486 --11425 --
NM_019903chr1021350 705 --11622 --
NM_020066chr11811 ------
NM_020116chr41453 21513 1363 21820 594 21532 66
NM_020122chr254228 4209 2411 2096 348 13689 --44894 1664 801 775
NM_020123chr1031426 1146 214 1144 ----
NM_020130chr831415 981 483 --11377 --
NM_020141chr141954 1613 1560 893 1694 12189 --
NM_020144chr711908 --1540 --
NM_020147chr154684 319 151 128 11035 1313 --
NM_020148chr1842591 2556 1226 544 22771 105 --12788
NM_020151chr221361 1239 11394 ----
NM_020159chr441737 1431 426 409 ------
NM_020177chr563379 2975 1068 981 913 98 1544 --1951
NM_020178chr1711203 --21257 803 --
NM_020180chr181373 11025 ----
NM_020182chr2053573 2585 647 329 315 --1652 23314 381
NM_020185chr62146 81 ------
NM_020193chr11136 --21051 963 --
NM_020198chr1711143 --1472 2386 333
NM_020199chr52190 24 --143 --
NM_020207chr941350 898 836 48 1383 ----
NM_020210chr15----11017 1282
NM_020225chr42114 70 ------
NM_020238chr1121123 811 --11154 1867
NM_020243chr22------1587
NM_020245chr6114805 4622 4516 4469 3257 1948 1929 1519 1271 1251 1067 --15112 --
NM_020297chr1263586 3528 2967 1378 784 72 --1175 11170
NM_020307chr3------1357
NM_020336chr2013220 22461 1533 1118 13608
NM_020337chr422534 2364 2643 597 12830 1195
NM_020341chr2021316 526 12006 ----
NM_020342chr252620 2233 1770 1627 674 22456 876 1156 32389 1654 617
NM_020346chr1131370 1268 601 ----11591
NM_020348chr1022767 1800 12730 ----
NM_020362chr12738 600 ------
NM_020390chr344522 3669 851 29 24051 813 11833 --
NM_020403chr1321676 197 --11269 --
NM_020420chrY2682 267 1304 1291 21361 390
NM_020429chr732850 588 559 21936 982 ----
NM_020432chr751979 1968 863 515 119 12327 11620 --
NM_020438chr921397 960 ------
NM_020440chr173380 2725 2711 2233 1082 318 174 --12151 --
NM_020443chr156708 6126 2390 1836 938 1532 --1543
NM_020449chrX1218 --2504 204 1548
NM_020455chr642647 2615 1968 662 --32110 909 736 --
NM_020456chr1372319 2146 1726 533 417 249 108 11444 ----
NM_020463chr231423 1301 188 ------
NM_020465chr1621921 1693 ------
NM_020466chr674975 4349 3496 1636 1338 317 190 13230 ----
NM_020473chrX2638 384 --11657 --
NM_020474chr1831913 343 233 1529 --11812
NM_020525chr122526 181 ------
NM_020532chr21891 --1608 --
NM_020546chr532800 2367 200 ------
NM_020640chr331466 828 711 ------
NM_020645chr111531 ----1178
NM_020647chr862216 2009 1531 766 658 629 ----11833
NM_020648chr1852799 2556 2441 568 528 1810 1164 --
NM_020651chr231791 1186 503 ----11516
NM_020654chr31393 ----11589
NM_020666chr51780 --1603 --
NM_020673chr2077796 7565 7357 5807 5710 5279 458 47701 4741 1527 773 65692 5440 4876 2471 2018 871 21777 915
NM_020697chr82958 325 11061 ----
NM_020699chr121632 1288 24485 732 15428 --
NM_020711chr222038 317 ------
NM_020718chr1654801 2452 2265 810 40 --12143 --
NM_020727chr2153976 3820 3588 3489 2446 1125 11200 14012
NM_020728chr742240 1213 759 317 1385 12093 12809
NM_020732chr621293 76 11240 ----
NM_020734chr121567 23170 720 22658 2234 --
NM_020737chr62307 96 ------
NM_020739chr1554004 3659 3079 438 190 13589 14235 14193
NM_020742chrX42638 2313 2027 291 2647 410 ----
NM_020747chr51815 ------
NM_020748chr173727 373 168 --11713 1677
NM_020750chr611460 1209 ----
NM_020751chr1311266 ------
NM_020752chr1022109 953 --1254 --
NM_020755chr651606 1386 518 140 42 ----11418
NM_020760chr261800 1545 792 768 490 196 --11485 --
NM_020762chr123783 316 99 ------
NM_020766chrX64276 3623 3498 3060 214 132 1994 ----
NM_020768chr562541 2059 1170 981 443 239 12592 12761 12426
NM_020769chrX1704 ------
NM_020771chr641479 1461 1446 1043 ------
NM_020772chr17107635 7382 7205 7097 6400 5464 3128 2321 2001 1934 67570 6150 6022 5955 3277 820 28468 7915 36943 6584 1725
NM_020773chr432619 2341 183 1765 ----
NM_020774chr18116120 5714 5414 5266 4038 3961 2063 1640 1375 1227 874 --56086 5439 4862 1552 648 14018
NM_020776chr1843055 2773 2639 1927 ------
NM_020779chr231143 894 254 --23153 2238 --
NM_020791chr1741191 1160 945 160 ------
NM_020794chr11619 ------
NM_020795chr1722056 1583 ------
NM_020796chr522340 2043 --12551 --
NM_020800chr3--11450 --11459
NM_020801chr52917 340 --11798 1199
NM_020802chr115727 426 382 187 151 13123 12188 --
NM_020808chr12854 789 ----11144
NM_020815chr4----2413 369 --
NM_020818chr14--155 ----
NM_020819chr631185 297 144 ----1773
NM_020825chr1632933 2345 430 ----13803
NM_020830chr233320 3074 2941 --12987 1334
NM_020841chr1263492 3161 2851 1215 1099 852 13793 13805 --
NM_020843chr151100 ------
NM_020856chr192486 302 --1159 11187
NM_020858chr1541686 873 668 630 ------
NM_020860chr44886 376 172 87 --11050 --
NM_020861chr621395 1099 ----1405
NM_020865chr31375 ----160
NM_020866chr131911 ----11019
NM_020868chr2--11465 2778 474 --
NM_020870chr43305 295 63 126 ----
NM_020872chr31265 1533 ----
NM_020873chr3--1630 1760 --
NM_020895chr191277 ------
NM_020897chr11892 11366 ----
NM_020909chr234024 3610 2798 22610 1112 23885 1444 --
NM_020918chr1063622 3411 3301 2340 1338 926 ------
NM_020921chr1453618 3556 2535 2461 1397 12746 23379 2261 --
NM_020922chrX1295 ----1418
NM_020927chr1622371 2288 --12167 --
NM_020937chr142263 80 ------
NM_020940chr1062945 2547 2050 1141 961 392 ------
NM_020948chr163718 2744 2297 1070 1059 637 1561 32404 421 378 21079 995
NM_020951chr1932118 360 261 12416 1154 --
NM_020964chr1894057 3975 3842 1483 1302 1225 939 43 37 14613 --11831
NM_020975chr1011551 --11661 --
NM_020981chr21609 1564 ----
NM_020988chr1611026 1259 ----
NM_021007chr251937 1794 444 360 40 11837 --41876 1514 1504 657
NM_021032chr32688 188 1411 21902 446 --
NM_021033chr1313131 11113 1571 --
NM_021038chr363331 3278 3240 2574 1297 50 --32249 1209 519 43290 3143 2829 1104
NM_021069chr432096 1338 413 ------
NM_021072chr53942 561 212 1874 21878 779 --
NM_021090chr2264894 4629 3765 3593 1833 833 --34040 1469 1395 14278
NM_021102chr191416 ------
NM_021104chr121239 ------
NM_021109chrX1326 2410 112 176 --
NM_021109chrX1326 2410 112 176 --
NM_021111chr921321 420 ------
NM_021115chr221117 ------
NM_021116chr767036 3614 3564 3365 2223 2177 12896 29116 5617 27903 6442
NM_021140chrX11065 --2831 798 1839
NM_021144chr9----1456 --
NM_021145chr741159 314 244 93 1329 ----
NM_021158chr203837 191 183 ------
NM_021165chr11890 ------
NM_021183chrX22282 527 21012 227 1206 11853
NM_021190chr14444 400 365 250 ----21215 238
NM_021191chr1252337 2120 1711 1593 330 ----22524 2511
NM_021192chr2191 ------
NM_021194chr11120 ----1258
NM_021201chr1121418 138 11477 31875 1787 530 2645 369
NM_021204chr42909 312 --1687 --
NM_021205chr11183 --22734 1799 11936
NM_021215chr2052161 1624 1554 1508 937 12375 12175 --
NM_021229chr121844 --1951 1167
NM_021239chr142908 890 1471 --21199 1176
NM_021240chr92521 223 --1123 --
NM_021249chr1421293 292 11182 11620 --
NM_021252chr1021895 775 --1643 1342
NM_021255chr1473644 2722 1654 1260 1037 853 91 13077 43850 3367 1580 220 23469 1600
NM_021622chr102915 343 21729 311 21982 318 1943
NM_021629chr334033 2039 600 --21385 516 13858
NM_021639chr1150 ------
NM_021643chr211888 1758 ----
NM_021647chr474531 4250 3609 3350 1707 1224 770 --1872 --
NM_021648chr662386 2367 2159 1875 920 63 12148 1779 12736
NM_021649chr521448 1355 1690 11508 190
NM_021722chr73383 143 38 ------
NM_021723chr73424 184 38 ------
NM_021809chr2022390 479 ------
NM_021813chr655676 5215 4461 4178 3875 11111 14024 22111 1062
NM_021814chr651523 1216 1184 647 502 1456 21660 1128 21200 1167
NM_021815chr212537 13057 ----
NM_021818chr1441419 1246 614 600 1427 ----
NM_021911chr575203 4117 4044 3712 1361 930 269 14739 1599 25249 4946
NM_021912chr152640 200 33603 498 437 24122 4015 --
NM_021913chr19--1282 ----
NM_021914chr1442442 701 527 428 32471 2398 312 ----
NM_021925chr21196 --177 --
NM_021940chr62584 74 11597 2524 418 1596
NM_021943chr611500 12061 1418 --
NM_021949chrX22583 1791 ----12360
NM_021951chr91200 1223 ----
NM_021954chr1333725 1407 172 ------
NM_021955chr71202 ----1231
NM_021956chr621387 526 ------
NM_021958chr12341 70 ------
NM_021961chr1187134 6165 6092 4818 1398 1262 881 626 15028 --16195
NM_021963chrX1233 --1690 --
NM_021964chr376218 5775 1229 1082 881 848 446 1468 25657 5173 11870
NM_021979chr142351 155 1344 ----
NM_021980chr1031387 1128 1108 ----1334
NM_021988chr2021556 1302 ------
NM_021998chrX31232 1002 95 ------
NM_021999chr13----1646 --
NM_022037chr2266 34 ----1734
NM_022041chr1631003 993 140 --11867 --
NM_022048chr1566208 2342 1766 1468 282 242 --22123 1150 --
NM_022049chr1--11304 ----
NM_022058chr21503 12023 --2724 247
NM_022062chr1121395 345 1137 ----
NM_022079chr10----3999 885 328 --
NM_022080chr2082039 1936 951 923 834 420 216 92 --31104 298 132 11975
NM_022087chr71514 --1564 --
NM_022091chr652712 2694 2277 2181 472 1536 ----
NM_022114chr144638 4376 3975 1228 --14405 14305
NM_022117chrX--1132 ----
NM_022123chr141184 ----1627
NM_022129chr1011165 1335 11311 155
NM_022130chr521350 337 ------
NM_022133chr851594 701 526 503 495 21634 445 --11392
NM_022138chr641378 1350 375 273 --11452 --
NM_022166chr1655410 5275 4792 2085 970 14136 14692 15430
NM_022173chr2266 34 ----1734
NM_022367chr12722 708 ------
NM_022373chr7--155 1676 --
NM_022442chr2021556 1302 ------
NM_022443chr3124 ------
NM_022451chr101598 ------
NM_022456chr1275222 3072 2810 2405 1091 922 175 1740 77505 4796 4762 4749 2923 2284 2160 36884 5077 4712
NM_022459chr1396140 5645 4933 4510 3985 2531 2464 2407 700 24145 2230 46259 5454 1125 21 14645
NM_022470chr32973 457 1327 1105 --
NM_022473chr1554372 3980 3858 2992 286 33270 1470 392 33642 3626 427 13322
NM_022474chr1421940 1074 1571 2475 311 --
NM_022476chr162928 254 ------
NM_022484chr74532 389 267 210 ----11235
NM_022488chr31124 --1169 --
NM_022496chr122446 39 1106 ----
NM_022572chr211669 ------
NM_022574chr711963 ------
NM_022650chr52705 65 ------
NM_022658chr1221210 1074 ------
NM_022659chr82534 526 --1338 --
NM_022716chr142049 1945 1011 238 22455 706 1270 --
NM_022725chr11--1295 1666 1618
NM_022728chr72106 67 ------
NM_022731chr11106 --1215 --
NM_022733chr13873 783 770 2946 390 --21140 433
NM_022744chr161865 ----1940
NM_022745chr121938 128 1394 --22333 479
NM_022753chr162662 2653 2326 1828 698 49 --22801 218 --
NM_022755chr912618 12257 ----
NM_022757chr32732 406 ------
NM_022763chr322086 552 ------
NM_022771chr122850 824 --1331 1895
NM_022776chr331422 1373 45 ----1512
NM_022780chr231665 1518 753 --51578 641 625 505 333 --
NM_022781chr963204 2487 2082 1119 999 235 ----12113
NM_022782chr122396 89 ------
NM_022784chr152792 301 1824 ----
NM_022787chr152582 2114 1886 1078 464 42661 876 575 109 ----
NM_022802chr1041620 1353 1125 177 --11245 --
NM_022817chr252271 2086 2040 1934 52 ------
NM_022818chr1621314 1272 1250 --137
NM_022824chr521938 1918 --21767 1199 --
NM_022826chr23859 219 43 2817 758 ----
NM_022828chr511142 --2674 350 11664
NM_022831chr131624 1373 512 11875 --1571
NM_022841chr1532462 2376 1832 2567 483 12390 12443
NM_022843chr1341351 1057 541 137 11297 ----
NM_022844chr162944 712 ----1963
NM_022845chr1611746 --12246 11640
NM_022875chr51425 ----1525
NM_022877chr51425 ----1525
NM_022893chr272969 2321 2151 2002 917 787 171 1979 ----
NM_022894chr221675 292 11303 --11355
NM_022898chr1454687 4599 4548 1041 513 --14618 24150 1884
NM_022902chr52351 303 ------
NM_022910chr1621921 1693 ------
NM_022912chr282803 2682 2582 2440 1070 1064 716 637 12146 1959 --
NM_022918chr1141841 1727 1659 1547 11750 21366 182 21668 1411
NM_022977chrX52614 2601 2065 1767 780 1396 --12151
NM_023000chr1431107 667 657 --11444 --
NM_023001chr1431107 667 657 --11444 --
NM_023016chr222651 869 1963 --21115 928
NM_023039chr53422 68 35 ------
NM_023076chr1621933 581 11150 --22944 2927
NM_023105chr811870 ----12177
NM_023106chr811870 ----12177
NM_023110chr811870 ----12177
NM_023111chr811870 ----12177
NM_023927chr51997 11374 ----
NM_023929chr822446 613 ----11782
NM_023931chr1611256 ------
NM_023943chr3--1167 ----
NM_024007chr522050 297 32993 2656 963 ----
NM_024052chr1721083 721 12947 ----
NM_024069chr192693 667 ------
NM_024090chr421588 138 ----11198
NM_024095chr122218 211 1606 11192 11535
NM_024117chr93543 233 207 ----1582
NM_024328chr141260 ------
NM_024345chr931866 1248 533 25791 5469 14122 12253
NM_024408chr142727 2362 296 262 ----11285
NM_024423chr1844093 3391 2855 373 1578 --23252 997
NM_024424chr11------21108 1013
NM_024425chr11------21108 1013
NM_024426chr11------21108 1013
NM_024429chr71110 2428 151 --1175
NM_024494chr12680 566 --1729 --
NM_024501chr22690 566 ------
NM_024513chr343340 1509 943 904 1275 33535 2905 2436 13289
NM_024524chr362769 2718 2078 584 572 402 11010 --22577 2481
NM_024539chrX1422 1154 ----
NM_024551chr1212343 ----2523 499
NM_024551chr1212343 ----2523 499
NM_024556chr111414 --164 --
NM_024557chr1111461 21681 1493 ----
NM_024561chr1331128 349 193 ------
NM_024563chr531682 518 137 ----11177
NM_024565chr51649 --11057 --
NM_024583chr22923 748 ------
NM_024586chr11620 --1641 --
NM_024607chr853877 3132 2790 1292 910 --12776 --
NM_024611chr1522529 1459 --52745 1515 1404 611 52 --
NM_024612chr171994 ------
NM_024613chr831650 594 243 ------
NM_024624chr231169 621 320 ------
NM_024635chr91305 ------
NM_024645chr831345 1077 64 ------
NM_024646chr111567 12931 1269 13925
NM_024652chr152836 764 ------
NM_024657chrX--2589 210 ----
NM_024665chr363437 1655 1642 1532 1433 536 31214 1094 814 ----
NM_024670chr1021460 255 --1448 1218
NM_024674chr133126 2963 1975 22629 1270 12932 --
NM_024676chr111249 ------
NM_024680chr11124 --2360 44 --
NM_024686chr1--1525 1503 --
NM_024692chr231851 1804 301 --1760 11381
NM_024700chr121051 908 ------
NM_024709chr142348 556 544 486 --12357 1627
NM_024711chr732230 465 143 ------
NM_024713chr1531665 1366 1227 1486 ----
NM_024715chr531527 363 321 --21914 393 --
NM_024721chr852625 1744 997 876 528 --11072 127
NM_024744chr252658 2596 2237 832 496 22455 1014 12676 12624
NM_024751chr411874 --1337 --
NM_024753chr22614 29 ------
NM_024755chr151317 --2268 94 1166
NM_024757chr911066 ------
NM_024759chr83867 749 731 ------
NM_024761chr935213 2131 525 ------
NM_024770chr284110 2691 2383 841 365 358 350 251 36460 5694 4124 25131 1844 14322
NM_024811chr1151751 1698 773 721 170 --2767 514 --
NM_024813chr11759 --1275 --
NM_024817chr1565339 5306 5086 4473 1995 1268 ------
NM_024824chr1441711 1311 338 231 21440 1153 11261 21619 491
NM_024828chr921516 435 --1605 --
NM_024834chr1051860 1620 1415 268 150 ------
NM_024852chr11165 ------
NM_024881chr1921534 466 11033 1443 11248
NM_024893chr201361 --1978 --
NM_024899chr181263 2282 109 136 1153
NM_024900chr411675 12201 11771 --
NM_024900chr411675 12201 11771 --
NM_024913chr73510 489 478 ------
NM_024915chr852761 2646 693 647 170 12505 1957 12623
NM_024920chr441590 1298 395 141 2564 420 11416 --
NM_024940chr82391 126 --1408 --
NM_024945chr921082 126 --1141 --
NM_024947chr3129577 9462 8858 8770 8096 6525 6162 3269 3223 1871 1018 308 38500 6903 6079 29454 2075 47843 6270 6024 5894
NM_024948chr101141 ----1154
NM_024949chr445007 3830 3702 1155 --24870 1953 1198
NM_024953chr1232407 1097 718 12483 11741 --
NM_024979chr132583 503 ------
NM_024989chr2118106 7383 7025 5301 2104 2080 1739 1507 1080 795 40 26891 6109 23031 1888 35730 5639 1863
NM_024991chr1032549 1238 1207 --12706 1145
NM_024996chr32696 439 1321 1273 --
NM_025054chr863949 3252 2880 1111 1083 33 --11029 11369
NM_025073chr144460 4377 1742 946 --44276 3610 3069 993 1396
NM_025075chr3----1242 164
NM_025079chr11257 ------
NM_025106chr1--11383 11461 21453 440
NM_025133chr211137 ------
NM_025134chr1632570 716 123 --11836 --
NM_025135chr183521 468 435 ------
NM_025138chr1341428 1319 1240 346 11345 1592 --
NM_025140chr12----2618 79 --
NM_025147chr221196 441 ------
NM_025154chr7--11546 ----
NM_025160chr173974 2623 1314 831 496 403 367 2746 361 132 12772
NM_025181chr22857 27 --1756 --
NM_025187chr1611120 ------
NM_025191chr153175 2725 2627 1244 726 12185 12606 32565 1203 188
NM_025208chr1131745 722 48 ------
NM_025211chr9--135 ----
NM_025221chr42938 97 ------
NM_025222chr372969 2847 2780 2096 913 582 414 ----12451
NM_025235chr101141 --11973 --
NM_025237chr17190 ------
NM_025238chr1551581 1145 397 221 148 1230 ----
NM_025246chr3163 ------
NM_025268chr141389 ------
NM_030579chr1652954 2661 608 509 61 12818 12975 --
NM_030613chr5----1332 --
NM_030621chr1453605 1571 1413 1192 964 1373 33742 2944 349 31565 1428 254
NM_030623chr241662 1262 324 279 --11505 --
NM_030625chr1031918 1780 307 --1409 --
NM_030627chr542856 2671 1266 926 ------
NM_030640chr12------1895
NM_030647chr745002 3999 1416 977 26008 266 --16166
NM_030648chr445436 5144 3810 1790 11176 11622 11783
NM_030664chr1032232 899 744 --1432 --
NM_030665chr1711386 ------
NM_030752chr62417 210 2440 183 1518 --
NM_030755chr1433057 2815 979 1206 21093 265 --
NM_030756chr102314 32 1269 --1251
NM_030758chr221413 ----11033
NM_030762chr1231933 1593 1587 1658 --11410
NM_030763chrX----2782 632 --
NM_030791chr142738 710 11790 11716 --
NM_030799chr521966 222 11996 12076 --
NM_030806chr169415 8713 8146 7782 7128 1976 19296 46266 2406 2293 2227 --
NM_030808chr171915 ------
NM_030816chr113387 11363 12901 22308 821
NM_030820chr621031 355 --1963 --
NM_030881chr2252295 2077 1973 798 731 ------
NM_030885chr321862 1548 1890 --1777
NM_030891chr2121318 460 1198 ----
NM_030906chr112574 162 1148 1526 --
NM_030917chr4----179 --
NM_030919chr202529 349 1205 ----
NM_030920chr12733 662 ------
NM_030934chr141863 1624 1584 375 11175 1265 --
NM_030938chr1721149 448 ------
NM_030939chr611160 190 11094 1298
NM_030949chr631534 1486 1178 ------
NM_030953chr5------11596
NM_030963chr62246 215 ------
NM_030978chr91185 ------
NM_031203chr19------199
NM_031216chr1872130 1845 910 782 491 129 40 2412 299 11401 --
NM_031243chr732253 1842 1522 ------
NM_031262chr91713 1254 --159
NM_031263chr91770 1311 --1116
NM_031266chr51181 ------
NM_031267chr7--1149 --1175
NM_031268chr1635318 2091 225 1956 13795 --
NM_031275chr11--2588 147 --1404
NM_031283chr21885 ------
NM_031291chr42712 608 1259 ----
NM_031296chr432779 2127 1817 --11830 --
NM_031314chr1431945 1394 713 --21834 1791 --
NM_031362chr232609 648 612 ----11058
NM_031365chr232745 784 748 ------
NM_031366chr232745 784 748 ------
NM_031369chr42858 165 --1640 --
NM_031370chr42858 165 --1640 --
NM_031371chr121416 591 ------
NM_031371chr121416 591 ------
NM_031412chr1221267 283 ------
NM_031418chr1142525 2313 1006 272 22164 376 ----
NM_031427chr1433861 3772 3664 22157 2057 24851 4049 24332 806
NM_031431chr13--31341 597 242 31486 1362 650 11756
NM_031435chr12122 1731 33210 1377 313 --
NM_031442chrX43122 3055 2995 422 1953 1463 --
NM_031445chr233140 2700 2437 12753 ----
NM_031469chr643065 1045 120 68 --11294 1742
NM_031475chr12537 247 ------
NM_031483chr2043575 2332 2309 1044 12830 1215 --
NM_031844chr133692 3249 876 22884 185 14044 --
NM_031845chr243707 2423 1321 1135 12781 ----
NM_031847chr243707 2423 1321 1135 12781 ----
NM_031858chr1741344 1145 1090 86 ----1984
NM_031862chr1741344 1145 1090 86 ----1984
NM_031889chr441846 1369 1200 433 --1299 --
NM_031911chr432650 2421 1902 --1774 --
NM_031935chr11779 1107 ----
NM_031940chr811518 22431 2043 ----
NM_032021chr1131153 1071 286 ----1785
NM_032042chr542827 2222 2090 64 ------
NM_032047chr351935 1732 1620 1575 636 22413 2034 31880 847 160 22013 1631
NM_032052chr2221216 972 ------
NM_032105chr177920 7322 7083 6644 5754 2040 1428 27092 5115 25559 5242 12147
NM_032109chr521427 321 ------
NM_032116chr1365855 5165 4804 3994 3750 1114 21433 114 --15297
NM_032119chr5----1283 --
NM_032121chrX1736 12739 11008 --
NM_032123chr19----1575 --
NM_032128chr4----11067 1827
NM_032138chr131240 --1170 --
NM_032143chr2----179 1316
NM_032144chr221702 1196 ----1488
NM_032145chr621416 160 ----11537
NM_032146chr33385 113 85 --1317 --
NM_032151chr5------1498
NM_032153chr332678 2417 914 32255 984 389 ----
NM_032175chr531706 1612 1226 --21560 481 --
NM_032182chr1031205 589 48 11265 ----
NM_032186chr131037 358 86 11489 ----
NM_032189chr1365053 4383 4196 1915 1616 341 14186 ----
NM_032199chr1053562 3137 2985 935 788 13730 ----
NM_032208chr222886 649 1881 11266 --
NM_032217chr431272 974 396 --1104 1906
NM_032228chr112812 160 12539 22779 1081 21407 489
NM_032229chr1341018 858 764 429 ------
NM_032231chr15----183 151
NM_032233chr141645 ------
NM_032236chr11297 ----1980
NM_032239chr41386 --1372 1470
NM_032242chr342471 1054 1025 221 ------
NM_032246chr1531115 1104 445 21172 1147 ----
NM_032268chr1632320 365 303 ----1929
NM_032281chr192762 718 1451 13155 --
NM_032288chr321563 646 1633 1732 155
NM_032289chr521847 1232 ----11388
NM_032291chr151642 1595 749 554 368 --1507 --
NM_032299chr111228 ------
NM_032312chr21738 ------
NM_032315chr1174 1172 ----
NM_032320chr112223 114 ------
NM_032324chr11239 ----2226 154
NM_032329chr212971 11682 44422 2956 1336 986 --
NM_032345chr121377 ----1279
NM_032373chr1034893 301 48 13701 1329 25756 402
NM_032410chr811136 ----1401
NM_032427chr111432 ----1118
NM_032429chr101532 ------
NM_032431chr11--21067 842 1869 --
NM_032435chr142383 2262 2049 1852 --124 1571
NM_032439chr10------1352
NM_032440chr1052547 2374 2277 1925 74 ------
NM_032446chr553660 3582 3110 3102 622 --33497 1237 1074 23397 337
NM_032452chr1421423 259 ------
NM_032457chr453906 2772 2501 1226 83 13672 13810 12894
NM_032458chrX3674 655 109 11045 ----
NM_032499chr1521732 1345 --11304 --
NM_032505chr312176 12666 12584 22234 128
NM_032508chrX51148 508 379 316 26 ----1959
NM_032510chr1812400 1686 --22389 1712
NM_032521chr2043113 2647 2076 717 165 ----
NM_032538chr612709 ------
NM_032539chrX3776 745 305 --1688 --
NM_032547chr421430 1256 ------
NM_032560chr141822 --1699 --
NM_032569chr16----11756 11958
NM_032582chr1731349 1218 297 ------
NM_032594chr1421074 873 --1817 --
NM_032622chr41237 ------
NM_032632chr1421782 421 ------
NM_032682chr313469 1686 22800 2236 13540
NM_032711chr1741679 686 636 461 21025 509 --1773
NM_032727chr10----2486 30 --
NM_032778chr322115 833 1647 --33213 2481 555
NM_032801chr112729 639 --22541 2156 --
NM_032810chr1031133 228 112 1987 ----
NM_032828chr1974937 3505 3466 1457 1145 999 489 24576 3975 --1451
NM_032837chr1731813 461 155 --11557 --
NM_032844chr102312 243 ------
NM_032859chr1343459 3128 3012 242 13628 13703 12900
NM_032866chr1532072 1972 1038 22957 197 11073 --
NM_032867chr111634 1461 ----
NM_032873chr1131515 857 582 14066 33542 3332 1305 21650 59
NM_032875chr172785 747 ------
NM_032876chr1421388 241 11597 ----
NM_032880chr11130 ------
NM_032900chr1053623 465 306 99 46 --23287 206 --
NM_032906chr43848 648 640 ------
NM_032940chr162859 181 ------
NM_032961chr43560 310 257 11305 ----
NM_032968chrX33968 3539 560 --21528 182 14031
NM_032969chrX33968 3539 560 --21528 182 14031
NM_032973chrY33960 3535 560 --21528 182 14023
NM_032999chr71322 123 ----
NM_033000chr71322 123 ----
NM_033001chr71322 123 ----
NM_033020chr113437 11273 --130
NM_033023chr711217 --1167 --
NM_033044chr121181 1147 --2509 436 --
NM_033049chr32368 66 1920 ----
NM_033055chr11213 --11062 --
NM_033058chr8------1867
NM_033081chr201977 --11308 --
NM_033083chr343408 3366 2848 216 1802 23342 2467 12363
NM_033132chr132666 618 ------
NM_033135chr1131745 722 48 ------
NM_033138chr712111 1328 ----
NM_033139chr712111 1328 ----
NM_033140chr712111 1328 ----
NM_033143chr473081 3055 1543 1410 958 862 843 --33264 2970 582 31839 1316 982
NM_033157chr712111 1328 ----
NM_033181chr652520 977 941 482 461 12591 21340 220 --
NM_033201chr161251 ------
NM_033211chr531363 795 330 1500 11747 --
NM_033222chr921206 898 ------
NM_033224chr767450 6653 6392 5996 1166 745 ------
NM_033225chr832695 2583 784 --1639 12684
NM_033228chr52176 157 ------
NM_033254chr31576 ------
NM_033281chr52355 202 ------
NM_033285chr874004 3809 3703 3037 2818 1686 43 ----24401 3594
NM_033326chr111343 ------
NM_033331chr953461 2723 1225 549 483 ----13193
NM_033360chr1284570 4372 4125 3417 3322 3242 1053 264 ------
NM_033389chr1744516 3657 3261 968 --23922 1074 11354
NM_033393chr432943 2928 2228 --1454 12869
NM_033394chr21373 11226 ----
NM_033425chr1133356 2197 572 --22865 2724 23309 2553
NM_033430chr433824 3159 320 --23961 1393 --
NM_033437chr433824 3159 320 --23961 1393 --
NM_033480chr622711 696 --42636 1079 373 272 --
NM_033481chr622711 696 --42636 1079 373 272 --
NM_033495chrX1176 --1230 --
NM_033505chr295938 5924 5866 5774 5421 5361 4391 619 44 --46720 6113 5073 88 56477 5325 4420 1280 705
NM_033626chrX1478 ------
NM_033632chr421435 1396 1496 ----
NM_033642chrX2483 463 11206 21218 1027 1410
NM_033644chr541908 1762 794 738 --32417 2060 831 --
NM_033645chr541908 1762 794 738 --32417 2060 831 --
NM_033656chr2135655 1965 423 26016 1731 15717 15505
NM_044472chr1--165 1224 --
NM_052832chr8102376 2244 2195 2006 1086 993 920 234 204 88 12600 32723 1206 697 1330
NM_052834chr1841841 512 492 302 22270 725 --2701 403
NM_052875chr1122080 1682 ------
NM_052879chr1233180 1203 1175 43319 3121 808 458 --13975
NM_052882chr191172 1323 --1542
NM_052886chr822000 114 --11545 --
NM_052897chr12----1314 --
NM_052898chr82433 226 21753 1572 --1529
NM_052900chr851620 1474 541 222 176 1352 --11690
NM_052903chr151529 ------
NM_052911chr181256 1415 ----
NM_052917chr252595 2272 2260 277 158 12169 ----
NM_052918chr1053732 3643 3472 3277 3031 ------
NM_052925chr1921056 834 ------
NM_052932chr1112261 176 2730 612 --
NM_052937chr862569 2405 2265 2243 1948 1913 1343 ----
NM_052944chr16187 ------
NM_052950chr1342169 1731 1511 397 --1297 --
NM_052962chr621472 146 --21705 1159 --
NM_052965chr141033 460 231 22 ------
NM_053002chr33985 892 467 ----1160
NM_053016chr9117848 6696 6322 6104 5510 5418 2696 2023 1834 1662 704 37293 3189 1706 --15910
NM_053024chr331553 1212 65 ------
NM_053043chr765738 4876 4098 857 452 276 14366 35969 5348 1560 12055
NM_053056chr112902 566 --12610 1416
NM_053064chr1452484 2406 2005 590 441 12641 12682 1143
NM_053281chrX3110 92 37 ------
NM_054016chr122016 1527 21816 685 1191 31668 262 99
NM_054016chr122016 1527 21816 685 1191 31668 262 99
NM_054016chr122016 1527 21816 685 1191 31668 262 99
NM_054034chr2199 ------
NM_057159chr92655 540 ------
NM_057168chr721508 635 --11251 --
NM_057175chr412458 1870 1539 12015
NM_057178chr1722290 377 ------
NM_057749chr851350 971 481 313 218 ----21402 1370
NM_058170chr121483 253 1328 ----
NM_058237chr142701 412 --1780 --
NM_058241chr251596 536 500 458 352 1791 ----
NM_058241chr251596 536 500 458 352 1791 ----
NM_078470chr1032537 2246 534 --32129 2114 270 12558
NM_078473chr811518 22431 2043 ----
NM_078483chr533366 3307 1227 13840 ----
NM_079420chr2289 29 ------
NM_079422chr2289 29 ------
NM_080392chr11445 --1242 --
NM_080422chr181132 ------
NM_080597chr181445 ----1391
NM_080617chr203996 719 324 ----1232
NM_080629chr1--11254 1369 --
NM_080630chr1--11254 1369 --
NM_080645chr641574 532 80 29 1634 ----
NM_080666chr142146 59 --1434 183
NM_080672chr20----131 --
NM_080676chr2063107 2255 1048 1003 950 302 --12866 11032
NM_080678chr22250 236 ------
NM_080682chr11721 ----1300
NM_080683chr42465 443 ------
NM_080684chr42465 443 ------
NM_080685chr42465 443 ------
NM_080717chr1211118 1174 11448 11596
NM_080743chr642593 2404 2134 903 --42058 1848 992 834 1454
NM_080759chr1321753 139 ------
NM_080760chr1321753 139 ------
NM_080764chr2253158 3038 2287 2109 221 1631 ----
NM_080798chr101173 ------
NM_080799chr101173 ------
NM_080800chr101173 ------
NM_080801chr101173 ------
NM_080802chr101173 ------
NM_080803chr101173 ------
NM_080804chr101173 ------
NM_080805chr101173 ------
NM_080806chr101173 ------
NM_080807chr101173 ------
NM_080808chr101173 ------
NM_080809chr101173 ------
NM_080810chr101173 ------
NM_080811chr101173 ------
NM_080812chr101173 ------
NM_080813chr101173 ------
NM_080814chr101173 ------
NM_080815chr101173 ------
NM_080821chr2052326 2095 841 678 436 12104 --11969
NM_080867chr1423143 1079 1191 24738 170 14024
NM_080874chr431835 439 245 --157 --
NM_080921chr121099 197 1402 31228 1160 762 11033
NM_080927chr352609 2448 2075 735 700 33362 2899 405 ----
NM_130387chr321175 1035 ------
NM_130391chr923184 185 ----31348 482 327
NM_130392chr923184 185 ----31348 482 327
NM_130393chr923184 185 ----31348 482 327
NM_130434chr152480 61 1781 ----
NM_130435chr10----32762 2747 1113 --
NM_130436chr2132841 2270 2121 --11929 2181 85
NM_130438chr2133418 2847 2698 --12506 2758 662
NM_130439chr1032020 1595 915 ------
NM_130439chr1032020 1595 915 ------
NM_130469chr141644 ------
NM_130798chr1561367 1230 526 364 249 77 21159 226 11553 --
NM_130811chr2011050 11198 11014 --
NM_130831chr342879 2729 2310 327 12547 --1419
NM_130832chr342879 2729 2310 327 12547 --1419
NM_130833chr342879 2729 2310 327 12547 --1419
NM_130834chr342879 2729 2310 327 12547 --1419
NM_130835chr342879 2729 2310 327 12547 --1419
NM_130836chr342879 2729 2310 327 12547 --1419
NM_130837chr342879 2729 2310 327 12547 --1419
NM_130838chr152346 340 --1357 --
NM_130839chr152346 340 --1357 --
NM_130847chr1195602 5317 5153 2374 1859 1671 1583 1201 1018 --34877 4385 4337 25828 4355
NM_130902chr4------135
NM_133264chr1743540 2886 2823 1182 11562 --12683
NM_133265chrX83419 3247 2899 2769 1106 904 898 873 33636 3557 3166 1190 2317 307
NM_133329chr231199 723 634 --1477 --
NM_133334chr446316 4943 4179 2127 12208 1961 --
NM_133367chr653394 1255 1146 686 211 22785 1095 23072 2495 13257
NM_133370chr442335 2270 650 68 --13399 129
NM_133372chr532567 1128 787 --22196 988 --
NM_133433chr54739 341 244 231 ----2658 273
NM_133445chr953489 2653 984 642 627 --22307 1206 12612
NM_133476chr1221000 955 ------
NM_133477chr443224 2071 1178 1140 12846 ----
NM_133478chr232120 474 244 1926 22372 1906 32048 553 357
NM_133486chrX1437 ------
NM_133493chr633084 1510 1059 14670 --2582 373
NM_133507chr122729 330 ------
NM_133631chr321200 353 ------
NM_133633chr2221151 404 ------
NM_133638chr521215 155 11039 ----
NM_133642chr2211235 ------
NM_133646chr242127 958 172 60 11477 44942 1750 1242 592 22066 1345
NM_133647chr1543813 3134 2468 2335 --33399 2458 24 --
NM_134265chr1721165 1035 1820 ----
NM_134428chr9156 1313 ----
NM_134442chr21283 ----11710
NM_138270chrX43227 2984 2586 2226 --12304 --
NM_138288chr142832 748 1532 11611 --
NM_138290chr71121 --146 --
NM_138316chr10----1302 --
NM_138333chr932374 1919 751 21655 467 --22116 381
NM_138335chr41180 128 --1280
NM_138344chr141334 ------
NM_138370chr21776 ------
NM_138395chr21881 11191 1849 --
NM_138415chr22151 --1630 --
NM_138426chr731001 395 195 --12402 12377
NM_138437chrX------1290
NM_138444chr1321237 451 1709 --24579 1861
NM_138453chr5----1163 --
NM_138455chr81119 ------
NM_138457chr61369 ----13308
NM_138459chr643287 2500 1401 67 23456 2448 11270 --
NM_138468chr266342 6144 5953 5936 4906 1740 13918 --24392 2384
NM_138473chr1221990 605 14117 13574 23601 859
NM_138494chr742213 676 543 382 ----11874
NM_138559chr261374 1329 1172 463 443 422 --1379 --
NM_138565chr111187 ------
NM_138576chr1454687 4599 4548 1041 513 --14618 24150 1884
NM_138609chr51150 151 ----
NM_138610chr51150 151 ----
NM_138621chr242880 1158 293 44 12568 ----
NM_138633chr611331 1421 2354 89 --
NM_138638chr1442442 701 527 428 32471 2398 312 ----
NM_138711chr31146 ------
NM_138712chr31146 ------
NM_138713chr16137837 7620 7530 7192 6710 6648 6450 5476 5162 1658 1421 366 164 2787 310 28021 7513 15671
NM_138714chr16137837 7620 7530 7192 6710 6648 6450 5476 5162 1658 1421 366 164 2787 310 28021 7513 15671
NM_138730chr6--1443 ----
NM_138731chr1453910 3244 3227 2936 839 1481 33713 580 163 24240 779
NM_138735chr221003 253 ------
NM_138766chr5--173 ----
NM_138771chr741515 980 459 80 --21280 393 --
NM_138821chr5--173 ----
NM_138822chr5--173 ----
NM_138927chr2131028 344 335 --1366 --
NM_138959chr155635 4830 2554 2344 1789 42135 1704 1012 659 15706 --
NM_138962chr17188 ------
NM_138970chr1452039 1662 1580 617 420 --22433 445 11871
NM_138980chr42615 250 ------
NM_138981chr41746 ------
NM_138982chr42615 250 ------
NM_139048chr341258 1041 862 138 ----1984
NM_139067chr122278 212 ------
NM_139126chr62622 353 --1684 179
NM_139131chr112550 434 ------
NM_139135chr121268 312 ------
NM_139136chr122685 256 --1947 --
NM_139168chr541876 1303 713 566 --21703 1281 2612 443
NM_139182chr41649 11780 1131 1354
NM_139207chr1222157 794 ----1465
NM_139211chr4164 --1128 --
NM_139212chr4164 --1128 --
NM_139241chr121145 ------
NM_139244chr61382 --1938 2978 920
NM_139266chr2276 26 ------
NM_139276chr1722239 1955 22009 788 ----
NM_139321chr2043991 3691 1511 370 ------
NM_139323chr201362 11798 21534 256 --
NM_144498chr2031951 1608 297 ----1906
NM_144567chr14682 500 411 86 --2553 311 --
NM_144571chr466964 5553 5058 4661 2418 802 26473 4431 56868 6549 6542 5634 4586 --
NM_144574chr141478 --1626 --
NM_144578chr1442021 1345 1174 1037 21880 1306 21671 851 41534 1397 1329 292
NM_144600chr16--11101 1135 --
NM_144609chr171119 ------
NM_144610chr172406 213 ----189
NM_144628chr2043056 2146 718 404 --12119 --
NM_144632chr232271 647 304 21930 344 --1763
NM_144635chr311245 --1450 --
NM_144642chr331011 875 574 1304 ----
NM_144657chrX1262 ------
NM_144658chrX----1268 1280
NM_144690chr191363 ------
NM_144710chr2--1326 21336 552 11045
NM_144721chr412594 12626 --32086 1760 782
NM_144728chr11613 ----1135
NM_144729chr11613 ----1135
NM_144767chr1554412 4305 1512 810 681 11586 12816 --
NM_144775chr1754921 4292 4266 3744 1060 --197 --
NM_144778chr1332410 1775 834 --22458 201 1253
NM_144949chr232275 1760 115 12461 1982 --
NM_144963chr822711 294 11821 2363 113 --
NM_144964chr91933 ----1913
NM_144979chr4--1193 ----
NM_144982chr123795 724 572 1733 1614 --
NM_145012chr1021004 759 ------
NM_145025chr61183 1464 ----
NM_145036chr172379 261 ------
NM_145037chr351461 1205 1142 1059 561 1154 11605 11269
NM_145044chr31723 1464 ----
NM_145048chr44876 803 630 386 1831 1393 --
NM_145055chr181628 11297 1960 23635 3320
NM_145063chr6----2184 119 --
NM_145113chr1411423 ------
NM_145117chr1123333 541 --12064 12875
NM_145159chr142329 137 ------
NM_145173chr1942512 2085 2070 310 ------
NM_145175chr221456 1248 11208 ----
NM_145176chr622844 264 12674 ----
NM_145185chr1922022 781 ----11507
NM_145206chr1023281 245 11228 22732 2462 --
NM_145234chrX----3723 361 76 --
NM_145239chr161136 ------
NM_145247chr10--1579 --1461
NM_145251chr1431122 561 379 11065 ----
NM_145259chr295966 5952 5209 4976 2380 2241 1916 1460 566 --46915 2554 529 206 15804
NM_145268chr73401 316 193 11110 ----
NM_145284chrX2681 54 --22447 397 22207 258
NM_145307chr1094529 4172 4081 3989 3760 3742 3573 3563 51 --21585 514 14419
NM_145313chr1021426 184 21452 53 ----
NM_145320chr773595 2885 887 441 193 75 46 12211 1115 --
NM_145321chr773595 2885 887 441 193 75 46 12211 1115 --
NM_145322chr773595 2885 887 441 193 75 46 12211 1115 --
NM_145331chr61150 1818 ----
NM_145332chr61298 1966 ----
NM_145333chr61298 1966 ----
NM_145341chr1051733 1520 1383 1190 271 ----21630 1361
NM_145649chr622578 1752 22471 2336 ----
NM_145655chr622578 1752 22471 2336 ----
NM_145686chr2113133 2837 2782 2655 2581 2572 2242 2223 948 862 547 --11033 22514 874
NM_145687chr2113133 2837 2782 2655 2581 2572 2242 2223 948 862 547 --11033 22514 874
NM_145690chr841672 1601 724 90 --1158 --
NM_145698chr1032175 1559 307 1703 22112 785 --
NM_145728chr152501 394 11776 12422 --
NM_145735chr1332497 152 32 1811 ----
NM_145793chr102926 592 ------
NM_145799chrX43121 2868 2436 2179 22067 1108 ----
NM_145800chrX41002 772 645 639 ------
NM_145802chrX2951 721 ------
NM_145805chr15----1508 --
NM_145918chr9------1265
NM_147150chr963332 3279 2686 979 733 35 --11591 12774
NM_147175chrX1272 32203 1677 64 --31577 674 641
NM_147181chr42938 97 ------
NM_147182chr42938 97 ------
NM_147183chr42938 97 ------
NM_147189chr862186 1487 261 136 107 41 11529 ----
NM_148174chr821854 484 1247 21578 798 1363
NM_148904chr11620 --1641 --
NM_148905chr11620 --1641 --
NM_148906chr11620 --1641 --
NM_148907chr11620 --1641 --
NM_148908chr11620 --1641 --
NM_148909chr11620 --1641 --
NM_148921chr1742040 917 616 591 1771 ----
NM_148955chr1566251 4276 2419 2053 1851 1524 --24989 423 16551
NM_148977chr10----1302 --
NM_148978chr10----1302 --
NM_152233chr1421293 292 11182 11620 --
NM_152240chr32973 457 1327 1105 --
NM_152261chr1232034 2023 1591 1521 12075 --
NM_152263chr135655 5220 2414 --25213 1457 11944
NM_152265chr131414 509 297 ----11194
NM_152277chr511767 21555 831 22081 2047 21888 1568
NM_152280chr133310 2552 2135 11370 12127 --
NM_152287chr1631956 936 304 --11613 12311
NM_152292chr431885 1638 26 --11600 1474
NM_152305chr332058 1892 1708 --11743 --
NM_152317chr121225 ------
NM_152330chr1432171 809 381 --32011 869 829 1939
NM_152332chr1462852 2206 1910 997 668 454 1799 12837 12749
NM_152375chr162559 2473 2431 1848 629 326 ------
NM_152384chr232052 1985 238 149 ----
NM_152387chr241053 937 763 102 ------
NM_152388chr252762 1379 464 251 168 2507 359 ----
NM_152409chr553368 2632 2585 2197 559 --12326 32288 1095 889
NM_152415chr81215 ------
NM_152417chr8--1832 1395 --
NM_152422chr92652 286 ----11349
NM_152424chrX84402 4045 3598 3553 3511 1610 1160 1056 --196 --
NM_152429chr102390 151 --1398 --
NM_152431chr111111 1402 ----
NM_152433chr112529 309 21489 1217 --11729
NM_152437chr1232245 2022 1539 122 --1345
NM_152440chr1221051 787 2965 847 ----
NM_152442chr1231380 1167 76 1370 ----
NM_152450chr1551673 1488 1438 335 149 1597 1314 --
NM_152451chr151620 --1839 --
NM_152455chr1542846 1132 101 48 ------
NM_152470chr1873281 2945 2701 1139 742 634 437 13804 ----
NM_152487chr131323 1114 998 2545 352 ----
NM_152493chr111230 ------
NM_152495chr131176 902 398 --11075 11018
NM_152496chr11493 --11047 --
NM_152519chr261742 1541 1381 762 218 127 --21660 657 --
NM_152520chr21480 1355 1797 --
NM_152522chr23399 345 248 ------
NM_152525chr2----140 --
NM_152549chr52425 98 --1460 --
NM_152551chr672999 422 144 137 114 107 33 --22990 2922 --
NM_152556chr742266 2048 2029 50 1184 ----
NM_152564chr831830 1271 29 11868 1592 11740
NM_152574chr91340 ------
NM_152581chrX1307 21119 262 ----
NM_152594chr1521903 507 31715 1494 28 12297 --
NM_152608chr172260 2211 2079 1855 869 827 30 11583 ----
NM_152622chr562875 2545 2265 2201 684 457 22516 1075 12405 12936
NM_152624chr5127464 6876 6240 6231 4984 2054 1713 1491 1351 638 228 136 37190 4945 4747 12351 --
NM_152629chr973610 2791 2598 2495 1540 864 47 13841 183 12557
NM_152636chr1152454 2371 776 564 252 2992 455 ----
NM_152638chr1211278 ----1146
NM_152641chr1242040 1806 526 430 21842 1077 --1185
NM_152678chr32607 457 ----1577
NM_152682chr421741 225 --21709 457 --
NM_152688chr61386 ------
NM_152699chr331514 1441 305 --1182 --
NM_152707chr102369 169 ------
NM_152715chr111114 ------
NM_152716chr111136 ------
NM_152724chr1022050 309 --1986 --
NM_152737chr631791 1773 1377 ------
NM_152744chr71834 11225 12468 1104
NM_152745chr74976 944 921 473 ----1772
NM_152756chr573583 3097 3026 2823 1689 1277 928 --11180 --
NM_152758chr832802 2752 928 12460 32436 1975 100 --
NM_152774chr732099 1817 1748 --22265 902 12407
NM_152780chrX1241 ----184
NM_152787chrX33080 3041 1006 12863 12492 1650
NM_152789chr731306 967 953 11229 21018 215 1186
NM_152793chr752043 1993 757 652 463 31922 1337 861 24139 1480 --
NM_152826chr1566251 4276 2419 2053 1851 1524 --24989 423 16551
NM_152835chr121989 1841 --147 1485
NM_152836chr851594 701 526 503 495 21634 445 --11392
NM_152837chr851594 701 526 503 495 21634 445 --11392
NM_152838chr2053520 2906 2436 1134 152 2804 414 1865 --
NM_152857chr6----1696 1948
NM_152858chr6----1696 1948
NM_152878chr2221282 1048 1292 11216 --
NM_152879chr242299 2234 359 343 ----12197
NM_152897chr2011165 1257 ----
NM_152902chr12442 96 ------
NM_152903chr1362687 2458 2253 2171 304 255 12786 ----
NM_152924chr1536107 6073 4280 --26710 192 25940 5580
NM_152991chr113681 672 220 ------
NM_152994chr2------1398
NM_152996chr11755 ------
NM_153020chr611424 1414 ----
NM_153026chr121139 196 --130
NM_153029chr1653768 3256 3045 888 794 --24158 260 --
NM_153038chr2--1750 ----
NM_153042chr611510 --11696 --
NM_153050chr2264894 4629 3765 3593 1833 833 --34040 1469 1395 14278
NM_153051chr2264894 4629 3765 3593 1833 833 --34040 1469 1395 14278
NM_153182chr322115 833 1647 --33213 2481 555
NM_153184chr311264 --21465 1296 1254
NM_153188chr574934 4289 3825 1589 1375 932 863 --35710 5688 1446 35382 5239 3667
NM_153207chr1252898 1086 976 444 307 --1154 13662
NM_153215chr3----1562 --
NM_153230chr171211 ------
NM_153235chr652212 1704 518 391 373 11856 --1326
NM_153240chr3------1191
NM_153260chr1531507 366 355 ----11116
NM_153261chr1631331 1209 425 21353 520 ----
NM_153262chr143081 2794 2138 201 22312 1230 --12777
NM_153267chr92857 726 1719 ----
NM_153271chr1531240 1137 313 --1480 --
NM_153332chr821121 240 ----1347
NM_153367chr1033137 2468 1562 ------
NM_153371chr1332185 808 150 12345 --12373
NM_153449chr122493 412 ------
NM_153456chr1352206 1695 1627 922 759 --21537 114 14261
NM_153606chr1--192 ----
NM_153607chr542510 2199 2032 1267 32223 702 387 1240 --
NM_153616chr1541686 873 668 630 ------
NM_153617chr1541686 873 668 630 ------
NM_153618chr1541686 873 668 630 ------
NM_153619chr1522924 2387 ------
NM_153620chr7----21535 464 11179
NM_153634chr122644 381 --1602 2218 210
NM_153645chr22--1754 12379 11202
NM_153649chr132172 1725 725 ----12029
NM_153686chr41612 1259 --1868
NM_153688chr1631660 1186 560 ------
NM_153689chr221457 170 --52214 2060 1856 803 676 22250 1612
NM_153690chr32786 614 ------
NM_153693chr122743 652 ------
NM_153695chr92280 92 1204 ----
NM_153706chr51222 ------
NM_153715chr731263 804 189 --1481 --
NM_153748chr122685 256 --1947 --
NM_153757chr431253 1042 1033 11245 21125 402 --
NM_153809chr91580 ------
NM_153810chr1064917 4816 4523 1791 1706 510 ----11274
NM_153828chr21891 --1608 --
NM_153831chr81160 ------
NM_170606chr731453 1413 1339 ----11148
NM_170665chr1244296 4057 1811 631 --3957 279 30 160
NM_170674chr1511232 ------
NM_170675chr151908 ------
NM_170676chr151908 ------
NM_170677chr1511232 ------
NM_170709chr831993 1721 975 32091 1944 794 2447 210 --
NM_170711chr191775 --1746 --
NM_170719chr1341428 1319 1240 346 11345 1592 --
NM_170731chr1132315 1119 524 11097 12506 --
NM_170732chr1132315 1119 524 11097 12506 --
NM_170733chr1132315 1119 524 11097 12506 --
NM_170734chr1132315 1119 524 11097 12506 --
NM_170735chr1132315 1119 524 11097 12506 --
NM_170750chrX3754 626 120 ------
NM_170751chr61927 ------
NM_170752chr61927 ------
NM_171998chrX52535 2211 2013 1909 807 12172 --12220
NM_172037chr81499 --11451 11434
NM_172058chr8----11876 21728 1689
NM_172059chr8----11876 21728 1689
NM_172060chr8----11876 21728 1689
NM_172069chr212024 --12325 --
NM_172070chr241923 866 798 150 1572 ----
NM_172071chr197271 7163 6523 6040 5655 4756 2081 1642 1272 12518 67360 7091 2511 1244 786 507 --
NM_172097chr152700 314 --1327 --
NM_172127chr42694 219 11390 ----
NM_172128chr42650 175 11346 ----
NM_172159chr352211 921 675 534 258