TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4504
miRNA Sequence: UGUGACAAUAGAGAUGAACAUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr1163547 912 880 774 603 585 11097 ----
NM_000084chrX76112 5592 2248 2106 796 762 567 35777 543 214 1414 --
NM_000091chr252915 2818 1002 780 283 --11036 12025
NM_000092chr244179 2937 128 82 21243 905 34315 3820 2819 13417
NM_000112chr544577 3589 1446 873 --15577 13906
NM_000125chr631342 574 251 21263 819 --14177
NM_000138chr1522042 699 41940 1788 887 878 --1229
NM_000161chr1411670 --1122 198
NM_000168chr722892 2692 11279 --1229
NM_000217chr1255329 4561 4520 4254 87 13884 ----
NM_000245chr741546 1475 483 127 21738 240 12167 --
NM_000259chr15146354 5678 4685 4422 4025 2504 2266 1822 1358 861 697 546 490 383 25139 4134 15231 14388
NM_000264chr943337 2584 489 160 23178 1127 22347 135 --
NM_000297chr41378 --1761 11728
NM_000314chr1073239 3227 2934 1243 640 359 213 1785 12102 12161
NM_000332chr645378 1857 796 758 21726 155 35294 4566 131 15389
NM_000390chrX63190 3167 3120 2705 2292 301 ----12083
NM_000397chrX2725 476 1824 12220 11770
NM_000430chr1743627 1463 853 318 2738 145 32861 2648 558 --
NM_000489chrX62616 2470 1330 935 184 29 ----1337
NM_000555chrX97880 6470 6112 4942 4833 2585 1107 863 124 11259 ----
NM_000618chr1295743 1962 1722 1533 1497 1306 1219 923 477 16577 ----
NM_000618chr1295743 1962 1722 1533 1497 1306 1219 923 477 16577 ----
NM_000633chr1875016 3949 3914 1990 1444 1154 70 --11496 --
NM_000793chr1454643 3849 1892 1389 780 --14782 1882
NM_000809chr458673 7304 6627 6403 2382 37342 1090 417 28187 6390 11510
NM_000813chr555261 5033 2181 491 334 25045 4577 --13705
NM_000814chr1553285 3084 3071 2910 799 34061 1572 1088 23971 3713 --
NM_000875chr1596762 6288 6133 5447 4906 4735 4340 1210 565 11615 --26819 5214
NM_000891chr1743355 3175 2881 2779 --13192 1599
NM_000902chr323141 3040 --11087 12493
NM_000926chr11109458 7825 7709 7454 6982 3296 2379 2011 1110 255 --12240 --
NM_000959chr162693 2670 2571 520 157 134 1676 12852 1603
NM_000961chr2064001 3955 2509 913 458 353 13676 13140 --
NM_001001395chr1262550 2142 893 621 344 258 12847 ----
NM_001001419chr564286 3900 3427 2046 715 31 1734 ----
NM_001001420chr564286 3900 3427 2046 715 31 1734 ----
NM_001001481chr853488 3408 1042 996 845 23456 1018 ----
NM_001001484chr1012293 11847 12010 12271
NM_001001664chr253849 3394 2873 2850 1531 13004 44138 3238 2655 275 --
NM_001002233chr811623 1447 11774 11958
NM_001002257chr272881 2637 1304 855 526 380 123 --32305 1244 1174 --
NM_001002860chr1444655 4369 3238 579 1711 --13971
NM_001003652chr1868669 8391 8076 5447 3467 1259 155 --17655
NM_001003674chr18107013 6912 6451 5051 4568 2695 2097 1566 1349 879 --16542 15903
NM_001003675chr18107013 6912 6451 5051 4568 2695 2097 1566 1349 879 --16542 15903
NM_001003712chr1263870 3501 3050 3010 2990 2887 12824 23475 2811 22864 2709
NM_001005386chr262150 1803 902 630 168 157 ------
NM_001005404chr1734199 1527 346 14486 11156 11414
NM_001005473chr564637 4409 2638 1486 606 485 14296 ----
NM_001005753chr242159 2051 1974 1788 12080 --11517
NM_001007023chr1454643 3849 1892 1389 780 --14782 1882
NM_001007075chr421082 386 --11015 1101
NM_001007102chr631651 568 481 ----1561
NM_001007278chr1354129 3918 399 43 33 33567 3428 1572 --15119
NM_001008239chr1811086 13145 23125 1362 179
NM_001008393chr432437 2081 585 22258 57 --12795
NM_001008401chr1941477 1417 1351 587 1177 --1428
NM_001008408chr766034 4744 2196 2154 1790 1051 11295 2610 228 --
NM_001008495chr83903 807 24 ----22024 577
NM_001008738chr51443 --11839 22547 329
NM_001009554chr464581 3482 3319 1723 640 474 11345 1613 --
NM_001009554chr464581 3482 3319 1723 640 474 11345 1613 --
NM_001009894chr1231287 1175 292 ----11708
NM_001009899chr396465 5994 5656 1903 1835 1772 1115 648 173 15787 22008 300 --
NM_001010853chr643042 2627 2312 2163 12030 --1854
NM_001010980chr151401 1288 878 490 377 --1238 --
NM_001011658chrX41877 1785 172 31 21662 1491 ----
NM_001011666chr746272 5550 460 341 --26470 5599 --
NM_001012761chr552571 1020 811 656 600 ----167
NM_001013620chr1257843 6353 5945 2152 1242 15678 48030 2585 2201 1545 27907 6975
NM_001013659chr1954928 4565 1653 1350 1105 24158 997 21178 73 --
NM_001014797chr1068152 7218 2637 2240 1865 426 26598 5613 17053 11256
NM_001015048chr1443199 2952 2536 1175 11086 --22604 969
NM_001015049chr1443199 2952 2536 1175 11086 --22604 969
NM_001017368chr172631 141 --22733 2020 12811
NM_001018067chr185064 4365 4002 3954 3422 1946 491 109 --11427 --
NM_001018068chr185064 4365 4002 3954 3422 1946 491 109 --11427 --
NM_001018069chr185064 4365 4002 3954 3422 1946 491 109 --11427 --
NM_001024647chr1247721 5940 5473 5064 26544 2459 34843 4837 690 --
NM_001024649chr552166 1959 1909 798 656 12259 22240 1799 --
NM_001025076chr1084769 2179 1485 1281 1271 1234 994 672 ------
NM_001025077chr1096127 2843 2639 2629 2592 2352 2030 919 649 11138 ----
NM_001025079chr3103826 3771 3573 3361 3244 3054 1024 743 247 154 13317 1129 11617
NM_001025108chr253834 1658 1386 925 611 14200 12703 --
NM_001025252chr842805 1257 821 66 ----1295
NM_001025253chr842805 1257 821 66 ----1295
NM_001025580chrX64293 3954 3390 2713 1083 186 11316 11206 1682
NM_001025595chr441450 1050 630 37 ----11337
NM_001029863chr653001 2761 2016 1071 636 12149 1146 22267 599
NM_001030055chr1484741 4054 3602 3021 1771 1238 400 296 --1696 --
NM_001032282chr831172 1078 904 --2466 316 --
NM_001033087chr2053278 3178 2316 1284 1041 1824 12301 --
NM_001033112chr54734 326 162 126 2574 100 191 --
NM_001037132chr74628 434 424 63 11585 ----
NM_001037133chr74628 434 424 63 11585 ----
NM_001037174chr221805 428 --11988 12052
NM_001039538chr233595 341 76 13549 13711 1138
NM_001039547chr367716 7075 6892 1987 1946 841 21742 1410 37051 6414 2639 --
NM_001039585chr172950 2927 2828 777 414 391 160 1933 13109 1860
NM_001039590chrX33639 3095 3005 ----1343
NM_001039591chrX33639 3095 3005 ----1343
NM_001039693chr263647 1473 1235 323 152 70 22604 1031 11164 13781
NM_001039762chr1062366 2198 2071 1525 336 188 1616 ----
NM_001039840chrX96040 6027 5801 4826 4611 3939 2217 36 29 15445 11455 25893 2203
NM_001039937chr1343269 1637 652 500 1677 2327 264 --
NM_001040108chr143976 658 318 --12128 1798
NM_001040152chr794939 4056 3824 3473 3458 3322 2021 1159 315 15124 14366 --
NM_001040153chr13157 --1957 1715
NM_001040284chr1665429 5366 3985 1740 1329 551 12108 21294 636 11953
NM_001040402chr42435 35 22704 2188 22618 49 12172
NM_001040441chr174919 4839 4063 2172 1482 635 525 13601 ----
NM_001040446chr53618 570 70 --12139 12270
NM_001040450chr1522805 1880 31870 290 206 22297 140 --
NM_001040453chr1522805 1880 31870 290 206 22297 140 --
NM_001040633chr73873 383 243 ----1931
NM_001040665chr764782 4055 1967 1859 174 113 24632 686 1263 1861
NM_001040712chr953447 2683 1439 1196 1114 ----13595
NM_001040875chr842313 1925 1714 938 ----1135
NM_001040876chr421593 729 ----165
NM_001042355chr1645340 3595 1683 496 11249 11863 14242
NM_001042383chr383414 2908 2803 2522 1351 624 459 58 13187 ----
NM_001042412chr1645340 3595 1683 496 11249 11863 14242
NM_001042413chr943310 3275 2994 280 --12751 23681 3618
NM_001042494chr1532400 703 683 13061 ----
NM_001042495chr1532400 703 683 13061 ----
NM_001042496chr1532400 703 683 13061 ----
NM_001042497chr1532400 703 683 13061 ----
NM_001042550chr962023 1917 798 776 106 98 ----11872
NM_001042555chr1244323 977 665 568 --24636 4409 --
NM_001042599chr277636 7227 6404 5416 5237 1300 309 12133 --17831
NM_001042604chr374758 4488 3722 3455 1477 1283 492 11087 13654 --
NM_001046chr552367 1154 1064 919 505 12954 --12781
NM_001099678chr346008 4538 1714 1045 15785 25187 4526 --
NM_001106chr3139356 8993 8828 8726 8411 7545 7385 7014 3555 3400 3108 1502 351 1444 27823 1653 --
NM_001113490chrX33268 1333 1046 12357 --13067
NM_001167chrX66454 5116 2414 1779 1703 1251 --11888 15107
NM_001173chr1484741 4054 3602 3021 1771 1238 400 296 --1696 --
NM_001186chr2122906 696 11226 --12724
NM_001204chr2117402 7283 7120 6825 6373 6318 6047 4710 2912 1954 1883 --16942 --
NM_001206chr932915 2288 637 12482 12362 12741
NM_001241chr242345 1780 678 151 --22464 1888 11634
NM_001241chr242345 1780 678 151 --22464 1888 11634
NM_001259chr786165 5869 2112 1398 986 958 939 477 14920 35209 4837 1334 --
NM_001527chr684664 4359 3833 3509 3047 1466 1352 1076 13486 ----
NM_001530chr14----1969 21146 1050
NM_001609chr1084350 4245 4161 3889 3785 1058 302 34 14474 23629 910 1709
NM_001616chr263480 2841 2369 1264 1183 818 --13314 --
NM_001621chr752980 2933 2729 2545 75 1353 12528 --
NM_001621chr752980 2933 2729 2545 75 1353 12528 --
NM_001650chr1862765 1549 1379 1306 534 84 2438 122 43937 3553 1345 1288 --
NM_001695chr852905 1456 1348 899 628 23146 594 1319 12726
NM_001746chr552166 1959 1909 798 656 12259 22240 1799 --
NM_001755chr1672042 2009 1864 1648 1585 1424 373 ----11694
NM_001759chr1274173 3266 1517 1370 1214 947 564 ------
NM_001777chr3103826 3771 3573 3361 3244 3054 1024 743 247 154 13317 1129 11617
NM_001830chrX53468 1030 964 459 44 --11406 --
NM_001858chr654719 4422 3549 3536 664 14148 15153 11994
NM_001918chr188346 7533 6933 5860 2233 2023 1260 600 1206 36543 2336 143 28404 8378
NM_001938chr131525 1217 732 21612 291 1111 --
NM_001949chr622985 67 1555 --13182
NM_002006chr472255 1591 1456 546 393 221 63 --24514 4297 11538
NM_002015chr1363378 2383 2184 1264 695 622 ----1838
NM_002024chrX41892 428 291 72 11877 1514 --
NM_002025chrX168963 8934 8200 7864 7479 6568 5755 3085 2369 2325 1838 1711 662 632 510 132 28109 2044 38158 6934 2897 12995
NM_002039chr44888 768 629 619 ----1363
NM_002092chr464185 4133 3278 1049 772 311 11008 13874 --
NM_002126chr1723832 1198 --22938 2756 11346
NM_002210chr243270 2891 1016 151 11157 23223 3166 --
NM_002214chr755015 1578 763 373 41 24530 700 11198 --
NM_002264chr374452 3776 3285 3078 1950 1899 653 --14253 --
NM_002270chr564452 4348 3514 1644 844 89 --22114 1928 --
NM_002285chr253834 1658 1386 925 611 14200 12703 --
NM_002310chr556545 6140 4216 2577 105 11173 16601 --
NM_002374chr233595 341 76 13549 13711 1138
NM_002397chr541726 1702 1650 307 1293 11609 --
NM_002481chr127892 1632 21683 1393 --15851
NM_002500chr221073 910 --2417 144 11030
NM_002577chr324002 2522 11184 12828 2695 568
NM_002581chr955447 5100 2127 1847 1188 ----1283
NM_002595chr1221686 1348 --11894 1176
NM_002613chr1633574 524 332 ----24869 4384
NM_002628chr32975 115 ----11157
NM_002655chr874755 4657 4269 1595 731 690 524 --14584 1232
NM_002656chr6------2290 245
NM_002709chr252373 1443 1159 1085 37 1110 ----
NM_002716chr1133153 617 199 --23169 1481 143
NM_002734chr1742261 860 640 230 --11600 11674
NM_002737chr1796650 5393 5091 4627 1634 1200 986 914 656 --16148 --
NM_002738chr16136 --11005 2989 870
NM_002745chr2243351 765 715 219 11388 11456 13711
NM_002839chr953447 2683 1439 1196 1114 ----13595
NM_002886chr333623 3462 1466 34338 3732 854 --23853 659
NM_002892chr14--1321 --21182 224
NM_002938chr441810 1683 1385 156 12007 --11952
NM_002940chr421593 729 ----165
NM_002971chr3--1470 2749 454 11124
NM_002977chr252857 2649 2231 1264 915 12504 1310 --
NM_003034chr12157311 7060 6761 6732 2222 2199 1946 1762 1690 1048 642 544 380 316 43 18007 25933 787 11522
NM_003043chr323824 1475 ----2355 122
NM_003099chr1576478 5702 2578 2401 2257 1621 338 25021 2162 35207 4113 849 --
NM_003113chr21262 1621 --2667 553
NM_003149chr32441 418 ----11320
NM_003161chr172672 110 22486 2475 --13307
NM_003199chr18115060 5043 4313 4168 4067 3909 1969 1687 1167 1084 819 --24126 3829 --
NM_003234chr382217 2101 2066 1776 790 720 629 287 --11671 12003
NM_003262chr354443 4376 4007 3912 2116 15222 1769 --
NM_003274chr2142949 2473 2102 134 12063 12115 --
NM_003330chr1231234 1177 348 ----11804
NM_003338chr1051644 1492 1474 654 401 --11606 --
NM_003342chr1742556 2027 1129 1080 32913 2528 2499 ----
NM_003387chr252887 2760 2731 1107 262 ----1334
NM_003463chr652899 1208 877 291 56 12828 1238 --
NM_003483chr1232143 1132 836 1403 --12961
NM_003489chr2133378 2335 185 ----12732
NM_003574chr1875625 5426 5238 4640 4581 1517 370 ------
NM_003590chr263997 3870 3485 3270 1345 1206 13358 --13244
NM_003607chr183487 3413 3247 3212 2839 1741 1721 997 14319 23865 3495 --
NM_003615chr384006 3977 3591 1366 1116 405 89 64 --11027 --
NM_003622chr1252644 2172 2003 1807 841 12231 --1356
NM_003644chr1746508 4269 1954 1104 34711 4245 321 21691 1159 15208
NM_003671chr953256 3163 2845 2363 1234 12209 --13545
NM_003701chr132740 352 1202 --1404
NM_003714chr52758 608 198 12341 13077
NM_003759chr482912 2650 1257 1171 868 395 185 178 ------
NM_003787chr1821344 242 --1528 11400
NM_003799chr1873792 3659 2847 2790 1280 929 421 21419 895 1939 --
NM_003825chr152559 244 --21088 412 11479
NM_003913chr664146 3301 2774 1492 952 818 13350 ----
NM_003983chr1653074 2983 1751 1512 927 23979 743 24321 4293 --
NM_004028chr1862765 1549 1379 1306 534 84 2438 122 43937 3553 1345 1288 --
NM_004035chr172854 793 13806 15045 1693
NM_004093chr1342978 2055 1254 513 23165 2799 --22160 441
NM_004124chr14103557 3461 2920 2680 1166 807 697 411 215 95 --1291 --
NM_004136chr1563266 2599 2394 1059 1053 1006 ----1529
NM_004171chr1167596 6805 2986 1105 1049 434 27590 640 16254 --
NM_004330chr151368 2917 106 --11142
NM_004338chr18107013 6912 6451 5051 4568 2695 2097 1566 1349 879 --16542 15903
NM_004379chr21507 --31386 1305 1217 1478
NM_004397chr1164308 3579 2684 1700 1451 350 12962 22782 1693 13810
NM_004412chr1065926 5737 5664 2178 1322 205 33704 811 341 ----
NM_004430chr812211 --11112 12614
NM_004459chr1751679 782 715 441 212 11812 ----
NM_004501chr123903 1452 --13629 1389
NM_004504chr262164 1207 1142 828 363 348 1401 ----
NM_004612chr954639 3923 3595 1238 798 --21513 1421 --
NM_004726chrX24986 1865 14729 34391 2026 966 184
NM_004736chr131979 1801 429 --11397 1610
NM_004738chr201293 1934 11895 1754
NM_004742chr341790 1691 1666 277 ----1662
NM_004763chr2--7784 728 448 392 336 280 263 ----
NM_004768chr141004 433 138 46 --1202 --
NM_004781chr12584 578 --41403 1262 324 284 --
NM_004781chr12584 578 --41403 1262 324 284 --
NM_004815chr154639 3825 3604 1266 945 11671 23966 3773 1466
NM_004834chr233116 2757 825 12466 --23152 1085
NM_004857chr1453974 3766 3365 3059 1515 14625 1972 1498
NM_004859chr1712832 22418 550 --12974
NM_004863chr1434263 4051 3259 35217 1814 1510 25101 1887 --
NM_004873chr1443199 2952 2536 1175 11086 --22604 969
NM_004874chr82495 31 ----1404
NM_004904chr746272 5550 460 341 --26470 5599 --
NM_004949chr1822012 824 ----1471
NM_004985chr1253775 3354 1815 1677 1449 23917 1715 44498 3579 1080 505 --
NM_005010chr74628 434 424 63 11585 ----
NM_005054chr241156 624 119 103 11665 ----
NM_005065chr1455124 3296 1338 662 572 ----1617
NM_005079chr842805 1257 821 66 ----1295
NM_005121chr1733044 2959 858 22512 1023 12672 12601
NM_005135chr1532400 703 683 13061 ----
NM_005156chr975395 4660 4439 3930 1661 1450 796 --13632 --
NM_005160chr2286046 5958 5661 5461 2451 2192 1224 1045 24592 4131 --1167
NM_005233chr331618 736 580 ----1705
NM_005235chr277636 7227 6404 5416 5237 1300 309 12133 --17831
NM_005259chr251455 1381 1256 1064 408 ------
NM_005339chr484060 3856 3783 3723 3656 3473 3196 576 23562 842 ----
NM_005342chrX42569 2275 712 159 --12148 12789
NM_005359chr1875787 2625 2534 2450 707 436 198 --16134 --
NM_005389chr6--1535 1573 1157
NM_005497chr1776153 5992 5401 3808 1821 1016 987 --21282 1227 --
NM_005499chr19164 --1671 1582
NM_005502chr962900 2851 2665 2392 721 541 ------
NM_005504chr1266167 5598 4782 2406 1978 1104 35518 558 134 12363 26485 2541
NM_005578chr343747 3393 3331 541 1352 43380 1868 907 165 --
NM_005596chr935120 4752 3999 11221 26348 4390 1360
NM_005614chr731070 967 829 ----1326
NM_005655chr831172 1078 904 --2466 316 --
NM_005722chr262150 1803 902 630 168 157 ------
NM_005754chr551216 1178 1090 940 928 ------
NM_005798chr1354129 3918 399 43 33 33567 3428 1572 --15119
NM_005828chr1784733 4576 4246 4169 1698 489 291 126 ----13687
NM_005840chrX57693 5350 3020 1512 470 --25442 244 15117
NM_005898chr1153143 2494 854 155 64 11210 1882 12486
NM_005901chr1868669 8391 8076 5447 3467 1259 155 --17655
NM_005903chr564286 3900 3427 2046 715 31 1734 ----
NM_005909chr553535 2784 651 575 136 13609 ----
NM_005941chr894144 4112 4093 3470 3107 2878 1215 1055 592 24062 1153 21601 236 --
NM_005955chr144933 4832 4657 257 --31761 551 273 --
NM_006007chr943277 2842 1563 877 14486 --1165
NM_006011chr1592768 2673 1516 1193 1021 970 943 393 115 --23730 1204 --
NM_006037chr233375 1064 76 ----13928
NM_006047chr2053559 3004 2215 1024 436 52824 1413 1343 695 194 11277 --
NM_006080chr721938 313 ----12462
NM_006095chr494509 4445 1649 1256 893 784 751 738 31 13253 23168 60 --
NM_006106chr1143348 3321 3212 782 1382 --13414
NM_006134chr2131602 1533 33 11023 1295 11351
NM_006154chr1572313 1973 1817 1062 658 586 408 --11961 --
NM_006203chr565426 1338 1144 448 188 98 167 11360 --
NM_006212chr144061 3871 3682 1342 --44752 4385 2132 74 --
NM_006241chr352348 2274 918 883 33 22077 1905 ----
NM_006251chr532398 1261 521 --32626 1273 529 1973
NM_006281chr81810 1343 --1911
NM_006281chr81810 1343 --1911
NM_006306chrX54790 2016 1698 1485 591 1694 11745 --
NM_006315chr474290 3897 2951 1623 1585 660 89 --11340 11209
NM_006323chr4197 1558 --1645
NM_006353chr631358 475 115 ----11156
NM_006379chr741535 608 376 192 12240 --12291
NM_006393chr1094557 4545 4523 2975 1812 1294 775 733 359 14516 ----
NM_006420chr2093048 2923 2865 2266 1046 952 563 488 275 11390 --12554
NM_006534chr2083430 2835 1306 850 621 314 291 146 ------
NM_006544chr14104803 2234 1676 1483 1387 1050 466 427 325 276 34238 4083 602 ----
NM_006561chr1084769 2179 1485 1281 1271 1234 994 672 ------
NM_006599chr16118203 6660 5626 3143 2919 2846 2418 2412 2161 664 269 23280 1294 11186 --
NM_006614chr313398 --12249 12793
NM_006628chr1594637 4596 4488 4291 1642 1340 1296 350 58 --23038 942 --
NM_006654chr1244323 977 665 568 --24636 4409 --
NM_006658chr7--1732 197 11044
NM_006682chr752765 2478 2305 908 189 --22000 873 --
NM_006718chr6------2290 245
NM_006729chrX55576 5230 4251 3981 3762 13623 --14622
NM_006750chr1645376 1824 1573 775 136 --17480
NM_006775chr652634 2294 2100 1237 1074 22185 771 --12768
NM_006777chrX52878 2749 2527 1169 1070 ----12010
NM_006815chr12170 ----11197
NM_006832chr14165 1954 --1208
NM_006851chr1252335 2138 2095 834 526 ------
NM_006885chr1654051 2970 2647 1686 607 1246 24064 1605 34175 4158 419
NM_006888chr141664 --13360 1434
NM_006924chr1733531 2762 441 1199 --2752 509
NM_006947chr471720 1637 1484 1205 1121 695 572 --11561 --
NM_006954chr1083221 3031 1312 1128 500 223 87 26 ------
NM_006974chr1083221 3031 1312 1128 500 223 87 26 ------
NM_006988chr2131267 1081 314 ----1278
NM_007011chr1576885 5978 4830 1991 619 383 219 ----12258
NM_007038chr21105012 4553 4304 3849 2265 2049 1600 1166 413 114 13918 1308 --
NM_007039chr1451702 1662 1468 863 513 ----11499
NM_007073chr643346 3109 1642 602 14013 --13966
NM_007146chr1732733 2260 1826 ----21924 492
NM_007172chr2273262 2910 2587 2463 1118 694 464 ------
NM_007220chrX74940 3247 3089 1788 1763 961 65 24581 1606 11950 24003 667
NM_007249chr13119466 8283 7416 7354 7215 3519 1684 831 653 475 323 --26873 603 --
NM_007287chr323141 3040 --11087 12493
NM_007288chr323141 3040 --11087 12493
NM_007289chr323141 3040 --11087 12493
NM_007292chr172854 793 13806 15045 1693
NM_007358chr121622 562 --1400 21523 177
NM_007375chr142570 2120 1095 317 1451 12280 1198
NM_012081chr593428 3066 2975 1266 992 957 860 307 224 13685 --13705
NM_012095chr1033483 2789 46 --11134 11126
NM_012096chr333726 2501 2280 --12329 13686
NM_012097chr221805 428 --11988 12052
NM_012120chr652943 2758 2406 787 748 11152 2929 73 --
NM_012141chr1343269 1637 652 500 1677 2327 264 --
NM_012164chr917249 37213 2771 962 35837 5776 1373 1436
NM_012193chr1124833 3962 21613 483 --1605
NM_012214chr265758 5413 4761 4451 1854 41 21794 325 2696 129 32257 2058 294
NM_012234chr343663 3413 3375 2872 12594 ----
NM_012249chr242976 2529 2323 2200 22402 972 23082 3065 --
NM_012262chr133446 1652 171 --25261 5215 14371
NM_012290chr221299 164 1252 2576 354 11396
NM_012302chr12964 920 ----1222
NM_012382chr551703 1286 1237 1166 333 --1500 23476 710
NM_012395chr753403 3395 3039 2904 801 1833 23351 42 12180
NM_012464chr462845 2809 2173 1929 910 355 --22856 948 12703
NM_013231chr14104355 4236 4188 3958 3795 3071 2987 2821 1083 802 24345 101 13918 --
NM_013233chr241352 988 410 33 ----11345
NM_013261chr431499 1396 941 --22903 1462 11147
NM_013374chr352697 2442 2041 795 504 --1489 --
NM_013989chr1454643 3849 1892 1389 780 --14782 1882
NM_014028chr653027 2685 1310 457 417 13247 1839 1242
NM_014048chr1653693 1192 1126 1035 234 14339 13394 24942 116
NM_014112chr834320 1872 140 25488 4520 12188 --
NM_014155chr1165651 4724 2432 1054 557 100 16533 22541 816 --
NM_014157chr1653924 3870 749 236 192 23980 3590 ----
NM_014181chr232909 2705 908 --11924 12900
NM_014313chr141542 1135 303 239 ----1321
NM_014333chr1121854 587 32843 2705 750 --11796
NM_014372chr162100 1904 1863 1525 795 252 11570 162 11714
NM_014381chr143976 658 318 --12128 1798
NM_014423chr575586 5115 4540 3699 3564 2076 1909 150 ----
NM_014445chr352327 2274 354 237 139 1781 22165 1539 --
NM_014447chr441449 1049 630 37 ----11336
NM_014517chr321769 173 --11929 1700
NM_014563chrX41877 1785 172 31 21662 1491 ----
NM_014614chr221293 373 ----11115
NM_014616chr353438 2210 1286 1127 528 --11356 --
NM_014636chr911265 23677 1276 34271 2757 1649 14313
NM_014720chr1051840 1715 1525 561 47 1331 ----
NM_014739chr643758 1302 1042 345 14186 33392 511 210 1261
NM_014766chr773583 3323 3281 3206 702 469 139 13541 --12623
NM_014776chr1243054 757 619 238 2596 535 1654 11930
NM_014803chr1042455 1913 626 620 11814 --12239
NM_014820chr341974 527 124 75 ----1133
NM_014826chr183487 3413 3247 3212 2839 1741 1721 997 14319 23865 3495 --
NM_014841chr61263 1435 --11089
NM_014877chr1735261 2149 1083 16358 22353 2179 21298 255
NM_014897chr1742335 1187 192 129 ----13021
NM_014904chr1063403 3150 2535 1620 657 648 23282 2728 175 --
NM_014906chr1753723 1628 1363 1280 274 1576 ----
NM_014912chr1033163 2947 2763 13307 23421 282 --
NM_014913chr1851343 1144 1127 245 157 ----11527
NM_014915chr1031260 1033 146 --1262 1414
NM_014920chr633116 1450 524 --22702 2686 12662
NM_014939chr1831478 311 86 1303 2965 134 --
NM_014942chr662581 2478 2349 2105 908 695 1576 ----
NM_014947chr163094 2798 1267 821 449 432 ------
NM_014982chr1474398 3858 3799 1891 1545 1153 177 --34688 3892 3288 1391
NM_015000chr1223100 216 ----1993
NM_015017chr161294 1274 1061 910 809 283 --1258 --
NM_015026chr1244502 2970 1187 474 --23892 972 13331
NM_015032chr1362880 2482 2211 486 472 378 11881 12036 --
NM_015068chr753791 2908 2676 1580 873 13976 13218 --
NM_015071chr586416 6037 5239 4651 1603 1491 596 156 16059 25004 2424 --
NM_015074chr163816 3614 3348 1487 1048 409 1985 14670 11398
NM_015076chr632772 904 521 13290 11187 --
NM_015087chr1372691 2607 2260 670 593 299 56 ------
NM_015097chr31546 1610 --11465
NM_015115chr42435 35 22704 2188 22618 49 12172
NM_015144chr1663954 3811 3238 3007 2977 1048 --13249 11592
NM_015156chr1443950 3414 2659 1317 22594 651 33224 3192 2813 --
NM_015163chr1421389 191 --11990 11481
NM_015200chr421952 1599 22043 440 1871 --
NM_015206chr1533391 3149 1113 --22368 555 11373
NM_015247chr1645340 3595 1683 496 11249 11863 14242
NM_015250chr9--140 --21735 313
NM_015265chr252686 2661 2620 1727 76 12435 1861 --
NM_015271chr453903 2794 1601 1527 1027 12814 --12701
NM_015275chr1252074 1797 1333 568 47 1123 22113 1639 --
NM_015282chr243005 2150 1903 395 22932 2720 1861 1586
NM_015310chr868060 7629 5764 2520 2074 145 25396 2286 1823 --
NM_015335chr1222615 813 ----1624
NM_015336chr1212133 --12084 11850
NM_015349chr673033 2985 2668 2386 1993 515 185 --12244 --
NM_015355chr1751813 1692 540 273 205 --11431 --
NM_015365chrX64293 3954 3390 2713 1083 186 11316 11206 1682
NM_015378chr182665 2651 2503 2007 485 376 292 116 --11864 --
NM_015394chr1262440 2410 2214 1863 646 423 12418 22133 110 --
NM_015423chr1161707 1548 1332 1318 1277 615 --11754 --
NM_015446chr141414 1293 522 492 --11378 --
NM_015455chr552683 2527 1229 1174 637 13562 34060 2792 1194 1244
NM_015458chr865218 5183 3877 1722 574 209 --33444 739 722 --
NM_015565chr2162290 2151 2101 1836 1562 710 ------
NM_015571chr641705 758 241 227 1801 12157 --
NM_015576chr33372 345 227 --12936 12132
NM_015640chr185064 4365 4002 3954 3422 1946 491 109 --11427 --
NM_015691chrX42918 2809 889 561 --32895 2528 505 --
NM_015879chr18118562 8168 6853 6554 2799 2772 1816 1513 1057 1018 840 13004 16228 --
NM_015886chr875665 4816 4033 1810 1757 1349 1264 14206 13755 --
NM_015902chr8--198 --1920
NM_015906chr154753 3421 370 287 186 11463 --14125
NM_015912chr842306 1699 366 236 1567 --1660
NM_015990chr421082 386 --11015 1101
NM_016037chr14986 808 120 47 --124 11127
NM_016040chr112000 162 --12045
NM_016075chr1362637 2552 2503 1240 957 621 --12600 --
NM_016076chr153125 2030 1200 1181 493 23200 3058 22425 1039 --
NM_016079chr242159 2051 1974 1788 12080 --11517
NM_016083chr643789 3693 2691 670 21131 1120 1127 --
NM_016132chr1562628 2617 1285 1002 317 168 ------
NM_016203chr73873 383 243 ----1931
NM_016217chr653540 3523 2440 1378 820 ----12936
NM_016221chr542268 1816 725 600 1369 22203 554 --
NM_016260chr266823 5859 5646 1458 506 156 11992 1945 15605
NM_016277chr631612 1477 67 178 11313 1332
NM_016322chr942170 1261 788 267 --13166 12446
NM_016436chr2032120 1678 1091 --1976 1850
NM_016480chr54734 326 162 126 2574 100 191 --
NM_016513chr633116 1450 524 --22702 2686 12662
NM_016530chr1544015 3598 2859 1625 23069 1443 21591 560 23433 1271
NM_016531chr4114081 3757 2807 2775 2682 1523 1152 794 772 542 320 13198 23677 2796 --
NM_016544chr233418 2914 2768 13929 1123 11551
NM_017415chr511833 1765 --24483 4364
NM_017435chr121733 1851 --1319
NM_017447chr2164441 3819 3339 3084 275 144 1268 13385 --
NM_017548chr352041 1943 1493 578 156 ----1201
NM_017633chr633603 3375 261 ----1801
NM_017635chr1131614 540 492 ----11064
NM_017637chr989317 7799 6757 3459 3055 2111 1894 1587 27418 5992 25946 2938 15726
NM_017644chr363701 3477 2039 1606 478 203 --23220 223 24242 373
NM_017650chr796067 6027 5793 4006 3999 1921 1725 651 357 1973 21749 304 --
NM_017658chr1464573 4238 4229 4179 1694 1654 13905 13782 --
NM_017693chr13----11610 1379
NM_017752chrX82037 1787 1711 651 445 316 227 173 --196 --
NM_017754chr684978 4588 4482 4210 4184 1756 1543 1287 13205 ----
NM_017769chr1472265 2258 1129 516 491 454 182 --12941 --
NM_017799chr1421429 208 11299 --1495
NM_017801chr372561 2058 1820 1759 303 86 23 22042 312 ----
NM_017813chr854635 2121 1218 517 296 11509 25658 5194 1239
NM_017831chr1864560 4091 4001 1350 138 81 11225 --1248
NM_017848chrX53891 3867 3743 3558 2992 ----11310
NM_017849chr243209 2309 2198 2187 --1819 12076
NM_017919chr985706 4210 2017 1847 914 836 436 400 --25798 5465 --
NM_017998chr931063 399 186 ----11029
NM_018000chr231623 1602 387 1308 12162 --
NM_018061chr151400 1380 1196 547 192 1557 --11392
NM_018086chr231493 1347 716 11727 --11420
NM_018121chr1043165 644 307 202 --42941 2638 2511 349 --
NM_018156chr182665 2651 2503 2007 485 376 292 116 --11864 --
NM_018159chrX21562 72 1548 11086 11425
NM_018181chr18----11641 2237 63
NM_018195chr1131502 205 182 22131 446 --1745
NM_018227chr453173 2496 1285 1183 579 22909 2581 ----
NM_018243chr463870 3602 3511 1022 297 286 --13807 13886
NM_018299chr853488 3408 1042 996 845 23456 1018 ----
NM_018351chr1244399 3043 590 142 31850 896 823 23843 3523 --
NM_018373chr1476340 5926 5452 1989 1897 1303 304 26221 2382 16482 --
NM_018374chr785212 4511 4191 3896 3774 3440 1073 461 --1558 --
NM_018388chrX31430 1119 392 --1986 1280
NM_018401chr431525 1300 429 ----11430
NM_018424chr92521 303 11750 --1175
NM_018429chr532860 2142 862 22214 642 11882 --
NM_018566chr184635 4248 3728 1707 1482 1435 981 153 23981 3895 15074 24345 853
NM_018590chr1021231 1122 ----11217
NM_018638chr1255340 5124 4005 3594 722 12085 ----
NM_018640chr1262550 2142 893 621 344 258 12847 ----
NM_018662chr164268 3198 2869 435 255 231 24381 448 14233 --
NM_018683chr2031692 1135 529 21305 35 --1227
NM_018972chr842313 1925 1714 938 ----1135
NM_018999chr1074685 4240 4133 3809 3645 1320 1093 14274 11469 14316
NM_019001chr374758 4488 3722 3455 1477 1283 492 11087 13654 --
NM_019022chr1862855 2229 1110 571 543 27 --12419 --
NM_019027chr421658 581 ----12083
NM_019117chrX83111 2776 2241 1079 1013 921 680 588 --1690 --
NM_020122chr296019 5660 4095 1426 1012 817 633 413 105 ----1115
NM_020141chr141893 1857 836 310 --11752 12060
NM_020177chr543273 3244 2506 834 --11236 23337 627
NM_020336chr2022955 2639 31211 588 520 31492 1078 508 --
NM_020346chr1121708 557 --11272 1385
NM_020347chr331949 1661 404 --11923 187
NM_020381chr621711 27 --1209 1458
NM_020390chr311308 --172 24527 4446
NM_020403chr1341695 1418 1279 653 --31756 1321 399 --
NM_020443chr176152 4892 2534 1839 1689 1170 21 --25770 5097 --
NM_020456chr1351983 828 630 601 552 --21666 357 --
NM_020651chr211658 1479 --11708
NM_020673chr20117779 7447 7272 7148 6380 5999 5544 5074 1746 1300 410 --1644 --
NM_020717chrX33677 843 68 11703 33334 1998 1715 --
NM_020718chr1686448 5442 4073 4024 2425 1990 950 652 36272 6054 1104 11436 --
NM_020727chr2153722 2659 1505 1462 757 3861 779 68 1118 13869
NM_020734chr1262975 2817 2757 888 746 173 --1406 --
NM_020772chr17118517 8497 7844 7260 7217 7050 6926 6036 1150 784 359 13414 27007 2267 17529
NM_020774chr18115620 5427 5272 5207 4983 4869 4719 3819 2116 1088 25 1455 --14457
NM_020776chr1832825 1916 129 ----12410
NM_020782chr1244711 3686 1119 194 11053 24569 1670 1934
NM_020803chr421938 1909 ----1724
NM_020810chr1483437 3027 2978 2520 1250 1002 848 708 ------
NM_020841chr1263870 3501 3050 3010 2990 2887 12824 23475 2811 22864 2709
NM_020844chr8117049 6572 6254 2040 1763 1501 1422 1102 974 820 96 ----12458
NM_020870chr421447 191 11894 --12155
NM_020940chr1052912 2845 2221 2156 312 ----12645
NM_020948chr133710 1418 789 --13575 13128
NM_021090chr2274694 3646 2015 1985 1892 1712 317 --14739 --
NM_021097chr232853 2035 347 11081 43056 2556 1221 89 --
NM_021116chr788946 8758 7416 5846 5679 2971 2088 874 32868 2728 964 16731 27659 7374
NM_021255chr1463494 1223 1020 957 708 416 --13399 --
NM_021638chr464481 3848 3057 3048 1054 227 1696 34207 3627 629 --
NM_021647chr464581 3482 3319 1723 640 474 11345 1613 --
NM_021911chr555261 5033 2181 491 334 25045 4577 --13705
NM_021912chr1553285 3084 3071 2910 799 34061 1572 1088 23971 3713 --
NM_021914chr1452242 607 570 560 195 1231 --11534
NM_021961chr1177121 6879 6120 5270 4604 2714 1269 --12839 12051
NM_021964chr346190 6184 4996 4566 11002 25634 201 35807 1546 1501
NM_022091chr662610 2267 2021 736 634 143 1136 ----
NM_022114chr163915 3089 2925 1880 1850 1662 ----14199
NM_022166chr1665868 5755 3924 1651 1641 1293 16318 15004 --
NM_022334chr2--7784 728 448 392 336 280 263 ----
NM_022351chr853636 3282 696 671 88 ----13419
NM_022456chr1247721 5940 5473 5064 26544 2459 34843 4837 690 --
NM_022473chr1573881 3485 3235 3006 2928 1231 535 1783 --12830
NM_022482chr2021788 1584 11630 11726 1681
NM_022735chr141800 1775 1546 1237 11530 11251 --
NM_022763chr321209 451 --1531 1344
NM_022845chr1671996 1963 1818 1602 1539 1378 327 ----11648
NM_022893chr273100 2918 2880 2627 2057 1172 771 32544 2529 2047 1175 --
NM_023000chr14--1321 --21182 224
NM_023001chr14--1321 --21182 224
NM_023076chr1642752 2235 2127 515 2186 128 1195 --
NM_023929chr832210 1009 858 12784 12314 --
NM_024345chr995758 5444 4476 4395 4274 4044 1145 1030 576 --22415 289 15487
NM_024408chr163699 3305 2662 2431 1330 1249 13319 ----
NM_024429chr73873 383 243 ----1931
NM_024641chr692996 2915 2696 2460 1879 977 890 683 443 11833 31912 906 159 --
NM_024665chr333455 1681 1583 13919 11558 1188
NM_024721chr842275 988 696 447 --12518 22609 2595
NM_024744chr242240 2064 1066 469 11939 12581 --
NM_024751chr421992 1426 --1848 11416
NM_024770chr276734 4974 4939 4790 4706 2181 638 11857 24765 407 1127
NM_024896chr962551 2493 2433 710 351 68 12152 12505 12368
NM_024941chr531202 1084 100 21091 386 158 --
NM_024947chr3118872 8849 8086 7967 7849 7708 3263 3111 3072 1955 1699 --49480 7914 6782 421 32068 730 244
NM_024989chr285285 5250 2801 2214 1937 1481 1400 865 16596 17884 --
NM_025054chr853942 3206 699 390 126 ------
NM_025073chr1104748 4702 3570 3473 3201 1439 1402 1284 493 286 --11027 1651
NM_025134chr164982 760 586 431 --12016 --
NM_025146chr352717 1000 678 528 291 12737 2710 38 --
NM_025151chr811623 1447 11774 11958
NM_025180chr383413 2908 2803 2522 1351 624 459 58 13186 ----
NM_025184chrX2642 193 1175 2878 148 --
NM_030579chr1643710 3441 2363 1330 ----13040
NM_030621chr1464144 3600 3250 3145 3109 90 23033 830 ----
NM_030627chr553744 3475 2814 358 176 11054 ----
NM_030647chr765486 4825 4310 4192 1758 257 22045 480 1972 --
NM_030664chr1012293 11847 12010 12271
NM_030670chr1272261 2251 2124 2109 2065 1790 1484 ------
NM_030671chr1272261 2251 2124 2109 2065 1790 1484 ------
NM_030806chr1119291 8405 6802 3651 3415 3403 2964 2634 2469 2137 996 26389 1781 21370 982 29423 1287
NM_030816chr133576 3390 787 12560 33624 724 431 23259 1048
NM_030820chr621034 912 --11007 11025
NM_030938chr171828 1458 1277 1373
NM_031216chr1832111 867 539 --2317 254 --
NM_031268chr1633574 524 332 ----24869 4384
NM_031296chr422740 588 12747 3163 129 123 --
NM_031362chr252841 2744 928 706 209 --1962 11951
NM_031365chr252977 2880 1064 842 345 --11098 12087
NM_031366chr252977 2880 1064 842 345 --11098 12087
NM_031427chr1454795 1547 748 713 620 35512 4964 42 ----
NM_031438chr541431 731 575 483 198 1470 --
NM_031483chr2053466 3204 1034 592 422 12689 11266 --
NM_031844chr123903 1452 --13629 1389
NM_031845chr233595 341 76 13549 13711 1138
NM_031847chr233595 341 76 13549 13711 1138
NM_031892chrX1892 124 --1400
NM_032012chr973934 3408 1245 821 414 314 239 13210 ----
NM_032047chr372337 2289 855 778 420 392 33 ------
NM_032121chrX32751 2347 517 3753 677 417 12525 --
NM_032128chr41675 1934 --1891
NM_032145chr671853 1832 1826 1279 651 495 434 --1110 --
NM_032189chr1374913 4569 4253 1034 704 269 206 --14788 --
NM_032221chr2011372 21432 431 163 11401
NM_032228chr1193531 3503 3051 3008 2835 2405 2211 2147 89 ------
NM_032239chr431274 1172 516 --3980 300 158 --
NM_032321chr262897 1220 998 600 478 126 21113 263 22747 2730 --
NM_032373chr1095924 5650 5548 4218 2276 1299 1223 914 146 21488 1446 11275 32104 1920 1745
NM_032438chr631651 568 481 ----1561
NM_032440chr1032567 2171 1845 1410 22431 2028 12154
NM_032446chr562867 2718 2607 1178 1053 469 12526 23851 1462 --
NM_032457chr443398 2852 665 421 22859 2492 43910 2686 2391 203 1657
NM_032505chr332791 2185 1753 ----12485
NM_032810chr1021328 1002 --1565 1158
NM_032838chr19168 1259 1343 21282 372
NM_032859chr1333829 2960 702 33885 3206 305 ----
NM_032873chr1143861 3653 3288 1780 1905 13323 --
NM_032968chrX62683 1093 1007 752 581 513 13386 ----
NM_032969chrX62683 1093 1007 752 581 513 13386 ----
NM_032973chrY62678 1093 1007 752 581 513 13381 ----
NM_033012chr132740 352 1202 --1404
NM_033020chr154753 3421 370 287 186 11463 --14125
NM_033181chr643789 3693 2691 670 21131 1120 1127 --
NM_033290chrX43687 3471 2569 391 1982 --13276
NM_033326chr1142171 1854 194 188 --12021 --
NM_033331chr953256 3163 2845 2363 1234 12209 --13545
NM_033360chr1243896 3475 1798 1570 24038 1836 44619 3700 1201 626 --
NM_033389chr1734630 3913 3691 11674 33855 1198 1153 24872 1065
NM_033430chr443196 2751 1400 508 12654 22890 640 --
NM_033437chr443196 2751 1400 508 12654 22890 640 --
NM_033505chr266270 4953 2352 2141 1671 1395 --26620 1503 --
NM_033656chr2195474 4788 4160 3896 1151 1035 986 360 337 11343 23661 637 --
NM_052811chr1354129 3918 399 43 33 33567 3428 1572 --15119
NM_052885chr1233969 3883 3580 31128 948 490 14348 --
NM_052900chr831221 1181 489 ----1646
NM_052927chr521390 656 ----11999
NM_053024chr321297 437 ----11479
NM_053043chr766034 4744 2196 2154 1790 1051 11295 2610 228 --
NM_053064chr1432925 1022 254 1792 --11925
NM_057169chr1243054 757 619 238 2596 535 1654 11930
NM_057170chr1243054 757 619 238 2596 535 1654 11930
NM_057175chr432478 1818 764 21012 312 32572 466 63 --
NM_057178chr172631 141 --22733 2020 12811
NM_057749chr831174 412 305 --21226 339 --
NM_058241chr242245 1680 578 51 --22364 1788 11534
NM_058241chr242245 1680 578 51 --22364 1788 11534
NM_080676chr2053278 3178 2316 1284 1041 1824 12301 --
NM_080723chr621084 1038 11194 --1440
NM_080872chr854092 1037 966 741 406 34076 2809 2653 13802 --
NM_080874chr421890 223 --1407 1625
NM_080927chr342582 1292 1211 101 22964 1125 12927 --
NM_130391chr953447 2683 1439 1196 1114 ----13595
NM_130392chr953447 2683 1439 1196 1114 ----13595
NM_130393chr953447 2683 1439 1196 1114 ----13595
NM_130798chr152559 244 --21088 412 11479
NM_133265chrX33268 1333 1046 12357 --13067
NM_133334chr476339 6195 5448 5135 4223 2189 1282 --25276 4701 12061
NM_133372chr51443 --11839 22547 329
NM_133477chr473196 2723 2705 2482 1260 1240 1204 11268 ----
NM_133486chrX1421 ----1309
NM_133507chr125867 735 671 230 223 ------
NM_133646chr264598 3638 1724 1423 1332 943 25537 3935 --13688
NM_133647chr1532400 703 683 13061 ----
NM_134442chr21507 --31386 1305 1217 1478
NM_138270chrX62616 2470 1330 935 184 29 ----1337
NM_138292chr1163547 912 880 774 603 585 11097 ----
NM_138333chr972582 2532 2302 1849 1804 1028 76 ------
NM_138444chr1344952 4162 3492 1230 23162 1933 14317 --
NM_138459chr653137 3033 2975 2595 1475 1304 ----
NM_138638chr1452242 607 570 560 195 1231 --11534
NM_138694chr643519 3015 994 246 32300 908 432 13256 --
NM_138713chr16118203 6660 5626 3143 2919 2846 2418 2412 2161 664 269 23280 1294 11186 --
NM_138714chr16118203 6660 5626 3143 2919 2846 2418 2412 2161 664 269 23280 1294 11186 --
NM_138731chr1463791 3726 768 704 527 104 ----21701 1367
NM_138959chr156717 4307 1613 1532 218 24282 260 --15482
NM_139207chr121213 --11687 22089 425
NM_139283chr1272272 1999 1622 824 509 478 296 1449 12557 1598
NM_144571chr4105723 5440 5320 5272 5132 5068 4649 2765 1875 891 11769 11854 --
NM_144578chr14115007 4518 4280 3783 1837 1769 1740 1434 1132 543 337 ------
NM_144595chr13157 --1957 1715
NM_144721chr421066 138 --136 11109
NM_144963chr832681 2428 2176 --2699 379 --
NM_144973chr1285190 5060 5024 3781 1487 929 778 440 15102 ----
NM_144979chr44653 596 571 564 ------
NM_145049chr52346 213 ----1772
NM_145055chr1811086 13145 23125 1362 179
NM_145203chr131331 ----2949 685
NM_145307chr1063672 3418 3295 2960 1783 1232 1957 ----
NM_145686chr233116 2757 825 12466 --23152 1085
NM_145687chr233116 2757 825 12466 --23152 1085
NM_147147chr643346 3109 1642 602 14013 --13966
NM_148955chr1576478 5702 2578 2401 2257 1621 338 25021 2162 35207 4113 849 --
NM_152263chr145315 5248 530 217 --25365 2171 --
NM_152265chr1193 --1405 11344
NM_152556chr71228 42383 1994 490 211 12155 --
NM_152608chr12261 143 12516 --12474
NM_152622chr563270 2834 2282 1067 832 740 --22891 2539 --
NM_152624chr577015 6958 2737 2553 2071 1773 1530 41071 918 445 356 15692 --
NM_152629chr943310 3275 2994 280 --12751 23681 3618
NM_152665chr111093 1311 --1513
NM_152678chr31687 12292 12589 1642
NM_152688chr65887 699 676 607 345 1921 ----
NM_152695chrX61490 1440 559 518 473 397 1754 11837 --
NM_152699chr3--13644 53556 2433 870 125 54 --
NM_152756chr594359 3530 3507 3413 3209 2687 996 620 414 ----13931
NM_152787chrX63456 3400 3377 2817 1170 307 --13155 13167
NM_152826chr1576478 5702 2578 2401 2257 1621 338 25021 2162 35207 4113 849 --
NM_152838chr2053559 3004 2215 1024 436 52824 1413 1343 695 194 11277 --
NM_152924chr1576885 5978 4830 1991 619 383 219 ----12258
NM_152999chr764782 4055 1967 1859 174 113 24632 686 1263 1861
NM_153050chr2274694 3646 2015 1985 1892 1712 317 --14739 --
NM_153051chr2274694 3646 2015 1985 1892 1712 317 --14739 --
NM_153188chr564452 4348 3514 1644 844 89 --22114 1928 --
NM_153207chr1264056 3945 3465 3445 1235 1039 ------
NM_153365chr472614 2397 1870 1859 887 718 311 22462 2265 --12578
NM_153371chr1352086 2035 1730 260 251 1421 12268 --
NM_153456chr1395992 5817 4714 4030 2346 2209 1808 1217 511 1401 33896 2458 800 15959
NM_153607chr522660 498 --32928 1941 45 --
NM_153645chr2273262 2910 2587 2463 1118 694 464 ------
NM_153689chr23816 521 100 --32339 2296 318 12074
NM_153810chr1084737 4699 4127 1554 1059 856 641 529 21378 107 ----
NM_172071chr187294 5975 5643 5165 4950 4687 4555 47 --16359 --
NM_172373chr136460 445 176 140 113 35 11194 ----
NM_173214chr16118203 6660 5626 3143 2919 2846 2418 2412 2161 664 269 23280 1294 11186 --
NM_173468chr475695 5601 5082 4852 3933 1189 67 12275 25898 1481 --
NM_173508chr1------21124 1088
NM_173511chr243847 3111 2954 972 1445 23900 3212 --
NM_173519chr862047 2015 1316 651 631 145 1621 ----
NM_173552chr35996 768 679 282 230 199 1530 --
NM_173582chr11105904 4234 4141 3811 2424 2415 2049 925 477 463 1561 45490 4359 4244 4117 --
NM_173642chr168962 7370 7109 7098 5880 5757 49029 5936 3426 1896 37888 5897 847 12444
NM_173653chr311276 --11402 21475 140
NM_173829chr576094 5806 4987 4229 1333 1251 291 15605 25867 202 --
NM_173851chr8113963 3955 3796 3406 3193 2545 2450 2444 1517 1106 109 --23287 1600 22497 585
NM_175607chr341732 1716 1517 238 --11401 11262
NM_175612chr341732 1716 1517 238 --11401 11262
NM_175623chr1247721 5940 5473 5064 26544 2459 34843 4837 690 --
NM_175624chr1257816 6035 5568 5159 60 26639 2554 34938 4932 785 --
NM_175625chr1257816 6035 5568 5159 60 26639 2554 34938 4932 785 --
NM_176081chr1065926 5737 5664 2178 1322 205 33704 811 341 ----
NM_176083chr1065926 5737 5664 2178 1322 205 33704 811 341 ----
NM_177438chr1464144 3600 3250 3145 3109 90 23033 830 ----
NM_177985chr221805 428 --11988 12052
NM_178011chr1032275 2185 828 --21994 481 1948
NM_178151chrX97880 6470 6112 4942 4833 2585 1107 863 124 11259 ----
NM_178152chrX97880 6470 6112 4942 4833 2585 1107 863 124 11259 ----
NM_178153chrX97880 6470 6112 4942 4833 2585 1107 863 124 11259 ----
NM_178470chrX51530 1506 1345 1085 690 --21610 1298 --
NM_178498chr1144015 3245 829 83 33748 1166 315 12896 --
NM_178815chr1021023 608 22348 996 --1292
NM_180989chr1372125 1940 1919 1902 1766 991 226 ------
NM_181054chr14----11115 21292 1196
NM_181310chr6--1258 11876 11908
NM_181481chr18107013 6912 6451 5051 4568 2695 2097 1566 1349 879 --16542 15903
NM_181482chr18107013 6912 6451 5051 4568 2695 2097 1566 1349 879 --16542 15903
NM_181483chr18107013 6912 6451 5051 4568 2695 2097 1566 1349 879 --16542 15903
NM_181504chr5104049 4011 3358 2711 1424 936 920 835 633 342 21586 604 13709 13384
NM_181523chr5104049 4011 3358 2711 1424 936 920 835 633 342 21586 604 13709 13384
NM_181524chr5104049 4011 3358 2711 1424 936 920 835 633 342 21586 604 13709 13384
NM_181659chr2083430 2835 1306 850 621 314 291 146 ------
NM_181659chr2083430 2835 1306 850 621 314 291 146 ------
NM_181723chr842117 1810 1438 893 --42045 792 786 189 --
NM_182551chr272881 2637 1304 855 526 380 123 --32305 1244 1174 --
NM_182641chr1751679 782 715 441 212 11812 ----
NM_182729chr1231234 1177 348 ----11804
NM_182742chr1231234 1177 348 ----11804
NM_182743chr1231234 1177 348 ----11804
NM_182765chr1051975 1965 1888 735 604 12094 --1287
NM_182898chr746272 5550 460 341 --26470 5599 --
NM_182899chr746272 5550 460 341 --26470 5599 --
NM_182972chr162803 2797 1764 491 411 214 22401 1990 --11802
NM_183227chr631612 1477 67 178 11313 1332
NM_183416chr12313 133 ----1687
NM_194247chr2104307 4161 4060 4024 3964 3412 1768 1523 491 54 24258 197 24481 1378 --
NM_194285chr114961 540 146 132 22639 2427 ----
NM_194286chr1275645 5502 4636 4561 3936 1812 1215 --15261 --
NM_194291chr852696 2641 2307 1000 284 2522 65 1323 12678
NM_194314chr165638 1707 1561 1359 978 685 1746 15151 --
NM_194434chr1875625 5426 5238 4640 4581 1517 370 ------
NM_194449chr182223 126 1968 --1980
NM_198123chr831221 1181 489 ----1646
NM_198124chr831221 1181 489 ----1646
NM_198281chr43428 181 143 13143 --12500
NM_198395chr551216 1178 1090 940 928 ------
NM_198400chr1572313 1973 1817 1062 658 586 408 --11961 --
NM_198513chr831840 1691 400 --21655 1497 --
NM_198581chr287351 7034 6461 6332 2093 1807 1725 420 32250 738 584 15174 --
NM_198595chr464481 3848 3057 3048 1054 227 1696 34207 3627 629 --
NM_198793chr3103822 3767 3569 3357 3240 3050 1020 739 243 150 13313 1125 11613
NM_198859chr335034 4790 1138 24802 3133 21878 1872 1597
NM_199039chr421082 386 --11015 1101
NM_199072chr712360 1227 --12210
NM_199324chr433534 1019 265 23435 2448 11123 --
NM_199454chr163915 3089 2925 1880 1850 1662 ----14199
NM_201432chr1746508 4269 1954 1104 34711 4245 321 21691 1159 15208
NM_201433chr1746508 4269 1954 1104 34711 4245 321 21691 1159 15208
NM_201545chr131361 102 83 1561 --11198
NM_201624chr161294 1274 1061 910 809 283 --1258 --
NM_203406chr582740 2696 1829 740 672 499 225 155 ------
NM_203458chr142617 2505 2488 1416 13004 --2909 344
NM_203463chr274945 4094 3659 3392 1893 1808 1156 --1410 13989
NM_203487chr1341695 1418 1279 653 --31756 1321 399 --
NM_206853chr613707 --11476 13335
NM_206854chr624968 3748 11095 --14596
NM_206855chr645933 4713 4218 673 12060 --15561
NM_206866chr2122906 696 11226 --12724
NM_206876chr252373 1443 1159 1085 37 1110 ----
NM_206907chr532398 1261 521 --32626 1273 529 1973
NM_206909chr868060 7629 5764 2520 2074 145 25396 2286 1823 --
NM_207012chr1033483 2789 46 --11134 11126
NM_207123chr44888 768 629 619 ----1363
NM_207406chr4125856 5265 4281 4212 2237 2231 1423 1332 951 679 94 72 --16460 11659
NM_207411chr832948 1155 923 ----11414
NM_212471chr1742261 860 640 230 --11600 11674
NM_212472chr1742261 860 640 230 --11600 11674
NM_213590chr1354129 3918 399 43 33 33567 3428 1572 --15119