TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4509
miRNA Sequence: ACUAAAGGAUAUAGAAGGUUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51472 ------
NM_000038chr542022 1720 781 284 21489 1446 ----
NM_000051chr11143518 3417 2952 2724 2561 2425 1307 1153 794 693 686 265 58 52 23390 208 11355 139
NM_000052chrX13130 43060 2136 592 488 11376 --
NM_000053chr1341836 1364 1322 102 --11918 11989
NM_000055chr31144 --1324 140
NM_000067chr8--1675 153 --
NM_000081chr141856 482 193 71 ------
NM_000084chrX145884 5611 5451 4415 4281 2493 1965 1635 1339 1048 944 661 622 180 12366 15942 14447
NM_000090chr22706 275 ------
NM_000091chr262566 2276 1055 1032 369 87 12588 ----
NM_000092chr263825 3134 1554 1471 1186 738 11512 ----
NM_000104chr263026 2875 2838 2742 1152 621 32224 290 28 12950 --
NM_000109chrX62418 2162 2139 2029 1947 344 ----12308
NM_000110chr14938 450 397 59 ----11165
NM_000125chr6113952 3836 3712 3619 3526 1567 1506 542 515 438 69 12595 11183 --
NM_000151chr172671 394 31931 1559 1551 ----
NM_000161chr1451831 1688 1382 527 482 ------
NM_000163chr552352 2284 1963 1683 713 ------
NM_000165chr651700 1205 1186 1105 1086 ------
NM_000168chr7113299 2343 1178 862 717 446 433 289 149 101 84 23111 2665 --22388 335
NM_000176chr5103825 3319 3148 3138 2871 2474 1078 535 500 51 --23367 2678 --
NM_000194chrX2560 480 1146 1215 --
NM_000202chrX113974 3857 3830 3471 3015 2549 1549 1256 1242 877 185 11377 --1308
NM_000210chr252352 851 435 402 35 21882 1725 ----
NM_000216chrX103828 3288 3272 3130 1509 1406 987 730 594 127 ------
NM_000217chr1294806 4505 3330 1882 1659 1272 351 343 220 12015 ----
NM_000232chr452464 1278 672 649 346 --1421 --
NM_000237chr861921 1819 1563 274 157 73 1497 ----
NM_000242chr1062625 2589 2123 2086 2057 1039 ------
NM_000245chr72511 66 11580 1825 --
NM_000248chr371219 1070 937 688 527 262 98 1154 ----
NM_000259chr1596234 5965 5855 5767 5697 5590 4566 1080 202 1166 --12111
NM_000264chr953123 3014 2509 2225 1266 --13212 --
NM_000267chr17123434 3321 3310 2878 2464 2295 2276 1154 1114 783 281 193 --1489 --
NM_000276chrX61752 590 450 409 240 155 11901 --1185
NM_000286chr172639 140 --1173 --
NM_000289chr123346 109 82 ------
NM_000291chrX3641 629 219 ------
NM_000297chr491920 1826 1655 1622 1365 1301 779 462 315 ------
NM_000314chr1073250 2915 2714 2681 2639 591 414 ----12279
NM_000317chr111323 ------
NM_000321chr1341652 1584 1108 620 --11387 --
NM_000328chrX2325 96 ------
NM_000332chr6176861 5743 4972 4755 4630 4412 2771 2493 2487 2111 2011 1690 1515 1201 1114 639 109 --26434 6173 --
NM_000333chr35981 908 407 236 91 11052 ----
NM_000337chr5116258 5971 5258 4793 4470 1473 1212 1052 514 508 475 22291 55 24283 416 --
NM_000340chr381453 1280 1233 1139 1060 277 265 95 ------
NM_000345chr441004 963 381 371 1702 ----
NM_000346chr1751883 1869 1295 449 391 21740 504 11496 186
NM_000362chr2283630 3381 2999 1281 886 860 404 307 13338 23427 2889 --
NM_000368chr964427 2971 1543 933 490 314 11828 44647 3061 876 693 1136
NM_000388chr331254 1176 175 ------
NM_000390chrX113439 3350 3278 3206 3128 2639 1375 1279 595 416 393 3928 343 34 ----
NM_000406chr462971 2692 2130 534 469 393 1680 12732 1138
NM_000408chr2123008 2777 2661 2527 2472 2442 2378 2291 2144 2096 1048 208 --13424 --
NM_000411chr2173325 3112 2332 877 350 166 140 12398 --12373
NM_000430chr1763128 3012 2878 2613 1432 888 43019 3004 1250 483 ----
NM_000436chr531560 1279 519 --11034 --
NM_000441chr762332 2158 1987 1671 939 484 1497 ----
NM_000448chr1142376 806 559 81 --1192 --
NM_000459chr92849 350 1675 ----
NM_000461chr393855 3103 1763 1470 1459 1066 897 815 515 --32971 457 432 --
NM_000462chr1541329 674 231 173 ----11732
NM_000474chr71191 ----1459
NM_000480chr1121182 512 11414 ----
NM_000484chr2141056 958 718 204 ------
NM_000489chrX173219 3157 2650 2481 2407 2371 2283 1222 1168 1115 1016 992 907 697 385 59 50 12175 1318 --
NM_000493chr641054 970 784 229 ------
NM_000503chr851560 1448 645 239 148 ------
NM_000522chr74870 433 336 161 1964 ----
NM_000523chr211066 ----163
NM_000533chrX51519 1245 445 405 90 1168 1195 11956
NM_000545chr12----11293 --
NM_000555chrX207409 6687 6520 5936 5886 5854 5641 5098 4860 4788 2955 2616 2443 2417 2370 2358 2206 2182 1360 1337 16891 21509 234 --
NM_000582chr41420 ------
NM_000599chr264364 1793 1627 1321 1315 225 31854 1812 790 13088 13201
NM_000601chr7146 ------
NM_000602chr751505 1455 1376 355 80 --1185 --
NM_000610chr1182818 2451 2183 1981 972 605 160 116 ------
NM_000611chr1162819 1909 1002 872 620 260 36692 5147 376 ----
NM_000615chr11122947 2549 2463 2013 1180 1000 847 788 751 677 217 152 12763 ----
NM_000617chr1231868 1759 1506 --12275 --
NM_000618chr12156600 6113 5193 5156 4529 4437 4192 1909 1165 895 715 510 230 170 50 2634 80 ----
NM_000618chr12156600 6113 5193 5156 4529 4437 4192 1909 1165 895 715 510 230 170 50 2634 80 ----
NM_000633chr1865070 5036 3943 3701 2082 753 54489 3721 1753 1401 295 24452 962 14200
NM_000635chr1941564 1385 326 312 11480 --1588
NM_000639chr11327 ------
NM_000663chr1662829 2780 2566 2486 2352 2269 ------
NM_000681chr10--21281 1034 11020 --
NM_000686chrX41497 614 496 481 11296 ----
NM_000693chr1551739 1594 1250 1143 256 ----1666
NM_000702chr142258 2184 2150 2021 22099 717 --12113
NM_000721chr142644 2408 2231 194 1911 ----
NM_000724chr1021321 79 1646 ----
NM_000780chr83990 936 306 ----176
NM_000788chr461475 1455 1446 1362 1210 1042 31340 995 90 ----
NM_000806chr541452 1290 726 463 11590 ----
NM_000809chr4289323 9159 9017 8819 8148 8115 7743 7474 7414 7149 6968 6838 6784 6605 6573 6511 6147 6023 3678 3626 2752 2739 2305 2232 1586 857 778 86 13727 1432 --
NM_000810chr153571 497 381 ------
NM_000811chr52678 552 ------
NM_000812chr43339 294 123 ------
NM_000813chr565298 5012 4395 2055 1934 594 21779 1233 ----
NM_000814chr1531196 1098 431 ------
NM_000817chr2--11212 ----
NM_000826chr492405 1849 1689 1657 964 786 667 589 562 ------
NM_000827chr562468 2453 2114 1979 1655 775 --12148 --
NM_000833chr1611111 ------
NM_000840chr7--2113 34 ----
NM_000859chr531641 1576 1115 ------
NM_000875chr15146962 6681 5791 5467 4542 2453 2413 2212 2112 1735 1215 1203 504 241 11963 11499 26009 4361
NM_000876chr64943 362 328 100 ------
NM_000891chr1763260 2998 2613 1459 904 325 ------
NM_000895chr12--125 ----
NM_000899chr12123797 3428 3372 3098 2834 2782 1635 1588 1392 1273 1071 122 23578 2824 12969 --
NM_000901chr472571 2512 2071 1796 1733 967 792 11555 12192 --
NM_000912chr853465 2535 2332 2203 1050 ----1121
NM_000917chr102317 173 ------
NM_000919chr51209 1579 163 --
NM_000922chr113779 435 395 1985 ----
NM_000944chr462380 2045 724 654 362 234 ------
NM_000945chr271969 1842 1391 676 545 454 292 22061 1656 ----
NM_000950chrX83157 3011 2590 2542 2239 890 847 143 42851 2761 2656 2254 ----
NM_000958chr531024 904 873 ------
NM_000959chr163226 3003 2981 2431 977 312 33868 3085 749 ----
NM_000962chr942436 2384 2293 1113 ------
NM_000963chr182278 2060 1867 1529 905 764 740 159 11940 ----
NM_001001132chr2141158 933 356 307 ------
NM_001001323chr1263151 3136 2793 2537 1938 589 22517 389 --11947
NM_001001330chr1041249 898 473 354 ------
NM_001001389chr1182818 2451 2183 1981 972 605 160 116 ------
NM_001001390chr1182818 2451 2183 1981 972 605 160 116 ------
NM_001001391chr1182818 2451 2183 1981 972 605 160 116 ------
NM_001001392chr1182864 2497 2229 2027 1018 651 206 162 ------
NM_001001395chr1292563 2405 2307 2166 1961 784 759 567 47 1728 1846 --
NM_001001396chr163912 3683 3523 2733 1329 1078 12928 24098 3968 --
NM_001001419chr5135231 4602 4283 3706 3655 2088 1334 884 873 856 843 420 278 64221 3963 3691 1763 1702 53 14775 --
NM_001001420chr5135231 4602 4283 3706 3655 2088 1334 884 873 856 843 420 278 64221 3963 3691 1763 1702 53 14775 --
NM_001001433chr2092739 2559 2375 1960 524 411 360 224 131 1284 ----
NM_001001436chr163802 599 566 ------
NM_001001481chr8112988 2840 2729 2706 1092 1067 1027 567 201 128 87 ------
NM_001001483chr112341 169 ------
NM_001001484chr1062393 962 856 847 619 420 ------
NM_001001567chr211193 ------
NM_001001568chr211193 ------
NM_001001571chr211193 ------
NM_001001572chr211193 ------
NM_001001573chr211193 ------
NM_001001574chr211193 ------
NM_001001575chr211193 ------
NM_001001576chr211193 ------
NM_001001577chr211193 ------
NM_001001579chr211193 ------
NM_001001580chr211193 ------
NM_001001581chr211193 ------
NM_001001582chr211193 ------
NM_001001584chr211193 ------
NM_001001585chr211193 ------
NM_001001664chr2103707 3577 3360 3179 2651 1344 1327 847 598 433 33092 1069 951 11143 --
NM_001001668chr1994268 4055 2828 1391 1272 985 979 598 169 23494 377 1558 --
NM_001001701chr451564 1446 650 505 331 1833 22237 221 --
NM_001001877chrY2112 42 ------
NM_001001890chr2163429 3299 3226 1517 721 634 33664 1177 1033 ----
NM_001001924chr861680 1651 1324 1317 1304 352 21925 1448 ----
NM_001001925chr861680 1651 1324 1317 1304 352 21925 1448 ----
NM_001001931chr861680 1651 1324 1317 1304 352 21925 1448 ----
NM_001001933chr11169 ------
NM_001001938chr9103675 3353 3329 3270 1414 1095 961 489 259 87 2477 334 ----
NM_001001971chr1031265 516 109 ------
NM_001001974chr1072357 2161 2018 356 185 131 95 ------
NM_001002233chr872089 1941 1433 741 228 205 183 ------
NM_001002243chr2----1939 --
NM_001002244chr171117 ------
NM_001002245chr171152 ------
NM_001002246chr171152 ------
NM_001002247chr171152 ------
NM_001002248chr171152 ------
NM_001002249chr171152 ------
NM_001002257chr293119 2851 1438 1360 1106 1100 890 681 523 13434 1273 --
NM_001002265chr105776 687 676 600 89 ------
NM_001002266chr105776 687 676 600 89 ------
NM_001002294chr12314 259 ------
NM_001002838chrX41504 1393 1373 406 31450 1421 121 11540 --
NM_001002843chr1531168 824 370 11209 ----
NM_001002857chr151140 1296 ----
NM_001002858chr151140 1296 ----
NM_001002860chr1484006 3693 3332 3078 1316 1230 537 275 --23621 3215 12952
NM_001003406chr2243030 1023 554 52 1704 ----
NM_001003652chr18238515 8014 7122 6933 6897 6710 6250 6220 5941 5570 3472 3165 2886 2313 2235 1831 1794 1583 1330 870 556 417 363 16075 27420 7209 27084 5903
NM_001003665chr153247 3223 1229 78 63 1865 22683 1087 --
NM_001003674chr18166981 6928 6244 5927 5636 5379 4920 4547 4523 4499 2692 2636 2026 1655 554 466 11272 26309 151 --
NM_001003675chr18166981 6928 6244 5927 5636 5379 4920 4547 4523 4499 2692 2636 2026 1655 554 466 11272 26309 151 --
NM_001003681chr2261912 1529 752 528 339 182 12010 ----
NM_001003688chr421169 340 1781 1256 --
NM_001003712chr12123766 3481 3388 2965 2936 2792 2510 1161 1021 908 154 79 1915 ----
NM_001003792chr32983 132 ------
NM_001003793chr32983 132 ------
NM_001003800chr993573 3532 2968 2909 2671 2533 2439 1047 434 --11333 12286
NM_001003810chr41695 2791 660 ----
NM_001003891chr221120 ------
NM_001003895chrY1306 --157 --
NM_001004065chr963933 3796 3727 3127 718 29 33940 2717 908 ----
NM_001004125chr981092 970 910 865 811 782 511 421 --1842 --
NM_001004127chr131820 1107 --1131
NM_001004308chrX61482 1066 421 409 132 72 --1462 --
NM_001004316chr3------1282
NM_001004317chr674225 3892 2816 1736 455 318 29 13832 13747 --
NM_001004329chr1271530 1513 1498 450 382 350 133 1109 ----
NM_001004342chr1176023 5801 5077 4983 4826 4511 4378 4193 4024 2363 2128 2044 1485 753 646 631 528 --1506 --
NM_001004346chr431197 223 68 ------
NM_001004360chr272010 1861 1762 1387 694 621 434 11689 ----
NM_001004419chr1274525 4104 3313 1818 1627 1429 713 23109 105 ----
NM_001004720chr25976 960 784 301 119 1206 ----
NM_001004722chr251145 1129 953 470 288 1375 ----
NM_001005335chr192229 54 ------
NM_001005375chrY51610 1602 1510 1193 703 21519 59 ----
NM_001005386chr282392 2365 973 389 351 328 110 50 22309 1754 31884 853 446 --
NM_001005404chr1754360 3543 3242 3223 3082 13890 ----
NM_001005463chr1052460 2092 1994 1722 1711 12342 ----
NM_001005473chr5216503 6349 5789 5644 5288 5141 4960 4859 4822 4653 4218 4090 4082 4045 2374 2348 2335 2199 1728 1281 839 14677 ----
NM_001005474chr331198 1135 369 ----11513
NM_001005612chrX2187 149 ------
NM_001005732chr212633 69 ------
NM_001005733chr212590 69 ------
NM_001005753chr262189 2031 1902 549 353 198 ------
NM_001005849chr173511 151 40 ------
NM_001005861chr34854 700 403 199 2267 141 ----
NM_001006600chr5112099 2063 2004 1980 1844 1813 1719 1621 773 390 349 ------
NM_001006605chr13809 473 44 ----1204
NM_001006605chr13809 473 44 ----1204
NM_001006612chrX2187 75 1118 ----
NM_001006613chrX2187 75 1118 ----
NM_001006614chrX2187 75 1118 ----
NM_001006617chr951382 475 445 415 395 ------
NM_001006619chr951382 475 445 415 395 ------
NM_001006620chr951382 475 445 415 395 ------
NM_001006621chr951382 475 445 415 395 ------
NM_001006623chr262327 1694 870 834 364 161 ------
NM_001006657chr272732 2678 2347 2092 937 869 501 12392 1602 --
NM_001006684chrX2113 88 ------
NM_001007024chr1764401 4308 4027 3928 3439 1745 --1393 --
NM_001007025chr1764401 4308 4027 3928 3439 1745 --1393 --
NM_001007097chr9105039 4790 4652 4026 3841 1680 1267 1250 581 477 23851 912 ----
NM_001007098chr14853 714 654 193 --1828 --
NM_001007156chr1551868 1747 783 307 144 2262 90 11447 --
NM_001007189chr5151 ------
NM_001007226chr1741378 490 144 99 --1228 --
NM_001007227chr1741378 490 144 99 --1228 --
NM_001007228chr1741378 490 144 99 --1228 --
NM_001007229chr1741378 490 144 99 --1228 --
NM_001007230chr1741378 490 144 99 --1228 --
NM_001007237chr142559 2467 2104 248 --2842 363 --
NM_001007246chr2171726 1708 1682 1589 785 381 334 ------
NM_001007257chr12470 377 ------
NM_001007267chr25863 829 229 176 161 1774 1635 --
NM_001007278chr13135160 5081 4961 4909 4193 4084 3984 3678 3647 1635 933 897 541 35206 4488 4314 14592 --
NM_001007466chr6125131 4514 3951 3497 2003 1949 1768 1066 674 515 288 56 ----2446 137
NM_001007468chr221248 ------
NM_001007538chr1341645 1181 397 26 ----1109
NM_001007553chr12830 250 ------
NM_001007559chr1851413 797 631 178 154 --11795 --
NM_001007794chr14767 520 127 120 ------
NM_001008222chrX4875 124 118 103 --1539 --
NM_001008225chr74519 184 88 74 ------
NM_001008226chr1591781 1698 1691 1674 1402 1373 1249 250 198 1624 ----
NM_001008239chr18143689 3337 3078 3020 2718 2665 2371 2365 1380 1230 702 622 545 277 13738 33720 3186 3085 1306
NM_001008391chr113695 592 182 --1575 --
NM_001008392chr373230 3001 2667 1350 730 474 189 --1467 --
NM_001008401chr1951335 1295 1269 1094 998 --1354 --
NM_001008408chr7156257 5763 5072 4925 4825 4792 4764 4715 4374 4001 1886 1274 1264 889 532 --15057 14114
NM_001008495chr891775 1545 1520 870 849 428 323 246 211 11425 ----
NM_001008539chr895255 5100 5093 4345 3426 3397 1573 832 732 25331 1254 --11283
NM_001008541chr1041777 1683 535 98 ----11868
NM_001008541chr1041777 1683 535 98 ----11868
NM_001008660chr1161529 1187 1106 1083 1052 374 ------
NM_001008707chr1431895 1775 332 11849 ----
NM_001008708chr22528 108 1244 ----
NM_001008726chr1461733 1655 1600 1084 571 376 21351 293 ----
NM_001008738chr572671 2598 2182 1977 1105 904 630 ----196
NM_001008744chr1431319 208 159 11263 ----
NM_001008777chr173686 615 241 1142 --125
NM_001008801chr1972141 2015 1984 1771 1638 1449 129 --1718 --
NM_001008895chr1331287 394 294 --1213 --
NM_001008896chr11234 ------
NM_001008925chr4103439 3277 3161 3147 3050 2458 2411 2301 1101 907 1635 1417 --
NM_001008938chr113459 357 35 ------
NM_001009554chr4164657 4578 4323 4285 4174 3976 3873 3804 3651 3617 3432 1035 907 560 457 372 24337 1261 12911 --
NM_001009554chr4164657 4578 4323 4285 4174 3976 3873 3804 3651 3617 3432 1035 907 560 457 372 24337 1261 12911 --
NM_001009555chr481700 1656 1369 1314 1308 1138 589 370 ------
NM_001009894chr122590 500 --11452 --
NM_001009899chr3146184 6071 5727 4839 4786 4593 4501 4410 4195 2381 2152 1238 654 546 35713 5259 4774 11506 --
NM_001009909chr1153697 3086 2821 2697 1274 23634 58 ----
NM_001009955chr11168 ------
NM_001009955chr11168 ------
NM_001009959chr282107 2028 1635 1006 825 658 445 223 ------
NM_001009993chr263021 847 663 571 548 232 --11767 --
NM_001010853chr6103082 3022 2985 2624 2534 2396 2145 685 63 53 ------
NM_001010861chr152742 2618 1955 1709 299 1535 ----
NM_001010862chrX42262 813 710 595 33031 1004 566 ----
NM_001010867chr176007 4402 2466 2240 2157 965 442 --22341 55 --
NM_001010888chrX174406 4392 4305 4237 3837 3170 3017 2956 2901 1699 1211 1027 589 413 289 171 24 11498 33874 1594 816 --
NM_001010891chr5136747 6472 6286 5258 4995 4475 2677 2458 2231 1412 1154 1066 471 36407 2207 731 2702 296 --
NM_001010895chr971888 1761 1559 1550 546 536 108 ----1139
NM_001010922chr174122 2810 1551 1416 1158 662 350 33490 875 501 ----
NM_001010923chr651619 1359 415 243 152 21482 1177 11568 --
NM_001010927chr6145 ------
NM_001010932chr7146 ------
NM_001010971chr13693 328 307 ------
NM_001010984chr162408 2329 812 779 762 593 22231 2008 11046 --
NM_001010986chrX62538 2477 835 260 226 158 ------
NM_001011513chr4124026 3785 3764 3515 3328 3135 2904 1176 1118 986 562 449 2307 74 13029 --
NM_001011515chr421040 391 1729 ----
NM_001011516chr421040 391 1729 ----
NM_001011537chr392139 2009 1772 1589 595 582 424 342 260 21845 355 12058 --
NM_001011546chr202799 320 ----1121
NM_001011551chrX3428 349 181 --1412 --
NM_001011553chr73875 758 630 ------
NM_001011666chr7156053 4964 4956 4763 4753 4701 4685 4654 2583 1926 1507 319 223 157 61 22257 75 31256 685 356 15871
NM_001011708chr282904 2746 2167 2053 2027 1062 798 786 ------
NM_001011724chr131205 ------
NM_001011725chr131205 ------
NM_001011885chr1541794 1711 1396 133 ------
NM_001012393chr1185024 4590 4509 1803 1734 1340 1143 158 ----24850 4028
NM_001012398chr161424 ------
NM_001012410chr33163 69 37 ------
NM_001012420chr1522035 1019 12592 1735 --
NM_001012423chr1522035 1019 12592 1735 --
NM_001012614chr4--2498 273 ----
NM_001012755chrX134554 4402 4099 3916 3629 3198 3186 1800 1557 1359 285 249 75 14733 21778 104 --
NM_001012756chr1952836 2646 2512 2135 2052 ------
NM_001012761chr562537 2130 1877 481 445 358 ----12630
NM_001012968chrX102636 2601 2435 2238 1123 1104 972 827 714 656 ------
NM_001012979chrX----1169 --
NM_001012989chrX1258 1459 ----
NM_001013031chr1063282 968 585 497 361 140 11178 ----
NM_001013415chr451539 1499 1034 376 302 ------
NM_001013438chr33808 250 186 ------
NM_001013439chr34654 336 96 32 ------
NM_001013620chr12238444 8335 8138 7365 7342 7141 7043 6939 6920 6811 6209 5443 3002 2279 1981 1961 1785 1256 1220 1042 939 727 709 58260 7891 7101 2794 1620 22099 96 --
NM_001013746chr7122343 1547 904 666 582 498 418 334 268 250 166 81 ------
NM_001013843chr151186 --1750 --
NM_001014380chr13205227 5171 5069 4665 4622 4241 3591 2228 2037 1797 1711 1701 1373 1192 1090 1037 1016 660 399 295 ----25108 495
NM_001014434chr12766 191 ------
NM_001014797chr10167952 7768 7409 7377 7310 6769 5059 3040 2876 2799 2555 1668 1329 1220 792 617 25139 3069 22674 1076 --
NM_001014811chr111111 ------
NM_001014972chr2------1213
NM_001015045chr462464 2205 1973 1918 1828 1630 ------
NM_001015877chrX83080 2615 2424 2412 1196 1174 986 387 42730 2582 1095 945 ----
NM_001015880chr1041550 1501 1353 110 ------
NM_001015882chr9--168 ----
NM_001017368chr1762748 2314 2305 1964 1118 586 2567 515 12342 11864
NM_001017369chr43944 344 135 1735 --1355
NM_001017395chr3113651 3222 2818 2310 2221 1250 1023 900 889 717 267 23290 176 ----
NM_001017415chr1180 1175 ----
NM_001017416chr1180 1175 ----
NM_001017424chr181783 1689 1606 1505 1414 566 453 58 21816 1443 --11834
NM_001017425chr181783 1689 1606 1505 1414 566 453 58 21816 1443 --11834
NM_001017440chr788189 8062 7226 7167 1452 1428 1029 909 27675 6273 ----
NM_001017523chr1251379 1332 616 476 305 ------
NM_001017923chr1471701 1130 1040 612 593 258 64 ------
NM_001017926chr851782 1741 1666 1575 1517 11185 ----
NM_001017962chr102317 173 ------
NM_001017969chr91593 ------
NM_001017970chr1462228 2114 1811 890 442 115 11971 ----
NM_001017975chr11202 ------
NM_001017999chr142099 1962 761 717 22041 260 ----
NM_001017999chr142099 1962 761 717 22041 260 ----
NM_001018000chr142099 1962 761 717 22041 260 ----
NM_001018000chr142099 1962 761 717 22041 260 ----
NM_001018001chr142099 1962 761 717 22041 260 ----
NM_001018004chr15192 ------
NM_001018006chr15192 ------
NM_001018007chr15192 ------
NM_001018020chr15192 ------
NM_001018038chr95505 454 206 124 47 ------
NM_001018064chr951928 1835 627 443 69 ------
NM_001018065chr9145976 5508 5472 5436 5224 4813 4475 4463 1932 1585 1561 1458 1366 308 --15045 --
NM_001018066chr9145976 5508 5472 5436 5224 4813 4475 4463 1932 1585 1561 1458 1366 308 --15045 --
NM_001018067chr1135217 5057 4512 4499 3850 3517 3247 1619 1553 1362 1170 614 32 35152 4392 1439 --14976
NM_001018068chr1135217 5057 4512 4499 3850 3517 3247 1619 1553 1362 1170 614 32 35152 4392 1439 --14976
NM_001018069chr1135217 5057 4512 4499 3850 3517 3247 1619 1553 1362 1170 614 32 35152 4392 1439 --14976
NM_001018072chr1251379 1332 616 476 305 ------
NM_001018074chr5103825 3319 3148 3138 2871 2474 1078 535 500 51 --23367 2678 --
NM_001018075chr5103825 3319 3148 3138 2871 2474 1078 535 500 51 --23367 2678 --
NM_001018076chr5103825 3319 3148 3138 2871 2474 1078 535 500 51 --23367 2678 --
NM_001018077chr5103825 3319 3148 3138 2871 2474 1078 535 500 51 --23367 2678 --
NM_001018090chr15112793 2596 2263 2251 2168 2154 2097 2074 1092 286 255 11017 ----
NM_001018091chr15102903 2706 2373 2361 2278 2264 2207 2184 396 365 11127 ----
NM_001018102chr15112793 2596 2263 2251 2168 2154 2097 2074 1092 286 255 11017 ----
NM_001018108chr1562122 1919 1840 1766 417 119 1362 --11492
NM_001020658chr161676 1167 1080 457 400 170 11700 ----
NM_001020658chr161676 1167 1080 457 400 170 11700 ----
NM_001020825chr521300 346 --1153 --
NM_001023567chr1532085 1789 1763 --1213 1740
NM_001024094chr5103825 3319 3148 3138 2871 2474 1078 535 500 51 --23367 2678 --
NM_001024218chr143615 329 157 --1283 --
NM_001024372chr842000 1701 913 732 --11825 --
NM_001024463chr151310 ------
NM_001024647chr12156713 5757 5172 5085 5039 4829 2759 2644 2125 1855 1798 912 572 182 150 16891 11972 --
NM_001024649chr572678 2583 2428 1120 1027 706 321 12729 ----
NM_001024660chr331358 1095 668 1636 ----
NM_001024666chrX1577 ------
NM_001024688chr831799 1720 1598 ------
NM_001024847chr362459 2346 1670 1531 781 192 ------
NM_001024937chr171102 ------
NM_001024948chr183408 2975 2757 2555 773 535 361 337 12823 1947 --
NM_001024956chr11115721 5124 4888 3920 3551 2349 2217 2046 1368 1315 840 34156 3850 1223 15164 23945 1845
NM_001025068chr351748 725 508 276 267 31422 1338 255 ----
NM_001025069chr351748 725 508 276 267 31422 1338 255 ----
NM_001025076chr10136176 5524 4126 3784 2068 1650 1577 1433 1059 566 196 179 34 16257 14211 --
NM_001025077chr10197534 6882 5484 5142 4996 4974 3008 2935 2791 2417 1924 1554 1537 663 590 274 250 109 34 27615 671 15569 --
NM_001025079chr3104156 3358 2546 1598 1442 1393 702 679 455 429 --33446 1365 1237 11230
NM_001025108chr274064 3337 3315 2891 2686 1303 1115 --12967 --
NM_001025201chr2------1712
NM_001025233chr12112381 2162 2122 1898 1731 941 788 327 314 234 136 ------
NM_001025266chr394949 4903 4369 4086 3891 1758 1018 910 54 33376 3195 3093 21053 399 --
NM_001025356chr1272999 2957 2571 989 941 369 94 ------
NM_001025389chr1121182 512 11414 ----
NM_001025390chr1121182 512 11414 ----
NM_001025579chr1741192 1079 973 449 1846 ----
NM_001025580chrX174302 3915 3779 3719 3634 3054 2968 2905 2783 2710 1127 874 638 455 431 399 87 31522 1229 209 ----
NM_001025595chr441229 1101 646 424 --21472 1326 --
NM_001025780chr961590 1315 1211 1090 581 56 ------
NM_001029858chr6122862 2772 2763 2534 2260 2188 2132 998 950 871 653 589 --22722 2226 --
NM_001029863chr682494 2367 2096 1976 1306 1095 889 838 1789 22689 106 --
NM_001029875chr582818 2408 2381 2236 937 416 149 127 21061 963 11174 --
NM_001029882chr1--1280 ----
NM_001029882chr1--1280 ----
NM_001029989chr152705 205 ------
NM_001030006chr171172 ----1912
NM_001030007chr16143808 3721 3413 3340 3048 2930 2891 2848 1309 1007 833 785 475 26 11385 ----
NM_001030055chr14124708 4446 4187 3969 3853 2985 1180 1059 943 711 629 573 33484 1079 816 ----
NM_001030272chr113436 316 101 ------
NM_001030273chr113436 316 101 ------
NM_001031623chr671181 1119 686 670 473 386 343 --11350 --
NM_001031679chr1273577 2271 712 639 430 306 205 --1257 --
NM_001031684chr221197 1124 --122 --
NM_001031692chr71128 ----1311
NM_001031695chr22125423 5384 5322 5315 4484 3671 2111 1230 864 831 206 192 --25023 4349 --
NM_001031710chr76997 977 863 727 184 150 ------
NM_001031711chr561815 1689 1296 621 492 464 1188 21602 72 --
NM_001031716chr24252 114 99 67 1226 ----
NM_001031722chr61144 ------
NM_001031723chr43194 160 38 --2389 27 --
NM_001031732chr483387 1298 1131 1071 903 869 224 142 ----11286
NM_001031738chr21494 --1458 --
NM_001031804chr1684171 3746 3717 3522 2861 1320 733 408 24004 3917 --1531
NM_001031812chr542132 1886 1440 194 ------
NM_001032282chr861095 920 490 243 235 35 --11346 --
NM_001032283chr1221022 230 3821 687 187 1667 --
NM_001032284chr1221022 230 3821 687 187 1667 --
NM_001032288chr2021094 527 ------
NM_001032293chr17--1249 ----
NM_001032296chr1352852 2467 2051 574 293 11123 --12202
NM_001033002chr172111 81 ------
NM_001033045chr2114403 4045 3763 3404 3095 3015 2876 1656 1229 384 61 44235 3778 1389 723 1263 --
NM_001033047chr462459 2405 2013 956 516 82 11821 1886 --
NM_001033057chr331760 706 26 ------
NM_001033059chr671644 1581 804 775 640 479 269 --11423 --
NM_001033112chr51765 ------
NM_001033117chr353869 3483 3299 3019 1420 13647 14688 --
NM_001033503chr5--2389 119 ----
NM_001033506chr112390 331 1117 ----
NM_001033507chr15730 574 558 261 73 11417 ----
NM_001033557chr251357 1310 1151 1141 114 11259 ----
NM_001033561chr17--1881 ----
NM_001033564chr631782 1456 123 --1130 199
NM_001033566chr173737 604 42 ------
NM_001033568chr173737 604 42 ------
NM_001033602chr1341883 907 598 433 ----1639
NM_001033659chr1761680 1560 1541 1395 492 81 1358 ----
NM_001033723chr851809 1727 1123 1106 579 21912 1022 ----
NM_001033925chr1041618 764 219 145 1525 1129 --
NM_001033953chr11147 ------
NM_001034845chr431141 451 53 ------
NM_001034850chr541521 1078 1057 338 1116 ----
NM_001034852chr1422045 135 ----1277
NM_001034954chr1042876 2414 2299 69 12215 --1795
NM_001034955chr1042876 2414 2299 69 12215 --1795
NM_001034956chr1042876 2414 2299 69 12215 --1795
NM_001034957chr1042876 2414 2299 69 12215 --1795
NM_001035chr161279 1217 1198 530 521 367 11305 ----
NM_001035003chr4----178 --
NM_001035004chr4----178 --
NM_001035267chr121292 ------
NM_001037132chr71711 ------
NM_001037133chr71711 ------
NM_001037164chr761974 1680 1429 1289 608 364 1696 ----
NM_001037165chr7118883 7830 7378 7336 6823 6674 5981 5851 3334 3198 376 16581 ----
NM_001037174chr241825 1593 1516 1474 ------
NM_001037317chr152742 2618 1955 1709 299 1535 ----
NM_001037334chr182600 427 62188 957 722 661 191 77 ----
NM_001037339chr171867 1420 1300 1238 704 430 384 ------
NM_001037340chr171867 1420 1300 1238 704 430 384 ------
NM_001037341chr171867 1420 1300 1238 704 430 384 ------
NM_001037341chr171867 1420 1300 1238 704 430 384 ------
NM_001037535chrX71169 590 308 251 238 228 170 31390 1371 1030 185 --
NM_001037536chrX71169 590 308 251 238 228 170 31390 1371 1030 185 --
NM_001037540chrX71169 590 308 251 238 228 170 31390 1371 1030 185 --
NM_001037631chr24864 856 457 158 ------
NM_001037872chr22520 113 ------
NM_001037954chr1153160 2698 2141 893 731 21379 739 22243 1029 --
NM_001038702chr592512 2463 2189 2167 1899 1812 1067 984 856 31739 602 162 --1140
NM_001038707chr122326 1683 22198 534 22232 2215 --
NM_001038707chr122326 1683 22198 534 22232 2215 --
NM_001039199chr20125017 4253 4022 4010 3959 3868 3825 1731 1296 1241 1043 26 21710 50 1167 --
NM_001039457chr1135 ------
NM_001039479chr1462233 2094 408 278 204 162 --32289 2020 896 --
NM_001039538chr2123477 3377 2731 2725 2488 2293 1404 1225 1012 965 844 89 1891 1876 --
NM_001039547chr3247777 7413 6779 6575 6303 5819 5516 5129 3196 3102 2790 2491 2094 2053 1830 1352 1331 946 828 682 591 418 410 141 27795 3028 25291 1072 17165
NM_001039569chr2113289 3241 2927 2826 2668 2172 2080 1305 1169 769 672 1574 ----
NM_001039570chr2274643 4602 1390 1112 736 441 376 24477 4363 13117 --
NM_001039571chr2274643 4602 1390 1112 736 441 376 24477 4363 13117 --
NM_001039573chr172487 143 ------
NM_001039577chr1123630 3444 3122 3101 1550 1534 1057 988 430 240 187 34 13437 ----
NM_001039580chr454239 3820 1142 1121 922 24753 146 --11400
NM_001039585chr163483 3260 3238 2688 1234 569 34125 3342 1006 ----
NM_001039590chrX73974 3028 2945 994 751 533 401 --13238 --
NM_001039591chrX73974 3028 2945 994 751 533 401 --13238 --
NM_001039618chr11175880 5819 5783 5673 4853 4240 4009 3773 1903 1804 1651 1016 993 902 690 221 21 12333 45717 5017 2061 797 --
NM_001039690chr1632396 1716 651 --1852 --
NM_001039693chr274093 3994 3741 2506 1549 186 36 11427 1620 --
NM_001039762chr1042378 1584 727 147 137 ----
NM_001039802chr11470 ------
NM_001039840chrX215546 5206 4741 4454 4411 4373 4325 3728 2377 1984 1229 1182 988 963 841 772 685 464 449 106 85 15351 31727 1487 1475 1428
NM_001039937chr13123681 3103 2931 2620 2606 1600 1569 1336 1072 862 614 317 23336 825 21237 952 --
NM_001040001chr641834 1691 1451 410 ------
NM_001040020chr73431 393 370 11349 ----
NM_001040057chr74538 515 463 339 --1487 11518
NM_001040058chr41420 ------
NM_001040060chr41420 ------
NM_001040100chr34976 927 402 170 1203 ----
NM_001040108chr14133179 2586 2491 2350 2323 2133 1256 1183 875 842 779 669 584 --1575 --
NM_001040135chr7----1702 --
NM_001040142chr222100 1667 1640 1920 --
NM_001040143chr222100 1667 1640 1920 --
NM_001040144chr1632396 1716 651 --1852 --
NM_001040146chr1632396 1716 651 --1852 --
NM_001040152chr7105000 4754 4639 4583 3852 3354 3220 2059 1566 1233 24536 3341 14038 --
NM_001040153chr131899 ------
NM_001040157chr472397 2158 666 219 163 69 34 ------
NM_001040159chr431350 1274 1006 ------
NM_001040214chr661938 1884 1828 1488 958 815 11581 1623 --
NM_001040284chr16145565 5543 5505 5392 5203 4885 4545 4387 4312 1636 1589 1305 1225 935 11883 24497 1624 --
NM_001040402chr483188 2916 2546 2317 2036 1223 759 657 1516 --12635
NM_001040409chr23797 683 369 ------
NM_001040427chr16----145 --
NM_001040429chr1373512 3133 2896 2871 2843 1386 777 23590 2193 43126 2727 636 124 12959
NM_001040437chr6164 ------
NM_001040438chr6164 ------
NM_001040441chr1105071 5044 4926 4491 4388 4030 3576 1670 816 300 14816 11629 --
NM_001040446chr542640 2265 962 956 1897 ----
NM_001040450chr1572683 1846 1837 747 578 558 184 ------
NM_001040453chr1572683 1846 1837 747 578 558 184 ------
NM_001040619chr131400 1016 415 ------
NM_001040653chr362524 2005 1785 1751 1657 709 ----1243
NM_001040665chr7114738 4671 4340 4263 4003 3956 3065 1804 856 676 357 11228 ----
NM_001040697chr112231 106 ------
NM_001040708chr82943 159 1404 11089 --
NM_001040712chr983359 3211 3017 2922 2754 1076 509 457 --32414 2352 1305 --
NM_001040876chr441707 1379 1298 605 ------
NM_001042355chr16155276 5035 4826 4075 4012 3961 3639 3521 1892 1339 1331 1296 822 754 370 45351 5075 4537 914 1336 --
NM_001042388chr182991 810 ------
NM_001042403chr123858 387 240 ------
NM_001042404chr161896 1759 1553 1378 1364 1251 ------
NM_001042406chr64952 905 878 809 1965 ----
NM_001042412chr16155276 5035 4826 4075 4012 3961 3639 3521 1892 1339 1331 1296 822 754 370 45351 5075 4537 914 1336 --
NM_001042413chr964136 4071 3992 3627 3471 3045 1685 ----
NM_001042414chr133230 62 54 ------
NM_001042424chr452383 2158 1291 832 305 1516 13096 --
NM_001042430chr14144 ------
NM_001042453chrX71750 1345 1135 504 314 259 205 --1663 --
NM_001042473chr1041765 1604 1391 768 ------
NM_001042475chr61316 ----1208
NM_001042481chr1461856 980 455 320 120 70 1782 ----
NM_001042492chr17123434 3321 3310 2878 2464 2295 2276 1154 1114 783 281 193 --1489 --
NM_001042493chr671885 1563 1470 736 666 565 29 ----11667
NM_001042494chr1583168 3018 2991 1395 1079 1026 515 502 12953 ----
NM_001042495chr1583168 3018 2991 1395 1079 1026 515 502 12953 ----
NM_001042496chr1583168 3018 2991 1395 1079 1026 515 502 12953 ----
NM_001042497chr1583168 3018 2991 1395 1079 1026 515 502 12953 ----
NM_001042510chr851959 1729 1501 844 32 1338 ----
NM_001042511chr851959 1729 1501 844 32 1338 ----
NM_001042533chr3113291 3071 2971 2851 2745 2669 1219 729 426 348 334 22218 318 ----
NM_001042537chrX102437 2308 2301 2222 1579 969 469 436 223 183 --12364 --
NM_001042543chr441582 1507 1391 190 11380 ----
NM_001042550chr951836 1578 255 127 52 ------
NM_001042555chr12244452 4367 4288 4221 4153 3951 3869 3525 1783 1775 1763 1754 1644 1297 1223 1159 1128 860 555 463 337 139 95 32 24611 4435 ----
NM_001042599chr2187601 7562 7316 7295 6607 6419 6345 6292 6150 6133 5856 2763 2164 1959 1305 870 809 679 --15121 15454
NM_001042601chr373213 2882 1271 1148 581 532 92 32943 1287 916 ----
NM_001042603chr12135371 4780 4729 4503 3874 1810 1740 1687 1433 1107 773 239 209 13943 ----
NM_001042604chr3114688 4650 4235 3965 3625 3406 1565 1266 1190 1036 708 53162 1840 1131 634 555 ----
NM_001042646chr321338 537 ------
NM_001042681chr172404 2148 1897 688 468 292 117 1551 12161 --
NM_001042682chr172404 2148 1897 688 468 292 117 1551 12161 --
NM_001042682chr172404 2148 1897 688 468 292 117 1551 12161 --
NM_001042683chr671872 1631 1520 1399 1275 420 30 11747 ----
NM_001042749chrX51984 1472 726 571 476 ------
NM_001042750chrX51984 1472 726 571 476 ------
NM_001042751chrX51984 1472 726 571 476 ------
NM_001042762chr76938 338 292 247 54 46 ------
NM_001043318chr1494156 4147 3886 2919 2790 2511 1099 798 615 21470 872 11296 --
NM_001043351chr141809 258 100 82 22331 617 --1215
NM_001044385chr243920 2870 2744 2515 13001 24013 3875 --
NM_001044722chr542132 1886 1440 194 ------
NM_001044723chr542132 1886 1440 194 ------
NM_001046chr5112812 2801 2630 2228 1043 974 869 784 374 256 183 --1322 --
NM_001049chr1442295 2032 542 157 ----22357 773
NM_001071775chr1351820 1542 1402 1207 237 21356 1250 ----
NM_001077628chr11683 ------
NM_001079874chr151851 1550 677 550 310 11585 ----
NM_001083620chr492403 1847 1688 1656 963 785 666 588 561 ------
NM_001083621chr1124734 4728 4538 4352 4158 4074 3511 3226 1701 1384 810 68 --12923 11029
NM_001084chr7146 ------
NM_001099678chr3156233 5683 4772 4569 4345 4334 4097 4029 2253 2211 1706 995 889 785 636 36160 3963 1590 15843 --
NM_001100108chr1148005 7628 7340 7215 6089 5449 5272 3227 2329 2276 2262 1280 989 838 --22948 1810 17101
NM_001102566chr13913 119 75 ------
NM_001106chr3198834 8146 7717 7417 7210 6807 6792 6330 6103 3771 2942 2656 2542 2511 2464 2449 535 524 432 29606 1735 32064 712 318 --
NM_001113490chrX42955 2910 62 44 22390 633 23551 1209 --
NM_001115chr8--185 ----
NM_001117chr1892238 2148 2079 2060 2008 1851 1649 1593 656 12325 ----
NM_001126chr171001 927 759 703 313 195 170 ------
NM_001128chr16143808 3721 3413 3340 3048 2930 2891 2848 1309 1007 833 785 475 26 11385 ----
NM_001144chr1621304 931 11262 ----
NM_001156chr102546 446 ------
NM_001159chr21712 ------
NM_001160chr1282091 2057 1782 881 748 526 473 185 12039 ----
NM_001167chrX96785 5782 2242 2214 2031 972 517 496 142 2902 476 ----
NM_001173chr14124708 4446 4187 3969 3853 2985 1180 1059 943 711 629 573 33484 1079 816 ----
NM_001174chrX32129 1970 1444 11733 --11674
NM_001178chr113436 316 101 ------
NM_001200chr203973 953 335 148 ----
NM_001201chr4113848 3724 3191 1529 1354 1242 948 928 878 649 216 33824 2623 280 13791 --
NM_001204chr2157738 6775 6617 6349 6006 5706 5425 5245 4861 2532 2144 2000 1463 1134 771 16294 25870 1420 26574 6268
NM_001206chr9113012 2789 2252 798 749 721 598 495 458 311 128 12766 22140 1052 --
NM_001219chr792109 1846 1813 1655 1613 1504 598 361 341 --11736 --
NM_001232chr13789 405 141 --11119 --
NM_001241chr252427 1965 1714 276 128 ------
NM_001241chr252427 1965 1714 276 128 ------
NM_001253chr62261 249 --1222 --
NM_001254chr1741054 172 146 67 1826 ----
NM_001256chr17112391 1818 1130 967 885 771 277 266 205 80 21 22535 1810 11020 --
NM_001270chr521102 863 21083 329 139 --
NM_001271chr1573118 3097 3053 2407 1113 713 205 13290 ----
NM_001278chr1041185 963 825 358 ------
NM_001282chr171172 ----1912
NM_001283chr74671 487 276 263 1212 ----
NM_001289chrX4600 269 206 192 ------
NM_001293chr112437 191 --1453 --
NM_001304chr17143689 3326 3221 3203 2796 2787 2716 2440 1388 1185 856 343 195 111 ------
NM_001310chr1292773 2640 2620 2552 2279 2118 2035 689 470 ------
NM_001316chr202403 374 ------
NM_001326chr111480 1174 ----
NM_001328chr4--2498 273 ----
NM_001329chr1041658 1097 1004 293 ----11470
NM_001331chr1152289 2094 1946 465 41 12848 22650 1082 1477
NM_001332chr531322 1113 640 21537 159 ----
NM_001351chr321485 1159 11493 1608 --
NM_001356chrX72497 2400 1956 1575 854 660 317 1325 ----
NM_001358chr42129 103 ----1358
NM_001364chr1143436 898 220 81 24196 1557 13268 1503
NM_001386chr831875 745 726 --11803 11621
NM_001390chr1873167 3090 1028 1014 725 506 416 11323 23245 1345 --
NM_001391chr18--1243 --1205
NM_001400chr171357 1243 922 495 429 390 36 ------
NM_001401chr92475 304 ------
NM_001406chr1711185 --1154 --
NM_001412chrX73654 3143 2833 1318 1203 725 209 23583 2873 ----
NM_001417chr1241979 1631 1388 173 1237 21938 401 --
NM_001418chr112212 201 ------
NM_001418chr112212 201 ------
NM_001419chr19154548 4459 4450 4339 4095 3749 3493 1759 1577 1381 1052 962 468 387 224 --1381 13280
NM_001420chr1923140 2236 ------
NM_001422chr11144 1475 ----
NM_001423chr1261911 1582 1554 1496 1299 505 1531 ----
NM_001427chr742134 1960 1913 1770 ------
NM_001432chr4103311 3038 2869 2792 2672 2402 1396 1168 1009 720 1865 ----
NM_001438chr193066 2959 2858 2584 543 410 348 311 239 --13101 --
NM_001440chr841992 774 494 158 --32123 2067 1910 --
NM_001448chrX1514 11554 11358 --
NM_001451chr1631339 931 428 21068 385 --1509
NM_001452chr61683 ------
NM_001465chr561807 840 823 494 250 140 ----21651 287
NM_001466chr17----1115 --
NM_001483chr731047 349 141 1398 ----
NM_001497chr972769 1903 1852 1695 912 357 224 --12518 --
NM_001498chr681168 899 891 457 445 415 374 150 ------
NM_001527chr6134570 4539 4459 3573 3076 1735 1663 1484 1039 774 479 322 102 13212 --14430
NM_001530chr1431032 182 171 21019 88 ----
NM_001533chr192229 54 ------
NM_001542chr142559 2467 2104 248 --2842 363 --
NM_001546chr621454 294 1350 ----
NM_001553chr4184 ------
NM_001564chr4139 ------
NM_001584chr1131215 1180 288 ------
NM_001587chrX61752 590 450 409 240 155 11901 --1185
NM_001609chr1064191 3675 3313 2973 443 206 --14339 --
NM_001616chr2113168 3142 2763 2623 1386 1087 1075 997 900 754 136 22745 2226 --12919
NM_001620chr112542 533 ------
NM_001621chr792943 2497 2292 2282 1081 936 930 462 314 21879 1095 --1161
NM_001621chr792943 2497 2292 2282 1081 936 930 462 314 21879 1095 --1161
NM_001634chr671644 1581 804 775 640 479 269 --11423 --
NM_001642chr1131241 432 174 ------
NM_001649chrX62099 1989 716 216 192 181 ------
NM_001650chr1893910 3335 2553 1556 1108 941 880 871 479 13093 ----
NM_001655chr1182188 1647 758 656 529 325 308 236 --21748 765 --
NM_001656chr541458 553 419 244 11381 ----
NM_001660chr33649 277 224 ------
NM_001661chr171560 ------
NM_001663chr14122733 2462 2350 2067 1972 1791 1767 1093 992 590 525 334 ------
NM_001668chr142058 1401 638 455 --1212 --
NM_001677chr14996 866 816 773 ------
NM_001679chr35767 670 645 621 201 ------
NM_001681chr122184 63 1694 ----
NM_001682chr1262865 2850 2507 2251 1171 303 32231 1053 103 ----
NM_001684chr153629 3400 3240 1046 795 12645 23815 3685 --
NM_001690chr3132568 2377 2344 2226 1959 1811 1700 1583 796 216 182 96 88 ------
NM_001695chr8153861 3689 3458 3307 3051 1498 1421 1388 1264 987 939 827 762 97 81 33993 3895 1712 --11100
NM_001701chr951571 1306 1015 427 43 ------
NM_001704chr63514 488 246 ------
NM_001709chr1152762 2474 794 595 460 21012 410 ----
NM_001713chr51907 1178 ----
NM_001718chr631380 1178 314 1992 ----
NM_001730chr1331303 1128 595 11337 ----
NM_001730chr1331303 1128 595 11337 ----
NM_001731chr123818 309 58 1719 ----
NM_001743chr21492 1188 ----
NM_001746chr572678 2583 2428 1120 1027 706 321 12729 ----
NM_001748chr11286 ------
NM_001753chr751669 1601 1251 716 45 11230 11434 --
NM_001754chr2163429 3299 3226 1517 721 634 33664 1177 1033 ----
NM_001755chr164868 663 310 81 1483 ----
NM_001759chr12105206 5144 4718 4602 3498 3344 1984 1111 546 85 ----21268 144
NM_001769chr123346 169 115 ------
NM_001777chr3104156 3358 2546 1598 1442 1393 702 679 455 429 --33446 1365 1237 11230
NM_001788chr73875 758 630 ------
NM_001789chr32566 51 11242 ----
NM_001791chr11470 ------
NM_001792chr1831079 403 123 ------
NM_001795chr1631605 1470 1060 --1997 --
NM_001796chr16--194 ----
NM_001797chr161682 ------
NM_001798chr121904 --1739 --
NM_001806chr1962487 2439 2261 1103 966 799 32987 2068 24 1726 --
NM_001822chr2------1712
NM_001839chr13285 118 35 --1185 --
NM_001843chr121198 ------
NM_001845chr1331313 1250 1237 ------
NM_001854chr161502 1470 575 555 276 147 ------
NM_001855chr94607 575 336 122 ------
NM_001858chr6135031 4922 3717 3636 3581 3501 3224 3144 1926 1668 908 871 371 13760 13605 --
NM_001873chr4--172 ----
NM_001875chr241099 1057 1048 742 1727 ----
NM_001880chr21294 129 ----
NM_001901chr64921 903 369 266 ------
NM_001903chr51619 ----1184
NM_001904chr341093 1010 312 53 ------
NM_001918chr1219129 9027 9018 8834 7510 7337 7210 7166 7078 6754 6616 6116 3367 3135 2396 1651 1087 995 966 332 81 38197 3557 948 18259 --
NM_001935chr24739 363 132 93 ------
NM_001938chr141506 1380 487 370 1251 ----
NM_001942chr1831880 1707 801 --11263 --
NM_001946chr1261002 984 816 790 751 333 1190 ----
NM_001949chr633153 822 812 ------
NM_001951chr84508 190 143 103 153 ----
NM_001957chr452234 1911 476 343 195 1394 11408 --
NM_001969chr1483814 3675 3635 3158 3036 2488 993 801 21281 1023 12621 --
NM_001977chr46585 441 282 243 150 114 ------
NM_001981chr152192 1577 865 463 138 1690 ----
NM_001982chr123831 361 147 2786 139 --21274 54
NM_001993chr1158 1269 ----
NM_001994chr11182 ------
NM_001999chr521189 349 31086 499 471 1544 --
NM_002006chr4105396 4923 4189 1954 1488 1186 1054 698 287 203 154 --1877
NM_002009chr1592771 2583 2543 1013 856 795 97 89 47 12324 --12357
NM_002013chr141245 ------
NM_002015chr1353330 2980 1309 1261 959 12090 199 --
NM_002017chr1151170 448 314 134 121 31288 1180 50 ----
NM_002024chrX61928 1831 1502 478 251 220 ------
NM_002025chrX208452 8343 7415 7306 7228 6788 5795 5769 5728 5664 3192 2982 2092 1560 1283 1202 1159 918 710 103 36854 6616 2975 1219 16761
NM_002033chr11124100 3306 3294 3065 3024 2699 1471 1152 987 821 779 219 ------
NM_002040chr2183056 2851 1994 1031 1010 908 93 69 2411 186 12151 12065
NM_002041chr15122 ------
NM_002056chr24874 830 263 106 1713 ----
NM_002069chr751676 585 350 321 302 1365 --1638
NM_002072chr92983 239 1630 --1678
NM_002074chr141248 1240 1107 508 1370 ----
NM_002077chr962036 1890 869 573 472 391 1560 ----
NM_002089chr41269 1181 ----
NM_002092chr494922 4327 4111 3882 3838 3425 3291 489 353 33450 920 623 13118 --
NM_002103chr1921024 310 ----1349
NM_002114chr6----1200 --
NM_002126chr17154138 3983 3612 3594 3552 3318 3088 2934 1618 957 815 648 534 282 214 22720 28 1253 --
NM_002128chr1382328 2035 1974 1634 1599 839 819 74 22218 172 ----
NM_002129chr42325 160 ------
NM_002136chr121205 1133 ----
NM_002137chr752023 1764 937 441 247 1710 11896 1719
NM_002138chr41695 2791 660 ----
NM_002140chr91199 ------
NM_002145chr172402 339 1312 ----
NM_002146chr1741223 1166 450 172 ------
NM_002154chr51113 ------
NM_002158chr2113262 3085 3017 2916 2901 2367 783 767 730 82 42 ------
NM_002163chr1681299 1292 1234 1059 820 482 413 255 ------
NM_002166chr26612 496 262 229 70 26 ------
NM_002193chr241799 1453 1424 525 ------
NM_002196chr2041027 937 783 208 1892 ----
NM_002196chr2041027 937 783 208 1892 ----
NM_002199chr42964 169 194 ----
NM_002203chr5134173 4166 3880 3571 3016 2675 2598 1032 917 396 381 331 253 11609 22618 833 1601
NM_002210chr293356 1266 1049 956 840 686 600 572 214 --13039 --
NM_002211chr104925 861 380 73 --11104 --
NM_002214chr7125239 4816 4651 4490 4471 3974 3657 2302 1623 1475 1339 657 ------
NM_002222chr331345 1116 34 ------
NM_002226chr143345 154 95 ------
NM_002227chr151307 1109 829 812 193 ------
NM_002239chr2--1765 ----
NM_002241chr152787 986 859 777 124 22383 2325 12363 --
NM_002247chr1071997 1799 1522 927 918 625 399 ------
NM_002264chr3134846 4165 3480 3061 1988 1762 1569 1122 1063 768 400 355 233 21581 256 14524 13560
NM_002267chr1362315 2096 1860 1789 474 382 31774 673 218 --1351
NM_002268chr341627 1586 1447 1360 11392 ----
NM_002270chr5175324 5126 4918 4678 4257 4116 3814 3469 2185 1933 1920 1751 1657 1116 693 223 95 --14594 --
NM_002285chr274064 3337 3315 2891 2686 1303 1115 --12967 --
NM_002293chr172802 2675 2657 2635 2471 2383 718 --1579 --
NM_002294chrX4443 169 147 117 ------
NM_002296chr171673 1488 1202 1097 460 451 159 --21501 1173 --
NM_002310chr5115954 5040 4653 4498 4358 4184 1831 1819 735 729 159 ----14298
NM_002332chr122747 481 ------
NM_002336chr1254882 4810 3250 3100 1728 44126 4015 3986 1268 --1686
NM_002345chr121275 1484 ----
NM_002349chr231676 1581 474 ------
NM_002356chr672578 2518 2277 1930 907 326 274 --11822 --
NM_002372chr53146 85 40 ------
NM_002374chr2123477 3377 2731 2725 2488 2293 1404 1225 1012 965 844 89 1891 1876 --
NM_002376chr141507 ------
NM_002381chr271054 994 970 926 356 287 222 ------
NM_002389chr171967 1547 1524 643 582 259 31 11674 ----
NM_002395chr641314 244 76 41 11122 ----
NM_002397chr552071 1866 377 277 147 11434 12205 --
NM_002399chr1521359 918 --1901 --
NM_002408chr141754 --1676 --
NM_002480chr1241360 1341 1035 1006 ------
NM_002485chr831799 1720 1598 ------
NM_002486chr982358 2308 2154 1689 1555 546 439 157 ------
NM_002487chr155742 318 143 135 113 ------
NM_002500chr24932 924 917 867 --183 1157
NM_002505chr641290 1096 191 103 ----11456
NM_002514chr841128 1095 158 145 ------
NM_002515chr1421803 41 ------
NM_002519chr1141329 1222 1155 966 ------
NM_002522chr1731014 529 461 1403 32575 981 554 13466
NM_002526chr641484 1142 103 22 --170 --
NM_002527chr122294 103 ------
NM_002544chr171235 ------
NM_002545chr1185024 4590 4509 1803 1734 1340 1143 158 ----24850 4028
NM_002546chr8--1501 ----
NM_002547chrX94267 3819 3163 2903 1368 1339 941 196 77 13308 ----
NM_002572chr111249 ------
NM_002576chr111402 ----1800
NM_002577chr3143966 3867 3369 3128 2809 2664 1544 1435 1335 948 874 581 198 181 43285 2931 2837 662 43230 2976 339 55 --
NM_002581chr994582 4370 1900 1591 1556 1545 1315 970 134 --2568 55 14449
NM_002583chr124568 531 420 192 ------
NM_002591chr202584 25 ----1480
NM_002595chr1211758 1727 ----
NM_002600chr171867 1420 1300 1238 704 430 384 ------
NM_002603chr8--144 ----
NM_002605chr152472 402 ------
NM_002606chr211193 ------
NM_002610chr262878 2857 2213 2164 2021 421 22499 2205 12367 --
NM_002613chr1685351 3551 3325 1637 1355 1304 1295 431 --11459 --
NM_002618chr21349 139 ----
NM_002623chr202697 267 2686 631 ----
NM_002628chr331049 784 97 ------
NM_002629chr103563 316 153 ------
NM_002635chr12171 ------
NM_002641chrX41734 1491 397 304 21621 96 ----
NM_002645chr11122740 2575 2379 2335 2003 1238 1126 1042 768 568 387 378 124 12185 --
NM_002648chr62832 498 ------
NM_002655chr8174852 4768 4597 3996 3739 3684 3654 3209 1975 1672 1609 828 609 596 287 156 70 31654 1091 170 14187 1315
NM_002656chr62951 424 11071 ----
NM_002657chr2053197 3078 2428 508 246 33682 827 320 13617 --
NM_002670chr361604 1515 1466 1192 1049 425 ------
NM_002687chr1461326 1176 524 451 435 320 ------
NM_002706chr24640 593 161 149 1542 ----
NM_002709chr2103342 3026 2756 2569 2291 1430 835 355 116 100 31355 967 583 ----
NM_002713chr121051 752 1862 ----
NM_002716chr11103453 3304 3283 3150 3048 2310 998 946 856 27 ------
NM_002717chr82627 227 ------
NM_002718chr381962 1660 942 754 747 740 532 506 --12699 --
NM_002719chr1492354 2339 2328 2080 2018 1843 953 431 339 ------
NM_002720chr16--1261 ----
NM_002726chr64435 356 177 162 ------
NM_002731chr152716 853 668 242 130 ------
NM_002734chr1751647 1417 786 701 143 --11592 --
NM_002736chr751964 1913 1383 857 768 21580 684 ----
NM_002737chr17116353 6164 5738 5465 4855 4461 2450 2342 2045 1753 1403 25481 423 ----
NM_002740chr382830 2524 2303 2195 2036 1011 629 467 ------
NM_002745chr22103221 3201 3147 3105 1523 1244 1015 278 160 120 ----1662
NM_002747chr1841755 1707 590 179 1281 ----
NM_002755chr153845 693 174 ------
NM_002758chr171492 ------
NM_002786chr111119 ------
NM_002808chr31153 ------
NM_002816chr171279 ------
NM_002821chr62747 656 --1180 --
NM_002822chr1221731 542 --152 1512
NM_002828chr182693 313 ------
NM_002835chr73693 272 82 ------
NM_002836chr20139 1106 ----
NM_002837chr1284407 3747 3401 3350 3220 2984 1566 1439 14349 11114 --
NM_002839chr983359 3211 3017 2922 2754 1076 509 457 --32414 2352 1305 --
NM_002841chr32505 443 ------
NM_002843chr1122340 993 ------
NM_002844chr641023 876 516 119 1556 ----
NM_002850chr191447 ------
NM_002855chr1163672 2763 903 705 259 238 --13607 --
NM_002858chr12529 340 ------
NM_002869chr1192130 2023 1915 1533 1526 1384 807 512 45 ------
NM_002874chr951606 942 824 303 253 12309 ----
NM_002881chr241168 1078 426 128 ------
NM_002886chr3105036 4027 3525 3266 3240 1851 1453 1215 1199 979 ------
NM_002897chr23728 231 87 ------
NM_002902chr154680 451 424 38 --1152 1465
NM_002906chr1162324 1477 832 721 679 65 11463 ----
NM_002912chr62635 218 ------
NM_002923chr11650 ------
NM_002924chr11559 ------
NM_002940chr441707 1379 1298 605 ------
NM_002942chr33420 405 321 ------
NM_002956chr1231259 888 535 11045 1160 --
NM_002958chr34854 700 403 199 2267 141 ----
NM_002959chr184363 3857 3336 2926 2886 1554 1461 234 --1653 22967 1648
NM_002970chrX--140 ----
NM_002973chr123531 511 405 ------
NM_002977chr243356 2955 295 193 ----1692
NM_002994chr4131966 1954 1853 1588 1580 1520 1499 1302 1213 714 686 677 464 41833 792 668 560 ----
NM_002995chr16824 761 666 131 117 84 ------
NM_002998chr861816 1627 1360 903 616 271 31984 482 165 1790 11499
NM_003010chr1752147 2080 959 707 631 22343 1841 ----
NM_003011chr921194 646 --1591 --
NM_003016chr1741345 580 400 282 --1138 --
NM_003017chr671219 1213 1103 575 569 426 119 --1266 --
NM_003022chrX51258 1218 1061 805 53 ----11313
NM_003034chr12128112 8045 7780 7581 7489 6942 6692 6079 4929 798 754 484 47752 7066 1632 437 16532 --
NM_003035chr14768 299 216 23 ------
NM_003042chr321963 341 ----11737
NM_003043chr344072 2892 759 363 24287 4241 ----
NM_003046chr895255 5100 5093 4345 3426 3397 1573 832 732 25331 1254 --11283
NM_003051chr141810 605 293 253 21917 301 ----
NM_003071chr32648 338 31996 74 49 ----
NM_003073chr221248 ------
NM_003088chr711087 ------
NM_003091chr201235 ------
NM_003095chr123354 331 312 1248 ----
NM_003100chr52359 327 ------
NM_003106chr33945 407 228 1736 ----
NM_003107chr652247 1988 1684 1647 347 ------
NM_003108chr2166568 6205 5822 5503 5317 5216 5109 5088 5078 4501 4451 4416 2132 1377 1070 283 26895 6744 24623 2048 --
NM_003110chr1731050 995 965 ------
NM_003112chr7132872 2786 2762 2670 2102 1201 1019 952 700 590 262 122 52 12644 ----
NM_003115chr1143 ------
NM_003133chr141030 845 357 192 1153 ----
NM_003136chr141292 ------
NM_003137chr662105 1804 627 534 351 295 ------
NM_003144chr631941 530 30 2782 296 ----
NM_003150chr173631 205 166 ------
NM_003155chr861927 1842 689 652 248 46 12552 12796 1358
NM_003161chr1783447 3009 2886 2859 2670 2603 1435 1082 ------
NM_003162chr23825 755 254 ------
NM_003185chr2041349 1202 1081 96 1450 11215 --
NM_003188chr61757 ------
NM_003189chr1123344 3304 3036 3000 2979 2761 2576 2265 1311 1067 149 139 --1394 --
NM_003199chr1885629 4239 4039 3674 2129 1641 1625 232 13695 13650 --
NM_003201chr1041004 662 262 110 1168 ----
NM_003202chr541877 1749 1432 1344 --11737 --
NM_003204chr1731721 1555 1194 ------
NM_003211chr1281752 1569 1509 1311 1264 475 370 288 ------
NM_003217chr1221856 791 11788 ----
NM_003221chr6144132 3872 3847 3770 3574 3493 3338 3213 3035 3002 1356 1136 447 70 196 --1316
NM_003222chr203965 316 241 2308 206 ----
NM_003234chr372150 2137 2118 1676 1569 155 141 --11563 --
NM_003236chr223288 2319 13317 --22405 2153
NM_003242chr362459 2346 1670 1531 781 192 ------
NM_003253chr2151895 1861 1652 1419 244 11633 ----
NM_003257chr1521052 997 190 ----
NM_003262chr3175010 5004 4586 4324 4232 4151 4052 3776 3282 1727 1539 1449 1339 1006 489 418 99 21198 837 ----
NM_003270chrX2953 37 11102 --1382
NM_003272chr13247 178 75 1578 ----
NM_003275chr961184 459 199 138 122 27 ------
NM_003286chr2051144 964 956 821 796 11058 ----
NM_003291chr133697 314 80 ------
NM_003292chr191873 1603 1443 594 532 318 183 118 51 1219 ----
NM_003298chr3105918 5851 5610 4726 4150 3817 2453 1304 800 239 --35364 4255 2132 --
NM_003304chr351510 1413 616 425 124 ------
NM_003305chr43126 111 96 ------
NM_003309chr641882 1272 365 292 ----1135
NM_003314chr52153 90 ------
NM_003320chr1174479 4456 4101 4080 1164 162 115 34432 1743 1104 121 --
NM_003336chrX51068 1008 825 769 304 1832 --1993
NM_003337chr541742 1614 1369 1218 1342 ----
NM_003338chr1061964 1455 1393 782 721 600 ------
NM_003340chr4--1187 --1204
NM_003341chr31199 1438 ----
NM_003342chr17143317 3172 3050 2978 2701 2417 2195 2172 1231 1144 569 563 433 381 ------
NM_003344chr721622 357 21487 1160 11746 1157
NM_003348chr1251381 1352 1275 660 258 1460 1131 --
NM_003349chr2021094 527 ------
NM_003359chr441222 1029 958 278 ------
NM_003360chr4------1236
NM_003362chr128915 842 809 707 291 276 192 24 ------
NM_003368chr1180 1175 ----
NM_003369chr1152665 2523 408 135 74 12596 22402 277 1559
NM_003373chr1041664 1583 1557 696 ------
NM_003374chr53745 235 74 1768 ----
NM_003379chr63915 757 73 ----1117
NM_003387chr262737 2702 2190 2028 1144 489 12277 ----
NM_003392chr3124107 3894 3587 3514 3340 3187 3142 2979 2880 2861 1726 1191 22809 83 22780 1108 --
NM_003403chr144807 696 300 79 ------
NM_003406chr881724 1682 1597 1490 1446 793 672 516 ----21875 544
NM_003409chr1871454 1320 1310 1040 963 328 320 ------
NM_003410chrX82647 2406 2199 2116 1187 1117 1106 235 1635 --1672
NM_003411chrY71831 1752 1590 1541 1495 186 142 ----1635
NM_003412chr383007 2285 2274 2100 1249 957 695 177 ------
NM_003413chrX41902 1715 730 231 ------
NM_003430chr1961614 1120 1030 400 250 232 ------
NM_003439chr783580 3363 2614 2279 803 416 302 159 --12636 --
NM_003442chr111257 ------
NM_003452chr931006 227 59 --1652 --
NM_003453chr133526 188 64 ------
NM_003457chr17--1249 ----
NM_003462chr151789 1187 652 500 90 2605 493 1389 --
NM_003463chr673036 2568 835 804 788 678 383 ------
NM_003468chr292921 1354 1090 821 528 419 309 303 226 11258 ----
NM_003473chr1041089 1072 823 755 1172 ----
NM_003478chr1183170 2861 2358 2261 1278 663 642 260 ------
NM_003483chr1242818 2787 2488 275 12378 12156 12391
NM_003488chr17--1955 ----
NM_003489chr21123164 2951 2843 2833 2113 782 752 687 628 422 343 275 32536 1240 851 13432 --
NM_003495chr6145 ------
NM_003503chr161320 497 311 261 233 120 ----1386
NM_003506chr851145 536 496 487 479 ------
NM_003507chr241883 1642 1631 1458 11990 ----
NM_003517chr1--139 ----
NM_003522chr6138 ------
NM_003548chr1147 ------
NM_003559chr1773088 2992 2525 1077 302 164 125 --21312 932 1891
NM_003563chr1741378 490 144 99 --1228 --
NM_003566chr1272875 2792 2713 2544 2278 1263 976 1279 ----
NM_003567chr13396 310 57 --1118 123
NM_003574chr18215332 5139 5096 5053 4520 3942 3639 2322 2251 1928 1560 1426 1149 1143 1127 963 485 479 349 251 140 21905 1397 ----
NM_003576chr1352852 2467 2051 574 293 11123 --12202
NM_003580chr8165 ------
NM_003581chr25976 960 784 301 119 1206 ----
NM_003583chr1293346 3283 3211 2866 2670 1441 1121 1073 811 --1637 --
NM_003586chr162461 412 ------
NM_003589chr1331287 394 294 --1213 --
NM_003590chr2143980 3896 3691 2581 1602 1550 719 596 474 264 219 151 142 65 13845 --11532
NM_003592chr71112 ------
NM_003597chr222200 1449 1379 1488 1542
NM_003607chr184178 4073 3150 2739 1615 1567 1079 736 --13629 --
NM_003613chr155650 475 214 199 135 ------
NM_003615chr3123829 2742 1598 1519 1331 1321 983 849 790 756 590 365 23374 2492 11342 --
NM_003618chr251207 1166 511 389 304 ------
NM_003622chr1282421 2095 1995 976 775 664 542 425 ------
NM_003626chr1151242 1125 478 311 94 21074 191 ----
NM_003629chr193213 3154 2233 2127 1401 1110 944 770 424 ----1992
NM_003630chr61777 1178 ----
NM_003633chr532388 1702 960 21774 1670 ----
NM_003637chr13957 352 292 ----1607
NM_003644chr17115946 5814 4395 2545 2150 1864 1498 1186 573 502 486 21842 386 1934 25763 4083
NM_003663chr383186 2256 1370 1092 851 701 254 183 22346 437 --13433
NM_003670chr331206 928 486 ------
NM_003671chr953316 3080 3057 2500 1417 32825 914 679 11031 12943
NM_003672chr131671 468 228 1537 ----
NM_003677chr1231612 610 71 ------
NM_003679chr182987 2719 2479 2406 1206 1192 1053 325 12310 ----
NM_003692chr92246 107 ------
NM_003716chr33740 233 136 ------
NM_003722chr342472 768 600 298 1571 ----
NM_003725chr122421 310 ------
NM_003743chr241910 1462 874 795 --11764 --
NM_003749chr134880 814 784 328 21616 1535 ----
NM_003750chr1041004 660 311 99 ------
NM_003758chr1531499 1264 29 ------
NM_003758chr1531499 1264 29 ------
NM_003759chr4124278 4243 4058 3965 3329 1111 774 509 479 429 377 224 24069 516 --13903
NM_003760chr11329 1712 ----
NM_003762chr131449 1236 192 ------
NM_003763chr2092739 2559 2375 1960 524 411 360 224 131 1284 ----
NM_003766chr172385 39 ------
NM_003769chr12234 26 ------
NM_003774chr12122996 2895 2864 2836 2577 2553 2514 2123 1293 1151 838 456 2548 476 22624 2061 --
NM_003783chr131212 472 91 1366 ----
NM_003787chr1881633 1282 1240 611 539 234 205 104 ------
NM_003795chr62536 175 --173 --
NM_003796chr194529 244 131 116 1580 ----
NM_003797chr111193 ------
NM_003799chr1874047 2828 2801 1215 546 229 214 11031 11561 --
NM_003800chr662021 1981 1911 1749 765 425 22254 391 ----
NM_003825chr152541 21 11302 ----
NM_003831chr1871728 1590 1337 1315 505 228 163 ------
NM_003850chr13190 ------
NM_003860chr11--1352 ----
NM_003861chr1462509 2311 2058 1987 1805 618 11855 1372 12525
NM_003870chr15102098 1998 1892 1775 1505 1390 1376 556 485 326 ------
NM_003872chr2112967 2796 2634 2165 1879 1149 667 633 485 348 273 --22681 1199 179
NM_003873chr1042273 1776 827 319 22227 1827 --1389
NM_003877chr123786 698 189 1838 --1243
NM_003884chr351670 629 592 498 411 --1152 --
NM_003885chr1772488 2174 2161 2154 618 599 240 ----12119
NM_003887chr282345 2201 771 751 490 472 393 375 ------
NM_003888chr1531716 643 549 ----11676
NM_003895chr2142231 1895 1407 1354 2265 220 ----
NM_003901chr1022670 2626 21006 339 ----
NM_003902chr14672 319 218 54 ------
NM_003913chr694308 3949 3263 2851 2723 1134 1106 1099 497 --12906 23214 156
NM_003916chrX21510 168 ------
NM_003922chr152287 74 ------
NM_003930chr7112413 2288 2139 2131 2034 2006 1891 1872 1850 1780 1626 2395 48 ----
NM_003934chr92907 823 ------
NM_003936chr211002 ------
NM_003941chr772342 1980 909 733 543 451 442 ------
NM_003948chr432584 2426 1080 22211 1765 ----
NM_003953chr142064 1108 513 385 --1476 11988
NM_003957chr111830 ------
NM_003958chr683742 3189 2993 2783 888 850 839 496 ------
NM_003968chr3181 ----1256
NM_003971chr17170 ------
NM_003972chr105896 372 348 311 88 ------
NM_003980chr651325 1238 913 389 282 11142 ----
NM_003983chr1634401 867 749 13250 1616 13517
NM_003993chr1132 ------
NM_003994chr12123797 3428 3372 3098 2834 2782 1635 1588 1392 1273 1071 122 23578 2824 12969 --
NM_003998chr42679 181 1619 ----
NM_004006chrX62418 2162 2139 2029 1947 344 ----12308
NM_004007chrX62418 2162 2139 2029 1947 344 ----12308
NM_004009chrX62418 2162 2139 2029 1947 344 ----12308
NM_004010chrX62418 2162 2139 2029 1947 344 ----12308
NM_004011chrX62418 2162 2139 2029 1947 344 ----12308
NM_004012chrX62418 2162 2139 2029 1947 344 ----12308
NM_004013chrX62418 2162 2139 2029 1947 344 ----12308
NM_004014chrX62418 2162 2139 2029 1947 344 ----12308
NM_004015chrX62418 2162 2139 2029 1947 344 ----12308
NM_004016chrX62332 2076 2053 1943 1861 258 ----12222
NM_004017chrX62418 2162 2139 2029 1947 344 ----12308
NM_004018chrX62332 2076 2053 1943 1861 258 ----12222
NM_004020chrX62418 2162 2139 2029 1947 344 ----12308
NM_004021chrX62332 2076 2053 1943 1861 258 ----12222
NM_004022chrX62332 2076 2053 1943 1861 258 ----12222
NM_004023chrX62332 2076 2053 1943 1861 258 ----12222
NM_004028chr1893910 3335 2553 1556 1108 941 880 871 479 13093 ----
NM_004034chr102546 446 ------
NM_004039chr151140 1296 ----
NM_004047chr1135 ------
NM_004056chr84924 896 876 821 1429 ----
NM_004060chr531305 1209 474 1298 ----
NM_004067chr741258 460 302 274 21298 631 ----
NM_004075chr121391 2536 452 ----
NM_004080chr731209 488 301 --11325 1447
NM_004081chrY51610 1602 1510 1193 703 21519 59 ----
NM_004087chr331352 765 48 11557 1595 --
NM_004090chr1763458 3327 2513 2502 2496 1176 2814 699 ----
NM_004093chr1353184 2987 2646 2040 833 32723 2669 1105 22429 675 --
NM_004094chr14103070 2488 1060 966 891 668 497 491 485 247 22866 571 ----
NM_004096chr1051362 704 676 553 507 21937 1393 ----
NM_004100chr6122213 2193 2030 1961 1859 1836 960 743 696 406 290 172 ------
NM_004103chr82830 724 ------
NM_004117chr672223 1733 1667 1611 1560 383 355 --22127 841 --
NM_004124chr1482902 2792 2283 1058 833 799 691 523 ------
NM_004133chr882520 2319 2291 2159 1090 994 950 666 1546 ----
NM_004171chr11219597 8507 8343 8300 7219 6982 6363 3857 3194 3122 2894 2414 2319 2251 2119 1855 1726 1711 1042 568 80 38577 7645 1953 29525 6534 --
NM_004187chrX----11492 --
NM_004193chr101408 ------
NM_004202chrY2569 67 ----1621
NM_004203chr16235 27 ------
NM_004225chr861377 1210 610 603 577 457 ------
NM_004229chrX92221 1843 1828 1693 1646 1617 1606 671 599 ------
NM_004232chr18123477 2821 2622 1517 1461 1361 1142 913 583 303 190 31 1216 ----
NM_004234chr193713 174 90 1150 ----
NM_004237chr52940 828 1912 ----
NM_004241chr102648 25 ------
NM_004242chr6295 52 ------
NM_004253chr93928 368 326 ------
NM_004261chr12841 105 ------
NM_004272chr541742 1282 1264 549 1173 11246 --
NM_004274chr1472975 2538 2297 2044 1040 348 219 ------
NM_004279chr742386 2334 1866 356 ------
NM_004282chr6--1208 ----
NM_004293chr951438 1303 1151 1063 628 33708 3377 565 --1227
NM_004296chr1443973 1411 1099 1028 --13434 1786
NM_004311chr1072986 2979 2782 2140 1981 1946 284 31047 984 614 ----
NM_004319chr173020 2968 2481 2468 2407 903 250 1238 --1853
NM_004326chr171040 805 497 458 451 439 131 --1851 1345
NM_004329chr1061033 971 955 440 405 199 ------
NM_004331chr882625 1832 1650 992 963 891 867 626 3920 588 215 ----
NM_004338chr18166981 6928 6244 5927 5636 5379 4920 4547 4523 4499 2692 2636 2026 1655 554 466 11272 26309 151 --
NM_004342chr7102142 2056 2027 1740 1448 645 620 515 203 114 1676 ----
NM_004346chr42455 29 2498 462 ----
NM_004349chr831238 1195 422 1234 ----
NM_004365chr53297 219 98 ------
NM_004370chr632129 1880 1559 11966 11628 --
NM_004380chr1632336 2027 202 32414 1895 665 ----
NM_004384chr542132 1886 1440 194 ------
NM_004385chr53462 440 244 ------
NM_004392chr1392264 2142 2112 2100 1910 1745 1033 130 93 1886 11636 --
NM_004396chr172184 47 ------
NM_004397chr11103778 3667 3611 3570 3227 1513 1161 843 557 96 13432 23463 2927 21269 496
NM_004403chr71172 --1155 --
NM_004414chr2131521 543 54 11341 ----
NM_004415chr63655 599 309 ----1688
NM_004432chr941671 766 276 193 ------
NM_004433chr141672 1317 688 258 11324 --1725
NM_004434chr1431895 1775 332 11849 ----
NM_004438chr253254 3217 2724 795 677 --1472 --
NM_004440chr661569 1339 1227 784 523 486 2477 457 ----
NM_004454chr362151 1934 701 695 380 109 --1888 --
NM_004458chrX51749 1702 1642 1071 74 --1223 11945
NM_004459chr1731792 1517 84 ------
NM_004463chrX1180 ------
NM_004464chr4123846 3607 3555 3238 3215 2951 2847 1454 1191 560 468 318 --1739 --
NM_004480chr144822 675 533 182 ------
NM_004482chr23710 620 141 ------
NM_004498chr151335 ------
NM_004499chr51364 ------
NM_004500chr1461324 1262 253 236 188 42 --11753 --
NM_004501chr1123950 3707 3383 2676 1644 1634 1339 1276 1165 1106 331 68 22524 126 --11421
NM_004502chr172559 376 ------
NM_004503chr121616 ------
NM_004504chr282998 2915 2535 663 540 388 116 34 12051 --11929
NM_004514chr1762818 2662 2443 956 441 22 --12564 --
NM_004516chr1971267 789 452 422 380 316 191 11185 ----
NM_004521chr102304 120 ------
NM_004523chr103966 547 147 ----11099
NM_004529chr951151 1122 1060 574 167 ------
NM_004537chr1271450 1363 1234 1213 397 367 165 21070 283 ----
NM_004539chr183676 388 52 1344 ----
NM_004571chr2163416 3090 2752 2728 2253 231 ------
NM_004586chrX95445 5140 4870 4726 3670 1244 1114 950 502 ------
NM_004593chr34897 617 124 115 ----1783
NM_004598chr563280 2928 2772 2491 2122 1170 12088 1593 --
NM_004600chr141476 970 957 473 --21427 1084 --
NM_004612chr9134432 4104 4075 3450 1614 1594 1487 1341 1092 957 329 299 244 44451 3499 1849 163 14623 --
NM_004621chr1141255 1201 801 96 1482 --1460
NM_004622chr262366 2166 1725 1716 1667 182 22197 1554 ----
NM_004650chrX71916 1723 1429 679 465 279 252 276 37 11493 --
NM_004654chrY21087 26 11209 ----
NM_004657chr241464 1024 427 197 --11391 --
NM_004660chrY31885 656 246 32296 1697 323 1726 --
NM_004663chr1541563 1478 1012 145 --11090 --
NM_004670chr1041550 1501 1353 110 ------
NM_004680chrY1306 --157 --
NM_004685chr1372875 2753 2719 2461 811 509 103 --1440 --
NM_004686chr82525 496 --1381 --
NM_004687chr17129 ----1504
NM_004690chr61156 ------
NM_004703chr1772470 2351 2212 1567 807 531 34 3712 556 54 ----
NM_004708chr19196 ------
NM_004709chrX31708 1697 26 ------
NM_004715chr182694 620 ------
NM_004718chr24655 648 535 45 1602 ----
NM_004722chr71212 ------
NM_004726chrX165379 5306 4373 4333 4006 3840 3798 3766 3727 3559 2006 1770 1445 997 819 652 15734 14795 11472
NM_004727chr1531819 1683 1455 11736 ----
NM_004730chr592113 1988 1740 1469 1449 1440 740 272 182 1238 ----
NM_004731chr1231532 382 91 ----11292
NM_004734chr1362960 2769 268 145 120 106 --22693 1256 1490
NM_004736chr152032 1864 1717 1422 30 1846 ----
NM_004738chr2032339 239 123 22333 609 --1190
NM_004742chr371624 1377 700 657 382 304 172 1670 ----
NM_004744chr473662 3531 3518 1265 992 711 452 11441 ----
NM_004745chr876634 6505 4954 4817 4324 862 506 25131 2075 ----
NM_004748chr15154181 4101 3872 2986 2936 1364 1305 1247 868 683 615 557 311 303 236 11128 ----
NM_004755chr1451141 212 78 70 38 11055 ----
NM_004757chr42278 245 ------
NM_004759chr132171 1623 55 ------
NM_004760chr752010 1555 457 313 247 1435 11980 --
NM_004762chr1711614 --11492 11864
NM_004768chr14964 930 322 53 ----1172
NM_004772chr541581 1572 1536 1265 1132 ----
NM_004774chr1783078 2593 812 608 579 507 379 356 ----1770
NM_004776chr2093276 2711 2392 2324 830 777 529 498 444 12640 ----
NM_004779chr531084 974 365 21166 171 ----
NM_004783chr162668 520 ------
NM_004788chr1152540 2266 1980 536 392 ------
NM_004789chr93111 51 33 1341 ----
NM_004796chr1431978 1521 347 22099 66 ----
NM_004798chr2073538 2872 1256 717 683 361 204 21442 431 1600 13549
NM_004801chr251421 1096 973 482 259 ------
NM_004808chr1083312 3267 2942 2493 2298 2088 752 640 ------
NM_004815chr164337 4156 1485 1094 795 213 1711 ----
NM_004824chr641332 1074 944 305 ------
NM_004831chr192445 394 ----1929
NM_004834chr252874 2680 2202 2158 1077 1660 12848 --
NM_004836chr21612 ------
NM_004840chrX52433 2086 1907 398 89 --2867 774 --
NM_004841chr131138 1131 63 1808 --1749
NM_004842chr641716 1312 512 275 ------
NM_004845chrX63739 3324 2819 1442 591 316 ------
NM_004849chr641714 1537 1041 382 11256 1286 --
NM_004850chr261546 1461 1447 1223 421 184 ------
NM_004856chr151531 1466 ----
NM_004857chr14114137 4010 3745 3396 3265 3236 1657 1201 671 282 53 13983 ----
NM_004859chr1752475 2222 265 108 53 32640 804 194 23039 2158 --
NM_004863chr14155068 5062 4694 3725 3519 3327 1843 1552 1140 654 551 531 208 192 59 --13513 --
NM_004865chr63362 110 43 ----1149
NM_004866chr5134890 4766 4134 4055 3872 3816 3169 1652 1345 1269 870 711 472 2558 359 11012 13596
NM_004869chr18101698 1412 1258 1151 1126 643 603 587 456 98 11324 11589 --
NM_004871chr1764401 4308 4027 3928 3439 1745 --1393 --
NM_004872chr12424 64 ------
NM_004883chr52155 45 ------
NM_004898chr442591 930 761 236 --21162 349 --
NM_004902chr202226 69 ------
NM_004904chr7156053 4964 4956 4763 4753 4701 4685 4654 2583 1926 1507 319 223 157 61 22257 75 31256 685 356 15871
NM_004905chr16933 912 861 641 170 110 ------
NM_004915chr211569 ------
NM_004926chr1441615 1498 1465 1261 11451 ----
NM_004929chr821151 87 21237 402 11493 --
NM_004932chr551705 715 201 168 60 ------
NM_004936chr951133 941 733 714 559 ----11189
NM_004938chr94463 378 234 228 ----177
NM_004946chr51379 1405 ----
NM_004948chr1841049 483 425 220 ------
NM_004956chr774351 3811 3440 1271 1055 975 767 11021 24240 3257 23551 819
NM_004964chr1--1410 ----
NM_004965chr21198 1713 ----
NM_004966chr103951 694 294 ------
NM_004969chr101514 ------
NM_004972chr931168 868 826 11083 ----
NM_004973chr62480 147 2418 129 ----
NM_004985chr12124441 4424 4206 3999 3726 3556 3275 1790 1227 1020 130 85 33819 3742 3111 22889 1545 --
NM_004987chr21328 ------
NM_004992chrX87497 7243 6996 5437 5408 5198 2303 1372 28304 509 25420 958 --
NM_004992chrX87497 7243 6996 5437 5408 5198 2303 1372 28304 509 25420 958 --
NM_004993chr1441332 1247 1019 76 --21062 112 --
NM_004999chr6164358 4304 3867 3667 3406 3100 3055 2985 1732 1614 1269 958 793 538 276 35 33443 1255 1200 14189 11759
NM_005010chr71711 ------
NM_005028chr1072356 2314 2081 1864 1633 1553 334 11755 --12062
NM_005037chr31173 ------
NM_005045chr7160 ------
NM_005054chr241412 1342 1165 464 21607 1093 ----
NM_005056chr12135615 5024 4973 4747 4118 2054 1984 1931 1677 1351 1017 483 453 14187 ----
NM_005057chr131651 1333 1182 11779 ----
NM_005063chr1053004 2908 829 173 135 13505 ----
NM_005065chr14135276 5163 4885 4328 4268 3312 1833 1757 1578 981 469 368 160 1693 12004 11906
NM_005066chr16828 718 696 210 78 62 ------
NM_005080chr224775 727 630 616 --1784 --
NM_005087chr34654 336 96 32 ------
NM_005095chr161921 1473 878 393 374 202 1362 12204 --
NM_005099chr131094 949 326 ------
NM_005105chr112046 1774 32158 1916 1669 --
NM_005109chr352139 1789 512 420 132 2724 124 --11003
NM_005116chr2044438 4338 1597 217 23929 3869 13157 1274
NM_005121chr1783512 3270 3066 1485 1009 820 496 196 ----1602
NM_005126chr372119 2073 2056 2041 1889 370 102 ------
NM_005132chr141154 ------
NM_005134chr182991 810 ------
NM_005135chr1583168 3018 2991 1395 1079 1026 515 502 12953 ----
NM_005151chr182600 427 62188 957 722 661 191 77 ----
NM_005153chr162111 77 2230 90 ----
NM_005154chr154603 578 230 32 ------
NM_005155chr65678 668 143 126 79 ------
NM_005156chr9165384 4773 4585 4245 3913 3799 3477 3408 3372 1730 1691 1307 640 623 371 319 ----1963
NM_005160chr22106235 5563 5450 5100 2131 1365 1297 1285 733 228 26774 2706 16060 12066
NM_005164chr1252661 2565 1987 643 129 ------
NM_005168chr231582 624 404 11111 --11304
NM_005171chr1231050 1008 386 ------
NM_005180chr1041552 1522 1344 1192 ------
NM_005181chr82692 559 ------
NM_005188chr11217888 7860 7820 7227 7153 7131 6188 5951 5462 5440 5026 2685 2652 2466 2167 1557 1342 1236 1229 910 715 55910 2205 1772 1714 593 42985 1071 551 88 --
NM_005191chr351491 1232 560 367 113 1257 --11214
NM_005197chr14125162 4950 4920 4809 4383 3859 2337 2179 2161 1263 725 143 15517 14730 --
NM_005204chr102792 727 ------
NM_005207chr22113677 3304 3169 3059 2355 1252 1163 1152 1012 749 56 2425 214 ----
NM_005214chr24827 819 420 121 ------
NM_005222chr72928 847 ------
NM_005228chr751617 1483 1092 248 192 11353 ----
NM_005229chrX1405 --1316 --
NM_005230chr121429 --1244 --
NM_005233chr342025 514 435 164 --11008 --
NM_005235chr2187601 7562 7316 7295 6607 6419 6345 6292 6150 6133 5856 2763 2164 1959 1305 870 809 679 --15121 15454
NM_005238chr1183486 2841 2825 2662 1400 1168 867 419 32970 1376 1322 ----
NM_005239chr2142032 1912 1544 218 1351 ----
NM_005249chr141700 ------
NM_005254chr151310 2510 173 ----
NM_005256chr112814 228 ----1615
NM_005257chr1831308 930 121 ------
NM_005259chr231386 1007 346 ------
NM_005264chr104815 768 225 148 --1172 --
NM_005277chr461797 1694 1609 761 393 75 ------
NM_005302chr71306 ------
NM_005308chr102529 456 ------
NM_005312chr932686 1805 284 --12408 --
NM_005326chr16----145 --
NM_005328chr81713 ----1790
NM_005329chr1652213 1538 645 535 103 ------
NM_005339chr4163985 3901 3518 3429 3120 2623 1705 1431 1336 1123 965 907 720 283 91 69 12909 ----
NM_005358chr1341676 1212 1172 584 1136 ----
NM_005359chr18176462 6424 5912 5437 4874 4816 4439 4265 4227 4099 2256 1970 1822 1735 1168 321 301 22467 2011 45216 5037 4354 1649 --
NM_005369chrX1175 ------
NM_005376chr13983 316 93 --1971 --
NM_005385chr342186 777 750 361 ------
NM_005392chr941672 1276 1216 1194 ------
NM_005399chr1114269 4048 3275 2999 2926 2686 1733 1701 818 709 581 23561 1616 --13645
NM_005400chr272922 2195 2171 1936 603 597 328 12277 ----
NM_005433chr1832810 2692 93 1824 ----
NM_005436chr10144088 3686 3477 3458 3329 3095 2998 2871 2790 2747 2603 1435 1242 475 13838 1333 13139
NM_005440chr1742831 975 602 563 22859 794 22335 706 --
NM_005445chr101127 ------
NM_005455chr151686 1568 1187 659 464 ------
NM_005458chr922288 2135 --11834 --
NM_005465chr121785 1405 --21669 348 1291
NM_005475chr1282881 2777 2499 2024 1133 1068 593 517 12836 ----
NM_005476chr951188 435 226 118 65 ----1879
NM_005487chr2261912 1529 752 528 339 182 12010 ----
NM_005493chr63716 270 199 ------
NM_005497chr17175943 5505 5163 4261 3927 3918 1990 1982 1956 1553 1275 1262 712 610 562 380 328 1465 11939 --
NM_005504chr12186574 6371 6313 5916 4715 4377 4275 2041 1914 1836 1579 859 805 473 432 328 279 93 15534 21904 1821 --
NM_005509chr531468 1168 402 ------
NM_005520chr53773 488 180 --1729 --
NM_005522chr751284 1007 544 355 316 --1257 --
NM_005537chr132883 67 1216 ----
NM_005539chr1021003 876 11193 --11403
NM_005542chr731948 1671 1338 11550 ----
NM_005562chr11682 ------
NM_005563chr12720 159 1102 ----
NM_005570chr182956 826 1432 11044 --
NM_005573chr53749 102 46 ------
NM_005575chr55838 811 715 552 180 1120 ----
NM_005578chr3164987 4969 4898 4512 4474 4396 4043 3666 1922 1909 1474 1297 1285 1246 285 213 --1395 --
NM_005584chr132584 114 ------
NM_005587chr154966 799 633 122 1937 ----
NM_005593chr123528 441 202 --1450 --
NM_005596chr996264 5500 5047 5027 4580 4234 1678 1596 355 25954 1664 56139 5877 4368 1882 630 --
NM_005599chr131439 1190 414 11398 ----
NM_005602chr32892 310 ------
NM_005603chr1861516 1497 543 244 187 128 11958 ----
NM_005604chr661851 1842 727 224 189 104 --12052 --
NM_005607chr81277 --1978 --
NM_005610chr11820 128 ----
NM_005611chr1621101 53 --1925 1277
NM_005627chr6154 1686 ----
NM_005637chr1851413 797 631 178 154 --11795 --
NM_005638chrX41696 1521 435 250 ------
NM_005639chr1231278 216 45 ------
NM_005650chr2231159 537 361 ------
NM_005654chr5----1202 --
NM_005655chr861095 920 490 243 235 35 ------
NM_005665chr1144931 4635 4470 4383 4149 3361 3339 3050 1270 1195 971 892 673 186 23992 3291 13622 13962
NM_005668chr564373 3309 2838 2805 1123 835 24146 1720 --11336
NM_005669chr53605 375 160 ----11713
NM_005685chr7----195 --
NM_005708chr13135 ------
NM_005711chr52882 375 ------
NM_005715chr652637 2576 2326 2035 204 ------
NM_005717chr131006 299 166 1853 ----
NM_005721chr261034 945 881 831 822 247 1202 ----
NM_005722chr282392 2365 973 389 351 328 110 50 22309 1754 31884 853 446 --
NM_005725chr152392 2253 1816 862 741 1577 11781 --
NM_005731chr2174 ------
NM_005738chr761974 1680 1429 1289 608 364 1696 ----
NM_005739chr1542212 2168 1808 1574 1606 ----
NM_005746chr741819 289 225 216 1814 11857 --
NM_005748chr1273481 3204 2711 2428 2399 2156 548 1849 22592 281 23450 3009
NM_005752chr1651217 882 822 801 168 21096 927 ----
NM_005754chr541191 981 239 223 --2188 72 --
NM_005756chrX61556 1078 486 391 307 63 1189 21354 1001 --
NM_005759chr2104314 4291 3999 3681 3675 3639 3617 3552 3521 3142 23324 971 24608 3577 11791
NM_005765chrX1129 --168 --
NM_005779chr553208 2654 2344 943 92 1640 ----
NM_005780chr132759 369 ----1747
NM_005782chr171109 ------
NM_005786chr1861101 994 815 396 212 94 ------
NM_005789chr1752046 1615 1457 405 124 ------
NM_005792chr162211 179 1130 ----
NM_005795chr263016 2736 2505 2240 2090 461 12358 1446 --
NM_005797chr1161566 1527 1452 1306 1252 80 --21805 387 --
NM_005798chr13135160 5081 4961 4909 4193 4084 3984 3678 3647 1635 933 897 541 35206 4488 4314 14592 --
NM_005801chr171127 ------
NM_005802chr93661 530 207 1287 ----
NM_005808chr373230 3001 2667 1350 730 474 189 --1467 --
NM_005813chr292310 1702 1694 927 894 593 503 315 228 11984 ----
NM_005819chr142824 2604 926 360 12511 33005 2817 2633 --
NM_005822chr662283 1698 1647 858 83 39 ------
NM_005826chr13264 243 95 ------
NM_005828chr1794835 4546 3971 3417 3374 1818 1798 1770 1605 11071 34703 4400 254 --
NM_005840chrX147141 7065 6890 6844 6235 5814 5202 5072 4646 2040 556 487 234 212 26639 73 47077 5154 4893 1503 1387
NM_005842chr133695 580 513 1485 --1539
NM_005851chr111381 ------
NM_005857chr131455 1405 1391 191 11254 --
NM_005859chr551510 1490 1476 515 471 1493 ----
NM_005862chr32968 814 ------
NM_005863chr1021245 922 ------
NM_005868chr751007 996 581 477 199 ------
NM_005870chr132900 94 --21324 1106 --
NM_005871chr1021083 1046 ------
NM_005872chr13523 222 60 ------
NM_005876chr21732 ------
NM_005880chr161130 11274 ----
NM_005888chr12171 ------
NM_005895chr1263755 2735 1370 859 725 118 13037 21219 461 --
NM_005898chr1173037 2896 2766 2720 2459 2293 346 11055 ----
NM_005899chr175975 334 310 254 49 1197 ----
NM_005900chr421169 340 1781 1256 --
NM_005901chr18238515 8014 7122 6933 6897 6710 6250 6220 5941 5570 3472 3165 2886 2313 2235 1831 1794 1583 1330 870 556 417 363 16075 27420 7209 27084 5903
NM_005902chr1584517 4460 3315 2881 1234 1012 986 685 14502 1216 --
NM_005903chr5135231 4602 4283 3706 3655 2088 1334 884 873 856 843 420 278 64221 3963 3691 1763 1702 53 14775 --
NM_005907chr6101648 1629 1598 1589 1251 1115 682 442 188 137 ------
NM_005909chr584229 3730 3723 3596 3337 1295 1187 543 ------
NM_005911chr241201 1161 296 150 ------
NM_005922chr62506 405 ------
NM_005927chr541073 1034 479 428 ----1841
NM_005930chr144822 692 587 305 2809 193 ----
NM_005935chr4135267 4924 4564 4241 4007 3742 3713 3558 3480 3218 1783 1535 939 45160 4822 3828 3363 --11471
NM_005937chr1774163 3848 3652 3013 937 692 423 --21348 1179 --
NM_005941chr894117 3686 2988 1689 1678 1326 1016 792 222 1567 12807 --
NM_005955chr1105250 4718 4578 4347 4065 3603 3588 2019 1026 140 24404 183 34621 1710 1318 --
NM_005962chr1041777 1683 535 98 ----11868
NM_005962chr1041777 1683 535 98 ----11868
NM_005966chr232025 1632 605 ------
NM_005977chr133976 347 33 1832 ----
NM_005986chr1322476 2049 22418 223 12065 --
NM_005987chr11308 ------
NM_005999chr161233 580 405 347 250 98 --21281 1084 --
NM_006003chr19139 --1243 --
NM_006007chr9103824 3535 3070 2749 1594 1329 666 455 365 144 23082 477 11700 --
NM_006009chr12130 ------
NM_006011chr1584213 3930 3848 1167 848 717 360 278 21333 325 14007 --
NM_006015chr131299 929 74 --1829 --
NM_006016chr652077 1788 1448 110 72 1776 ----
NM_006020chr1431018 519 298 ----1559
NM_006024chr74566 246 174 111 1613 ----
NM_006036chr292530 2189 2161 1627 1580 928 891 541 100 ----1359
NM_006037chr2104099 4007 3738 3575 3527 3396 3186 3129 1119 584 --24232 3113 --
NM_006038chr2031476 856 322 ------
NM_006047chr2093209 3143 2858 1217 950 852 751 520 474 13428 ----
NM_006055chr2132987 2901 2808 2778 2691 2437 2352 989 941 784 412 202 175 12915 12960 --
NM_006079chr61775 ------
NM_006080chr762907 2301 2031 1870 933 238 1777 12990 --
NM_006089chrX6578 358 341 273 223 187 21736 1717 ----
NM_006090chr14767 520 127 120 ------
NM_006094chr832378 1970 282 1744 ----
NM_006095chr453303 3009 1528 1488 1466 --1709 --
NM_006100chr3162 ------
NM_006106chr11113307 2940 2797 2772 2508 2403 2314 988 923 603 423 33369 2143 1346 ----
NM_006107chr171509 ----1436
NM_006108chr1172272 1663 1537 1487 920 473 423 1849 ----
NM_006113chr151851 1550 677 550 310 11585 ----
NM_006122chr1542425 1891 793 265 12791 1971 11824
NM_006136chr721258 30 21243 925 ----
NM_006139chr272296 2223 2202 2132 863 590 374 11784 1562 --
NM_006141chr1672410 2374 2154 2063 1951 622 198 --12260 --
NM_006147chr12312 83 1387 ----
NM_006154chr1572670 1109 1007 914 900 799 176 3575 266 220 ----
NM_006157chr111381 ------
NM_006158chr861752 1525 1403 1156 359 175 11455 ----
NM_006166chr1242071 679 436 391 ------
NM_006167chr851985 1974 1585 954 619 ------
NM_006178chr1731417 1040 1005 ------
NM_006180chr951928 1835 627 443 69 ------
NM_006195chr921056 1023 ------
NM_006197chr842242 1975 1758 372 ----1504
NM_006202chr1921547 699 1272 ----
NM_006203chr5135385 4612 4321 3555 3452 2230 1963 1706 1654 1438 981 876 598 44430 4119 1866 1100 14485 --
NM_006206chr442941 1135 826 557 32789 2016 410 ----
NM_006216chr22435 250 ------
NM_006224chr1762420 2387 2124 1947 1649 317 --21919 876 11587
NM_006226chr231261 447 72 --1181 --
NM_006237chr1352137 1675 1426 730 171 31642 909 504 ----
NM_006241chr362402 2068 1507 862 789 324 22007 305 ----
NM_006246chr1441268 1107 249 110 1831 ----
NM_006251chr5102951 2445 2388 2216 1103 922 864 803 671 400 12998 12565 13135
NM_006252chr1207194 7022 7013 6758 6480 4898 2800 2233 2201 2040 1633 1573 1323 1260 1207 1112 908 745 233 54 12286 16549 --
NM_006256chr152589 2363 2126 1099 746 12231 11740 12387
NM_006265chr831147 954 82 11433 ----
NM_006267chr241845 531 407 332 11552 1663 --
NM_006275chr20102455 2421 2385 885 750 711 678 666 529 313 1409 ----
NM_006282chr20134433 3666 3348 3212 2997 1265 1006 726 550 353 234 116 43 14392 --14770
NM_006283chr8154640 4386 3560 3531 1888 1644 1616 1584 495 411 402 352 315 293 93 --24431 784 --
NM_006287chr262522 1725 726 358 300 91 ------
NM_006290chr661722 1660 741 725 683 667 1289 ----
NM_006291chr1431626 1561 1461 12007 1549 --
NM_006292chr112162 58 ------
NM_006298chr683198 2754 2691 2671 2332 929 148 106 22190 1073 12229 1243
NM_006300chr1941908 613 337 257 2620 197 1188 --
NM_006301chr121608 ------
NM_006306chrX54006 2208 1807 1364 1295 25850 408 ----
NM_006311chr172313 66 ------
NM_006313chr1291593 1275 1227 1147 608 597 298 262 130 ------
NM_006315chr493751 2766 1653 1600 1252 1005 795 407 371 --1476 11511
NM_006329chr141709 2753 514 ----
NM_006330chr861535 1407 1147 609 590 175 ------
NM_006333chr23486 254 171 1605 ----
NM_006335chr12394 24 ------
NM_006345chr41896 ------
NM_006348chr74651 326 164 149 --1705 --
NM_006352chr151950 1776 408 255 219 2187 137 --1464
NM_006357chr27479 472 443 437 122 74 65 ----1131
NM_006359chrX102437 2308 2301 2222 1579 969 469 436 223 183 --12364 --
NM_006364chr1451031 1025 381 359 247 ------
NM_006366chr691276 838 486 371 332 215 202 108 102 --1402 11159
NM_006367chr131067 902 286 ------
NM_006372chr63501 360 109 ------
NM_006375chrX71788 1221 748 537 393 246 102 --11485 --
NM_006379chr772222 2008 1891 617 419 354 250 2766 363 ----
NM_006380chr17144173 4108 4025 3976 3764 3738 3689 3054 2899 1519 1509 904 797 459 43383 2887 780 767 23207 2731 --
NM_006390chr1251590 1418 168 161 143 31572 1411 288 21145 95 --
NM_006393chr1084583 3381 2795 1308 1253 256 120 77 43724 3642 1716 365 13900 --
NM_006407chr351344 1056 560 308 272 21028 953 ----
NM_006415chr941261 1000 883 808 1817 ----
NM_006416chr6127 1218 2606 591 --
NM_006419chr44740 543 530 59 ------
NM_006420chr2053280 2617 2224 1157 697 12673 ----
NM_006421chr83871 839 46 --1168 --
NM_006427chr142161 115 ------
NM_006434chr1042876 2414 2299 69 12215 --1795
NM_006439chr42452 97 ------
NM_006449chr241727 1605 1467 812 12107 2662 25 11648
NM_006451chr55850 731 414 387 310 ------
NM_006457chr4124026 3785 3764 3515 3328 3135 2904 1176 1118 986 562 449 2307 74 13029 --
NM_006459chr1061684 1640 1618 722 546 459 ------
NM_006460chr1751797 505 351 183 133 1228 ----
NM_006464chr2104425 3302 1791 1073 984 948 510 264 237 217 13245 ----
NM_006465chr151366 ------
NM_006467chr572173 2000 1987 1908 1882 853 458 ------
NM_006469chr151627 645 517 220 211 ------
NM_006482chr1293346 3283 3211 2866 2670 1441 1121 1073 811 --1637 --
NM_006489chr1421803 41 ------
NM_006495chr173354 57 21 ------
NM_006496chr1111776 1687 1277 1271 1256 700 493 428 410 164 135 ------
NM_006504chr10132968 2937 2779 2708 2567 2477 2042 2002 1959 1814 550 524 296 --12241 --
NM_006516chr151277 1210 1080 643 562 ------
NM_006524chr771074 990 829 409 325 157 73 ------
NM_006529chr451684 1573 1498 1382 181 11371 ----
NM_006532chr1931882 1777 1542 --21468 349 --
NM_006534chr20103347 2809 2572 2562 2514 2287 982 856 511 477 ----12684
NM_006536chr15962 874 238 224 194 ----1831
NM_006538chr294179 3894 3229 2714 1546 1207 1174 984 677 1484 ----
NM_006540chr821589 1186 11058 ----
NM_006544chr14226003 5373 5359 5324 5138 4878 4817 4465 4282 4252 3920 2379 2148 1533 1336 1321 968 904 481 351 160 38 45479 2053 1640 1553 25497 3686 --
NM_006546chr17126546 6528 5818 5423 4783 4760 4058 2268 1910 1466 496 250 12517 35142 2157 1869 14649
NM_006547chr741985 1563 1391 279 --11960 --
NM_006548chr321204 588 1477 1315 --
NM_006549chr1232866 2142 145 ------
NM_006559chr12838 289 ------
NM_006561chr10136176 5524 4126 3784 2068 1650 1577 1433 1059 566 196 179 34 16257 14211 --
NM_006565chr1641202 1119 450 94 11066 ----
NM_006572chr1782943 2787 2719 2547 2224 1226 884 634 --1155 1575
NM_006574chr31137 ------
NM_006575chr143582 425 135 1314 1517 --
NM_006578chr1511267 21378 518 ----
NM_006593chr23831 677 511 ------
NM_006595chr1191811 1495 1303 1287 608 325 189 181 141 ------
NM_006599chr16188183 7918 7852 7634 7496 6472 6255 6021 5781 5314 5243 5202 5114 2452 2169 1705 939 405 36051 6035 893 25713 5157 --
NM_006601chr1221025 897 1383 ----
NM_006603chrX51984 1472 726 571 476 ------
NM_006609chr2102632 2586 2293 2286 2020 743 471 419 293 273 22450 531 12390 --
NM_006614chr332870 1370 839 23151 1395 ----
NM_006618chr191625 1598 1533 1171 1097 1081 633 510 480 ------
NM_006620chr664295 1599 939 878 587 228 31022 673 109 --1851
NM_006621chr141619 288 269 72 1186 --1800
NM_006624chr10121968 1943 1823 1375 1316 800 679 618 314 299 275 113 ------
NM_006625chr141205 1145 422 174 ------
NM_006625chr141205 1145 422 174 ------
NM_006625chr141205 1145 422 174 ------
NM_006626chr941937 944 755 603 1434 ----
NM_006628chr1583263 3030 1647 1535 1420 1319 1252 1180 --13611 --
NM_006636chr23797 683 369 ------
NM_006644chr132651 163 ------
NM_006646chr1353076 2731 2564 1951 434 42781 2311 983 486 22021 909 --
NM_006654chr12244452 4367 4288 4221 4153 3951 3869 3525 1783 1775 1763 1754 1644 1297 1223 1159 1128 860 555 463 337 139 95 32 24611 4435 ----
NM_006660chr152363 290 --1129 --
NM_006680chr111111 ------
NM_006682chr762800 2708 2324 1058 262 183 2365 67 ----
NM_006698chr2041437 958 438 181 ------
NM_006699chr152514 2497 2084 1867 1028 1293 12650 1375
NM_006704chr134414 367 292 116 1133 ----
NM_006708chr64918 320 236 21 ----11220
NM_006717chr9123410 2921 2781 2772 2722 2379 1078 1017 784 604 586 203 --12240 --
NM_006718chr62951 424 11071 ----
NM_006722chr371219 1070 937 688 527 262 98 1154 ----
NM_006724chr62506 405 ------
NM_006726chr41231 ------
NM_006727chr51357 ------
NM_006729chrX135424 5359 5348 4496 3933 3824 3438 1627 1589 1555 1066 599 227 12244 13554 --
NM_006731chr9135781 5526 4660 4346 4202 2028 1623 1264 987 458 303 280 245 --1588 --
NM_006734chr661607 991 452 284 253 222 1307 ----
NM_006745chr43944 344 135 1735 --1355
NM_006746chrX71169 590 308 251 238 228 170 31390 1371 1030 185 --
NM_006750chr16238125 8099 8090 7779 7237 7224 6889 6807 6601 6517 6484 6466 5771 5637 5401 5000 4962 2681 2402 2124 1472 1153 728 37828 5508 331 1862 --
NM_006751chr21769 ------
NM_006754chr721227 365 ------
NM_006756chr841493 1294 444 315 ------
NM_006761chr172233 103 --1225 162
NM_006763chr161942 1783 1762 745 669 519 11894 --1216
NM_006766chr8142578 2405 2344 2311 2241 2076 1651 1004 672 609 350 307 130 55 1148 --1844
NM_006774chr711280 31110 295 156 ----
NM_006775chr6133120 3026 2990 2679 2612 2541 2375 2152 1042 934 721 291 87 12355 12949 --
NM_006777chrX42319 1017 896 654 2459 150 ----
NM_006783chr131253 1460 ----
NM_006805chr541630 1576 1378 616 ------
NM_006811chr209868 848 815 715 378 305 298 277 70 ------
NM_006813chr61639 ------
NM_006814chr2032640 1781 1681 21626 451 22082 1851 --
NM_006823chr821191 450 ------
NM_006826chr241109 832 475 146 ------
NM_006827chr14103141 3109 3039 2877 2797 2789 979 760 472 387 1610 ----
NM_006828chr63214 200 183 ------
NM_006838chr1271658 1633 1399 632 199 117 30 11622 21914 1550 --
NM_006841chr31779 ------
NM_006842chr11--1113 ----
NM_006851chr1292949 2726 2212 2120 1954 961 792 292 178 32108 1012 447 22308 223 --
NM_006852chr1762856 2492 2446 876 428 120 ------
NM_006856chr1271140 1011 967 890 744 317 153 ------
NM_006857chr24782 736 689 363 1795 2809 203 --
NM_006868chr1892814 2267 1959 1081 610 492 469 414 285 2480 178 22719 222 --
NM_006870chr202799 320 ----1121
NM_006873chr243508 1198 683 110 1963 12630 --
NM_006874chr421186 977 1483 ----
NM_006885chr1664215 3950 2850 2836 658 209 1315 ----
NM_006888chr1482904 2651 2323 1399 1385 1142 351 56 22271 715 13134 --
NM_006892chr2041392 1191 1125 557 ----11083
NM_006892chr2041392 1191 1125 557 ----11083
NM_006894chr12314 259 ------
NM_006897chr12--1206 ----
NM_006914chr961370 1171 1157 618 415 184 11423 --11381
NM_006915chrX92529 2510 2344 2260 2241 2113 1887 799 113 --1851 --
NM_006916chr241108 408 191 45 ------
NM_006918chr11115721 5124 4888 3920 3551 2349 2217 2046 1368 1315 840 34156 3850 1223 15164 23945 1845
NM_006922chr242211 1801 1680 610 1821 1310 --
NM_006924chr17104061 3840 3793 3382 2840 994 975 612 433 52 32749 1081 399 23679 2872 --
NM_006930chr561474 1267 449 429 133 81 1318 1659 --
NM_006931chr1252013 1744 1681 1326 817 --11612 1870
NM_006937chr173511 151 40 ------
NM_006939chr1441152 1036 140 86 1962 ----
NM_006940chr1231634 762 546 1674 11476 --
NM_006950chrX3737 699 662 1258 --1217
NM_006963chr1031211 1046 389 2981 78 --1870
NM_006965chr183462 438 363 --1981 1876
NM_006981chr992938 2881 2582 2538 2200 1944 658 522 505 --1781 --
NM_006982chr122228 28 ------
NM_006996chr121455 1299 11322 ----
NM_007002chr20193 ------
NM_007005chr981572 1259 1226 1145 1058 964 557 261 ------
NM_007007chr1274736 4529 4301 3916 3874 541 182 23777 1753 14248 --
NM_007008chr24582 135 128 35 ------
NM_007010chr1731388 726 331 11272 ----
NM_007011chr15156762 6673 6305 5860 5090 4758 2481 2417 2349 1845 1573 1255 1221 534 281 36538 5420 4273 11936 --
NM_007019chr201128 1187 ----
NM_007027chr31441 ------
NM_007034chr11238 2793 663 --1337
NM_007040chr194977 812 691 219 ------
NM_007042chr392505 2366 2203 1669 921 699 493 471 315 11687 1150 12589
NM_007043chr1252162 1693 1330 356 145 --11672 --
NM_007054chr5103998 3783 3268 3199 2822 1204 1133 950 935 63 --23584 158 --
NM_007064chr331358 1095 668 1636 ----
NM_007073chr6104146 4035 3494 3354 3315 2969 1315 745 191 98 23703 893 183 --
NM_007076chr122125 109 ------
NM_007078chr10123061 2945 2907 2563 2198 2150 1149 848 842 831 324 139 22474 449 --1126
NM_007084chr1321455 1043 31302 1258 1004 ----
NM_007106chr1382742 2606 2551 2358 1736 1071 980 677 ------
NM_007111chr132791 265 ------
NM_007114chr3112828 2413 2249 1235 1168 1051 897 858 541 213 84 ------
NM_007121chr191356 ------
NM_007124chr641676 1444 1434 462 11497 ----
NM_007125chrY1421 --11063 11258
NM_007129chr131757 ------
NM_007137chrX145325 4869 4315 3932 3877 3842 3807 3509 1702 1544 1261 819 617 315 14684 44213 3974 3612 1485 15177
NM_007146chr1752672 2398 1865 1810 201 1866 3530 223 61 --
NM_007147chr1931055 984 173 --11080 --
NM_007150chrX31976 778 665 11989 ----
NM_007156chrX139 ------
NM_007158chr12830 250 ------
NM_007166chr1161529 1187 1106 1083 1052 374 ------
NM_007172chr2282703 2252 2165 2157 1045 995 701 156 11003 ----
NM_007173chr1162327 2067 1803 469 135 51 11718 1647 --
NM_007175chr893417 3319 3181 3050 2961 2450 278 251 44 1542 ----
NM_007178chr121470 ------
NM_007185chr161009 904 890 819 813 242 ------
NM_007187chr135962 935 862 754 300 --131 --
NM_007189chr721107 1032 ----1499
NM_007195chr18103531 3453 3329 3200 3139 2615 2438 1342 494 206 13538 ----
NM_007203chr963933 3796 3727 3127 718 29 33940 2717 908 ----
NM_007207chr11289 ------
NM_007212chr1122100 2045 1898 1779 1604 871 573 372 216 158 80 51 ------
NM_007214chr651002 515 380 374 254 ------
NM_007218chr83881 191 171 3859 370 352 ----
NM_007222chr851782 1741 1666 1575 1517 11185 ----
NM_007231chrX21795 620 2205 48 ----
NM_007235chr123494 447 372 ------
NM_007236chr1542251 1782 1651 960 22349 2140 1163 --
NM_007245chr163910 792 124 ------
NM_007246chr44841 780 374 138 1263 ----
NM_007249chr13229463 9330 9109 8581 8417 7860 7676 6934 6425 5870 5735 3181 2764 2162 2120 1873 1746 1108 560 434 377 199 59428 6467 6157 3698 2471 18687 --
NM_007257chr8122684 2513 2127 2095 2046 1963 1834 961 655 221 63 46 ------
NM_007271chr651865 1255 1143 737 422 21560 231 --11296
NM_007275chr31456 ------
NM_007282chr32107 32 ------
NM_007308chr4--1702 ----
NM_007331chr492317 2290 2237 2014 759 516 497 490 122 1783 12511 --
NM_007332chr831433 1348 155 --11173 --
NM_007345chr1862235 2031 1898 1761 937 23 32357 2327 1803 ----
NM_007347chr15113120 3093 2976 2556 2405 2189 1237 882 800 782 183 1433 ----
NM_007350chr12124556 3765 3659 3463 3400 1657 1610 1318 1007 796 235 221 11019 ----
NM_007353chr732143 368 287 ----11128
NM_007358chr181874 1831 1490 1326 1272 738 192 80 41916 1862 1348 665 --1437
NM_007363chrX2781 771 ------
NM_007365chr131894 1843 1582 11484 1112 11687
NM_007372chr172868 715 145 ----
NM_007373chr1051347 1205 721 669 438 ------
NM_007375chr182654 2595 2455 1092 1012 923 707 372 1159 1434 12324
NM_012081chr563394 3385 3022 1447 243 95 33232 3000 326 --12665
NM_012082chr82704 331 1366 126 --
NM_012084chrX1572 ----1533
NM_012089chr161554 1410 1031 479 430 377 ------
NM_012090chr141054 934 526 370 --1344 --
NM_012095chr10113546 3420 3323 3034 2878 2864 2777 2702 1052 869 826 22971 2638 2792 190 --
NM_012096chr3113317 3310 3095 2575 2338 1510 1286 968 506 444 303 23602 795 ----
NM_012097chr241825 1593 1516 1474 ------
NM_012102chr172404 2148 1897 688 468 292 117 1551 12161 --
NM_012104chr11103353 3028 2476 2426 1191 897 805 312 297 60 2678 483 12485 --
NM_012104chr11103353 3028 2476 2426 1191 897 805 312 297 60 2678 483 12485 --
NM_012111chr141186 ------
NM_012115chr61392 ------
NM_012120chr662950 2926 2114 2042 961 522 --1405 1682
NM_012129chr772340 2181 2049 2027 385 223 93 ------
NM_012137chr142900 2022 863 449 12255 12872 --
NM_012141chr13123681 3103 2931 2620 2606 1600 1569 1336 1072 862 614 317 23336 825 21237 952 --
NM_012157chr31173 ----1984
NM_012158chr1331855 1447 385 11685 1676 11400
NM_012161chr44768 467 352 252 2838 800 1991 --
NM_012164chr9157474 7375 7001 6897 6808 6334 6240 5802 2874 2690 2383 2167 1221 1150 32 17109 ----
NM_012180chr43671 544 157 ------
NM_012188chr51940 ------
NM_012193chr11115342 4966 4788 4346 4102 3459 1467 1133 600 401 264 23889 194 23670 1446 --
NM_012197chr961455 1230 1205 1197 655 60 --11111 --
NM_012199chr184524 4429 4234 3305 2902 829 529 458 1405 11551 --
NM_012207chr1031010 955 426 1336 ----
NM_012210chr961068 534 305 298 280 146 11536 1589 --
NM_012214chr2186261 5737 5346 5283 5217 4858 4565 4056 2266 1864 1296 1238 1224 947 907 652 387 301 36092 4832 563 12377 --
NM_012215chr1061753 1555 1541 1497 699 260 --11786 --
NM_012219chr332700 449 428 ------
NM_012223chr241336 1025 118 39 11119 1252 1109
NM_012229chr1061426 1027 597 516 506 289 ------
NM_012233chr231083 952 239 ------
NM_012234chr373192 2664 1128 1003 420 377 197 23501 2518 12609 --
NM_012238chr1091653 1406 1363 1195 623 617 490 269 52 ------
NM_012242chr104248 165 59 32 --1533 --
NM_012244chr1431406 131 43 11822 ----
NM_012249chr2103439 3070 2917 2497 2490 929 867 682 388 81 12999 ----
NM_012250chr1191199 1076 1041 990 868 507 452 430 226 ------
NM_012252chr7175304 4989 4806 4058 3647 3546 3531 3352 2152 1836 1758 1611 1220 1142 899 285 87 --11861 --
NM_012255chr203481 455 120 1409 ----
NM_012259chr621433 1358 --1986 --
NM_012262chr1124212 4009 3845 3715 3691 3676 2024 1803 1423 882 722 57 34112 4055 3945 ----
NM_012281chr752228 1890 1511 864 223 ----22437 636
NM_012286chrX2613 87 ------
NM_012287chr3114268 3502 3109 2961 1482 1411 1099 1074 913 435 203 23382 3319 --21588 666
NM_012288chr694877 4784 4178 3741 3575 2124 1857 1395 639 21170 1134 --25119 1317
NM_012290chr251549 1470 1388 684 595 1557 ----
NM_012297chr4122513 2481 2255 2046 2031 1842 1029 854 827 666 302 132 22016 82 ----
NM_012300chr5122155 2120 2101 1796 1785 1715 726 670 609 564 378 191 ------
NM_012301chr762177 1429 878 459 293 229 ------
NM_012309chr11124587 4309 4077 4052 4024 3983 3315 3106 1763 1679 701 634 13326 ----
NM_012316chr1125615 5441 5290 5265 4963 4650 4594 4139 729 630 384 276 11623 21077 204 --
NM_012325chr2031295 570 188 11149 --21561 513
NM_012326chr21821 ------
NM_012327chr1861574 1075 1025 563 532 46 --1261 --
NM_012328chr751387 1329 934 384 219 ------
NM_012329chr1731048 487 274 ----11295
NM_012330chr1071554 1398 1248 1165 711 230 66 21818 266 1407 --
NM_012333chr161543 1198 624 305 179 102 ------
NM_012342chr101200 ------
NM_012343chr531038 737 463 1282 ----
NM_012345chr1351833 1529 1294 592 344 --1157 --
NM_012347chr652977 2465 1203 805 183 12954 ----
NM_012382chr553308 3094 2877 840 774 13863 12795 --
NM_012388chr15102953 2702 2632 2570 1020 723 674 549 407 320 ------
NM_012399chr2261806 1659 735 533 505 486 ------
NM_012405chr163018 2992 2823 649 543 478 12536 ----
NM_012420chr1051723 1648 798 442 346 12151 ----
NM_012425chr1042224 2158 216 193 ----1156
NM_012430chr33767 730 529 ------
NM_012432chr11355 ------
NM_012433chr22252 78 ------
NM_012434chr681690 1667 1443 1406 433 325 278 217 ------
NM_012443chr101572 ----1121
NM_012454chr6145 ------
NM_012463chr1231507 1401 338 11519 ----
NM_012464chr462469 2380 1138 904 703 626 --11975 --
NM_012465chr10103243 3182 2730 2647 2589 2558 2261 2174 1181 456 1855 2848 653 --
NM_012471chrX21363 139 ------
NM_012479chr772695 2588 2149 2036 2022 650 50 12054 ----
NM_012482chr12626 159 ------
NM_013229chr1282091 2057 1782 881 748 526 473 185 12039 ----
NM_013230chrY61621 1472 1349 1318 625 127 21415 601 ----
NM_013231chr1462761 1752 1454 1190 1119 792 23659 867 ----
NM_013233chr221280 459 ------
NM_013236chr223836 378 219 --2871 127 --
NM_013243chr152520 137 1487 ----
NM_013249chr112209 49 1168 ----
NM_013254chr123681 197 75 --1613 --
NM_013255chr7198759 8711 8688 8568 8315 7967 7434 7166 7023 6617 6337 6288 5802 5462 1627 1488 858 497 275 25660 2545 --12887
NM_013261chr443191 2740 2519 627 13117 --13388
NM_013262chr671467 1379 1048 948 571 511 413 --1334 --
NM_013269chr1274452 4031 3240 1745 1554 1356 640 23036 32 ----
NM_013281chr2071418 1349 1110 1008 416 241 231 --11301 --
NM_013282chr191366 11321 ----
NM_013293chr72280 116 1494 ----
NM_013309chr1562637 2275 1746 908 840 672 ------
NM_013313chr2293239 2892 2785 2528 1055 679 396 300 25 31095 890 861 ----
NM_013316chr72924 179 1696 ----
NM_013322chr751410 1389 1294 224 173 11657 ----
NM_013330chr1181 ------
NM_013341chr282904 2746 2167 2053 2027 1062 798 786 ------
NM_013354chr831368 963 397 1435 ----
NM_013372chr15113385 3086 2941 2873 2810 1349 1187 1041 834 445 415 1188 22772 2219 --
NM_013374chr372661 2597 2462 2411 2115 2008 391 33043 2266 702 12058 --
NM_013377chr124495 204 110 33 ------
NM_013381chr1242349 2151 2096 136 --11801 --
NM_013390chr961702 1674 1423 1275 658 478 21689 357 ----
NM_013396chr2171279 1194 1039 544 294 150 42 ------
NM_013399chr1621827 713 ----11881
NM_013400chr71374 11093 ----
NM_013411chr172791 2138 1973 729 702 355 180 1935 ----
NM_013434chr2187 ------
NM_013434chr2187 ------
NM_013437chr841233 1219 189 85 ------
NM_013438chr941817 709 413 256 --11355 --
NM_013444chrX61087 347 190 107 87 62 --1268 --
NM_013449chr1262544 2483 2441 1855 1826 1163 ------
NM_013450chr241278 1229 889 406 ------
NM_013937chr661072 907 797 779 718 165 --1841 --
NM_013943chr1103259 3203 3103 3087 2756 2677 910 829 235 197 33267 734 272 11149 --
NM_013956chr81126 ------
NM_013957chr81126 ------
NM_013958chr82337 293 ------
NM_013959chr82337 293 ------
NM_013960chr82802 766 ------
NM_013961chr82337 293 ------
NM_013962chr82337 293 ------
NM_013964chr81126 ------
NM_013981chr52155 45 ------
NM_013982chr52155 45 ------
NM_013983chr52155 45 ------
NM_013995chrX102494 2102 1967 1039 874 767 716 517 494 177 42584 777 294 108 ----
NM_014000chr1041664 1583 1557 696 ------
NM_014011chr222326 1955 32641 2227 451 --1487
NM_014016chr361329 1294 581 183 107 62 1449 --11360
NM_014021chr163259 837 647 586 375 201 2701 188 1309 --
NM_014023chr1092881 2129 2077 971 940 930 607 399 47 22689 765 ----
NM_014034chr651269 1246 514 368 264 1347 ----
NM_014043chr32634 73 ------
NM_014048chr1665107 5072 4025 3591 3544 973 23733 71 --1289
NM_014055chr123356 194 121 1369 1381 --
NM_014057chr92457 374 11187 ----
NM_014059chr131292 ------
NM_014071chr20146 ------
NM_014106chr1582789 2757 2628 1185 1173 888 746 256 3356 195 174 1394 --
NM_014109chr841218 344 98 27 ------
NM_014110chr121051 752 1862 ----
NM_014112chr8105187 4681 4128 4075 4062 3666 3587 3550 1178 798 14309 --1687
NM_014117chr1662166 2085 2042 1947 1820 533 12662 --32541 2157 1788
NM_014141chr753236 1826 915 499 194 12064 --1249
NM_014154chr321232 1076 1118 ----
NM_014155chr11157440 7428 7207 6673 5489 5362 5320 5179 3026 2666 2228 2169 2000 877 805 67513 4885 2798 2091 1922 1613 11498 16295
NM_014170chr31333 ------
NM_014181chr242295 974 751 404 12507 --22690 1134
NM_014190chr461778 1750 1727 1715 656 50 ------
NM_014214chr181158 1345 ----
NM_014217chr181783 1689 1606 1505 1414 566 453 58 21816 1443 --11834
NM_014220chr31120 ------
NM_014223chr12728 690 1772 ----
NM_014240chr3104102 4005 3627 3608 3581 2600 1131 896 740 150 --22618 1500 --
NM_014243chr421507 1433 1331 12061 --
NM_014245chr331027 881 303 --1133 --
NM_014250chr2261912 1529 752 528 339 182 12010 ----
NM_014253chrX82338 2133 1927 951 790 446 200 179 --12408 --
NM_014263chr1021161 72 11446 1341 --
NM_014267chr114807 163 114 86 ------
NM_014271chrX1198 1320 ----
NM_014278chr43385 324 61 ------
NM_014280chr13767 667 113 --1842 --
NM_014283chr141570 1332 1077 433 11351 21231 328 --
NM_014288chr11224 --1294 --
NM_014290chr9142 ------
NM_014294chr851270 1148 1017 1006 191 ------
NM_014309chr22125413 5374 5312 5305 4474 3661 2101 1220 854 821 196 182 --25013 4339 --
NM_014313chr12483 426 ------
NM_014323chr222732 284 1175 ----
NM_014325chr1241904 611 448 287 1313 ----
NM_014331chr4166733 6696 6201 5633 5286 3092 2627 2597 2427 2048 1856 1383 1044 714 140 97 26785 4980 16245 --
NM_014332chrX2376 362 ------
NM_014333chr1182636 2446 1897 1885 1104 898 775 341 32544 2170 172 12666 --
NM_014345chr62796 778 ----1708
NM_014351chr2251473 1414 1069 913 442 ----1190
NM_014363chr1331282 1186 1050 ------
NM_014372chr122089 2037 1168 ----
NM_014374chr71374 11093 ----
NM_014381chr14133179 2586 2491 2350 2323 2133 1256 1183 875 842 779 669 584 --1575 --
NM_014388chr1125919 5754 4973 4949 4710 2092 1052 879 869 767 588 297 11092 11242 --
NM_014393chr862302 2183 2045 1870 788 419 ------
NM_014415chr331618 561 277 1521 11266 --
NM_014423chr5165319 5220 5180 5043 4917 4655 4451 3737 3589 1793 1597 1553 1436 958 212 176 34216 3492 1903 --13693
NM_014426chr205710 549 522 266 100 ------
NM_014429chr3258 23 1690 ----
NM_014445chr362210 2000 1923 1823 936 916 --21666 538 --
NM_014447chr441228 1100 646 424 --21471 1325 --
NM_014454chr62943 308 1392 1129 --
NM_014456chr1051469 1301 682 662 440 ------
NM_014458chr131451 1050 949 ------
NM_014497chr2------1213
NM_014500chrX121 ------
NM_014504chr762144 1781 1759 624 507 315 11552 21804 541 22131 1840
NM_014515chr121801 ------
NM_014517chr361634 786 749 741 393 308 11812 ----
NM_014554chr1262299 1697 788 601 528 202 ----11791
NM_014569chr72535 205 --2143 125 --
NM_014574chr1461002 992 548 487 274 265 11278 ----
NM_014577chr224790 318 105 92 1809 ----
NM_014584chr1421505 1357 11204 --1643
NM_014587chr1621310 595 ------
NM_014606chr461473 1197 1148 988 508 118 ------
NM_014607chr262141 1766 1634 838 780 120 ------
NM_014608chr152407 72 ------
NM_014612chr961557 1149 442 374 344 172 1124 21566 299 --
NM_014613chr5112944 2178 2137 1998 1966 1215 866 612 589 523 367 ------
NM_014614chr251348 1178 1105 1039 993 ------
NM_014615chr1643252 2928 1267 1081 --1967 --
NM_014616chr373419 2520 2399 2387 878 815 361 22415 1084 ----
NM_014620chr122768 220 ------
NM_014633chr112633 401 ------
NM_014636chr973972 3902 2864 1337 1293 1020 678 23886 1614 11370 13285
NM_014637chr851374 1214 1018 192 98 ------
NM_014646chr1883083 2865 1995 1984 996 619 245 141 12042 1799 1889
NM_014647chr1672076 1811 1633 1456 663 411 274 ------
NM_014659chr151310 ------
NM_014660chr73776 380 53 ------
NM_014665chr893693 2352 2230 928 371 313 299 62 45 ----22948 2301
NM_014666chr54422 266 95 39 ----1954
NM_014670chr211596 ------
NM_014671chr771418 1290 1263 1142 1085 318 245 ------
NM_014674chr393987 3957 3718 2811 2626 1576 1294 718 372 53444 3262 3010 1106 288 21067 898 --
NM_014676chr161676 1167 1080 457 400 170 11700 ----
NM_014677chr871396 1329 1196 1042 916 846 325 ------
NM_014679chr112938 324 ------
NM_014682chr851704 1670 795 344 243 ------
NM_014683chr1781692 1462 1455 1361 786 761 728 474 --153 --
NM_014686chr1962555 2458 1829 490 340 170 ------
NM_014689chr23540 520 416 ------
NM_014701chr15103263 3018 2361 2345 962 507 412 165 137 59 22392 1104 12147 --
NM_014702chr6112980 2967 2598 2478 2445 2356 2119 1357 911 901 471 11274 1930 --
NM_014705chr741715 1601 1310 569 1428 ----
NM_014707chr752177 1924 1594 658 493 ------
NM_014709chr23476 247 26 ------
NM_014711chr1642079 1591 1473 307 11872 ----
NM_014713chr22547 193 ------
NM_014720chr1051796 1781 1172 531 511 31506 698 269 ----
NM_014721chr6137147 5317 4931 2895 2520 2312 2049 2025 1985 1450 1054 730 43 25648 5542 --16140
NM_014729chr872075 1868 1697 854 775 193 174 22039 1858 ----
NM_014730chr1283939 3752 2023 1763 987 975 898 349 34137 3359 1073 1598 --
NM_014730chr1283939 3752 2023 1763 987 975 898 349 34137 3359 1073 1598 --
NM_014733chr562097 1914 746 322 251 131 11688 ----
NM_014739chr654092 3779 2666 247 238 23669 2585 ----
NM_014743chr453147 2741 2464 2166 930 2401 157 ----
NM_014746chr2114262 3981 3778 3624 2703 1446 1323 1287 1178 787 377 1487 14366 --
NM_014747chr1105634 5433 5149 4599 4256 4033 3831 3759 3511 2033 25549 3583 25510 2230 --
NM_014751chr842060 1843 1684 192 1357 --1145
NM_014752chr1181828 1577 775 642 588 559 320 134 ------
NM_014755chr2103763 3611 3461 3355 2932 2879 1704 1063 692 187 1479 ----
NM_014756chr113459 357 35 ------
NM_014757chr552356 2205 2180 918 24 2414 81 ----
NM_014764chr124403 393 267 73 --1311 --
NM_014765chr142314 2003 993 807 22269 387 1773 --
NM_014774chr1123153 2959 2845 2524 2391 2013 1281 782 418 352 311 126 1989 ----
NM_014776chr1263110 3029 2269 2131 1200 1002 ------
NM_014781chr851015 910 433 421 163 11082 ----
NM_014783chr1521104 411 ------
NM_014787chr142648 2334 2104 700 12657 2512 264 1744
NM_014795chr241291 1065 958 540 ------
NM_014810chr153160 2904 2319 734 175 ----12689
NM_014811chr91151 ------
NM_014812chr161896 1759 1553 1378 1364 1251 ------
NM_014820chr341412 820 516 198 31678 1638 561 ----
NM_014824chr1151981 1745 1485 80 71 ------
NM_014826chr184178 4073 3150 2739 1615 1567 1079 736 --13629 --
NM_014829chr5102317 2300 2213 2124 2096 1775 825 705 614 225 ------
NM_014830chr1263884 3657 1557 1125 647 321 --13349 --
NM_014832chr1352095 1886 752 378 298 ------
NM_014835chr204588 403 369 268 11623 ----
NM_014838chr2252722 2336 2279 718 394 1886 --11145
NM_014839chr152321 2039 1900 346 333 1832 ----
NM_014841chr641069 1048 914 895 ------
NM_014848chr1562587 2451 2289 2279 2091 767 ------
NM_014850chr353869 3483 3299 3019 1420 13647 14688 --
NM_014860chr272658 2506 1996 1651 876 747 676 ------
NM_014862chr1594197 4007 3669 3536 3474 3247 3241 1069 838 ------
NM_014870chr1124734 4728 4538 4352 4158 4074 3511 3226 1701 1384 810 68 --12923 11029
NM_014873chr184578 4471 3804 3350 3239 1898 1378 615 21555 1219 1144 --
NM_014877chr17287655 7614 7123 7007 6918 6839 6639 6629 6549 6400 6207 6081 5651 5645 5042 2956 2710 2608 2222 1969 1921 1609 1389 1350 794 563 216 99 46753 6312 2330 573 11645 26804 5566
NM_014883chr462464 2205 1973 1918 1828 1630 ------
NM_014885chr43177 168 75 ------
NM_014888chr73431 393 370 11349 ----
NM_014892chr61251 1638 ----
NM_014893chrY42348 2342 671 457 31925 935 116 1701 --
NM_014897chr1782348 2279 1129 599 553 368 322 252 1577 ----
NM_014898chr1951974 425 195 176 23 12359 ----
NM_014899chr5103147 3141 3075 2796 2779 2564 2265 1182 461 271 1147 1921 --
NM_014903chr126759 636 433 329 193 37 --11820 --
NM_014904chr10123457 3294 3218 2618 2514 1561 1356 1186 923 800 176 119 21136 543 11089 --
NM_014906chr1783898 3570 3069 2932 1611 995 925 752 1974 ----
NM_014912chr1093409 3361 3239 3139 3020 2703 787 603 243 23171 3051 2658 554 --
NM_014918chr1561616 1152 1135 285 176 132 ------
NM_014923chr1361757 1520 1440 805 731 74 1744 ----
NM_014924chr1473222 3197 2038 1141 650 531 458 1396 ----
NM_014926chr321021 81 ------
NM_014929chr22673 138 ------
NM_014932chr331273 608 137 ------
NM_014936chr692775 2269 1115 1093 964 740 481 418 338 --12305 --
NM_014937chr105870 484 438 270 33 11214 ----
NM_014943chr841074 971 915 790 11037 ----
NM_014946chr2103040 3020 2936 2252 2235 2022 1242 1001 625 279 21920 110 --22603 2293
NM_014947chr172812 2671 1089 768 474 171 150 1545 ----
NM_014950chr1441733 1692 662 57 1182 ----
NM_014951chr1042463 1889 693 40 12621 --1204
NM_014953chr1394185 3617 3399 1204 752 511 471 462 102 21287 398 13380 --
NM_014961chr451394 655 339 290 140 12174 ----
NM_014962chr2092628 2453 2375 1037 978 523 185 149 141 2729 237 1674 1715
NM_014964chr1761617 978 870 762 601 145 ------
NM_014974chr1031758 1161 381 1220 1494 --
NM_014982chr14115233 4666 4565 4099 3686 1911 1111 999 949 755 154 14009 1649 --
NM_014988chr452821 2528 318 270 39 1358 --1588
NM_014989chr642035 1620 1364 835 ------
NM_014990chr144909 821 467 429 ------
NM_014991chr473099 2284 2197 1126 994 820 703 12908 --1377
NM_014992chr14--125 ----
NM_014997chr752739 2357 2242 1009 55 12765 1600 --
NM_014999chr1251630 1398 652 580 411 11201 --11391
NM_015000chr12123092 2991 2829 2692 2659 2628 2484 2251 1042 1015 973 571 ----12324
NM_015002chr1231965 816 26 ----21556 739
NM_015008chr3113651 3222 2818 2310 2221 1250 1023 900 889 717 267 23290 176 ----
NM_015009chr34648 621 298 265 ------
NM_015012chr11265 21 ------
NM_015017chr131320 1019 398 ------
NM_015020chr1622461 693 1288 ----
NM_015025chr251659 764 604 355 339 2877 450 22245 2162 --
NM_015026chr12114708 4558 4485 3961 3451 2947 2936 1434 853 471 124 14331 13013 --
NM_015027chr1661742 1585 1551 708 439 426 ------
NM_015032chr1371034 787 521 312 171 139 90 139 ----
NM_015035chr20206450 6340 6077 5303 4872 4091 1898 1613 1588 1333 1278 1229 1094 724 570 544 533 387 315 250 --11967 --
NM_015039chr151698 975 792 549 451 1184 13757 11040
NM_015040chr283330 3264 2817 2095 1107 784 478 181 ----1685
NM_015042chr1544025 3531 3174 2782 24314 3888 --13862
NM_015045chr1062239 2021 1625 1540 520 269 12181 ----
NM_015049chr283010 2905 2670 2592 2021 762 627 25 32856 2266 809 ----
NM_015051chr933060 1273 776 12186 12608 13031
NM_015054chr122432 90 ------
NM_015059chr1584011 3717 2985 1455 1041 882 363 320 12751 11203 --
NM_015060chr71221 ------
NM_015068chr783852 3606 3491 3435 2704 911 418 85 13388 22890 1480 --
NM_015069chr162607 495 ----1237
NM_015070chr1331152 568 147 ------
NM_015071chr5116397 6359 6260 5898 5889 5594 4235 2154 1935 1743 1660 55515 5385 5373 2187 1965 ----
NM_015076chr6134322 3960 3502 3385 3125 3096 2913 1056 929 913 457 362 168 24437 383 ----
NM_015079chr1543183 2577 705 532 --11990 --
NM_015091chr142827 720 1616 ----
NM_015092chr16154325 4015 3029 3017 2972 2946 2856 1624 1550 1273 1227 1179 1049 722 682 23211 1851 --14260
NM_015093chr611347 --1752 --
NM_015097chr36669 564 399 304 186 118 11704 --21889 93
NM_015100chr191841 1783 1777 1677 1401 704 562 430 368 ------
NM_015107chrX52222 766 698 306 31 22436 2298 21542 737 --
NM_015110chr971828 1566 936 837 742 550 122 1955 12077 22436 373
NM_015115chr483188 2916 2546 2317 2036 1223 759 657 1516 --12635
NM_015120chr2--2300 118 --1284
NM_015122chr191203 ------
NM_015129chrX31583 1484 42 1221 180 --
NM_015130chr451296 1267 1232 488 89 11242 ----
NM_015132chr721577 800 --1105 --
NM_015137chr832010 964 124 1494 --12488
NM_015141chr3102714 2681 2216 1991 757 736 600 521 467 341 12313 ----
NM_015143chr461378 1330 1074 286 260 250 ------
NM_015144chr1673768 3701 3516 3190 3068 2643 646 13980 ----
NM_015151chr212658 336 ----1150
NM_015153chr63794 293 98 ------
NM_015155chr1052768 1152 1014 984 211 ------
NM_015156chr1453309 2871 1082 897 541 23706 1625 12686 --
NM_015161chr1641346 1192 975 356 --1313 1276
NM_015163chr1461885 1490 750 540 286 143 ------
NM_015170chr882310 2135 2083 2060 1845 1639 1581 898 12025 ----
NM_015173chr431650 1393 588 2250 199 ----
NM_015185chrX82935 2842 2099 719 708 522 375 320 --12834 --
NM_015186chr92482 111 ------
NM_015192chr2062848 2582 2472 2172 504 293 11898 ----
NM_015196chr41110 ------
NM_015199chr373005 2909 2875 2707 2294 2215 673 --22581 1964 --
NM_015200chr4122436 2373 2260 1998 1982 1742 956 934 925 719 530 389 21047 419 --11795
NM_015206chr152814 516 33804 386 221 ----
NM_015208chr1893840 2827 2736 2556 1127 1119 964 698 95 13230 ----
NM_015209chr142099 1962 761 717 22041 260 ----
NM_015213chr11--1163 ----
NM_015215chr172436 2018 871 524 481 220 67 12034 ----
NM_015216chr561210 994 626 430 351 339 ------
NM_015221chr1041551 1353 614 36 ------
NM_015225chr9133134 3020 2902 2617 967 947 768 648 606 556 457 326 222 ------
NM_015230chr471596 1510 1338 1276 430 274 55 ------
NM_015231chr114938 869 387 23 1256 ----
NM_015233chr1341883 907 598 433 ----1639
NM_015236chr441056 999 163 102 11259 ----
NM_015239chr9--1354 ----
NM_015245chr642726 1909 562 309 1351 11072 --
NM_015247chr16155276 5035 4826 4075 4012 3961 3639 3521 1892 1339 1331 1296 822 754 370 45351 5075 4537 914 1336 --
NM_015250chr951875 1834 1270 835 741 1514 --1588
NM_015251chr1651598 767 588 408 366 12001 ----
NM_015252chr23886 622 91 137 ----
NM_015263chr1521201 238 ------
NM_015265chr262368 2310 2257 2022 558 62 ------
NM_015267chr1241995 1357 886 540 --11864 3357 333 300
NM_015268chr32259 140 ------
NM_015271chr4134305 4235 4128 4038 3936 3420 3278 3063 3011 1628 1267 1199 460 24018 523 31356 667 188 1961
NM_015278chr652583 2468 1152 610 588 32782 2454 542 ----
NM_015282chr272699 2008 1964 999 830 558 488 ------
NM_015285chr1872321 1930 1025 587 471 369 32 11617 ----
NM_015291chr1103239 3216 3157 3145 2536 2383 1312 982 833 147 22739 107 11404 --
NM_015293chr62538 121 3583 545 452 1517 --
NM_015299chr1473983 3349 2817 1434 1395 748 139 1121 ----
NM_015310chr8207773 7696 7678 7585 7373 7232 6874 6680 5163 5086 2979 2947 2464 2394 1831 1332 1090 708 436 404 18412 12623 --
NM_015313chr11214559 4495 4472 4457 4367 4343 3831 3815 3723 3700 3684 3226 3102 1814 1760 1680 1462 1127 437 431 286 43061 1862 1783 425 14640 --
NM_015314chr7102489 2445 2431 1968 1902 722 679 499 436 145 ------
NM_015315chr573437 3430 3291 2772 695 666 126 --12365 --
NM_015317chr23474 460 365 12418 12611 --
NM_015321chr1984916 4907 4620 1574 1239 968 737 579 13332 21912 924 --
NM_015322chr15154 ------
NM_015326chr163004 2874 2135 870 826 655 --1940 --
NM_015328chr743072 2762 1206 508 1954 21894 1139 --
NM_015329chr1932849 2819 2789 ------
NM_015335chr1262652 2475 2027 1832 1823 543 12666 --1389
NM_015336chr1242561 918 153 90 11918 22401 2366 --
NM_015339chr2051013 1002 920 789 407 ----1846
NM_015340chr311281 ------
NM_015344chr82138 118 ----11713
NM_015347chr1272771 2501 1819 1079 1045 692 231 1406 ----
NM_015349chr622756 1902 12592 2705 207 --
NM_015355chr1771838 1657 1377 721 591 195 47 1412 ----
NM_015356chr8175 ------
NM_015359chr872843 2385 2243 2138 2065 2021 343 ------
NM_015361chr22263 27 ------
NM_015365chrX174302 3915 3779 3719 3634 3054 2968 2905 2783 2710 1127 874 638 455 431 399 87 31522 1229 209 ----
NM_015367chr221438 11559 ----
NM_015378chr142166 2025 661 563 32419 274 198 ----
NM_015379chr71214 ------
NM_015382chr142560 155 ------
NM_015385chr1042876 2414 2299 69 12215 --1795
NM_015387chr231582 746 138 166 ----
NM_015393chr463606 3436 3256 2669 195 40 12848 ----
NM_015397chr981721 1566 669 573 364 275 224 103 --1200 --
NM_015409chr1282609 2468 2268 1826 1771 995 583 446 11930 32240 2117 846 --
NM_015423chr1111397 ------
NM_015429chr33745 370 317 --11004 --
NM_015435chr831254 978 370 ------
NM_015436chr4113258 3096 2980 2966 2869 2277 2230 2120 1275 920 726 1454 1236 --
NM_015439chr6151 --1150 --
NM_015443chr1731227 139 109 11392 11313 --
NM_015446chr141676 1457 1135 636 --11271 --
NM_015455chr5104144 3959 3717 3638 3457 1401 1006 855 683 449 43779 3160 2716 2548 ----
NM_015457chr1131092 218 211 ------
NM_015458chr8184691 4587 4354 4325 4284 3942 3889 3566 3259 1590 1458 1313 1287 1027 523 409 214 81 44711 1908 1383 110 ----
NM_015460chr371970 1857 1708 1605 1587 1383 798 ------
NM_015463chr22722 618 ----153
NM_015464chr73979 822 162 ------
NM_015469chr93650 497 90 ------
NM_015474chr203438 272 145 ------
NM_015475chr22932 257 1383 ----
NM_015483chr71368 ------
NM_015484chr13858 783 596 ------
NM_015509chr1231386 346 337 ------
NM_015525chr63857 192 129 ------
NM_015532chr15112793 2596 2263 2251 2168 2154 2097 2074 1092 286 255 11017 ----
NM_015534chr13994 787 243 1426 ----
NM_015535chr2104216 4176 3832 3528 3497 2720 2593 1125 519 232 2576 342 ----
NM_015541chr341442 1344 271 250 --11162 --
NM_015550chr773419 3225 2924 995 546 165 135 11030 13138 --
NM_015553chr684399 4195 4100 3841 1301 901 876 736 14051 34933 4822 517 --
NM_015554chr1562782 2381 1155 956 940 374 --12528 --
NM_015555chr671181 1119 686 670 473 386 343 --11350 --
NM_015557chr163622 3241 3203 2417 416 106 13536 13675 --
NM_015564chr562773 2599 2408 645 614 289 ------
NM_015565chr2162046 1949 1805 1591 208 105 2378 176 ----
NM_015567chr1351209 937 894 421 170 ------
NM_015568chr2074352 3728 3710 3014 2837 1634 503 --22878 873 11539
NM_015569chr1154681 4568 3598 3552 3001 1933 1921 1910 1679 1545 1447 1114 927 786 261 1304 1175 1206
NM_015570chr721558 1320 --1198 --
NM_015571chr662554 2102 1031 488 417 336 22272 2261 12456 --
NM_015575chr2113499 3455 2788 1388 1097 896 557 267 165 149 92 ----163
NM_015576chr352377 2200 1824 630 612 ------
NM_015577chr531788 1715 1114 --1423 --
NM_015578chr1921973 1925 ----11597
NM_015602chr141800 1496 1313 432 11465 ----
NM_015607chr13229 201 161 ------
NM_015609chr152419 2365 1927 1829 542 ------
NM_015626chr172301 152 1938 ----
NM_015630chr221044 298 ------
NM_015635chr992103 1815 1680 1379 741 378 349 182 138 ------
NM_015640chr1135217 5057 4512 4499 3850 3517 3247 1619 1553 1362 1170 614 32 35152 4392 1439 --14976
NM_015642chr32328 313 ------
NM_015652chr104637 596 77 51 ------
NM_015678chr1321442 1117 --11059 --
NM_015691chrX52352 2346 985 420 80 12699 --1675
NM_015695chr641881 1857 1766 604 --1743 11920
NM_015697chr41350 1286 ----
NM_015713chr8123589 3136 3119 2395 2354 1379 1264 1221 933 680 343 92 11430 --12624
NM_015716chr171102 ------
NM_015723chr74482 257 229 202 ------
NM_015726chr171433 1368 1213 1196 457 429 328 2116 102 11321 --
NM_015852chr7133486 2825 2774 2768 2425 1417 1087 1003 919 583 331 247 163 22860 2323 33295 752 500 --
NM_015859chr14121 ------
NM_015866chr12470 377 ------
NM_015869chr31173 ------
NM_015878chr862223 1970 1780 1429 663 589 123 ----
NM_015879chr18208650 8056 7492 7304 6139 5992 5935 5715 5658 5650 5616 5547 5223 2818 2587 1933 1633 1354 161 151 58308 6790 5925 5589 5266 ----
NM_015885chr111154 ------
NM_015886chr8104794 4228 4142 4063 4049 3734 3586 1887 172 131 25572 1036 ----
NM_015888chr162128 2079 2067 1107 863 301 22890 594 23030 2153 --
NM_015889chr221120 ------
NM_015904chr22831 523 ------
NM_015905chr7--2421 34 ----
NM_015906chr1144204 4181 4055 3987 3776 3359 3142 3117 3065 1494 1354 422 142 82 --11744 --
NM_015932chr137785 727 610 567 237 231 151 1760 ----
NM_015975chrX21487 150 ------
NM_015986chr1761124 533 512 207 148 22 1386 ----
NM_015999chr12524 46 ------
NM_016009chr184912 4465 3262 1954 1585 1463 617 326 13394 ----
NM_016018chr862752 2354 2157 2000 1871 511 --22517 1078 --
NM_016021chr692557 2390 2305 2250 2169 2122 2051 972 313 ------
NM_016022chr111075 ------
NM_016023chr842083 1921 1634 885 1145 ----
NM_016028chr115965 898 117 83 26 ------
NM_016032chrX4875 124 118 103 --1539 --
NM_016037chr11962 ------
NM_016040chr122653 2248 1466 ----
NM_016048chr551006 737 642 382 236 ------
NM_016072chr1241881 914 635 109 21831 384 1646 --
NM_016073chr154802 788 298 182 1382 ----
NM_016076chr163237 3039 2910 2713 931 911 12561 --32233 475 83
NM_016079chr262189 2031 1902 549 353 198 ------
NM_016083chr683638 3491 1413 1165 867 860 511 331 1591 21316 271 --
NM_016090chr117914 798 394 263 119 48 40 1255 ----
NM_016096chr851959 1729 1501 844 32 1338 ----
NM_016100chr201104 ------
NM_016103chr5--2389 119 ----
NM_016107chr52447 296 ------
NM_016121chr121106 397 1422 --1327
NM_016125chr171427 1117 ----
NM_016127chr81698 165 ----
NM_016128chr31215 ------
NM_016129chr42385 109 ------
NM_016132chr1573103 2479 2282 2254 2202 131 112 1452 ----
NM_016133chr241622 1434 464 211 11592 ----
NM_016138chr1651549 1233 648 289 270 ----11660
NM_016141chr3--2707 162 --1271
NM_016162chr121638 ------
NM_016194chr1511267 21378 518 ----
NM_016200chr71283 ----1256
NM_016206chr3188862 8562 7702 7563 7197 6875 5617 5495 3552 3491 2179 1977 1863 1654 1564 309 263 224 37008 1686 1257 --25532 3086
NM_016217chr663056 2869 2495 1037 751 62 23643 2331 11200 2405 386
NM_016220chr7122343 1547 904 666 582 498 418 334 268 250 166 81 ------
NM_016221chr572333 1996 1444 848 808 691 564 22172 957 ----
NM_016226chr12196 ------
NM_016227chr141570 1332 1077 433 11351 21231 328 --
NM_016231chr1721231 172 ----1199
NM_016248chr1383964 2951 2914 2844 762 592 392 27 21068 783 13685 --
NM_016252chr22194 156 ------
NM_016257chr163164 3005 2579 2401 803 794 13468 --1482
NM_016260chr2216920 6853 6842 6610 6441 5939 5132 4986 2258 2028 1623 1364 1247 1112 880 759 750 619 399 221 102 36993 6907 4941 16313 26598 6164
NM_016271chr1872074 1941 1637 740 588 121 47 ------
NM_016275chr352538 942 893 713 397 1862 1438 --
NM_016277chr631463 1265 206 11649 ----
NM_016287chr151736 1299 546 176 167 --1603 --
NM_016289chr241956 1736 1452 801 --11978 --
NM_016290chr5199 ------
NM_016297chr263534 2777 2523 2447 984 837 11086 --11054
NM_016302chr34616 529 183 171 2308 61 ----
NM_016303chrX2187 75 1118 ----
NM_016304chr154752 727 190 24 1632 --149
NM_016308chr172091 1861 665 503 345 307 274 ------
NM_016315chr261526 1468 1184 1177 1152 212 ------
NM_016316chr22520 113 ------
NM_016322chr973180 2854 2508 2360 1115 1107 637 32975 2751 2488 23064 327 --
NM_016328chr7----195 --
NM_016337chr14--1189 ----
NM_016338chr531171 1080 306 ------
NM_016339chr1731447 1151 1142 --1512 --
NM_016351chr7150 ------
NM_016353chr862294 2188 2033 1925 1882 461 32081 1635 834 1111 --
NM_016356chr692785 2702 2249 2220 2033 1972 785 547 194 11097 ----
NM_016357chr126794 509 477 424 222 60 21197 127 ----
NM_016376chr1784262 4199 4138 3394 3133 784 561 545 43955 3787 3466 1186 12898 1951
NM_016377chr641716 1312 512 275 ------
NM_016396chr15122788 2775 2537 2307 2261 2006 1954 1935 997 572 356 127 1220 3950 658 531 --
NM_016410chr92243 138 ------
NM_016418chr2283154 3005 2861 2517 2450 1171 701 317 ------
NM_016422chr1192989 1951 982 873 678 576 532 150 117 1206 --12297
NM_016424chr1762014 1782 1495 801 768 314 1255 --11941
NM_016441chr272259 2253 2104 1716 1679 683 535 ------
NM_016442chr592281 2117 1996 1868 1832 1624 932 250 165 11818 ----
NM_016448chr191900 1808 1570 1375 1200 605 109 56 31 1134 ----
NM_016451chr111313 ------
NM_016476chr171152 ------
NM_016480chr51765 ------
NM_016485chr621535 406 11596 11636 --
NM_016506chr112672 563 1167 ----
NM_016507chr1772432 2081 920 579 496 458 69 12090 ----
NM_016530chr1593826 3314 3292 2970 2886 2749 1006 867 580 33575 3552 1129 ----
NM_016531chr483547 3302 3224 2614 1268 1102 1016 589 12848 --14166
NM_016542chrX71750 1345 1135 504 314 259 205 --1663 --
NM_016544chr283426 3366 3121 3056 3043 1069 582 469 --31567 1309 535 --
NM_016559chr361432 1212 1020 539 526 312 ------
NM_016578chr111552 ----1116
NM_016598chr321345 236 ------
NM_016603chr542240 2137 1914 1439 21979 323 2280 230 --
NM_016604chr521249 819 ------
NM_016607chrX51674 1371 1310 1285 155 ------
NM_016613chr482491 2288 2203 2194 2008 1794 842 824 42734 2052 1696 640 12643 --
NM_016620chr111258 11053 ----
NM_016621chr1154482 1432 1011 983 116 --23498 1692 14336
NM_016622chr241906 1464 604 580 --1263 --
NM_016623chr83563 107 71 ------
NM_016631chr213779 392 204 ------
NM_016654chr151310 2510 173 ----
NM_016655chr15122 ------
NM_016818chr211569 ------
NM_016836chr23728 231 87 ------
NM_016839chr23728 231 87 ------
NM_016929chr684519 4459 4207 3997 3942 3142 966 936 1349 ----
NM_016936chr1641869 1610 754 615 --21808 1527 1602
NM_016940chr213440 414 91 ------
NM_016950chr431350 1274 1006 ------
NM_016954chrX3653 488 51 ------
NM_017412chr821191 531 ------
NM_017415chr544571 3596 3550 392 --32995 944 252 --
NM_017416chrX1128 ------
NM_017420chr1493667 3312 3284 2445 2369 1380 934 408 220 1133 ----
NM_017423chr452218 635 435 317 204 12028 1274 --
NM_017432chr191455 ------
NM_017437chr1462324 2167 1675 826 467 258 21684 741 ----
NM_017439chr73433 75 64 ------
NM_017440chr125592 445 421 178 51 ------
NM_017447chr21104013 3845 3498 3034 2693 1630 965 456 436 35 11066 --13121
NM_017456chr1711614 --11492 11864
NM_017489chr821203 185 ------
NM_017519chr631324 857 844 --1216 --
NM_017528chr7--176 ----
NM_017540chr542927 2020 738 498 1404 33175 2572 442 13068
NM_017545chr204562 535 387 150 ----1197
NM_017549chr741136 459 243 114 ------
NM_017551chr1012653 22617 2487 1466 --
NM_017553chr1521290 162 169 --1306
NM_017563chr3136225 6201 5413 5225 4589 4138 3970 2020 885 583 421 162 33 15189 11830 12339
NM_017576chr91183 --123 --
NM_017580chr1071774 1583 1486 955 670 522 194 1603 1568 --
NM_017582chr171768 1553 1537 556 479 427 55 ------
NM_017590chr2242690 2540 2350 1928 1580 1978 --
NM_017594chr943211 2308 1220 418 2872 781 12541 --
NM_017599chr1271876 1705 1630 1614 623 270 42 32036 1519 651 1187 --
NM_017610chr1551869 846 428 405 321 ------
NM_017617chr93234 166 146 1640 11108 --
NM_017623chr251903 929 413 382 347 21010 115 1199 --
NM_017628chr494881 4549 4435 3848 3507 2035 1874 1655 1061 25075 194 1760 13801
NM_017629chr121300 514 --1786 --
NM_017633chr673542 3203 3009 1314 1280 378 164 --13555 --
NM_017634chr871517 1422 1214 591 506 488 310 11787 11404 --
NM_017637chr9169322 8476 8245 7226 6866 6454 5781 5738 3558 3396 2509 2004 1992 1331 272 214 28341 6892 --18852
NM_017640chr68854 795 770 639 278 243 124 41 ------
NM_017641chr123834 245 56 ------
NM_017643chr17132922 2756 2703 2524 2426 1974 1905 1188 1103 979 665 651 156 22209 433 --13008
NM_017644chr3215184 4916 4202 4147 4038 4032 3841 3594 3341 1971 1775 1259 1216 1167 1086 721 627 472 248 233 88 34310 1912 1679 1305 --
NM_017645chr9113090 3047 2879 2525 2247 1215 1100 772 438 158 148 12168 1139 --
NM_017650chr7115940 5804 5597 5057 2403 2277 2161 2070 1474 1200 1050 23676 1099 1210 --
NM_017657chr2----1939 --
NM_017658chr14184529 4209 4194 3951 3214 2885 1879 1445 1435 1367 879 648 619 580 518 398 350 149 --13167 --
NM_017660chr1933269 3187 1243 13421 21209 269 11168
NM_017661chr1531168 824 370 11209 ----
NM_017667chr71171 ------
NM_017680chr921003 758 ----1833
NM_017684chr1531251 588 112 --2160 106 11432
NM_017686chr13961 367 283 1243 ----
NM_017693chr1351628 1337 1330 349 80 ------
NM_017694chr251938 1795 1631 1297 597 ------
NM_017709chr1104169 3391 3340 2937 1036 992 821 470 142 95 33655 1356 1166 11590 --
NM_017712chr1995146 4614 4304 3953 3945 3920 1068 649 403 1791 24987 629 16023
NM_017719chr342083 1972 1905 945 --11000 --
NM_017737chr132117 1684 1466 21532 496 --1376
NM_017740chr1651849 1728 1348 1167 569 1703 ----
NM_017741chr481996 1717 923 828 816 786 208 135 2955 631 ----
NM_017742chr182772 322 ------
NM_017744chr142151 2113 580 574 --1313 --
NM_017745chrX6552 241 217 181 173 118 ------
NM_017747chr53435 106 22 --1290 --
NM_017748chr176835 599 219 205 162 69 1547 ----
NM_017752chrX62153 1892 1536 1510 1487 151 --21388 346 --
NM_017753chr93952 885 361 ------
NM_017754chr6174771 4296 4154 4065 3843 3796 3679 3646 3314 3250 1850 1553 1249 1153 1046 993 472 ------
NM_017755chr52607 238 1177 1201 --
NM_017760chr71305 ------
NM_017762chr1572408 1934 661 654 570 417 385 2529 515 ----
NM_017769chr14123225 2911 2687 2632 2586 2555 2363 1194 1179 838 59 32 32195 935 544 12846 --
NM_017780chr83941 868 766 ----1603
NM_017798chr202364 353 1938 ----
NM_017799chr1461978 1786 1702 1289 1243 455 ------
NM_017801chr32985 325 --21715 1000 --
NM_017811chr983005 2802 2720 2149 1255 1026 226 176 32599 2407 336 33085 2609 2303 --
NM_017813chr8135663 5241 5179 3929 1733 1526 1495 1425 1057 969 788 569 208 13770 ----
NM_017824chr1082515 2473 2004 1935 1790 1780 562 216 ------
NM_017831chr18124686 4349 4269 4140 3560 3464 3339 3104 2932 1838 1054 571 --44262 3697 1591 1181 13409
NM_017848chrX154547 4024 3773 3589 3320 3283 3076 3023 1183 959 656 549 357 62 47 34272 1674 1555 24689 4323 13523
NM_017849chr272919 2835 2454 2227 2022 732 306 2827 531 1149 --
NM_017851chr1541151 513 219 157 1856 ----
NM_017860chr13299 133 83 1822 --1784
NM_017864chr8124 ------
NM_017890chr851696 1508 578 550 535 1735 ----
NM_017902chr10115733 5496 5216 5067 4592 4360 1771 1190 1092 1078 614 12189 ----
NM_017905chr134629 547 535 151 1176 ----
NM_017906chr6------2108 33
NM_017910chr22327 95 ------
NM_017911chr2231515 1050 579 11309 ----
NM_017913chr92437 77 ------
NM_017915chr124910 325 251 22 --1808 --
NM_017919chr9114422 4117 3667 2337 2272 1543 1118 767 628 433 52 --11534 --
NM_017922chr143550 422 415 ------
NM_017923chr4----1286 --
NM_017925chr951494 1386 536 456 258 ------
NM_017938chrX21743 1585 ------
NM_017944chr1132969 2463 308 32067 1991 1038 ----
NM_017952chr2104026 3938 3895 3696 1701 1630 1504 950 687 372 ------
NM_017958chr282769 2598 1855 728 654 582 451 116 1297 ----
NM_017964chr291014 1004 924 841 757 628 297 258 235 ----1220
NM_017974chr251246 1030 992 965 877 ------
NM_017987chr1092050 1971 1961 1884 894 655 557 498 406 12028 ----
NM_017988chr122661 67 ------
NM_017994chr741009 659 596 426 12068 11872 --
NM_017998chr911390 21311 306 ----
NM_018010chr361327 1146 492 452 356 161 --11360 11442
NM_018014chr25971 912 439 418 375 11006 ----
NM_018017chr10142743 2337 1034 901 804 675 617 513 485 362 329 310 296 146 42306 2246 2174 1856 ----
NM_018027chr1083277 3237 2740 2726 2652 2197 776 207 ------
NM_018028chr19--11291 ----
NM_018030chr184951 411 324 93 21121 400 ----
NM_018036chr14124496 4254 3855 3419 2986 1735 1438 1431 885 751 394 125 34281 1184 627 12959 12722
NM_018043chr1131437 1273 1201 ------
NM_018046chr531733 1469 149 ----1438
NM_018048chr1252048 1940 1782 613 370 1318 1823 --
NM_018061chr181496 1447 1377 1346 1207 1165 627 152 21753 1522 2655 292 1585
NM_018063chr102345 24 1428 ----
NM_018070chr11168 ------
NM_018084chr2123134 2877 2498 1126 1063 994 828 757 243 142 130 75 ------
NM_018085chr1116137 5205 3269 3233 3000 2937 2812 2662 2040 1206 900 38127 1555 701 36954 5973 2439 1964
NM_018086chr231828 1662 602 1141 ----
NM_018092chr1661616 1435 618 403 392 317 11152 ----
NM_018095chr112672 563 1167 ----
NM_018100chr653174 3090 2977 2636 2489 23268 293 1917 32892 1349 893
NM_018103chr12109 91 ------
NM_018105chr841258 1213 961 282 11176 ----
NM_018121chr1072838 2634 2316 1078 912 736 529 1334 32164 1147 1034 12010
NM_018126chr411261 11565 ----
NM_018131chr103861 761 114 --1150 --
NM_018133chr362130 1863 1760 1721 484 268 ----11438
NM_018139chr14123 ------
NM_018155chr3113442 2855 2560 2206 1224 1193 1043 868 772 560 397 --12186 23013 227
NM_018156chr142166 2025 661 563 32419 274 198 ----
NM_018157chr1283252 3154 2928 2155 2090 1295 1232 99 11994 --11059
NM_018159chrX21366 1321 ----11522
NM_018164chr12172 ------
NM_018167chr14--1372 --1218
NM_018179chr125617 423 238 205 30 ------
NM_018181chr184582 495 423 313 1440 ----
NM_018184chr342189 1923 1588 1458 --1470 --
NM_018195chr1161657 1642 1489 1367 1340 461 ------
NM_018196chrX41184 899 511 257 11153 ----
NM_018199chr145913 848 814 252 74 ------
NM_018200chr1562368 1603 1028 932 383 115 22491 1717 ----
NM_018202chr13749 347 283 1197 ----
NM_018211chr161577 1390 849 667 437 94 ------
NM_018216chr11218 ------
NM_018221chr24454 353 327 303 ------
NM_018222chr1131647 592 450 ------
NM_018227chr462675 2559 2376 2273 1167 1042 22476 857 13117 --
NM_018229chr1431014 923 383 1266 ----
NM_018237chr102239 96 ------
NM_018243chr453651 3571 3280 3019 77 23186 303 ----
NM_018246chr852793 2187 2026 2006 27 41982 1071 943 861 ----
NM_018247chr633018 1059 321 23080 907 ----
NM_018254chr1122359 2124 2081 1862 964 952 864 810 676 601 438 331 11608 ----
NM_018257chr2082510 2018 1854 1609 1029 855 738 718 ------
NM_018264chr72947 936 1739 ----
NM_018266chr321019 349 1709 2426 314 --
NM_018285chr152338 31 ------
NM_018287chr10------1959
NM_018290chr441173 1024 418 156 ------
NM_018293chr372567 2560 2268 2239 2048 1998 1810 1105 --1937
NM_018298chr11942 3375 265 25 1919 --
NM_018299chr8112988 2840 2729 2706 1092 1067 1027 567 201 128 87 ------
NM_018302chr471981 1934 1859 1726 1632 968 671 --1683 --
NM_018307chr173737 604 42 ------
NM_018312chr1152111 1983 1600 853 133 11411 ----
NM_018313chr362424 2264 1913 154 62 22 22121 594 11623 --
NM_018314chr114521 514 496 258 ------
NM_018315chr451539 1499 1034 376 302 ------
NM_018319chr1431319 208 159 11263 ----
NM_018321chr5170 ------
NM_018323chr441279 376 324 116 21510 489 ----
NM_018325chr961562 1118 452 400 364 262 21426 507 ----
NM_018327chr2021205 294 --21264 749 --
NM_018330chr1031631 517 428 163 --1480
NM_018334chr71476 ------
NM_018335chr141163 ------
NM_018338chr31166 ------
NM_018339chr981786 1700 1662 1500 1241 1166 659 439 11534 ----
NM_018340chr1673449 3387 1567 1453 1078 654 193 13775 24536 1416 --
NM_018348chr1631176 339 89 ------
NM_018351chr1294392 3960 3481 3339 3212 1608 747 733 603 1267 1511 14529
NM_018362chr11133960 3347 3126 2979 2973 1570 949 871 822 599 440 319 37 1340 12834 --
NM_018364chr194011 3854 3677 3576 3161 3041 3030 2986 412 11165 13401 --
NM_018373chr14176492 6086 5878 5593 5297 4998 4676 4046 2535 2000 1886 1791 1673 1624 1316 762 420 15251 --24316 2357
NM_018374chr7144829 4087 4029 3913 3736 3710 3200 1676 1507 764 753 493 420 202 44885 4684 3188 1017 1500 --
NM_018375chr1471326 1301 1294 758 584 459 229 --1644 1173
NM_018383chr211779 11954 1445 1823
NM_018388chrX21400 1125 11169 ----
NM_018403chr3124143 3880 2620 2582 1579 1510 1492 1134 763 711 491 428 11461 ----
NM_018416chr1282541 1931 1912 994 850 795 577 222 1371 12277 --
NM_018423chr1231089 851 128 1270 ----
NM_018429chr551070 875 414 150 108 11966 22115 1807 --
NM_018431chr204634 612 241 165 ------
NM_018439chr1881731 1680 779 483 420 410 319 251 22303 1966 ----
NM_018440chr8207217 7102 6869 6174 6133 5883 5491 3178 3102 2989 2838 2575 2517 2285 2220 1834 883 527 506 104 46816 6654 1638 730 ----
NM_018444chr861760 748 675 480 269 237 ------
NM_018445chr152516 508 ------
NM_018448chr1241007 465 365 228 --11065 --
NM_018465chr9------1200
NM_018469chr1731377 939 284 ------
NM_018482chr852599 1816 831 592 514 --22206 449 --
NM_018489chr121854 1789 11999 11803 --
NM_018490chr1121184 677 21422 1226 ----
NM_018509chr1761228 694 675 515 489 85 --21509 1374 --
NM_018553chr1751402 1144 673 317 252 ----11575
NM_018555chr191408 1611 ----
NM_018557chr271542 1442 1434 1306 289 255 108 --11377 --
NM_018559chr132101 72 ------
NM_018566chr174430 4309 1673 1601 1163 1031 118 24881 1751 ----
NM_018584chr131106 963 898 11130 ----
NM_018590chr1031518 1275 133 11110 ----
NM_018638chr12125547 4970 4568 3977 3875 3847 3658 3499 2154 1024 1011 830 11044 ----
NM_018639chr1271476 1395 1343 1214 1129 906 111 ------
NM_018640chr1292563 2405 2307 2166 1961 784 759 567 47 1728 1846 --
NM_018649chr101456 1235 ----
NM_018650chr152073 1765 1691 475 454 12108 ----
NM_018682chr75662 283 200 164 101 ------
NM_018683chr2041706 1165 648 443 --1180 --
NM_018685chr751048 1006 954 784 474 ------
NM_018686chr12158 ------
NM_018689chr1562529 2316 2109 1016 470 344 --1630 --
NM_018691chr561187 1011 988 850 814 96 ----1900
NM_018695chr5112099 2063 2004 1980 1844 1813 1719 1621 773 390 349 ------
NM_018698chrX31907 1213 110 ------
NM_018700chr541278 1155 1143 257 --11346 --
NM_018704chr142044 1319 518 507 ------
NM_018710chr881374 1173 991 291 231 139 129 71 ------
NM_018712chr1131478 525 379 1274 ----
NM_018713chr131083 980 150 144 --1780
NM_018717chr482732 2690 2531 2474 2084 981 906 888 1408 ----
NM_018718chr772246 2224 1756 1720 930 882 298 32005 1557 1500 ----
NM_018723chr16192 ------
NM_018841chr1113764 3669 3240 2972 2911 1456 1275 559 473 404 181 1299 ----
NM_018845chr1--1205 ----
NM_018846chr76997 977 863 727 184 150 ------
NM_018847chr941962 1830 1383 21 --1134 --
NM_018898chr52940 634 --12047 --
NM_018899chr52940 634 --12047 --
NM_018900chr52940 634 --12047 --
NM_018901chr52940 634 --12047 --
NM_018902chr52940 634 --12047 --
NM_018903chr52940 634 --12047 --
NM_018904chr52940 634 --12047 --
NM_018905chr52940 634 --12047 --
NM_018906chr52940 634 --12047 --
NM_018907chr52940 634 --12047 --
NM_018908chr52940 634 --12047 --
NM_018909chr52940 634 --12047 --
NM_018910chr52940 634 --12047 --
NM_018911chr52940 634 --12047 --
NM_018931chr53665 320 36 ------
NM_018934chr52148 138 ------
NM_018940chr54461 426 397 84 11134 ----
NM_018945chr6133726 3581 3568 3294 3105 2812 2387 2269 1446 751 727 642 530 2567 122 ----
NM_018948chr121331 569 1951 1498 --
NM_018958chr15114080 3978 3856 3847 3831 3178 2731 2570 1342 839 249 1620 --13608
NM_018970chr762806 2682 2641 2469 245 21 21247 408 ----
NM_018976chr1252757 1872 484 478 286 1642 ----
NM_018979chr1272610 2514 1876 1607 903 803 773 1507 ----
NM_018992chr1621626 1615 ----11064
NM_018994chr14568 384 115 36 1449 ----
NM_018999chr1084606 3265 3118 1635 1394 1263 374 349 ----13285
NM_019000chr541521 1078 1057 338 1116 ----
NM_019001chr3114688 4650 4235 3965 3625 3406 1565 1266 1190 1036 708 53162 1840 1131 634 555 ----
NM_019002chr21106 ------
NM_019004chr762108 963 521 385 371 190 11962 ----
NM_019006chr153258 238 220 ------
NM_019022chr18113212 2883 2497 2476 2207 2109 1250 837 774 440 86 13126 ----
NM_019027chr4102618 2555 2530 2447 1918 1884 1014 864 700 249 12489 ----
NM_019028chr112341 169 ------
NM_019035chr431997 1855 829 1457 ----
NM_019036chr64952 905 878 809 1965 ----
NM_019041chr652463 2298 1620 707 508 ------
NM_019044chr253991 3000 1395 268 41 23897 1150 ----
NM_019050chr4121984 1765 1695 916 895 836 799 767 618 608 294 118 1283 ----
NM_019053chr1051012 985 974 930 437 1379 2431 225 --
NM_019063chr251959 842 779 554 180 12207 12026 --
NM_019072chr573939 3890 3747 3648 1669 551 361 24042 3586 --12920
NM_019083chr151457 1261 1150 354 136 21052 203 ----
NM_019084chr1072378 2322 2120 2073 1688 793 409 2697 555 ----
NM_019087chr561695 1574 1554 1291 1228 651 11147 ----
NM_019091chr23814 724 171 ------
NM_019114chr9142152 2142 2130 2103 2009 1941 1798 1783 1030 957 479 427 330 155 --12536 --
NM_019117chrX83199 2554 2352 1316 1244 1185 542 464 11221 ----
NM_019555chr331647 696 145 ----11701
NM_019590chr1041516 452 446 338 ------
NM_019592chr93694 651 170 ----1272
NM_019593chr2062829 2042 1034 761 368 203 ------
NM_019594chr92652 338 21481 1410 ----
NM_019605chr11688 ----1649
NM_019610chr121573 757 11587 ----
NM_019842chr62142 36 ------
NM_019885chr222640 2037 --1361 --
NM_019891chr151318 1066 307 202 55 31206 983 276 --1834
NM_020066chr12799 654 ------
NM_020122chr2186000 5076 4738 4552 4464 2315 2244 2114 2063 1855 1640 1312 1096 1056 1047 737 677 402 15932 ----
NM_020127chr151543 1408 1181 714 85 ----1215
NM_020144chr751722 1336 848 791 366 1639 11442 --
NM_020147chr152225 48 ------
NM_020148chr1852998 2842 2309 1032 295 1262 ----
NM_020150chr1041586 1522 790 774 --11836 --
NM_020152chr212711 266 1840 ----
NM_020156chr7--1401 ----
NM_020159chr441679 1574 1159 1144 1304 ----
NM_020168chr15--11237 ----
NM_020177chr593113 3001 2503 2281 2177 1219 1184 1110 323 33158 2720 671 22463 1028 --
NM_020186chr71119 ------
NM_020193chr1131035 972 948 ------
NM_020198chr1751470 1289 1228 1132 580 11484 1317 --
NM_020199chr51298 61104 497 487 445 256 131 --1179
NM_020204chr12766 191 ------
NM_020205chr1103259 3198 2804 1343 1291 1104 909 745 409 131 ------
NM_020207chr92866 125 21262 534 ----
NM_020226chr42712 653 ------
NM_020228chr1191971 1740 1734 1013 986 466 309 280 171 1604 ----
NM_020235chr33333 307 56 ------
NM_020239chr122326 1683 22198 534 22232 2215 --
NM_020240chr592512 2463 2189 2167 1899 1812 1067 984 856 31739 602 162 --1140
NM_020245chr6115037 4420 3857 3403 1909 1855 1674 972 580 421 194 ----2352 43
NM_020320chr6121 ------
NM_020336chr20143819 2993 2807 2717 2631 1264 1048 706 387 302 268 252 235 168 --12867 --
NM_020338chr1013311 ------
NM_020341chr2041364 635 591 571 ------
NM_020342chr282108 2082 1955 1641 433 387 299 187 11948 12228 --
NM_020346chr1161637 1611 1438 1413 1245 28 ------
NM_020347chr382279 2169 2001 1906 1658 1516 457 255 1277 11968 --
NM_020357chr321654 1229 31076 295 89 11351 --
NM_020381chr641491 707 120 93 21753 547 ----
NM_020382chr121221 1311 ----
NM_020390chr3144838 4703 4659 3992 1849 1825 1727 1601 1508 1097 792 608 551 312 23493 1572 13557 --
NM_020405chr1794224 3275 1440 1287 998 871 644 323 21 1357 --12994
NM_020420chrY51610 1602 1510 1193 703 21519 59 ----
NM_020425chr671885 1563 1470 736 666 565 29 ----11667
NM_020429chr772396 1973 714 610 333 267 198 --1261 --
NM_020432chr782175 1761 751 738 435 383 192 186 21986 391 ----
NM_020440chr133086 515 376 12158 ----
NM_020443chr1126752 6561 6077 5911 5466 5066 5033 2453 1466 1040 255 169 1989 14882 --
NM_020445chr7----1702 --
NM_020449chrX--1308 1261 --
NM_020452chr152047 1606 1325 550 539 ------
NM_020463chr21522 21254 1108 2549 215 --
NM_020466chr6125044 3861 3739 3701 3614 3489 3346 3198 3164 3116 3078 334 23830 1987 14913 --
NM_020473chrX41734 1491 397 304 21621 96 ----
NM_020474chr1852009 1682 1406 675 332 ----11982
NM_020482chr61841 193 ----
NM_020529chr141468 ------
NM_020532chr24582 135 128 35 ------
NM_020638chr1261722 1326 335 326 168 25 12014 ----
NM_020640chr352224 2000 739 614 430 1655 ----
NM_020647chr882266 1792 1469 836 792 441 214 80 11974 ----
NM_020648chr1882848 2757 1941 709 542 239 220 134 31774 640 120 ----
NM_020651chr231448 1360 421 --21384 277 11340
NM_020652chr172485 164 ------
NM_020654chr341566 1455 1359 587 ------
NM_020655chr1621427 193 ------
NM_020661chr1251968 1958 775 381 147 11882 1307 --
NM_020673chr20127721 7695 7679 6143 5907 5703 5213 4778 2670 2273 1330 1082 35055 4899 4797 11257 --
NM_020686chr1662829 2780 2566 2486 2352 2269 ------
NM_020689chr2021256 518 1667 ----
NM_020697chr851108 517 493 199 148 2171 159 ----
NM_020699chr1175202 5191 5017 4827 4811 4702 4410 4159 3277 1716 1676 965 386 266 247 188 40 ------
NM_020708chr2072481 2444 2345 2170 2125 1674 690 22499 2229 ----
NM_020711chr282107 2028 1635 1006 825 658 445 223 ------
NM_020717chrX54720 4194 3595 721 690 --13743 13611
NM_020718chr16156501 6295 5652 5621 5107 4891 4704 4672 4041 2566 2061 1668 1476 1370 883 46426 5965 1765 327 22374 280 --
NM_020727chr21143689 3472 3407 3394 3144 2807 2579 2542 1425 1370 1252 476 367 189 31522 378 176 --13647
NM_020728chr793200 2979 2966 2718 2642 2270 1060 942 371 ------
NM_020732chr631324 857 844 --1216 --
NM_020734chr1271293 929 849 755 531 497 254 ------
NM_020739chr15154181 4101 3872 2986 2936 1364 1305 1247 868 683 615 557 311 303 236 11128 ----
NM_020742chrX62607 2450 2421 2415 1910 686 11992 1716 --
NM_020747chr51251 1833 ----
NM_020748chr1762181 1589 1547 1356 568 332 1195 ----
NM_020749chr861680 1651 1324 1317 1304 352 21925 1448 ----
NM_020752chr10102659 2477 2122 2076 2058 1004 670 583 480 196 --1739 --
NM_020754chr341241 1145 443 349 1280 --1479
NM_020755chr651563 1542 1104 606 338 11371 ----
NM_020760chr241966 801 576 317 --1101 --
NM_020766chrX134607 4568 4541 3617 3444 2984 2934 1805 1566 938 636 397 209 ------
NM_020768chr583192 2946 2292 2154 2107 1207 365 224 22748 1093 11193 --
NM_020771chr641431 1197 523 166 1432 ----
NM_020772chr17188538 8038 7893 7703 7602 7593 7587 6212 5435 2797 1702 1639 1558 1242 1079 1012 575 72 48186 7277 7111 2495 26795 5539 16059
NM_020773chr482634 2448 1722 939 400 286 162 106 11000 ----
NM_020774chr18256283 5953 5643 5544 5456 5346 5148 5074 4910 4816 4127 3951 2486 2411 2387 2199 2127 2075 1567 1454 1298 1289 1073 268 113 25530 1191 1246 14204
NM_020778chr1584965 4495 4332 1868 757 621 412 174 --13366 21532 1263
NM_020779chr272732 2678 2347 2092 937 869 501 12392 1602 --
NM_020782chr12104649 4193 4051 3962 3934 3884 3434 1529 869 543 24086 1893 ----
NM_020783chr1862005 1999 1623 900 791 431 12154 ----
NM_020791chr1711006 ------
NM_020792chr382667 2660 2459 2104 376 307 147 75 2338 57 12405 1949
NM_020794chr131300 383 332 ------
NM_020796chr593021 2818 2308 2182 2145 1969 836 701 664 ----11067
NM_020801chr542328 1861 764 220 32345 1651 158 ----
NM_020802chr1183391 2799 2299 2061 1020 615 395 332 22164 1193 ----
NM_020806chr143615 329 157 --1283 --
NM_020809chr1132236 150 77 1256 --11637
NM_020810chr1463634 2923 758 357 341 77 --11349 --
NM_020815chr4140 --1381 --
NM_020819chr631192 862 796 ------
NM_020821chr1531251 588 112 --2160 106 11432
NM_020824chr103694 529 489 ------
NM_020825chr16103736 3157 3047 2944 2928 2546 1213 1016 943 802 --11530 --
NM_020830chr242637 1196 972 296 12202 ----
NM_020834chr1431839 1607 1369 11395 ----
NM_020841chr12123766 3481 3388 2965 2936 2792 2510 1161 1021 908 154 79 1915 ----
NM_020844chr8217658 7641 7339 6964 4908 2839 2814 2725 2582 2575 2415 2309 2182 1729 1489 1314 1238 1204 707 363 113 35561 4839 2660 --25461 2860
NM_020853chr1241105 1058 880 381 11893 ----
NM_020854chr1831266 562 151 ------
NM_020860chr4193 ------
NM_020861chr62889 520 1261 ----
NM_020868chr272010 1861 1762 1387 694 621 434 11689 ----
NM_020870chr462262 1904 1838 1609 565 524 1362 ----
NM_020871chrX112433 2002 1963 1650 996 855 746 675 460 382 179 --32157 1024 523 --
NM_020873chr36732 719 566 352 266 151 1827 ----
NM_020888chr111967 --11360 --
NM_020892chr71353 ------
NM_020909chr294031 3966 3957 3578 3269 2888 2882 2839 234 --11143 --
NM_020918chr10103406 3149 2996 2835 1144 1119 590 521 441 315 13377 12925 --
NM_020921chr1463677 2640 2430 2418 1077 1037 32726 1281 796 ----
NM_020922chrX41504 1393 1373 406 31450 1421 121 11540 --
NM_020925chr11581 21237 979 ----
NM_020935chr2144670 4595 4570 4558 4533 4501 4388 4334 2900 1483 1458 1230 473 186 23638 716 1467 --
NM_020940chr1052417 2398 2101 1896 651 12387 1351 --
NM_020948chr1163664 3458 3439 3343 2981 2941 2378 1468 1402 774 678 495 455 266 194 129 128 ----
NM_020951chr1951806 1502 971 912 530 1115 ----
NM_020960chr953519 1742 1105 414 170 1513 14054 24673 4381
NM_020962chr1552458 2281 2262 395 133 ----1114
NM_020975chr1021614 696 ------
NM_020980chr15--1699 ----
NM_021003chr14173 ------
NM_021005chr153917 739 188 ------
NM_021007chr222100 1667 1640 1920 --
NM_021012chr1732468 783 124 ----1772
NM_021025chr51496 1363 ----
NM_021033chr13102780 2719 2684 2323 1166 1160 990 776 393 215 1675 12915 --
NM_021035chr2071332 1319 1006 987 407 142 101 --1438 --
NM_021061chr8174501 4421 4183 4143 4121 4083 3249 1613 1214 1165 999 960 947 887 815 274 108 23234 3107 ----
NM_021072chr562119 2062 686 313 300 243 1118 ----
NM_021079chr1743269 2589 808 397 ----22604 927
NM_021083chrX73338 3203 2513 1130 1106 688 134 33499 866 832 ----
NM_021090chr2284518 1889 1117 998 751 658 634 474 22008 92 --11020
NM_021096chr2243030 1023 554 52 1704 ----
NM_021097chr272696 2502 2396 2352 2285 1912 762 ------
NM_021101chr342264 697 510 501 1740 ----
NM_021104chr121292 ------
NM_021109chrX----168 --
NM_021109chrX----168 --
NM_021111chr911355 1330 ----
NM_021116chr767614 7314 6622 6275 5968 908 ----13635
NM_021120chrX22274 1044 1120 ----
NM_021127chr1831325 1258 195 11361 ----
NM_021133chr141673 1659 1333 79 --11091 --
NM_021136chr141148 ------
NM_021137chr1762328 2049 1814 1730 1713 583 --11883 --
NM_021140chrX3817 431 296 1992 ----
NM_021155chr19102621 2332 2278 2000 979 961 747 555 509 372 --1215 1100
NM_021159chr421562 548 21265 578 ----
NM_021161chr14197 ------
NM_021167chr792844 2785 2720 2325 2183 1855 661 646 186 22422 2285 --1336
NM_021174chr8----1289 --
NM_021180chr11753 ------
NM_021183chrX92328 2255 834 494 389 325 255 239 169 173 ----
NM_021190chr11534 11330 11056 --
NM_021205chr172714 2613 2367 1816 754 159 79 12599 12235 --
NM_021237chr32306 280 ------
NM_021238chr1272088 1660 1291 593 492 253 247 --11395 --
NM_021239chr144958 576 203 52 11383 ----
NM_021249chr1451710 1416 541 338 268 ------
NM_021252chr1091477 1389 1334 798 700 494 233 81 68 ------
NM_021255chr14113905 3759 3636 3602 3260 3019 3011 1409 954 900 694 23459 640 22870 1303 --
NM_021269chr1982081 1862 1573 670 615 351 101 34 11892 ----
NM_021572chr61883 ----1981
NM_021614chr5264 58 ------
NM_021622chr1072357 2161 2018 356 185 131 95 ------
NM_021629chr395119 4880 4725 3846 3226 1337 1076 1059 614 23695 3101 ----
NM_021633chr141374 1310 544 265 --11129 11039
NM_021638chr4105026 4632 4494 4441 3150 947 671 598 212 192 ------
NM_021639chr13888 825 798 1841 ----
NM_021643chr231331 668 437 ------
NM_021644chr1031010 955 426 1336 ----
NM_021645chr1332390 877 712 1169 152 1781
NM_021647chr4164657 4578 4323 4285 4174 3976 3873 3804 3651 3617 3432 1035 907 560 457 372 24337 1261 12911 --
NM_021705chr641290 1096 191 103 ----11456
NM_021722chr7150 ------
NM_021723chr7150 ------
NM_021728chr142376 65 1226 1750 --
NM_021809chr2051680 993 978 896 298 --21782 1557 --
NM_021813chr675254 3915 3705 2209 2065 1967 966 11623 1944 --
NM_021818chr143341 157 101 --11414 --
NM_021825chr111169 1145 ----
NM_021911chr565298 5012 4395 2055 1934 594 21779 1233 ----
NM_021912chr1531196 1098 431 ------
NM_021914chr1452010 1712 468 237 200 --11650 --
NM_021931chr2031151 1002 774 ------
NM_021943chr632147 2075 128 ------
NM_021947chr172463 160 140 ----
NM_021951chr92792 171 --1345 --
NM_021954chr13113485 3355 3146 2875 2530 1143 969 931 862 465 257 --1356 --
NM_021960chr172811 2333 1898 1820 561 544 30 --12042 1270
NM_021961chr11207197 6933 6778 6770 6597 6479 6346 5917 5886 5680 5661 4945 2711 2441 1355 1144 1086 662 458 386 1500 35099 5009 2639 --
NM_021963chrX1160 ------
NM_021964chr3206253 6134 5749 5694 5615 5502 4723 4590 4573 2533 2334 2271 1851 1706 1397 981 804 671 517 206 106203 4450 4303 4191 4166 2383 2221 1063 233 38 ----
NM_021970chr43587 516 87 170 ----
NM_021988chr2021094 527 ------
NM_021998chrX61218 1210 1093 461 390 173 1402 ----
NM_021999chr134794 274 194 58 1556 ----
NM_022041chr1682738 2674 2065 1766 381 156 123 107 12030 ----
NM_022048chr15116110 5532 5316 5034 5020 4708 4572 4329 3964 831 94 36027 5851 5264 24566 756 --
NM_022049chr141484 585 230 180 2466 245 11296 --
NM_022051chr1----1710 --
NM_022063chr102547 158 21637 1474 11794 --
NM_022085chr651435 1239 290 255 177 ----1992
NM_022091chr621813 934 12436 ----
NM_022114chr133396 1787 629 13562 --14245
NM_022116chr76938 338 292 247 54 46 ------
NM_022118chr132614 72 ------
NM_022123chr142483 73 1509 ----
NM_022133chr871858 1486 1440 1333 719 408 186 1550 ----
NM_022137chr1422045 135 ----1277
NM_022143chr711471 1395 ----
NM_022145chr53567 193 121 1283 ----
NM_022154chr461306 1085 1011 870 502 357 --1232 --
NM_022156chr17171 ------
NM_022162chr1641082 977 763 155 ----1803
NM_022166chr16106366 5625 5290 4881 2460 2388 2288 2162 1674 1601 35784 4538 1578 2576 186 --
NM_022170chr751764 1673 374 363 167 1381 ----
NM_022340chr373575 3395 3249 2700 2521 1175 811 3947 756 425 2438 25 --
NM_022346chr45971 914 286 139 27 11048 ----
NM_022351chr8113853 3510 3339 3161 1542 1332 1320 1214 1156 176 22 13370 1258 22749 360
NM_022373chr75967 668 363 306 126 ------
NM_022442chr2021094 527 ------
NM_022456chr12156713 5757 5172 5085 5039 4829 2759 2644 2125 1855 1798 912 572 182 150 16891 11972 --
NM_022458chr753057 2432 981 943 628 --23150 2447 --
NM_022459chr13206087 5771 5660 5611 5339 5275 5175 4901 4724 4417 4158 2454 2328 2224 2115 1976 1818 935 618 324 11259 15199 1225
NM_022465chr1272878 2846 2648 2583 579 451 350 12077 ----
NM_022473chr15144473 3695 3598 3205 2908 2882 2793 2739 1625 1314 820 749 410 176 --1629 13228
NM_022474chr1462764 2513 1825 545 208 188 --12154 --
NM_022475chr42685 112 ------
NM_022476chr161424 ------
NM_022484chr721337 1030 ------
NM_022491chr1273347 3007 858 355 282 274 146 ------
NM_022550chr52466 56 ------
NM_022648chr2123942 3820 3719 3651 3322 2822 2806 1803 1288 905 626 99 ------
NM_022652chr1261002 984 816 790 751 333 1190 ----
NM_022658chr1251280 1133 859 187 98 1392 --1171
NM_022716chr132174 1961 465 22440 1986 22235 2062 --
NM_022720chr2241362 581 336 151 ------
NM_022725chr1151852 1696 857 589 399 21703 109 1342 1648
NM_022728chr71260 ------
NM_022735chr161696 1659 714 550 182 167 --11849 --
NM_022739chr1761116 919 833 768 200 140 ------
NM_022753chr1112768 2388 2318 2230 1943 1087 904 828 770 463 410 11760 12035 --
NM_022755chr942489 502 414 108 --187 --
NM_022763chr352974 2781 2389 324 270 13078 1975 --
NM_022770chr1631278 1230 228 11143 ----
NM_022780chr241881 736 591 350 11798 ----
NM_022781chr9102994 2756 2436 2142 947 743 716 331 229 100 --1319 --
NM_022782chr121320 ------
NM_022802chr1041658 1097 1004 293 ----11470
NM_022817chr272241 2073 1493 819 803 578 256 1127 --12301
NM_022818chr1641627 1429 1092 461 21232 198 ----
NM_022824chr581610 1497 1462 1273 778 746 265 235 ------
NM_022826chr22843 440 --1252 1964
NM_022828chr551600 1472 1263 700 514 2392 130 --1117
NM_022832chr452363 2099 388 335 254 --22394 481 --
NM_022841chr1561939 1783 1108 1032 356 288 ----1392
NM_022843chr1371466 1161 1094 1017 1005 607 373 147 11403 --
NM_022845chr164822 617 264 35 1437 ----
NM_022893chr263182 3010 2940 2839 2021 241 1552 1912 --
NM_022898chr14104709 4568 3874 3249 1450 1235 503 406 303 209 11709 11025 13978
NM_022900chr731121 850 44 ------
NM_022912chr292752 2001 1041 980 531 434 296 240 211 2706 362 22629 2134 --
NM_022918chr1151710 802 397 345 167 ------
NM_022977chrX51749 1702 1642 1071 74 --1223 11945
NM_023012chr122777 233 ------
NM_023037chr131750 21151 346 ----
NM_023076chr1631886 1844 995 ----1927
NM_023079chr1741844 1789 1226 250 --21192 278 --
NM_023929chr8122846 2616 2601 2423 2386 2280 2159 2110 1953 1053 886 863 12839 ----
NM_024007chr552733 865 789 319 88 21124 512 --11970
NM_024057chr122134 42 1114 ----
NM_024063chr15------179
NM_024068chr12196 ------
NM_024082chrX1140 ------
NM_024089chr131204 1181 ----
NM_024090chr461828 1486 1440 1398 1334 250 --1183 --
NM_024095chr1241348 1231 444 403 11402 2356 277 --
NM_024107chr17141 --1241 --
NM_024117chr951382 475 445 415 395 ------
NM_024308chr17165 ------
NM_024312chr1221293 226 11527 ----
NM_024315chr72330 185 ------
NM_024345chr9185963 5899 5809 5372 5244 4511 4449 4215 4208 3822 2129 1579 1470 1320 1135 799 604 515 55950 5070 2175 1931 83 ----
NM_024408chr173397 2825 2613 1470 627 569 532 1671 22704 2400 --
NM_024411chr2031508 1462 566 21444 553 ----
NM_024416chr92457 374 11187 ----
NM_024420chr11322 ------
NM_024423chr1884136 3232 3200 3137 2963 1716 1227 487 21700 722 ----
NM_024430chr1831746 1476 380 1133 31886 1160 374 --
NM_024511chr4103333 3089 2947 2266 1258 1245 1177 493 41 24 2837 297 1767 --
NM_024520chr23192 112 32 ------
NM_024524chr383096 2915 2615 1960 1293 827 287 58 12835 ----
NM_024529chr14870 816 408 94 1278 ----
NM_024539chrX31247 382 316 21106 244 ----
NM_024546chr1331171 1040 111 --1428 --
NM_024556chr111462 ------
NM_024569chr142141 1185 590 462 --1553 12065
NM_024582chr42797 311 ------
NM_024583chr23872 408 258 ------
NM_024584chr281238 976 903 849 843 375 358 202 ------
NM_024586chr11568 1502 174 --
NM_024596chr875258 4825 1778 699 642 532 397 155 1961 --
NM_024607chr884244 3968 3718 3613 1618 987 931 427 14265 ----
NM_024612chr172750 399 ------
NM_024613chr871852 1656 1516 1286 466 250 54 ------
NM_024616chr341451 1400 1317 425 1610 1452 --
NM_024617chr92853 758 ------
NM_024624chr271643 1584 1534 1331 1179 538 120 ------
NM_024626chr141174 636 533 381 11638 ----
NM_024632chr51191 ------
NM_024638chr352391 1958 1657 961 226 1653 2443 250 --
NM_024639chr642680 1899 1007 976 1893 1721 12279
NM_024640chr14946 849 781 119 ------
NM_024646chr183953 3265 3071 2771 1584 1160 1092 211 13430 1225 --
NM_024665chr3154670 4620 4582 4409 4072 3206 3190 2984 1424 1398 1147 698 570 554 359 14156 24351 1703 13109
NM_024674chr143101 2885 2261 326 12469 23094 2588 --
NM_024692chr261761 1285 374 230 193 151 ------
NM_024713chr1541633 1299 255 126 11517 21351 1154 --
NM_024719chr13192 ------
NM_024721chr862209 1911 1888 1851 751 501 ------
NM_024731chr161119 ------
NM_024740chr11143766 3548 3525 3492 3245 3106 2740 2603 2563 1061 951 721 673 558 23586 1418 ----
NM_024744chr262541 2485 2301 621 592 125 11768 ----
NM_024749chr152244 1730 1520 1509 297 12165 --11654
NM_024751chr482090 1862 1842 1807 1582 1391 549 364 ------
NM_024755chr151186 --1750 --
NM_024763chr141025 449 370 149 ------
NM_024770chr2116757 6656 5965 2649 1951 1726 1601 1399 680 555 141 ------
NM_024772chr11409 ----1123
NM_024811chr1141845 1724 538 522 ------
NM_024812chr841894 1595 807 626 --11719 --
NM_024814chr7161 ------
NM_024828chr94312 174 126 26 11202 ----
NM_024831chr84643 255 219 77 ----1184
NM_024834chr1051877 1530 772 463 174 ----11479
NM_024852chr12609 586 1552 ----
NM_024884chr14153937 3861 3623 3606 3060 1806 1589 1415 1342 1100 920 368 105 98 71 33774 3670 1739 ----
NM_024920chr461123 985 295 194 160 38 --2389 27 --
NM_024930chr562732 2269 1845 503 242 233 11972 22493 669 --
NM_024944chr2141302 1102 408 321 ------
NM_024947chr3259622 9476 9160 9109 9070 8879 8831 8228 8044 7803 7742 7477 6535 6276 6232 3431 2746 2329 2290 1966 1564 1412 1299 934 332 36219 1804 1240 --26011 506
NM_024949chr474511 1715 1298 1059 588 378 132 ------
NM_024953chr1242669 2039 1013 145 ------
NM_024979chr1361649 602 471 420 410 403 ------
NM_024989chr2156000 5939 5859 5445 5413 5191 4948 2973 2829 2650 2354 1949 1928 1328 444 12031 36918 1176 509 23123 99
NM_024991chr1042876 2414 2299 69 12215 --1795
NM_024993chr221284 481 11298 ----
NM_025027chr193990 953 737 --1303 --
NM_025040chr1952028 1706 983 455 220 --2628 210 --
NM_025047chr32328 188 ------
NM_025054chr883932 3396 2850 1661 1600 915 838 168 14005 13184 --
NM_025057chr1451112 1055 918 902 75 ------
NM_025073chr1124296 4210 4038 3772 3267 1754 1713 747 563 557 376 232 --11840 11734
NM_025076chr22512 467 ------
NM_025099chr1741066 910 458 144 1871 1888 11026
NM_025126chr122750 643 ------
NM_025133chr22369 206 1845 ----
NM_025134chr1661956 1815 1712 1569 770 50 ------
NM_025135chr18--1453 ----
NM_025138chr1341494 1402 1084 318 ------
NM_025146chr361784 786 626 451 434 91 --1490 1730
NM_025147chr23310 113 39 --154 --
NM_025151chr872089 1941 1433 741 228 205 183 ------
NM_025160chr184087 4029 3332 2973 2956 1405 1346 1309 11081 11569 --
NM_025181chr21618 ------
NM_025191chr193055 2977 2664 2651 2480 2468 2458 2443 1069 13185 12147 --
NM_025205chr42234 118 ------
NM_025208chr1122345 363 2677 405 143 --
NM_025221chr4----178 --
NM_025222chr342290 1073 1051 117 12872 --12007
NM_025235chr10111542 1502 1452 1409 767 700 630 549 358 281 77 2852 468 ----
NM_025238chr1531591 1508 1193 ------
NM_025244chr2189 ------
NM_030579chr16153580 3199 3029 2528 2387 1468 1378 994 944 670 589 483 410 312 38 1880 ----
NM_030621chr14143703 3561 3485 3318 3226 3168 2813 1327 1305 1093 903 693 619 201 22600 1279 14211 --
NM_030623chr251291 1238 1135 500 37 ------
NM_030625chr1072138 2066 2001 1820 789 507 29 42150 1995 920 332 --12612
NM_030627chr574166 3194 2732 1475 1140 978 385 --13769 11124
NM_030629chr1651695 1313 329 310 218 --1198 --
NM_030631chr142589 532 ------
NM_030634chr191774 1667 1620 927 758 703 603 168 89 1396 ----
NM_030636chr782097 1932 906 675 486 439 243 95 --11844 --
NM_030647chr7156248 6118 5561 5278 5257 5170 4292 2526 2365 2356 2184 2143 1378 1084 369 25753 5729 --134
NM_030648chr4155341 5224 4973 4932 4392 3895 1264 1037 592 513 484 477 447 345 259 23765 1869 14371 11372
NM_030650chr2123633 3546 3343 3187 3010 1708 1251 1217 985 654 442 349 23374 3017 --1249
NM_030660chr1441332 1247 1019 76 --21062 112 --
NM_030664chr1062393 962 856 847 619 420 ------
NM_030674chr12185561 5555 5437 4847 4839 4514 4295 4204 4158 3943 3872 2331 2083 1857 1058 1047 953 928 25663 415 14668 --
NM_030753chr171252 ------
NM_030755chr1441968 1219 738 517 32745 486 350 ----
NM_030758chr222967 427 21474 377 ----
NM_030762chr1251703 1248 510 433 104 1444 1318 1545
NM_030769chr1--181 ----
NM_030771chr11126 ------
NM_030774chr1131103 563 30 ------
NM_030780chr881467 1455 1303 1288 1130 1074 403 377 ------
NM_030784chr62408 42 ------
NM_030786chr131821 1453 493 11907 --174
NM_030789chr20--1272 ----
NM_030791chr1461731 1625 1454 1336 1187 177 21250 626 ----
NM_030803chr251246 1030 992 965 877 ------
NM_030806chr1118917 8742 7018 6511 3749 2993 1816 1808 1130 958 843 37283 5959 502 17698 11648
NM_030808chr1741106 993 887 363 1760 ----
NM_030809chr1272476 2160 1779 1700 1655 971 123 --12468 --
NM_030810chr651435 1239 290 255 177 ----1992
NM_030816chr151474 1381 923 436 421 23271 1346 1670 --
NM_030817chr1283788 3671 3236 3193 2795 2534 1397 254 42994 2729 2689 2670 ----
NM_030820chr63919 649 302 1683 ----
NM_030885chr391842 923 659 366 355 314 298 266 228 12294 31631 524 384 --
NM_030906chr111507 --1110 --
NM_030912chr101633 ------
NM_030916chr14948 747 135 58 1823 ----
NM_030918chr195454 5210 4598 4405 4390 1520 1286 694 443 13836 24908 4576 --
NM_030920chr191929 1892 1748 1475 779 745 447 313 286 1428 ----
NM_030934chr131520 565 331 --11803 --
NM_030938chr172790 363 --1723 --
NM_030939chr621110 1072 ----11144
NM_030940chr971308 1185 1155 992 497 226 53 1233 ----
NM_030952chr131318 1161 423 ------
NM_030953chr531636 322 270 31392 649 53 ----
NM_030958chr8--1398 ----
NM_030964chr573371 1254 1215 465 407 200 88 13663 23076 3068 --
NM_031157chr121205 1133 ----
NM_031216chr1862014 1620 1514 426 360 157 ------
NM_031217chr111213 ------
NM_031243chr752023 1764 937 441 247 1710 11896 1719
NM_031244chr62925 851 ------
NM_031262chr91142 ------
NM_031263chr91199 ------
NM_031266chr51364 ------
NM_031268chr1685351 3551 3325 1637 1355 1304 1295 431 --11459 --
NM_031271chr871592 1248 1233 1180 1091 266 132 ------
NM_031291chr44614 555 515 209 ------
NM_031296chr452558 2269 960 619 366 1606 ----
NM_031302chr124364 94 79 54 ------
NM_031314chr1461324 1262 253 236 188 42 --11753 --
NM_031362chr252492 2202 981 958 295 12514 ----
NM_031365chr262628 2338 1117 1094 431 149 12650 ----
NM_031366chr262628 2338 1117 1094 431 149 12650 ----
NM_031369chr41695 2791 660 ----
NM_031370chr41695 2791 660 ----
NM_031372chr471711 1542 682 633 501 398 186 11219 ----
NM_031411chr52940 634 --12047 --
NM_031418chr1132417 932 702 22403 417 1615 12703
NM_031419chr331198 1135 369 ----11513
NM_031422chr181390 1512 ----
NM_031427chr14155875 5808 4941 4801 4489 4169 3901 3752 2233 1945 1560 1383 355 292 150 23881 216 34821 1852 445 25044 1934
NM_031431chr1331673 713 422 ------
NM_031435chr1253205 2985 2805 1390 1035 12168 12614 --
NM_031438chr541695 475 458 420 11445 --1696
NM_031439chr841748 1610 1556 758 21909 1453 21386 140 --
NM_031442chrX102931 2562 2528 2146 2116 1019 750 581 379 167 1180 ----
NM_031468chr788189 8062 7226 7167 1452 1428 1029 909 27675 6273 ----
NM_031476chr1682823 2365 2228 1068 988 805 108 58 --1769 1266
NM_031483chr2093517 3471 3449 3098 2875 2379 1257 493 276 1101 33358 803 367 33292 2603 336
NM_031844chr1123950 3707 3383 2676 1644 1634 1339 1276 1165 1106 331 68 22524 126 --11421
NM_031845chr2123477 3377 2731 2725 2488 2293 1404 1225 1012 965 844 89 1891 1876 --
NM_031847chr2123477 3377 2731 2725 2488 2293 1404 1225 1012 965 844 89 1891 1876 --
NM_031849chr52940 634 --12047 --
NM_031857chr52940 634 --12047 --
NM_031858chr175975 334 310 254 49 1197 ----
NM_031860chr52940 634 --12047 --
NM_031862chr175975 334 310 254 49 1197 ----
NM_031889chr441929 661 515 509 ------
NM_031899chr341591 1422 1054 102 ------
NM_031911chr482719 2702 2674 2661 2517 732 532 345 --1965 --
NM_031922chr63542 367 158 1413 ----
NM_031935chr12999 760 1402 ----
NM_031942chr231202 932 289 --1971 --
NM_031953chr42443 109 ------
NM_031966chr54508 483 109 87 ------
NM_031992chr751764 1673 374 363 167 1381 ----
NM_032028chr52621 597 ------
NM_032042chr552764 2541 2148 1037 780 22690 1822 11093 --
NM_032047chr342157 2000 1554 63 11718 --1650
NM_032050chr222732 284 1175 ----
NM_032102chr1163047 2551 2053 1987 539 349 --11161 --
NM_032116chr13205227 5171 5069 4665 4622 4241 3591 2228 2037 1797 1711 1701 1373 1192 1090 1037 1016 660 399 295 ----25108 495
NM_032121chrX82847 2573 2318 1901 1895 818 330 303 --11915 --
NM_032124chr184950 507 254 192 1923 ----
NM_032128chr42877 51 11050 1927 1264
NM_032131chr64552 537 490 124 ------
NM_032142chr181198 ------
NM_032144chr271771 1390 1383 1245 1135 659 361 11292 ----
NM_032145chr631799 1639 236 --1474 --
NM_032147chr123858 387 240 ------
NM_032160chr1893787 3411 3231 2901 1109 1031 495 212 86 24067 713 ----
NM_032182chr1051421 1219 620 299 166 11393 --1174
NM_032186chr111258 11053 ----
NM_032189chr1395087 4973 4414 1926 1889 1778 1493 400 262 11870 13892 --
NM_032195chr215531 513 501 198 172 ------
NM_032205chr8----2143 78 --
NM_032217chr42299 285 1370 --1256
NM_032221chr2031917 1522 574 ------
NM_032228chr11133546 3540 2887 2823 2680 2649 2231 1273 1190 920 896 622 478 11197 ----
NM_032239chr461345 1246 1067 563 290 179 ------
NM_032281chr1923140 2236 ------
NM_032287chr2284182 4162 3943 3934 3484 2587 1116 882 12683 12725 11367
NM_032288chr392139 2009 1772 1589 595 582 424 342 260 21845 355 12058 --
NM_032291chr141527 1518 1378 285 11536 ----
NM_032293chr93182 56 28 1249 197 --
NM_032305chr12380 32 ------
NM_032321chr2113046 2982 2767 2425 2082 1006 967 733 517 351 206 13023 11077 --
NM_032329chr274324 4238 4100 2741 602 221 77 ----11141
NM_032373chr10125519 4906 3928 3755 2182 2080 1897 1704 1374 1312 1242 390 25328 962 ----
NM_032408chr74861 808 469 263 ------
NM_032410chr851052 948 359 176 167 ------
NM_032413chr153404 293 112 ------
NM_032420chr52911 223 ------
NM_032435chr182415 2083 894 845 800 488 315 69 --12072 --
NM_032439chr1051484 1390 315 277 164 11680 ----
NM_032440chr10102729 2533 2283 2257 2149 976 912 877 728 535 ----1394
NM_032446chr543476 3122 2674 1043 2656 229 ----
NM_032449chr182381 2265 1799 808 664 379 46 33 22921 2515 ----
NM_032457chr483004 2673 2556 2413 996 510 395 30 11210 1152 --
NM_032458chrX83410 2945 2754 2742 2172 1316 717 325 33060 2912 1275 ----
NM_032466chr851639 1487 1100 164 113 1186 31248 609 290 --
NM_032468chr851639 1487 1100 164 113 1186 31248 609 290 --
NM_032471chr61933 11016 ----
NM_032482chr1942625 1974 909 591 2917 196 ----
NM_032499chr1551665 1221 674 607 533 2705 145 ----
NM_032505chr362543 1851 1119 1065 417 370 11839 22093 577 --
NM_032509chr852245 2193 1703 1031 628 ------
NM_032510chr1872448 2374 2214 2040 1560 525 245 ------
NM_032517chr101138 ------
NM_032521chr2073207 1202 1041 500 366 216 174 ------
NM_032539chrX1176 --1582 --
NM_032547chr471328 1278 1149 1139 292 88 52 ------
NM_032552chr931874 393 46 ----1572
NM_032557chr44800 358 214 88 ------
NM_032558chr961464 1357 1221 1205 1009 558 ------
NM_032569chr1681859 1851 1792 1574 1489 806 633 117 ------
NM_032576chrY--1123 157 --
NM_032598chr171126 ------
NM_032622chr431318 1071 634 11198 1465 11541
NM_032623chr43281 155 68 ------
NM_032626chr16--2236 27 ----
NM_032632chr1441249 455 374 244 1409 ----
NM_032635chr19154 ------
NM_032663chr1251876 1815 691 375 345 ------
NM_032682chr373325 3133 2986 2338 538 475 406 33185 3080 2215 22731 317 --
NM_032717chr42861 134 1952 --123
NM_032765chr53755 302 119 ------
NM_032778chr3113291 3071 2971 2851 2745 2669 1219 729 426 348 334 22218 318 ----
NM_032786chr121182 ------
NM_032787chr32311 68 ------
NM_032800chr142710 2636 930 622 12348 ----
NM_032804chr1072570 2347 1605 1597 785 635 465 --11845 --
NM_032810chr1051316 1299 1286 1041 88 ------
NM_032811chr1141866 1586 510 179 11655 ----
NM_032813chr1341125 810 755 728 --1297 --
NM_032832chr671731 1650 1334 1114 1099 1060 134 11307 1638 1337
NM_032833chr1122508 2030 1892 1774 992 686 451 404 262 251 86 59 22371 103 ----
NM_032837chr1752090 1617 1403 711 360 11645 --1648
NM_032838chr1961145 845 820 488 280 37 1180 1464 --
NM_032842chr741534 1139 557 205 2400 126 ----
NM_032846chr1451411 1097 1064 574 82 21197 1171 2447 392 --
NM_032857chr152178 159 ------
NM_032859chr13103950 3498 2949 1452 1130 954 908 816 798 135 --1355 168
NM_032864chr151598 1283 599 133 103 ------
NM_032866chr1583125 3104 3035 2946 2872 2477 1147 261 --12101 --
NM_032873chr1163922 3468 1758 1437 1404 473 21624 231 ----
NM_032875chr171577 ------
NM_032876chr1461963 1933 1918 1727 1672 1542 31904 1429 318 ----
NM_032883chr202904 700 ------
NM_032884chr1--1331 ----
NM_032900chr10113901 3774 3367 3230 2917 2725 2539 1012 992 555 543 ------
NM_032905chr102398 188 --11131 --
NM_032906chr45664 226 220 149 64 ----1279
NM_032918chr1251178 1158 512 284 155 ------
NM_032933chr1831722 1441 1301 2654 491 ----
NM_032960chr121544 996 ------
NM_032961chr431380 1374 974 1216 --1304
NM_032968chrX63608 3547 3207 3133 854 696 14152 23856 403 --
NM_032969chrX63608 3547 3207 3133 854 696 14152 23856 403 --
NM_032973chrY83600 3543 3202 3128 1687 1387 854 696 14144 23848 403 --
NM_032975chr1873167 3090 1028 1014 725 506 416 11323 23245 1345 --
NM_032978chr18--1243 --1205
NM_032979chr18--1243 --1205
NM_032980chr1873167 3090 1028 1014 725 506 416 11323 23245 1345 --
NM_032981chr18--1243 --1205
NM_032982chr7102375 2358 2118 941 414 371 359 199 156 67 --12520 --
NM_032983chr7103189 3172 2932 2183 1228 1185 1173 1013 970 881 --13334 --
NM_032991chr42455 29 2498 462 ----
NM_033014chr92457 374 11187 ----
NM_033020chr1144204 4181 4055 3987 3776 3359 3142 3117 3065 1494 1354 422 142 82 --11744 --
NM_033030chr261556 1461 1180 1141 437 322 ------
NM_033044chr141054 934 526 370 --1344 --
NM_033055chr12717 264 ------
NM_033056chr105732 701 615 599 271 ------
NM_033071chr62538 121 3583 545 452 1517 --
NM_033081chr2041369 1080 374 164 11117 ----
NM_033083chr383305 2990 2737 2441 1331 939 153 63 12130 --1741
NM_033089chr2041429 528 384 241 --21412 365 11118
NM_033119chr161182 ------
NM_033121chr1261491 1391 447 410 385 131 2606 298 11203 --
NM_033132chr1352160 1937 648 611 468 ------
NM_033135chr1122345 363 2677 405 143 --
NM_033138chr7102142 2056 2027 1740 1448 645 620 515 203 114 1676 ----
NM_033139chr7102142 2056 2027 1740 1448 645 620 515 203 114 1676 ----
NM_033140chr7102142 2056 2027 1740 1448 645 620 515 203 114 1676 ----
NM_033143chr4134177 3938 3886 3569 3546 3282 3178 2833 1785 1522 891 799 649 1328 11070 --
NM_033157chr7102142 2056 2027 1740 1448 645 620 515 203 114 1676 ----
NM_033161chr941847 678 413 86 1261 ----
NM_033181chr683638 3491 1413 1165 867 860 511 331 1591 21316 271 --
NM_033211chr581635 1427 1383 846 654 293 274 254 ------
NM_033224chr7127528 6771 6675 6359 6118 5736 2678 2239 2040 1231 952 521 24876 2744 ----
NM_033225chr853188 2562 2398 1155 1092 23226 1067 2962 66 11260
NM_033238chr1562590 2441 2220 1933 1742 692 22798 2488 11907 12013
NM_033255chr133472 429 395 1408 ----
NM_033272chr22319 43 ------
NM_033276chr121252 ------
NM_033281chr5297 44 ------
NM_033285chr8154501 4110 3909 3854 3770 3751 3223 2981 2750 1141 620 374 269 189 89 ------
NM_033290chrX113681 3551 3431 2422 1511 1172 862 809 630 201 161 11002 2683 272 1876
NM_033326chr1162529 2336 2045 902 896 640 2436 357 ----
NM_033331chr953316 3080 3057 2500 1417 32825 914 679 11031 12943
NM_033360chr12124562 4545 4327 4120 3847 3677 3396 2845 1348 1141 251 206 33940 3863 3232 33010 2810 1666 --
NM_033364chr351954 1820 1810 586 552 1595 ----
NM_033389chr17124658 4635 4537 3963 3625 3587 3296 3233 3170 953 416 268 ----1515
NM_033393chr452911 2792 2455 1949 428 11978 ----
NM_033394chr271586 1560 1150 304 163 112 95 ------
NM_033425chr1153160 2698 2141 893 731 21379 739 22243 1029 --
NM_033426chr1462860 2618 2544 1952 1932 943 --22804 41 --
NM_033429chr1552828 2667 2572 313 186 12474 ----
NM_033430chr483967 3572 3478 3284 3036 2925 2634 451 1166 ----
NM_033437chr483967 3572 3478 3284 3036 2925 2634 451 1166 ----
NM_033480chr652977 2465 1203 805 183 12954 ----
NM_033481chr652977 2465 1203 805 183 12954 ----
NM_033505chr2156781 6287 6260 6138 5047 4326 4246 2601 2219 2009 1963 1251 1136 1077 589 ----14465
NM_033512chr872640 2562 2305 2279 552 310 116 22206 242 --1110
NM_033515chr621301 1217 --11206 --
NM_033535chr44768 467 352 252 2838 800 1991 --
NM_033540chr331150 1129 843 ------
NM_033550chr2072381 1875 1813 891 730 611 300 ------
NM_033551chr573437 3430 3291 2772 695 666 126 --12365 --
NM_033624chr1231965 816 26 ----21556 739
NM_033631chr173657 3294 3287 2876 2569 1302 1254 13414 33429 920 586 --
NM_033632chr451539 1499 1034 376 302 ------
NM_033644chr5122155 2120 2101 1796 1785 1715 726 670 609 564 378 191 ------
NM_033645chr5122155 2120 2101 1796 1785 1715 726 670 609 564 378 191 ------
NM_033656chr21175591 5236 4722 4605 4537 4385 4280 4182 2397 2249 1933 1857 1115 1055 900 746 642 14444 ----
NM_048368chr182813 739 ------
NM_052811chr13135160 5081 4961 4909 4193 4084 3984 3678 3647 1635 933 897 541 35206 4488 4314 14592 --
NM_052818chr1392161 1851 1785 1524 793 592 577 515 78 ------
NM_052827chr121904 --1739 --
NM_052832chr862907 2594 2116 1213 241 33 1815 ----
NM_052834chr1872321 1930 1025 587 471 369 32 11617 ----
NM_052840chr1541170 1115 596 473 ------
NM_052860chr53802 705 214 ------
NM_052876chr1942734 984 951 220 --1651 --
NM_052877chr14462 401 85 51 ------
NM_052879chr1283907 3700 3570 3484 2694 1503 1303 1046 23171 2654 ----
NM_052885chr12124910 4646 4566 4425 4221 3888 3655 3187 1668 987 851 755 34318 4087 3420 11821 1570
NM_052886chr891916 1905 1716 1442 768 420 270 236 200 1452 --2813 796
NM_052897chr122341 305 ------
NM_052898chr821206 1194 ----11186
NM_052900chr851319 1175 607 510 419 ----1634
NM_052904chr641334 1173 396 212 21199 267 ----
NM_052907chr1284027 3854 3577 1191 808 507 372 30 13613 --13564
NM_052910chr1362199 1775 1478 1331 835 814 ------
NM_052911chr184984 947 746 206 ------
NM_052917chr283046 2911 2750 2514 2062 1168 943 563 1907 1109 --
NM_052918chr1073481 1167 784 696 560 339 110 11377 ----
NM_052927chr562241 2087 1872 1735 834 613 21864 314 ----
NM_052937chr892101 1961 1075 954 723 710 222 198 179 --141 --
NM_052954chr2141873 1632 664 540 ------
NM_052965chr13914 204 74 --1830 --
NM_053016chr9167761 6968 6619 6366 6345 5095 5066 2966 2591 2542 2308 1267 1165 1106 719 421 36996 6937 3023 ----
NM_053023chr11142953 2637 2446 2279 2234 2172 2094 1103 1034 571 512 369 362 215 --12427 --
NM_053025chr351624 1497 1190 1141 1096 1274 ----
NM_053026chr351624 1497 1190 1141 1096 1274 ----
NM_053027chr351624 1497 1190 1141 1096 1274 ----
NM_053028chr351624 1497 1190 1141 1096 1274 ----
NM_053031chr351624 1497 1190 1141 1096 1274 ----
NM_053032chr351624 1497 1190 1141 1096 1274 ----
NM_053042chr4133223 2970 2747 2457 2108 2093 1091 1015 990 694 586 524 399 12556 2925 36 23030 2056
NM_053043chr7156257 5763 5072 4925 4825 4792 4764 4715 4374 4001 1886 1274 1264 889 532 --15057 14114
NM_053056chr1182270 2096 1256 705 488 406 209 147 ------
NM_053064chr1482852 2327 2192 2114 1170 402 159 60 22220 392 ----
NM_053067chr91256 ------
NM_053281chrX1300 ------
NM_054012chr91247 ------
NM_054016chr191968 1782 1724 1689 1600 1509 525 459 25 11793 --11572
NM_054016chr191968 1782 1724 1689 1600 1509 525 459 25 11793 --11572
NM_054016chr191968 1782 1724 1689 1600 1509 525 459 25 11793 --11572
NM_057159chr92475 304 ------
NM_057169chr1263110 3029 2269 2131 1200 1002 ------
NM_057170chr1263110 3029 2269 2131 1200 1002 ------
NM_057175chr452552 2205 1697 446 402 134 ----
NM_057178chr1762748 2314 2305 1964 1118 586 2567 515 12342 11864
NM_057180chr12196 ------
NM_057749chr841357 1340 1202 293 ------
NM_058172chr41442 11257 1672 --
NM_058237chr143725 665 362 1710 ----
NM_058241chr252327 1865 1614 176 28 ------
NM_058241chr252327 1865 1614 176 28 ------
NM_078470chr1041775 781 380 203 ------
NM_078483chr553719 1519 704 655 432 1730 --13646
NM_080391chr1------1598
NM_080392chr1------1647
NM_080546chr981872 1664 1621 1570 824 755 663 234 ----1549
NM_080591chr942436 2384 2293 1113 ------
NM_080597chr184951 411 324 93 21121 400 ----
NM_080617chr202973 95 ------
NM_080629chr161502 1470 575 555 276 147 ------
NM_080630chr161502 1470 575 555 276 147 ------
NM_080645chr632129 1880 1559 11966 11628 --
NM_080651chr82101 95 ------
NM_080664chr1431899 820 474 1108 ----
NM_080666chr1461733 1655 1600 1084 571 376 21351 293 ----
NM_080743chr6112012 1965 1895 1822 1725 966 699 337 115 76 32 32299 849 148 ----
NM_080759chr1392264 2142 2112 2100 1910 1745 1033 130 93 1886 11636 --
NM_080760chr1392264 2142 2112 2100 1910 1745 1033 130 93 1886 11636 --
NM_080832chrX3674 516 61 1158 11314 --
NM_080840chr20139 1106 ----
NM_080841chr20139 1106 ----
NM_080867chr14175018 4414 4182 4111 3738 2037 1931 1856 1821 1616 1534 1390 1274 941 916 373 46 21264 78 33906 3188 1663 --
NM_080872chr873977 3378 3286 3142 2563 2552 648 23526 3422 23935 3618 1465
NM_080911chr128915 842 809 707 291 276 192 24 ------
NM_080927chr383050 2907 2444 2285 2213 1080 992 773 32372 1326 612 1676 --
NM_130385chr1152600 2436 2278 1187 131 ----1532
NM_130387chr311203 ------
NM_130391chr983359 3211 3017 2922 2754 1076 509 457 --32414 2352 1305 --
NM_130392chr983359 3211 3017 2922 2754 1076 509 457 --32414 2352 1305 --
NM_130393chr983359 3211 3017 2922 2754 1076 509 457 --32414 2352 1305 --
NM_130434chr1531162 812 310 ------
NM_130435chr10132968 2937 2779 2708 2567 2477 2042 2002 1959 1814 550 524 296 --12241 --
NM_130439chr1041777 1683 535 98 ----11868
NM_130439chr1041777 1683 535 98 ----11868
NM_130446chr3104256 3694 3168 2950 2791 1711 1286 964 287 136 --11478 14150
NM_130459chr91524 11637 1152 --
NM_130798chr152541 21 11302 ----
NM_130809chr562756 2420 980 625 403 343 11237 143 --
NM_130838chr1541329 674 231 173 ----11732
NM_130839chr1541329 674 231 173 ----11732
NM_130847chr1195819 5159 4974 4837 1797 1573 1445 864 700 13680 14803 --
NM_133264chr1752864 2449 1460 1084 462 22654 694 ----
NM_133265chrX42955 2910 62 44 22390 633 23551 1209 --
NM_133329chr241437 1214 672 221 ------
NM_133330chr452383 2158 1291 832 305 1516 13096 --
NM_133331chr452383 2158 1291 832 305 1516 13096 --
NM_133334chr4125328 4856 4470 4211 4051 2389 2342 2077 1171 1077 895 879 35154 4841 576 45570 4402 4248 274 --
NM_133335chr452383 2158 1291 832 305 1516 13096 --
NM_133370chr483387 1298 1131 1071 903 869 224 142 ----11286
NM_133372chr572671 2598 2182 1977 1105 904 630 ----196
NM_133433chr52686 365 ------
NM_133445chr963556 3505 3139 2833 826 323 23379 2525 ----
NM_133468chr772424 1836 1682 1565 1018 938 392 --12258 --
NM_133478chr252494 764 603 376 291 2624 458 ----
NM_133493chr6164450 4340 3972 3805 3712 3037 2981 1779 1761 1464 1433 1383 1304 1270 1104 1072 23238 297 --1248
NM_133496chr1184430 4266 4093 4029 3939 3896 3768 3433 3207 3078 2880 1821 1736 1116 852 606 260 28 34471 4220 3628 --14359
NM_133499chrX3807 769 732 1328 --1287
NM_133634chr2131695 1489 1353 ------
NM_133646chr2135576 5208 5092 4606 3823 1361 791 347 322 307 278 162 115 44213 4147 1260 1072 ----
NM_133647chr1583168 3018 2991 1395 1079 1026 515 502 12953 ----
NM_133650chr62538 121 3583 545 452 1517 --
NM_134265chr172301 152 1938 ----
NM_134447chr194529 244 131 116 1580 ----
NM_138270chrX173219 3157 2650 2481 2407 2371 2283 1222 1168 1115 1016 992 907 697 385 59 50 12175 1318 --
NM_138285chr22508 414 ----1120
NM_138286chr19124148 3791 3600 3211 2890 2856 1415 937 775 356 110 28 11450 13988 13895
NM_138288chr145696 654 551 270 175 11621 ----
NM_138292chr11143518 3417 2952 2724 2561 2425 1307 1153 794 693 686 265 58 52 23390 208 11355 139
NM_138316chr1051332 1045 535 158 81 ------
NM_138317chr14197 ------
NM_138318chr14197 ------
NM_138333chr9112600 2455 2328 2292 2187 2165 2149 2054 893 633 243 ----1173
NM_138340chr182564 501 1148 ----
NM_138348chr5176635 6097 5933 5608 5598 5494 5099 4881 4382 4310 4060 2524 2081 1602 1365 856 321 15154 1399 --
NM_138349chr171229 ------
NM_138357chr1031765 527 112 1619 11397 --
NM_138391chr13964 283 275 ------
NM_138395chr251169 1080 1003 938 200 ------
NM_138423chr1562307 2147 1814 1511 886 436 ------
NM_138426chr752204 1941 1911 1827 1609 ------
NM_138444chr1384995 4769 3049 3030 1663 1290 1276 83 2541 208 23277 976 23006 1761
NM_138459chr6103112 2942 2276 2251 1315 1204 1127 1059 948 288 22906 1045 13304 --
NM_138468chr2126160 5972 5725 5719 5563 2222 2182 2028 1395 1270 1254 352 2342 137 15278 25778 1979
NM_138473chr1295175 4960 4880 4218 3861 3717 3232 1144 1001 --1628 --
NM_138479chr142078 1452 1407 381 ----1801
NM_138485chr31333 ------
NM_138555chr151531 1466 ----
NM_138558chr121051 752 1862 ----
NM_138559chr25961 902 429 408 365 1996 ----
NM_138576chr14104709 4568 3874 3249 1450 1235 503 406 303 209 11709 11025 13978
NM_138621chr294179 3894 3229 2714 1546 1207 1174 984 677 1484 ----
NM_138633chr641716 1312 512 275 ------
NM_138638chr1452010 1712 468 237 200 --11650 --
NM_138701chr71275 1217 ----
NM_138711chr31173 ------
NM_138712chr31173 ------
NM_138713chr16188183 7918 7852 7634 7496 6472 6255 6021 5781 5314 5243 5202 5114 2452 2169 1705 939 405 36051 6035 893 25713 5157 --
NM_138714chr161