TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-450a-5p
miRNA Sequence: UUUUGCGAUGUGUUCCUAAUAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr511331 1409 ----
NM_000055chr3------1354
NM_000084chrX16837 26737 734 --12235
NM_000109chrX----11795 --
NM_000112chr524747 3573 24294 1234 ----
NM_000129chr611153 173 11053 --
NM_000142chr4--1578 ----
NM_000161chr1431798 803 536 ------
NM_000176chr533381 956 822 ----1895
NM_000183chr2----1339 --
NM_000189chr2--1761 ----
NM_000194chrX1568 ------
NM_000216chrX53478 1281 1166 600 391 --23562 2880 --
NM_000217chr1224598 835 --22098 437 --
NM_000245chr711482 ------
NM_000248chr322073 536 12177 ----
NM_000259chr1535719 1263 748 25889 1400 ----
NM_000266chrX1809 ------
NM_000280chr111898 ------
NM_000285chr192372 44 ------
NM_000321chr13--21234 511 ----
NM_000325chr41226 ------
NM_000329chr11131 ------
NM_000332chr645509 2454 929 156 25347 518 ----
NM_000346chr172763 579 --11446 --
NM_000348chr221562 1556 --11305 --
NM_000351chrX44303 3640 2921 2773 ----1778
NM_000368chr964252 3931 3298 1015 476 233 ------
NM_000369chr14----11208 --
NM_000387chr31588 ------
NM_000393chr211523 1836 ----
NM_000397chrX12419 ------
NM_000408chr232620 1017 554 ------
NM_000421chr171356 ------
NM_000430chr1723298 612 ----12465
NM_000439chr521634 375 ------
NM_000448chr1122391 33 --12874 --
NM_000451chrX2846 384 1814 ----
NM_000462chr151742 1595 ----
NM_000474chr71609 1493 ----
NM_000489chrX12193 11282 ----
NM_000493chr6--1177 ----
NM_000496chr22193 ------
NM_000527chr1912122 --12246 --
NM_000533chrX11925 ------
NM_000555chrX57863 7804 7767 6453 5834 27186 257 ----
NM_000615chr111550 ------
NM_000618chr1242265 1102 693 684 34155 2405 1289 14793 1193
NM_000618chr1242265 1102 693 684 34155 2405 1289 14793 1193
NM_000624chr14----2874 795 --
NM_000633chr1824843 4538 33222 981 34 13614 --
NM_000663chr1632282 2216 2110 22883 545 12970 --
NM_000676chr171349 ------
NM_000719chr1234271 1631 261 26270 1401 16730 --
NM_000721chr122483 197 ------
NM_000724chr101584 ------
NM_000788chr4163 1156 21142 463 --
NM_000808chrX--2313 157 1840 --
NM_000809chr488347 7965 7489 7198 6351 6275 1741 1470 17273 38926 2627 1092 --
NM_000813chr544482 1396 437 216 15422 ----
NM_000814chr1511561 ------
NM_000824chr41295 ------
NM_000826chr41862 --11680 --
NM_000829chr112661 602 ------
NM_000844chr32841 361 ------
NM_000868chrX32298 1728 133 --12560 --
NM_000875chr1556735 5754 1804 1044 25 ----14477
NM_000891chr1723324 2956 ------
NM_000899chr1244164 3166 735 652 ----23039 850
NM_000901chr412039 12519 12540 --
NM_000910chr421971 721 ------
NM_000919chr51496 ------
NM_000921chr121207 ------
NM_000926chr1139205 1020 665 59277 8706 1869 523 447 ----
NM_000933chr20--11603 --1474
NM_000945chr211328 ------
NM_000950chrX12709 --32396 1093 446 1391
NM_000989chr8131 ------
NM_001001132chr211197 ----1411
NM_001001330chr10--11084 ----
NM_001001331chr321088 425 11775 --11850
NM_001001396chr154360 4242 4069 2721 225 ------
NM_001001419chr521177 811 --24589 691 1478
NM_001001420chr521177 811 --24589 691 1478
NM_001001481chr833176 979 964 ------
NM_001001484chr1011800 1808 1663 --
NM_001001664chr21804 13954 11563 1375
NM_001001668chr1923431 2696 ------
NM_001001787chr1--1426 ----
NM_001001890chr21175 13770 --1517
NM_001001933chr12528 459 ------
NM_001001974chr1022027 1957 1713 ----
NM_001001994chrX----1456 --
NM_001001995chrX1397 ------
NM_001001996chrX----1456 --
NM_001002257chr2--13487 ----
NM_001002811chr121167 24 --11548 --
NM_001002812chr121167 24 --11548 --
NM_001002812chr121167 24 --11548 --
NM_001003652chr18--22056 1169 --17031
NM_001003674chr1846973 756 210 167 16333 15153 --
NM_001003675chr1846973 756 210 167 16333 15153 --
NM_001003698chr611937 11440 11286 --
NM_001003699chr611937 11440 11286 --
NM_001003712chr1211242 --1516 --
NM_001003792chr31179 11075 --11009
NM_001003793chr31179 11075 --11009
NM_001003800chr943472 1490 1437 540 12886 23108 2917 --
NM_001003810chr4--1684 ----
NM_001004065chr91101 ------
NM_001004317chr621816 1148 --141 --
NM_001004342chr135492 4340 103 --16001 --
NM_001004360chr211936 ------
NM_001004419chr122742 362 ------
NM_001004431chr171220 ------
NM_001005335chr19------184
NM_001005366chr122189 34 ------
NM_001005407chr161696 ------
NM_001005463chr101179 --12135 --
NM_001005473chr576022 5553 4739 4598 2489 2410 1688 ------
NM_001005474chr3----1512 --
NM_001005732chr213265 201 153 ------
NM_001005733chr212201 153 ------
NM_001006118chrY----149 --
NM_001006120chrY----149 --
NM_001006600chr522334 876 ----11663
NM_001006610chr161841 ----1993
NM_001006636chr21725 1829 ----
NM_001006641chr911676 11689 ----
NM_001006642chr911676 11689 ----
NM_001006643chr911676 11689 ----
NM_001006681chrX--161 ----
NM_001006682chrX--161 ----
NM_001006683chrX--161 ----
NM_001006684chrX1508 ------
NM_001007075chr42734 358 ----11094
NM_001007097chr934862 4370 400 ----24520 3984
NM_001007102chr631275 532 507 ------
NM_001007157chr7------199
NM_001007257chr121480 104 --1359 --
NM_001007267chr21149 ------
NM_001007467chr221111 ------
NM_001007526chrY----149 --
NM_001008220chr523922 3296 ------
NM_001008239chr1821071 669 --1892 1691
NM_001008392chr313563 13311 ----
NM_001008410chr252292 718 223 104 84 ------
NM_001008495chr852293 1595 786 672 193 ------
NM_001008529chr17----139 --
NM_001008564chr1311621 12097 ----
NM_001008738chr522434 452 ------
NM_001009555chr411396 ------
NM_001009567chr10----1571 --
NM_001009959chr212432 ----12085
NM_001010861chr12320 85 ------
NM_001010888chrX23389 1739 ----13047
NM_001010934chr71108 1186 ----
NM_001010986chrX12300 ----22390 2293
NM_001011537chr311731 12239 --11720
NM_001011546chr202717 148 --1559 --
NM_001011553chr71387 ------
NM_001011666chr726612 2230 ------
NM_001011713chr141656 --1267 --
NM_001012393chr1144311 1670 1444 686 --11939 --
NM_001012420chr1532498 1852 216 --12958 --
NM_001012512chr18--1101 ----
NM_001012513chr18--1112 ----
NM_001012751chr1011949 11454 ----
NM_001012754chr1341986 1884 1791 626 ------
NM_001012755chrX--23550 679 ----
NM_001012761chr512045 --12618 --
NM_001012968chrX2254 77 22050 273 ----
NM_001012971chr20155 ------
NM_001012977chrX11206 ------
NM_001013399chr6--1390 --1141
NM_001013415chr421313 1019 166 --21146 262
NM_001014380chr1315684 21861 1075 11752 --
NM_001014449chr161166 ------
NM_001014451chr161166 ------
NM_001014797chr1057666 6407 2384 2219 1704 1457 18238 --
NM_001015877chrX22512 396 ------
NM_001015880chr1011676 ------
NM_001017371chr21927 198 ----
NM_001017395chr333527 249 162 ------
NM_001017424chr111487 --11593 --
NM_001017425chr111487 --11593 --
NM_001017923chr1421185 1072 1174 ----
NM_001017926chr811688 ------
NM_001017930chrX41236 1116 1028 569 ------
NM_001017969chr91168 ------
NM_001017979chr4----1735 1256
NM_001017999chr152308 2122 942 659 223 ------
NM_001017999chr152308 2122 942 659 223 ------
NM_001018000chr152308 2122 942 659 223 ------
NM_001018000chr152308 2122 942 659 223 ------
NM_001018001chr152308 2122 942 659 223 ------
NM_001018038chr92492 23 ------
NM_001018054chr11180 ------
NM_001018056chr9----1547 --
NM_001018064chr912015 ----11702
NM_001018065chr944643 1175 1155 99 ------
NM_001018066chr944643 1175 1155 99 ------
NM_001018067chr134523 3411 1993 --1292 --
NM_001018068chr134523 3411 1993 --1292 --
NM_001018069chr134523 3411 1993 --1292 --
NM_001018074chr533381 956 822 ----1895
NM_001018075chr533381 956 822 ----1895
NM_001018076chr533381 956 822 ----1895
NM_001018077chr533381 956 822 ----1895
NM_001018090chr151227 --11875 --
NM_001018091chr151337 --11985 --
NM_001018102chr151227 --11875 --
NM_001023567chr1512425 --12350 1640
NM_001024071chr141820 ------
NM_001024094chr533381 956 822 ----1895
NM_001024218chr14----1238 --
NM_001024372chr83886 370 343 128 22278 1678 --
NM_001024455chrX2617 158 ------
NM_001024463chr15--2784 483 ----
NM_001024593chr10----175 --
NM_001024647chr1236084 5905 2562 15867 1120 15524
NM_001024649chr51362 ------
NM_001024666chrX1632 ------
NM_001024680chr221113 292 ----168
NM_001024808chr1241077 794 483 132 32344 2328 1883 ----
NM_001024934chr6139 ------
NM_001024935chr6139 ------
NM_001024936chr6139 ------
NM_001024947chr511075 1714 1287 --
NM_001025077chr1011269 ------
NM_001025105chr52988 472 ------
NM_001025580chrX----1764 --
NM_001025616chr42323 285 ------
NM_001025780chr9----191 --
NM_001029858chr623273 2422 --12681 --
NM_001029860chr8179 ------
NM_001029863chr622911 1256 23128 1246 --1878
NM_001029989chr151681 ------
NM_001030007chr1611556 1843 ----
NM_001030055chr142683 263 --11651 --
NM_001030272chr111324 ------
NM_001030273chr111324 ------
NM_001031679chr1223333 173 13213 ----
NM_001031695chr2274897 4812 3775 3603 1899 61 22 --14086 --
NM_001031700chr41334 22462 120 --1561
NM_001031720chr41167 ------
NM_001031804chr1643931 3380 1688 1644 --24246 668 --
NM_001031812chr512104 1742 ----
NM_001031855chrX180 ------
NM_001032293chr171203 ------
NM_001032380chr101537 ------
NM_001032394chr642780 1789 181 63 ------
NM_001032395chr632647 1656 48 ------
NM_001033030chr31195 ------
NM_001033031chr31195 ------
NM_001033032chr31195 ------
NM_001033045chr224008 1760 ----13338
NM_001033057chr321432 480 --1576 --
NM_001033059chr6--128 11788 --
NM_001033081chr111823 --11765 --
NM_001033082chr111823 --11765 --
NM_001033085chr2----133 --
NM_001033087chr2023110 3087 ------
NM_001033503chr51487 ------
NM_001033506chr111423 ------
NM_001033507chr121829 282 ------
NM_001033561chr17--159 1757 --
NM_001033602chr1331992 248 208 --1693 --
NM_001033925chr1011560 ------
NM_001034837chr51767 ------
NM_001034838chr51767 ------
NM_001034845chr4----1125 --
NM_001034915chr81215 --1263 --
NM_001035chr1--1815 11263 --
NM_001035003chr431283 1271 118 ------
NM_001035004chr431283 1271 118 ------
NM_001035260chr101377 1497 11207 --
NM_001037132chr71188 ------
NM_001037133chr71188 ------
NM_001037317chr12320 85 ------
NM_001037331chr184905 363 294 162 ------
NM_001037339chr111609 --1588 --
NM_001037340chr111609 --1588 --
NM_001037341chr111609 --1588 --
NM_001037341chr111609 --1588 --
NM_001037553chr2144425 2041 1707 414 45018 3757 3740 1981 ----
NM_001037872chr2----165 --
NM_001037954chr111480 --23543 3142 --
NM_001039199chr201662 13368 ----
NM_001039538chr232823 884 196 --23660 603 13695
NM_001039590chrX43896 2781 2715 1371 1926 13724 --
NM_001039591chrX43896 2781 2715 1371 1926 13724 --
NM_001039762chr1012223 --1455 --
NM_001039802chr11101 ------
NM_001039840chrX66069 5598 3700 1746 1375 674 11771 ----
NM_001039937chr1312962 ----1976
NM_001040101chr431606 1028 370 --31164 144 38 --
NM_001040142chr2--11597 ----
NM_001040143chr2--11597 ----
NM_001040152chr721903 71 ------
NM_001040158chr52552 452 ------
NM_001040214chr62131 55 --11797 1472
NM_001040272chr922282 379 ------
NM_001040284chr1625216 869 2735 173 12290 --
NM_001040409chr21347 ------
NM_001040429chr132980 955 ----22212 1121
NM_001040441chr1----14899 --
NM_001040624chr822711 357 ------
NM_001040625chr822711 357 ------
NM_001040626chr822711 357 ------
NM_001040627chr822711 357 ------
NM_001040628chr822711 357 ------
NM_001040629chr822711 357 ------
NM_001040630chr822711 357 ------
NM_001040665chr713728 --1335 --
NM_001040712chr923484 868 1728 ----
NM_001042404chr11591 21499 81 ----
NM_001042406chr621022 195 ------
NM_001042413chr933355 2810 447 ------
NM_001042440chr511604 --11860 --
NM_001042441chr511604 --11860 --
NM_001042442chr511604 --11860 --
NM_001042443chr511604 --11860 --
NM_001042444chr511604 --11860 --
NM_001042445chr511604 --11860 --
NM_001042446chr511604 --11860 --
NM_001042453chrX21576 112 ------
NM_001042459chr3141 ------
NM_001042473chr1021933 427 ------
NM_001042475chr6178 ------
NM_001042493chr61130 --2392 148 --
NM_001042537chrX22448 649 --22400 1561 --
NM_001042543chr451276 630 164 34 28 ----11162
NM_001042555chr1244797 4619 3809 1168 13693 --11549
NM_001042599chr256219 5397 1343 1314 1249 17096 25946 720 --
NM_001042669chr42323 285 ------
NM_001042749chrX21422 179 11623 11959 --
NM_001042750chrX21422 179 11623 11959 --
NM_001042751chrX21422 179 11623 11959 --
NM_001043351chr1------12238
NM_001044305chr6------1271
NM_001044385chr213761 ------
NM_001044722chr512104 1742 ----
NM_001044723chr512104 1742 ----
NM_001046chr512169 ------
NM_001083620chr41861 --11679 --
NM_001099678chr314317 --16295 25937 2133
NM_001106chr358512 8031 7647 3560 411 --19072 19522
NM_001109977chr42758 73 ------
NM_001113490chrX13120 --1967 --
NM_001116chr1652712 2586 2218 2121 1921 ------
NM_001117chr1812278 --11946 --
NM_001121chr10--21469 1399 ----
NM_001126chr1180 ------
NM_001128chr1611556 1843 ----
NM_001144chr161216 ------
NM_001149chr10--1150 1872 --
NM_001160chr1232586 1794 233 ------
NM_001167chrX35500 4776 4383 35171 5163 951 35599 2162 1838 --
NM_001173chr142683 263 --11651 --
NM_001178chr111324 ------
NM_001198chr622407 96 ------
NM_001202chr141201 ------
NM_001204chr236954 6556 5833 --11584 --
NM_001206chr9------1987
NM_001233chr7----11883 --
NM_001241chr21614 1328 ----
NM_001241chr21614 1328 ----
NM_001253chr6----1240 --
NM_001256chr1722964 459 --1711 --
NM_001257chr161447 --11083 --
NM_001268chr13--147 --11001
NM_001274chr11296 89 ------
NM_001290chr41110 --159 --
NM_001310chr1212706 ----11920
NM_001315chr61328 ------
NM_001329chr10--1623 11596 --
NM_001343chr511708 --1666 --
NM_001364chr1141119 1060 584 559 11906 ----
NM_001389chr211157 ------
NM_001390chr1843279 2713 2501 571 11262 11114 --
NM_001396chr2132386 1002 75 --1161 --
NM_001401chr931606 1528 247 ----11077
NM_001418chr111284 131 ----
NM_001418chr111284 131 ----
NM_001419chr1953513 3014 1294 652 211 21353 873 11789 13719
NM_001422chr112110 61 ------
NM_001430chr251728 1510 1403 1240 75 --1477 --
NM_001438chr113348 13584 11401 23358 2317
NM_001453chr631763 500 252 ------
NM_001463chr21265 ------
NM_001482chr152851 131 ------
NM_001483chr7----156 --
NM_001494chr10--1761 ----
NM_001498chr631321 1216 547 ------
NM_001533chr19------184
NM_001554chr11496 ------
NM_001570chr3----11409 --
NM_001584chr1131234 1223 822 ------
NM_001604chr111898 ------
NM_001609chr1043079 2735 1324 759 ------
NM_001616chr2----2742 219 --
NM_001620chr112222 116 --1623 --
NM_001621chr731219 1016 970 ------
NM_001621chr731219 1016 970 ------
NM_001634chr6--128 11788 --
NM_001635chr7--1154 ----
NM_001660chr31247 --1600 --
NM_001663chr142842 466 11882 ----
NM_001668chr11889 1616 ----
NM_001677chr1--11064 ----
NM_001683chr321088 425 11775 --11850
NM_001688chr11315 ------
NM_001693chr81155 ------
NM_001695chr81532 --11040 --
NM_001701chr931107 543 462 --11019 --
NM_001706chr32701 118 2330 303 ----
NM_001709chr1122407 687 ------
NM_001718chr611269 ------
NM_001730chr1321549 563 ------
NM_001730chr1321549 563 ------
NM_001742chr721289 247 1614 ----
NM_001743chr2------1419
NM_001744chr51534 2518 116 ----
NM_001746chr51362 ------
NM_001748chr11215 ------
NM_001750chr511604 --11860 --
NM_001753chr731770 1179 1149 ------
NM_001754chr21175 13770 --1517
NM_001759chr1211298 24470 3709 21383 440 --
NM_001788chr71387 ------
NM_001791chr11101 ------
NM_001829chr42909 142 --2371 155 --
NM_001830chrX63638 2786 2723 1606 1447 1057 11114 ----
NM_001839chr1--1292 ----
NM_001845chr131117 ------
NM_001892chr52988 472 ------
NM_001901chr6--172 1839 --
NM_001903chr51687 ------
NM_001904chr31250 ------
NM_001933chr1421391 299 ------
NM_001949chr622542 485 2502 434 1896 --
NM_001969chr1432887 432 41 32660 1531 85 ----
NM_001977chr4----1143 --
NM_001981chr122299 476 11689 ----
NM_001987chr1264129 3222 2945 2929 1276 992 --24293 434 13692
NM_001992chr521664 416 11817 1507 --
NM_001993chr1285 27 ------
NM_001995chr42555 383 ------
NM_001999chr521527 1019 ------
NM_002006chr421645 1345 35411 4065 839 14018 --
NM_002009chr1512317 12743 ----
NM_002015chr1312555 --1703 --
NM_002024chrX--11362 ----
NM_002025chrX67509 6863 3439 1635 921 786 19309 --37846 3275 1738
NM_002037chr61335 ------
NM_002039chr41726 ----1794
NM_002040chr2133166 890 564 --1982 12912
NM_002048chr9----1417 --
NM_002062chr62396 339 11438 ----
NM_002069chr71273 ------
NM_002073chr221158 ------
NM_002074chr1--1403 11272 --
NM_002077chr911438 ------
NM_002091chr18--1101 ----
NM_002094chr16----1116 --
NM_002126chr1723540 72 ------
NM_002128chr1322450 1700 ----1392
NM_002130chr531655 1552 1373 ------
NM_002137chr7----1586 --
NM_002138chr4--1684 ----
NM_002140chr911051 1240 1764 --
NM_002148chr21273 ------
NM_002199chr41730 ------
NM_002202chr51700 1226 --1879
NM_002211chr102877 37 ------
NM_002222chr3--11174 ----
NM_002233chr11189 ------
NM_002239chr21244 1729 ----
NM_002242chr22714 370 1726 ----
NM_002245chr11129 188 ----
NM_002247chr1021511 602 --12121 --
NM_002264chr344646 4352 1420 1333 11922 ----
NM_002267chr1312173 21971 910 ----
NM_002270chr5--24199 1192 24307 2194 --
NM_002271chr1311595 --2970 898 --
NM_002294chrX139 ------
NM_002296chr1------156
NM_002310chr525356 709 --11514 15695
NM_002317chr5--1320 ----
NM_002336chr1224900 4771 138 1263 --
NM_002342chr121611 ------
NM_002356chr61857 ------
NM_002359chr1721095 130 ------
NM_002372chr51456 ------
NM_002374chr232823 884 196 --23660 603 13695
NM_002376chr14--1514 ----
NM_002382chr1411295 --1899 --
NM_002390chr172369 95 ------
NM_002395chr6--11470 ----
NM_002397chr511481 --1730 1282
NM_002398chr221264 46 11233 126 --
NM_002438chr10----1571 --
NM_002449chr5--1311 1893 1441
NM_002465chr12151 --1298 --
NM_002469chr121426 ------
NM_002480chr12--21383 1314 ----
NM_002499chr151949 ------
NM_002500chr231303 106 99 ------
NM_002514chr81259 11074 ----
NM_002515chr141115 ------
NM_002519chr11--21412 242 ----
NM_002545chr1144311 1670 1444 686 --11939 --
NM_002553chr7------1475
NM_002568chr8------198
NM_002569chr1511575 ------
NM_002577chr31942 ----1163
NM_002581chr934788 735 651 14303 ----
NM_002586chr61359 ----11363
NM_002590chr131535 --1160 --
NM_002594chr20----11702 --
NM_002595chr12----11925 --
NM_002600chr111609 --1588 --
NM_002635chr12--161 ----
NM_002641chrX11809 11425 11758 --
NM_002645chr1112013 1447 12007 --
NM_002655chr834651 1768 1239 --11377 14631
NM_002656chr641124 1085 306 235 ------
NM_002687chr1411057 ------
NM_002705chr16125 ------
NM_002710chr12----1232 --
NM_002711chr74546 336 279 134 ------
NM_002716chr11----13329 --
NM_002717chr8----1615 --
NM_002731chr1--13166 1991 --
NM_002736chr72746 575 ----11604
NM_002737chr1724519 1572 --26566 1228 --
NM_002738chr1611096 1827 ----
NM_002752chr51203 ------
NM_002763chr11180 --1357 --
NM_002837chr1234105 3598 792 14085 --14123
NM_002839chr923484 868 1728 ----
NM_002851chr71175 ----1793
NM_002852chr3------1542
NM_002869chr1121499 119 ------
NM_002874chr91984 ------
NM_002886chr321239 642 ------
NM_002890chr51133 ------
NM_002892chr141643 --11671 1174
NM_002897chr2--1291 ----
NM_002912chr62703 668 ------
NM_002928chr131607 559 93 ------
NM_002941chr31462 --1605 --
NM_002942chr341283 1082 931 880 ------
NM_002955chr611937 11440 11286 --
NM_002968chr1621116 307 1691 1210 --
NM_002971chr321009 933 ------
NM_002977chr22431 203 ----12983
NM_002998chr842078 816 628 279 --11406 --
NM_003010chr1721997 55 ------
NM_003013chr4----1720 --
NM_003016chr172814 501 --1210 --
NM_003022chrX2511 134 --1918 --
NM_003026chr91390 11071 ----
NM_003027chr15134 ------
NM_003029chr11472 11297 ----
NM_003031chr161841 ----1993
NM_003034chr1247625 5043 1770 226 1805 ----
NM_003036chr1--21127 170 ----
NM_003070chr92795 670 ------
NM_003105chr11194 ------
NM_003106chr3--3201 168 70 --1400
NM_003108chr257274 2541 604 388 182 --24558 1647 --
NM_003111chr21927 198 ----
NM_003112chr743047 2805 2441 2329 --12655 13211
NM_003118chr522028 1606 ------
NM_003133chr11169 ------
NM_003161chr1753622 659 496 400 241 1177 ----
NM_003171chr10----141 --
NM_003188chr63340 239 34 1584 ----
NM_003199chr1864252 4025 1290 825 418 255 24807 149 1142 15300
NM_003201chr101193 ----179
NM_003236chr21250 12331 ----
NM_003243chr131083 984 813 ------
NM_003262chr31719 ------
NM_003286chr202392 350 ------
NM_003291chr131322 ----1775
NM_003298chr341853 1489 828 89 35503 5066 4305 ----
NM_003326chr1182 11848 ----
NM_003336chrX------1222
NM_003338chr101677 ------
NM_003340chr41879 ----11259
NM_003345chr16----172 --
NM_003348chr1221582 1511 ------
NM_003350chr8--180 11031 --
NM_003373chr1011933 ------
NM_003383chr9----1547 --
NM_003387chr222338 265 ------
NM_003392chr323838 114 ----13348
NM_003400chr2--1325 ----
NM_003405chr221634 ------
NM_003410chrX1830 13003 ----
NM_003412chr322481 666 ------
NM_003413chrX21479 130 ----11555
NM_003419chr191386 ------
NM_003426chr22--1438 11219 --
NM_003436chr191718 ------
NM_003457chr171203 ------
NM_003463chr61815 ----11001
NM_003473chr10----1273 --
NM_003478chr11--12031 --13359
NM_003482chr1232605 2015 412 ------
NM_003483chr1222676 387 ----11825
NM_003488chr171660 --1192 --
NM_003489chr2122920 1205 --13217 --
NM_003565chr1221413 1232 ------
NM_003567chr1195 ------
NM_003574chr1823770 685 11585 25807 1153 14647
NM_003575chr711486 ------
NM_003583chr1212911 ------
NM_003590chr254064 3460 2571 2529 1556 13929 11540 --
NM_003592chr71524 ------
NM_003602chr71447 ------
NM_003603chr41692 11689 ----
NM_003615chr343328 904 735 254 12433 --23433 325
NM_003629chr113525 13285 ----
NM_003630chr62764 226 ------
NM_003632chr17----1825 --
NM_003633chr541990 1912 1625 121 ------
NM_003642chr2----133 --
NM_003645chr15----1220 --
NM_003653chr171170 --1191 --
NM_003663chr31121 2166 110 ----
NM_003671chr92724 655 22574 1425 --193
NM_003679chr12347 155 12525 ----
NM_003692chr9----1272 --
NM_003701chr132934 331 2753 424 ----
NM_003722chr3--11693 12064 --
NM_003749chr1311635 11587 1871 --
NM_003758chr153644 306 161 ------
NM_003758chr153644 306 161 ------
NM_003759chr433869 2797 1645 ------
NM_003762chr11483 11465 ----
NM_003766chr17----158 --
NM_003783chr11447 --11078 --
NM_003816chr8194 --124 11144
NM_003819chr1----1113 --
NM_003822chr121035 627 12217 21262 208 --
NM_003848chr3--148 ----
NM_003858chr14----1619 --
NM_003877chr121672 ------
NM_003884chr331402 1257 623 --11786 --
NM_003885chr1722391 2195 1191 ----
NM_003887chr21849 --11947 1740
NM_003895chr2131964 1818 627 ------
NM_003901chr101843 12560 ----
NM_003902chr11260 ------
NM_003908chr201144 --124 --
NM_003913chr61669 12863 ----
NM_003930chr732562 655 39 1574 2598 236 --
NM_003931chr6139 ------
NM_003932chr22167 --11901 --
NM_003934chr91359 --183 --
NM_003941chr731680 1631 180 ------
NM_003947chr321220 851 ------
NM_003971chr171253 ------
NM_003980chr63595 583 558 --1479 --
NM_003988chr10--11591 ----
NM_003994chr1244164 3166 735 652 ----23039 850
NM_003998chr4------1508
NM_004006chrX----11795 --
NM_004007chrX----11795 --
NM_004009chrX----11795 --
NM_004010chrX----11795 --
NM_004011chrX----11795 --
NM_004012chrX----11795 --
NM_004013chrX----11795 --
NM_004014chrX----11795 --
NM_004015chrX----11795 --
NM_004016chrX----11709 --
NM_004017chrX----11795 --
NM_004018chrX----11709 --
NM_004020chrX----11795 --
NM_004021chrX----11709 --
NM_004022chrX----11709 --
NM_004023chrX----11709 --
NM_004052chr10153 ------
NM_004067chr7------1420
NM_004075chr121631 ------
NM_004093chr1322942 470 22147 2028 ----
NM_004098chr101968 ----11056
NM_004100chr61829 ------
NM_004124chr14--1143 ----
NM_004161chr2140 ------
NM_004162chr311096 ------
NM_004171chr1118709 39415 5860 1216 28196 3840 --
NM_004186chr31121 ------
NM_004202chrY192 ------
NM_004225chr81474 --1968 --
NM_004232chr1833694 3419 985 ------
NM_004236chr15------1466
NM_004261chr11273 ------
NM_004272chr511589 1424 ----
NM_004274chr1422398 1148 ------
NM_004297chr9166 --147 --
NM_004316chr1211169 2330 312 ----
NM_004319chr11393 --11075 --
NM_004331chr83373 272 254 ------
NM_004338chr1846973 756 210 167 16333 15153 --
NM_004342chr7--12296 ----
NM_004367chr61209 21706 58 --11762
NM_004370chr632101 1814 1603 ----11579
NM_004380chr1612508 11762 ----
NM_004384chr512104 1742 ----
NM_004392chr1311649 ------
NM_004419chr102950 831 --1148 --
NM_004432chr912241 --1601 --
NM_004441chr3----1946 --
NM_004447chr121133 ------
NM_004451chr112714 229 ------
NM_004456chr72210 183 ------
NM_004458chrX11629 ----11993
NM_004459chr17--11538 --21422 408
NM_004480chr141247 ------
NM_004496chr14--1163 ----
NM_004501chr133757 1044 197 ------
NM_004504chr2--2954 160 ----
NM_004514chr1713039 ------
NM_004523chr101504 11515 ----
NM_004529chr9--11350 ----
NM_004575chr41403 ------
NM_004586chrX1826 ------
NM_004588chr1134029 3495 3267 ------
NM_004598chr532033 1271 42 ----1945
NM_004602chr201946 ------
NM_004612chr934325 3371 1375 ------
NM_004631chr11180 ------
NM_004654chrY21332 155 ------
NM_004664chr121276 ------
NM_004670chr1011676 ------
NM_004687chr172320 164 11699 ----
NM_004709chrX11773 11165 11750 --
NM_004717chr711408 ------
NM_004719chr12142 --22202 497 --
NM_004721chr31314 ----1359
NM_004734chr1331153 871 350 12006 ----
NM_004736chr131779 473 333 ------
NM_004744chr433268 2664 143 ----13615
NM_004745chr845405 4665 4331 744 37018 2647 1897 15075 --
NM_004768chr111052 ------
NM_004785chr162498 475 ------
NM_004786chr18132 ------
NM_004795chr1321570 387 ----1172
NM_004799chr1141 ------
NM_004801chr221085 476 ------
NM_004820chr8183 ------
NM_004824chr611209 11008 ----
NM_004831chr19--21030 682 --1973
NM_004834chr233320 2939 2482 ------
NM_004840chrX22043 2031 --1416 --
NM_004849chr61463 ------
NM_004859chr1722397 1969 1583 ----
NM_004887chr5153 ------
NM_004893chr52552 452 ------
NM_004896chr101292 1412 11122 --
NM_004898chr432613 991 673 --12771 --
NM_004902chr201826 ------
NM_004904chr726612 2230 ------
NM_004915chr211520 ------
NM_004926chr1411479 11427 ----
NM_004947chr321838 473 ------
NM_004951chr133521 202 33 ------
NM_004952chr1--1826 ----
NM_004956chr7------13793
NM_004966chr101684 1161 ----
NM_004985chr121996 --12733 --
NM_004999chr621479 304 ------
NM_005010chr71188 ------
NM_005025chr3154 ------
NM_005058chrY----149 --
NM_005069chr211353 11699 11463 --
NM_005088chrX2786 97 ------
NM_005095chr11159 1409 ----
NM_005097chr10----194 --
NM_005113chr14------1424
NM_005119chr111313 ------
NM_005156chr935212 3775 1186 ------
NM_005159chr1531780 898 178 1702 1662 --
NM_005171chr12--11276 ----
NM_005190chr6--1390 --1141
NM_005197chr1466203 4438 4234 2028 1890 1166 ----35391 5359 1193
NM_005201chr3--1287 ----
NM_005204chr101930 ------
NM_005235chr256219 5397 1343 1314 1249 17096 25946 720 --
NM_005238chr1122412 646 23448 2305 ----
NM_005257chr182964 509 ----11251
NM_005261chr8--1784 --1908
NM_005277chr41294 ----11928
NM_005278chrX----1456 --
NM_005302chr7--196 ----
NM_005316chr111800 11029 1236 --
NM_005324chr1731950 733 325 ------
NM_005329chr1642199 1676 1482 140 ------
NM_005336chr242239 2044 1868 97 ------
NM_005339chr423693 1243 12953 --1820
NM_005359chr1841133 908 606 564 --16121 --
NM_005378chr21807 ------
NM_005382chr81421 ------
NM_005384chr9147 ------
NM_005400chr21335 22886 2711 12023 11197
NM_005402chr711835 1460 ----
NM_005406chr181481 11139 ----
NM_005410chr52288 111 ------
NM_005414chr31285 ------
NM_005415chr21598 ------
NM_005433chr181835 11753 ----
NM_005436chr10--1926 --1615
NM_005455chr1--1696 ----
NM_005458chr92560 261 --22461 2237 1293
NM_005465chr121620 176 ------
NM_005475chr1243265 3053 2350 688 ------
NM_005493chr62814 155 ------
NM_005502chr91350 ----13139
NM_005504chr1246235 6201 5969 174 14301 ----
NM_005509chr521546 719 --11655 --
NM_005523chr721394 545 ------
NM_005525chr1------1163
NM_005542chr711276 ------
NM_005562chr151351 1241 1211 1193 313 ------
NM_005563chr1----1691 --
NM_005570chr1821183 347 ------
NM_005573chr52196 123 ------
NM_005575chr5------173
NM_005578chr325124 603 14088 35005 1726 1038 --
NM_005584chr132280 99 ------
NM_005587chr1521004 199 --1295 --
NM_005595chr11920 ------
NM_005596chr955264 5172 2215 2141 335 26427 5612 16285 --
NM_005611chr16--11265 ----
NM_005613chr11578 11728 ----
NM_005618chr61585 ------
NM_005639chr121475 ------
NM_005668chr51166 ------
NM_005711chr5--171 ----
NM_005715chr6--12747 ----
NM_005717chr121219 926 ----1460
NM_005725chr1125 ------
NM_005731chr21304 --1171 --
NM_005749chr17----1623 --
NM_005759chr224489 1765 ------
NM_005779chr533663 3352 163 ------
NM_005788chr111759 ------
NM_005801chr172689 43 ------
NM_005806chr21194 --21241 1181 11313
NM_005808chr313563 13311 ----
NM_005822chr622275 2210 ------
NM_005824chr7--2249 100 ----
NM_005832chr31158 21330 141 ----
NM_005833chr91139 ------
NM_005839chr1------1162
NM_005840chrX36689 2753 2235 ------
NM_005841chr4------11084
NM_005842chr131719 ----1298
NM_005843chr2----11392 --
NM_005853chr16--1525 ----
NM_005857chr111507 11479 ----
NM_005859chr511409 1503 --1402
NM_005863chr1031140 1130 72 1406 1360 --
NM_005869chr5----1152 --
NM_005888chr12--161 ----
NM_005898chr11--23196 666 ----
NM_005901chr18--22056 1169 --17031
NM_005903chr521177 811 --24589 691 1478
NM_005904chr1821391 97 ------
NM_005906chr61523 1116 ----
NM_005909chr511482 1225 11439 --
NM_005910chr1733993 3452 110 ----12655
NM_005922chr6--1449 ----
NM_005924chr711012 ------
NM_005935chr413805 15176 1333 --
NM_005937chr17----24146 3994 14184
NM_005941chr822895 2633 13580 13885 --
NM_005955chr174922 4702 4452 1224 1085 801 721 ------
NM_005966chr241722 503 426 202 ------
NM_005968chr191181 ------
NM_005977chr131820 ------
NM_005996chr1211020 ------
NM_006002chr13141 ------
NM_006007chr943964 3336 2866 1304 --1841 --
NM_006016chr622037 2015 12279 ----
NM_006036chr2--11685 ----
NM_006037chr253440 3420 1281 289 243 --13133 --
NM_006047chr2012204 ----13375
NM_006051chr51295 ------
NM_006094chr822179 2022 1222 21956 756 --
NM_006095chr434481 3497 967 --14053 --
NM_006106chr11--12174 13202 13116
NM_006107chr171332 ------
NM_006136chr71856 ----159
NM_006141chr16--21935 1068 ----
NM_006158chr811564 11741 11334 --
NM_006159chr12--1628 ----
NM_006160chr1711677 11514 ----
NM_006164chr2--1107 --1344
NM_006166chr121283 11844 ----
NM_006178chr1721605 413 ------
NM_006180chr912015 ----11702
NM_006194chr14----11057 1408
NM_006195chr911050 21169 376 ----
NM_006203chr585309 4920 4037 1019 954 690 359 164 14103 15228 --
NM_006204chr10--1189 ----
NM_006206chr442442 1931 203 74 ------
NM_006216chr2126 ------
NM_006224chr172447 30 11005 ----
NM_006226chr2--11107 11346 --
NM_006243chr11393 ------
NM_006246chr14----2922 222 --
NM_006255chr1411003 ------
NM_006256chr132471 1996 197 ------
NM_006258chr101274 ------
NM_006275chr201565 ------
NM_006277chr21170 ------
NM_006282chr2011676 --1716 21497 1150
NM_006287chr2----12083 --
NM_006330chr8----1117 --
NM_006345chr41317 --11354 --
NM_006357chr2159 ------
NM_006359chrX22448 649 --22400 1561 --
NM_006364chr1411113 ------
NM_006371chr354590 4427 1914 1873 1565 ------
NM_006375chrX------2571 258
NM_006380chr1713771 1847 ----
NM_006421chr81150 1898 ----
NM_006451chr5--1368 ----
NM_006460chr17----1142 1492
NM_006466chr20----134 --
NM_006482chr1212911 ------
NM_006489chr141115 ------
NM_006526chr2031689 1549 680 ------
NM_006529chr441267 621 155 25 ----11153
NM_006534chr2042498 2381 943 675 --13356 --
NM_006539chr161545 ------
NM_006540chr8--2426 274 ----
NM_006544chr1421961 919 --21016 492 --
NM_006546chr1746358 2380 1566 241 ------
NM_006548chr311717 ------
NM_006557chr911707 11382 ----
NM_006558chr81430 1406 ----
NM_006559chr11425 ------
NM_006570chr9----1330 --
NM_006595chr1112000 ------
NM_006599chr1628252 5775 1144 ----
NM_006603chrX21422 179 11623 11959 --
NM_006624chr1011995 ------
NM_006628chr1534445 1047 975 ------
NM_006636chr21347 ------
NM_006646chr1332843 891 689 ------
NM_006650chr523922 3296 ------
NM_006654chr1244797 4619 3809 1168 13693 --11549
NM_006667chrX--1975 --141
NM_006670chr61564 ------
NM_006682chr731819 771 215 ------
NM_006690chr20----21758 717 --
NM_006703chr6153 ------
NM_006717chr9--12601 1847 --
NM_006718chr641124 1085 306 235 ------
NM_006722chr322073 536 12177 ----
NM_006724chr6--1449 ----
NM_006726chr411087 --1841 --
NM_006727chr5----1346 --
NM_006729chrX55628 4006 651 161 112 ------
NM_006738chr1533044 1526 280 --14420 --
NM_006750chr1677691 7498 6472 6080 2806 1380 123 27921 1631 27482 5553 --
NM_006754chr711273 ------
NM_006763chr121874 802 ------
NM_006775chr61658 12866 ----
NM_006788chr1822013 1449 ----11915
NM_006791chr152464 38 ------
NM_006806chr21----1418 --
NM_006813chr62878 96 ----1111
NM_006815chr1221251 1146 ------
NM_006818chr11836 1316 ----
NM_006823chr811078 ------
NM_006854chr731764 317 147 11324 ----
NM_006870chr202717 148 --1559 --
NM_006873chr223122 652 ------
NM_006885chr1623953 1014 ------
NM_006893chr1----186 --
NM_006915chrX21564 647 --11624 --
NM_006920chr231693 757 295 12058 ----
NM_006922chr252221 1022 714 690 278 ------
NM_006924chr1734381 4269 1131 24388 4034 21056 591 --
NM_006939chr14--1277 ----
NM_006940chr12--11746 11655 --
NM_006981chr942280 1868 998 484 ------
NM_006988chr21----1184 --
NM_007005chr9------11457
NM_007006chr1632954 575 339 ----13299
NM_007008chr2----1826 --
NM_007011chr1566719 6396 6265 4792 4610 2598 15508 ----
NM_007013chr81394 1152 ----
NM_007026chr17--1560 ----
NM_007034chr11972 ------
NM_007042chr3------1339
NM_007084chr1351286 1072 212 181 21 --11280 --
NM_007114chr342687 2650 2298 759 ----12611
NM_007118chr5--1259 1307 --
NM_007124chr611662 21863 1826 ----
NM_007126chr9------1168
NM_007129chr131768 ------
NM_007137chrX32049 870 737 1334 21645 911 --
NM_007146chr1721122 592 12878 ----
NM_007159chr31222 --11610 --
NM_007173chr111155 --21912 311 --
NM_007174chr1211689 ----12090
NM_007175chr853068 1375 1085 593 23 ------
NM_007200chr1533044 1526 280 --14420 --
NM_007203chr91101 ------
NM_007207chr12742 700 ----1919
NM_007214chr641296 876 237 42 ------
NM_007221chr11417 ------
NM_007222chr811688 ------
NM_007242chr161166 ------
NM_007249chr1363621 1749 1543 569 563 535 --18931 --
NM_007308chr4------1572
NM_007324chr1141 ------
NM_007358chr111608 ------
NM_007361chr142214 70 1144 ----
NM_007373chr1021641 360 ------
NM_012062chr122297 96 --1822 --
NM_012069chrX32121 934 284 ------
NM_012081chr543773 1098 628 448 ----12521
NM_012084chrX----1489 --
NM_012092chr22370 222 ------
NM_012096chr312994 13492 1470 --
NM_012104chr111521 ------
NM_012104chr111521 ------
NM_012120chr6----1227 --
NM_012129chr741645 1570 393 60 ------
NM_012141chr1312962 ----1976
NM_012153chr1121806 72 11010 11912 --
NM_012156chr2032798 492 377 1645 --13076
NM_012161chr4----21094 182 --
NM_012164chr916963 14687 15632 27179 2976
NM_012180chr4--1587 --1495
NM_012233chr221178 369 1408 --1842
NM_012234chr333270 2880 771 ----11454
NM_012243chr11305 --1342 --
NM_012247chr101709 ------
NM_012249chr213153 1298 --12515
NM_012252chr72341 155 14139 --14833
NM_012259chr63502 400 22 11347 ----
NM_012262chr135154 4339 3812 14458 ----
NM_012281chr721588 621 1340 ----
NM_012287chr323899 3215 --12903 --
NM_012288chr655506 4883 2188 376 130 --14133 --
NM_012297chr422452 969 1986 ----
NM_012300chr522570 135 ------
NM_012302chr11496 ------
NM_012307chr182392 43 ------
NM_012308chr1112234 ------
NM_012309chr1154894 4502 3506 954 711 23681 1471 23457 25 --
NM_012316chr1----25666 5427 --
NM_012323chr2211156 ------
NM_012330chr101248 1108 11605 --
NM_012340chr20--1102 ----
NM_012342chr101126 ------
NM_012345chr131168 ------
NM_012347chr6--22300 56 12421 --
NM_012382chr533553 3215 1570 ------
NM_012388chr1513043 12899 ----
NM_012395chr722343 481 1894 22780 593 12740
NM_012399chr2221742 1612 1343 ----
NM_012406chr122966 38 ------
NM_012414chr1----1726 --
NM_012446chr51231 ------
NM_012448chr1712180 1316 1973 --
NM_012464chr4----1392 --
NM_012465chr1032577 2234 922 --42936 2384 1116 376 1914
NM_012467chr161103 ------
NM_012479chr71802 ------
NM_013229chr1232586 1794 233 ------
NM_013242chr16--180 ----
NM_013269chr122669 289 ------
NM_013281chr2011174 184 1268 --
NM_013354chr821147 563 ----11429
NM_013357chr82855 256 ------
NM_013374chr332812 2500 819 ----12652
NM_013380chr191823 ----1743
NM_013381chr122481 232 1447 --1797
NM_013386chr11252 ----11581
NM_013396chr21--1125 ----
NM_013411chr132064 2001 1904 ------
NM_013423chrX11054 ------
NM_013427chrX11054 ------
NM_013434chr2------1105
NM_013434chr2------1105
NM_013437chr8------11173
NM_013438chr9----1429 --
NM_013444chrX1335 ------
NM_013956chr81102 ------
NM_013957chr81102 ------
NM_013960chr81778 ------
NM_013964chr81102 ------
NM_013995chrX1724 1232 ----
NM_014000chr1011933 ------
NM_014007chr9159 ------
NM_014011chr211691 1579 ----
NM_014016chr3--11049 ----
NM_014021chr123328 2243 ------
NM_014023chr1032779 2018 538 ------
NM_014034chr611500 ------
NM_014043chr311426 1185 --196
NM_014048chr1654894 4626 4503 4317 98 ------
NM_014089chr1311621 12097 ----
NM_014112chr845457 4271 3748 2034 25069 3878 11631 --
NM_014117chr1622233 1009 12384 21835 72 --
NM_014155chr1115099 --11622 --
NM_014217chr111487 --11593 --
NM_014240chr344148 2754 1309 524 11526 13161 --
NM_014241chr10--1396 ----
NM_014246chr2211443 --1418 --
NM_014253chrX22270 1733 ------
NM_014263chr10139 --1186 --
NM_014264chr4----2650 494 --
NM_014268chr181444 ------
NM_014283chr11462 ------
NM_014300chr151431 ------
NM_014309chr2264887 4802 3765 3593 1889 51 --14076 --
NM_014319chr1211707 ------
NM_014323chr22--1898 ----
NM_014333chr1121912 1773 --22378 591 --
NM_014363chr13--1217 ----
NM_014382chr3----127 --
NM_014392chr431606 1028 370 --31164 144 38 --
NM_014409chr121042 55 ------
NM_014415chr3----11463 --
NM_014423chr525292 276 ------
NM_014452chr621120 1062 ------
NM_014454chr62995 343 ------
NM_014458chr111220 1447 ----
NM_014476chr42365 212 ------
NM_014491chr72822 797 ------
NM_014494chr16--11532 --1355
NM_014577chr22----1615 --
NM_014585chr211089 2377 294 ----
NM_014586chr2113686 14288 24520 1511 --
NM_014592chr51767 ------
NM_014606chr4------11090
NM_014614chr211300 ------
NM_014615chr1621369 746 1533 ----
NM_014616chr3--13145 1968 --
NM_014620chr121755 1318 ----
NM_014647chr1611605 ------
NM_014659chr15--2784 483 ----
NM_014666chr51891 11181 ----
NM_014667chr332064 1818 706 ----1128
NM_014670chr2----1395 --
NM_014677chr821225 993 --170 --
NM_014682chr81118 --11877 --
NM_014705chr721730 1518 --1522 1610
NM_014707chr74715 598 552 390 ----1783
NM_014717chr19----1244 --
NM_014730chr12----14112 --
NM_014730chr12----14112 --
NM_014735chrX1343 ------
NM_014736chr151706 ------
NM_014751chr8------11788
NM_014755chr293121 3015 1629 1206 774 660 500 372 264 13278 ----
NM_014757chr51432 ------
NM_014775chr221111 ------
NM_014795chr221111 924 1199 ----
NM_014810chr133237 3061 867 --23430 3405 13089
NM_014812chr11591 21499 81 ----
NM_014819chr53982 71 47 ------
NM_014820chr31284 1676 1256 --
NM_014828chr1412115 ------
NM_014836chr101537 ------
NM_014838chr222416 271 ------
NM_014841chr61887 ------
NM_014859chr1711097 ------
NM_014864chr11403 12897 ----
NM_014868chr121903 ------
NM_014871chr12----1175 1218
NM_014873chr1179 24307 3025 14391 1722
NM_014877chr1765406 5134 4804 2660 2100 150 ----16425
NM_014890chr3141 ------
NM_014892chr61440 ------
NM_014897chr171857 1826 ----
NM_014899chr51226 --23088 2297 12595
NM_014903chr1221514 176 --12431 --
NM_014906chr1733943 3624 3541 ----23647 203
NM_014912chr1023449 2190 --13044 --
NM_014918chr151324 ------
NM_014920chr623184 401 ------
NM_014923chr13--11959 ----
NM_014932chr311565 ------
NM_014934chr1323107 2999 12458 ----
NM_014935chr123892 3066 ------
NM_014946chr21181 --12838 --
NM_014950chr1421294 364 --1149 --
NM_014962chr2032912 2025 79 ------
NM_014974chr10----2665 315 --
NM_014978chr1011699 11195 ----
NM_014982chr1411337 ------
NM_014988chr42698 529 12174 ----
NM_014990chr141538 11251 ----
NM_014991chr41406 13221 ----
NM_014992chr14181 ------
NM_014996chr3----1395 --
NM_015000chr1232351 1973 423 --22371 2151 --
NM_015002chr1241890 748 405 178 ------
NM_015008chr333527 249 162 ------
NM_015009chr3----2673 131 --
NM_015025chr21936 --11832 1543
NM_015032chr132924 628 ------
NM_015035chr2036600 4880 4429 --1143 12052
NM_015045chr101396 21689 1655 1509 --
NM_015051chr912733 13426 --13155
NM_015064chr1243327 2502 2433 1030 ------
NM_015068chr71755 ------
NM_015071chr535318 1496 1453 --1256 16062
NM_015076chr634021 1538 86 ------
NM_015090chr165003 3919 2359 1832 275 34 11086 21518 484 --
NM_015091chr141686 ------
NM_015093chr621548 575 ------
NM_015094chr2223546 3330 --14379 13489
NM_015097chr31555 ------
NM_015110chr9--21632 678 --12228
NM_015116chr1331339 615 231 --185 --
NM_015132chr731702 1695 224 1747 ----
NM_015137chr821677 418 21786 461 ----
NM_015144chr1643537 942 750 707 ------
NM_015156chr1412668 12648 13759 --
NM_015172chr121255 193 ------
NM_015176chr11202 ------
NM_015192chr201512 ------
NM_015200chr42736 680 2567 62 ----
NM_015202chr1611313 --11180 11715
NM_015206chr1512741 11124 11562 12414
NM_015208chr1833748 1149 751 23931 1271 --21498 1285
NM_015209chr152308 2122 942 659 223 ------
NM_015215chr1--13123 ----
NM_015233chr1331992 248 208 --1693 --
NM_015236chr431279 1087 932 --11035 --
NM_015239chr9129 ------
NM_015250chr911774 --11410 --
NM_015265chr221906 472 ----12027
NM_015268chr3--1578 ----
NM_015271chr433489 899 603 --1291 1546
NM_015272chr1611659 11414 ----
NM_015278chr633315 2389 2112 ----11015
NM_015286chr151166 12511 ----
NM_015288chr543649 3583 3240 2980 ----11336
NM_015294chr17128 ------
NM_015308chr11----1183 --
NM_015310chr867841 7141 6377 1467 1164 201 28359 1889 15797 27378 2906
NM_015315chr5----12496 --
NM_015317chr22804 563 ------
NM_015321chr1964703 628 545 176 164 112 ------
NM_015328chr722755 645 ------
NM_015335chr12179 12084 ----
NM_015336chr121604 42511 2123 935 880 ----
NM_015339chr202656 67 ------
NM_015344chr831338 780 537 ------
NM_015349chr633088 2196 454 ------
NM_015353chr172489 99 ------
NM_015355chr17------11820
NM_015361chr21913 ------
NM_015365chrX----1764 --
NM_015393chr443559 3514 2352 1250 ------
NM_015396chr3------1125
NM_015423chr1111568 ------
NM_015429chr3----138 --
NM_015443chr1711200 --11492 --
NM_015447chr93678 199 126 --2145 43 --
NM_015455chr5----23362 1488 --
NM_015460chr321888 633 --21798 480 --
NM_015461chr181544 ------
NM_015475chr21296 ------
NM_015509chr121432 ------
NM_015532chr151227 --11875 --
NM_015535chr243126 1667 754 597 13137 14113 --
NM_015548chr6195 ------
NM_015550chr733400 3378 3130 1671 ----
NM_015553chr641660 1378 780 187 14867 13261 163
NM_015559chr181425 ------
NM_015565chr21----12019 --
NM_015567chr1311018 ------
NM_015570chr711226 2437 353 1525 11495
NM_015571chr621974 274 ------
NM_015576chr332383 1877 992 12472 ----
NM_015577chr531315 703 690 ------
NM_015578chr191354 --176 --
NM_015589chr14----1166 --
NM_015601chr101953 134 ----
NM_015609chr11516 ------
NM_015630chr23874 753 269 167 ----
NM_015640chr134523 3411 1993 --1292 --
NM_015687chr6------1533
NM_015852chr733470 1227 428 ------
NM_015866chr121480 104 --1359 --
NM_015878chr822118 543 11712 11940 --
NM_015885chr112638 224 ------
NM_015886chr823643 1668 35117 4892 3809 ----
NM_015906chr123173 214 ------
NM_015912chr8----11639 1909
NM_015915chr142130 71 ------
NM_015955chr2----1371 --
NM_015981chr52175 38 12818 21197 826 --
NM_015990chr42734 358 ----11094
NM_015995chr1554790 2186 1670 553 94 15503 ----
NM_015999chr11693 ------
NM_016019chr71721 --1951 --
NM_016025chr1621986 604 21458 788 1663 --
NM_016041chr17------179
NM_016045chr2021240 1156 ------
NM_016057chr1211299 ------
NM_016072chr122849 623 ------
NM_016076chr1198 --1227 --
NM_016083chr623724 652 ------
NM_016087chr7154 ----11183
NM_016090chr111326 1225 ----
NM_016103chr51487 ------
NM_016121chr1----1455 --
NM_016123chr121876 1459 ----
NM_016131chr21328 159 ----
NM_016157chrX------189
NM_016169chr1022927 544 ------
NM_016201chr311482 --11722 --
NM_016221chr5146 12099 ----
NM_016227chr11462 ------
NM_016231chr17164 ------
NM_016248chr1323949 102 --1396 --
NM_016252chr21937 ------
NM_016257chr133042 3024 2915 1184 11120 --
NM_016260chr246181 6014 4762 2726 --11283 --
NM_016277chr6------11444
NM_016281chr12--171 ----
NM_016284chr16----1900 --
NM_016316chr2----165 --
NM_016351chr7181 ------
NM_016374chr111551 11068 ----
NM_016374chr111551 11068 ----
NM_016376chr1711500 ------
NM_016396chr1532917 2341 837 ------
NM_016399chr122295 249 1354 2706 31 --
NM_016424chr1711837 1182 ----
NM_016436chr2012697 --12108 12689
NM_016470chr201122 ------
NM_016488chr1221217 317 31982 475 68 ----
NM_016507chr1722905 120 ------
NM_016513chr623184 401 ------
NM_016531chr443430 2763 2711 861 --13267 --
NM_016542chrX21576 112 ------
NM_016544chr233524 2544 40 13499 13534 --
NM_016547chr11697 ------
NM_016569chr1211020 ------
NM_016577chr324208 1328 ------
NM_016603chr521430 599 11865 ----
NM_016605chr51640 --12651 --
NM_016613chr41334 22462 120 --1561
NM_016623chr8180 ------
NM_016626chr181506 --146 --
NM_016628chr10--1343 ----
NM_016818chr211520 ------
NM_016824chr10--21469 1399 ----
NM_016834chr1733993 3452 110 ----12655
NM_016835chr1733993 3452 110 ----12655
NM_016836chr2--1291 ----
NM_016839chr2--1291 ----
NM_016841chr1733993 3452 110 ----12655
NM_016936chr1611629 ------
NM_016953chr213959 127 14800 --
NM_017409chr121319 1116 ----
NM_017420chr1432821 1482 108 12876 12726 --
NM_017423chr4----21798 821 11733
NM_017440chr121251 ------
NM_017447chr2121160 56 11642 ----
NM_017452chr201946 ------
NM_017453chr201946 ------
NM_017454chr201946 ------
NM_017482chr221597 557 155 ----
NM_017522chr11180 ------
NM_017534chr17----2127 99 --
NM_017540chr523035 2036 --11066 --
NM_017548chr32427 251 ------
NM_017551chr1012682 ------
NM_017563chr321460 360 --15338 --
NM_017577chr331666 531 25 ------
NM_017628chr424003 3293 --14407 13396
NM_017629chr11255 ------
NM_017633chr633679 1189 606 1244 1960 --
NM_017634chr811462 ------
NM_017635chr111176 --21379 550 --
NM_017637chr939104 8470 2948 29120 412 33367 2583 1388 --
NM_017643chr171373 --13045 --
NM_017644chr331587 1413 831 1102 ----
NM_017658chr1443514 3117 2826 1868 --14450 --
NM_017693chr1321573 1410 ------
NM_017709chr113936 24264 1661 ----
NM_017714chr201112 --1382 --
NM_017737chr12624 546 ------
NM_017738chr92246 72 --127 --
NM_017742chr1821439 617 ------
NM_017752chrX11958 ----11942
NM_017754chr635003 4522 4008 ------
NM_017769chr1412396 ----12152
NM_017776chrX1633 21302 262 ----
NM_017778chr8------11429
NM_017791chr141209 1348 ----
NM_017810chr16194 ------
NM_017813chr821736 1586 22282 166 15667 --
NM_017822chr121140 ------
NM_017824chr1042228 1805 308 292 ----21755 850
NM_017848chrX21856 1661 ------
NM_017866chr8--1912 1846 --
NM_017922chr142275 264 ------
NM_017925chr921850 86 ------
NM_017938chrX21511 1420 ----11984
NM_017944chr1132445 2035 390 1234 13065 --
NM_017988chr122636 366 ------
NM_018010chr311535 ------
NM_018027chr1012457 12813 12719 13289
NM_018036chr1433753 3478 3448 ------
NM_018061chr121707 412 ----11675
NM_018079chr21485 ------
NM_018084chr211198 22630 598 ----
NM_018085chr167523 6076 5670 5144 866 45 --17744 --
NM_018086chr211521 1620 21859 102 --
NM_018094chrX1346 --1110 --
NM_018098chr31294 ------
NM_018103chr1152 ------
NM_018121chr1032680 2585 2433 ------
NM_018133chr311653 11885 11933 --
NM_018139chr142138 118 ------
NM_018147chr31195 ------
NM_018150chr11348 ------
NM_018164chr12--1316 --138
NM_018177chr41186 ------
NM_018181chr1821789 110 ------
NM_018193chr15------1208
NM_018201chr912547 ------
NM_018225chr923668 3463 15113 ----
NM_018234chr252292 718 223 104 84 ------
NM_018237chr10----1230 --
NM_018257chr20--12254 ----
NM_018264chr7196 1954 ----
NM_018270chr20----1827 --
NM_018286chr171829 ------
NM_018287chr101188 --1406 --
NM_018293chr3----1841 --
NM_018299chr833176 979 964 ------
NM_018312chr11----1685 --
NM_018313chr3--1539 22692 2353 --
NM_018315chr421313 1019 166 --21146 262
NM_018317chr4165 ------
NM_018318chr121901 1847 --1335
NM_018327chr2031730 1706 338 ------
NM_018332chr161166 ------
NM_018361chr833147 1067 304 ----1603
NM_018364chr122507 170 ------
NM_018368chr6--1246 ----
NM_018371chr8147 1193 ----
NM_018373chr1435305 4722 525 12304 16050 --
NM_018374chr71977 ----24798 613
NM_018387chr91155 ------
NM_018388chrX11151 --11240 --
NM_018394chr31157 ------
NM_018403chr31473 --24106 4044 --
NM_018407chr821100 1013 ------
NM_018416chr1232126 2096 2075 12393 ----
NM_018423chr121258 ------
NM_018429chr5----22609 210 --
NM_018439chr18--11770 1638 --
NM_018472chrX1126 ------
NM_018482chr822365 910 21685 692 1315 --
NM_018489chr132168 808 681 12025 ----
NM_018534chr2147 ------
NM_018566chr153323 1331 1134 942 610 14841 ----
NM_018584chr111123 1209 --21079 468
NM_018590chr10--11493 11594 --
NM_018593chr6----179 --
NM_018638chr1214931 1231 ----
NM_018682chr71480 ----1621
NM_018695chr522334 876 ----11663
NM_018699chr4------1228
NM_018704chr131757 1742 847 ------
NM_018710chr81174 ------
NM_018712chr1131228 969 74 11091 ----
NM_018717chr421043 107 --1656 --
NM_018719chr711341 --11238 --
NM_018723chr16167 ------
NM_018834chr5--1663 ----
NM_018844chr72105 22 --1182 --
NM_018898chr51272 1849 --1176
NM_018899chr51272 1849 --1176
NM_018900chr51272 1849 --1176
NM_018901chr51272 1849 --1176
NM_018902chr51272 1849 --1176
NM_018903chr51272 1849 --1176
NM_018904chr51272 1849 --1176
NM_018905chr51272 1849 --1176
NM_018906chr51272 1849 --1176
NM_018907chr51272 1849 --1176
NM_018908chr51272 1849 --1176
NM_018909chr51272 1849 --1176
NM_018910chr51272 1849 --1176
NM_018911chr51272 1849 --1176
NM_018945chr643407 2734 666 419 --1167 --
NM_018948chr1------199
NM_018968chr2144 ------
NM_018970chr722196 142 --1453 --
NM_018976chr1212605 ------
NM_018999chr1024377 837 11230 1495 --
NM_019003chrX--161 ----
NM_019006chr152174 38 ------
NM_019016chr171241 ------
NM_019027chr41222 ----22632 2156
NM_019035chr411870 ------
NM_019036chr621022 195 ------
NM_019049chr11117 ------
NM_019071chr71776 ------
NM_019072chr544244 3847 3601 1385 ------
NM_019084chr1012507 --12542 --
NM_019091chr21187 144 ----
NM_019094chr12----22951 92 --
NM_019098chr821848 1625 ------
NM_019116chr1643438 2962 2908 432 1482 1413 --
NM_019555chr31594 11270 1567 --
NM_019558chr21297 ------
NM_019590chr1011335 ----11138
NM_019595chr21170 ------
NM_019600chr153639 233 46 ------
NM_019605chr1--1155 157 --
NM_019610chr131711 738 705 1487 1778 --
NM_019842chr6195 ------
NM_019903chr10--21469 1399 ----
NM_020066chr14818 670 186 35 --1713 11033
NM_020116chr4------11422
NM_020132chr2144425 2041 1707 414 45018 3757 3740 1981 ----
NM_020135chr61430 --174 --
NM_020141chr1--11494 --2792 573
NM_020144chr71185 ------
NM_020163chr312094 ------
NM_020178chr171237 1156 ----
NM_020182chr2023032 1224 11392 13107 1191
NM_020190chr11454 ------
NM_020193chr11----1439 --
NM_020194chr2----160 --
NM_020198chr1721362 438 ------
NM_020199chr5166 ------
NM_020228chr11------11619
NM_020231chr31647 ------
NM_020310chr1722065 145 ------
NM_020336chr2031459 719 349 ------
NM_020337chr432814 2690 501 --23167 2869 --
NM_020341chr201434 184 12050 --
NM_020346chr1161601 1567 1301 1214 396 92 1364 ----
NM_020348chr101830 ----12647
NM_020374chr1231449 685 451 ------
NM_020390chr324541 147 ------
NM_020403chr1351801 1380 441 240 157 ------
NM_020424chr162332 26 ------
NM_020425chr61130 --2392 148 --
NM_020438chr911423 ------
NM_020440chr122757 1117 ------
NM_020452chr1------12127
NM_020455chr642780 1789 181 63 ------
NM_020466chr624549 3308 --13175 11934
NM_020473chrX11809 11425 11758 --
NM_020482chr6------1225
NM_020526chr1--11289 --11735
NM_020532chr2----1826 --
NM_020630chr101146 ------
NM_020640chr311550 12064 1442 --
NM_020644chr111793 ------
NM_020651chr211804 --2531 371 --
NM_020661chr1231669 1511 767 11285 ----
NM_020666chr51802 ------
NM_020686chr1632282 2216 2110 22883 545 12970 --
NM_020696chr31306 ------
NM_020711chr212432 ----12085
NM_020718chr1644469 1723 1325 1255 16066 1167 --
NM_020734chr122664 75 ------
NM_020742chrX21898 572 1147 ----
NM_020744chr2172 ------
NM_020752chr1011969 --32487 574 360 --
NM_020760chr21587 ------
NM_020766chrX34215 1122 698 23799 1697 2803 602 --
NM_020771chr621524 511 ------
NM_020772chr1732846 1130 23 --16379 16834
NM_020774chr1845469 5017 4259 1570 1964 ----
NM_020783chr1832054 492 78 ------
NM_020787chr1721515 977 ------
NM_020791chr17--1344 11082 --
NM_020796chr541144 691 566 196 31909 999 457 ----
NM_020799chr101260 ------
NM_020800chr311145 11514 ----
NM_020801chr511703 ------
NM_020806chr14----1238 --
NM_020809chr111701 ------
NM_020810chr1422782 825 ------
NM_020818chr141136 ------
NM_020819chr61987 ------
NM_020824chr101241 ------
NM_020841chr1211242 --1516 --
NM_020858chr1542253 2241 1961 820 ------
NM_020860chr431056 907 344 ----1364
NM_020868chr211936 ------
NM_020871chrX22575 628 ------
NM_020886chr111889 11192 ----
NM_020899chr17--22435 1881 1360 --
NM_020917chr192907 467 11015 ----
NM_020925chr111464 ------
NM_020935chr273749 3375 1153 1066 888 648 587 ------
NM_020940chr1022491 730 ----12236
NM_020947chr1642376 2192 1930 1794 --12349 --
NM_020958chr14--1114 1346 --
NM_020960chr921999 1206 --25015 4756 11921
NM_020973chr4------1250
NM_020987chr10--1150 1872 --
NM_020993chr1241077 794 483 132 32344 2328 1883 ----
NM_021004chr141374 --2363 348 --
NM_021005chr15----1910 --
NM_021007chr2--11597 ----
NM_021033chr1323493 2764 ----12149
NM_021038chr322381 2109 13119 --22579 1083
NM_021069chr41692 11689 ----
NM_021072chr5--1914 ----
NM_021098chr161696 ------
NM_021109chrX2397 92 ------
NM_021109chrX2397 92 ------
NM_021110chr81657 --1759 --
NM_021111chr911327 ------
NM_021116chr719043 ------
NM_021120chrX22641 2094 1277 11033 --
NM_021127chr18--1562 ----
NM_021132chr1011006 --1850 --
NM_021136chr14179 1490 ----
NM_021140chrX21152 89 ------
NM_021151chr71224 ------
NM_021201chr1111889 ------
NM_021215chr2021715 994 --1220 --
NM_021219chr21----189 --
NM_021229chr121889 --11211 --
NM_021252chr1031889 1337 135 --11303 --
NM_021622chr1022027 1957 1713 ----
NM_021627chr321195 186 --1372 --
NM_021648chr61152 12407 ----
NM_021723chr7181 ------
NM_021728chr14----1250 --
NM_021813chr655118 4549 4076 1731 1117 45780 4618 1716 485 14632 --
NM_021818chr14----21292 67 --
NM_021911chr544482 1396 437 216 15422 ----
NM_021912chr1511561 ------
NM_021914chr142833 322 11582 12382 1890
NM_021940chr6------1271
NM_021943chr621581 1553 11661 ----
NM_021956chr62515 159 2553 94 ----
NM_021961chr1145969 4894 1019 839 24544 1906 27404 6212 --
NM_021963chrX--1772 ----
NM_021964chr366457 6069 5429 5331 4649 1014 26042 4082 15915 --
NM_021977chr633174 1191 577 13905 156 21519 1289
NM_021979chr143439 125 23 --1421 --
NM_021998chrX11121 ------
NM_022037chr2197 ------
NM_022041chr1632271 1987 407 ------
NM_022068chr182167 23 ------
NM_022079chr101953 134 ----
NM_022114chr134096 1804 1261 24526 3530 34621 583 530 24158 284
NM_022121chr61975 1460 ----
NM_022130chr5------11387
NM_022143chr711221 ------
NM_022166chr1654715 2439 1807 1321 514 --24801 1529 --
NM_022173chr2197 ------
NM_022351chr833313 3226 3214 139 ----
NM_022456chr1236084 5905 2562 15867 1120 15524
NM_022459chr1342354 1496 276 40 21557 860 14444 12140
NM_022465chr12----12985 --
NM_022477chr2021155 29 1397 2523 502 --
NM_022484chr71477 1524 ----
NM_022488chr31185 ------
NM_022550chr5--1148 ----
NM_022648chr244626 3019 3010 409 1253 ----
NM_022650chr51133 ------
NM_022716chr132918 1019 1005 ------
NM_022725chr112547 152 ------
NM_022726chr621625 1134 --11411 --
NM_022728chr71508 ------
NM_022739chr1711182 ------
NM_022756chr1--11482 ----
NM_022763chr31317 1169 23138 2099 --
NM_022771chr122282 41 ----1919
NM_022780chr231304 377 21 ------
NM_022802chr10--1623 11596 --
NM_022817chr222227 709 --1823 11681
NM_022826chr21771 ------
NM_022832chr412385 12061 12180 --
NM_022841chr1512505 12653 ----
NM_022843chr1321363 1176 ------
NM_022893chr242921 2812 2422 300 11051 ----
NM_022898chr1424449 3235 11647 33878 1219 378 --
NM_022912chr23548 449 147 22057 587 ----
NM_022918chr1122052 572 ----11334
NM_022965chr4--1578 ----
NM_022977chrX11629 ----11993
NM_023000chr141643 --11671 1174
NM_023001chr141643 --11671 1174
NM_023016chr23416 341 26 1533 ----
NM_023929chr8--11888 --186
NM_024007chr542338 2112 956 330 --1159 13128
NM_024016chr171176 ------
NM_024095chr1211417 ----1247
NM_024315chr71149 ------
NM_024345chr945250 2016 1158 590 14093 ----
NM_024491chr32603 193 ------
NM_024496chr141630 1133 --1587
NM_024501chr21693 ------
NM_024524chr312566 ------
NM_024539chrX1459 ------
NM_024574chr41355 ------
NM_024582chr41396 ------
NM_024590chr451444 785 390 348 202 11309 ----
NM_024595chr1165 2393 160 ----
NM_024607chr823165 2881 --23516 3020 --
NM_024613chr831469 1376 1196 --1212 --
NM_024631chr11----1589 --
NM_024659chr21725 1829 ----
NM_024692chr211406 ----11508
NM_024715chr51184 1199 ----
NM_024744chr211820 --12224 --
NM_024751chr41167 ------
NM_024770chr225943 333 15956 35664 4098 2255 --
NM_024778chrX180 ------
NM_024835chr17--1399 --1364
NM_024837chr1511916 ------
NM_024841chr11138 --1929 --
NM_024884chr1413629 --14297 13112
NM_024900chr4123 1157 ----
NM_024900chr4123 1157 ----
NM_024913chr721539 1424 ------
NM_024944chr21--1394 1974 --
NM_024947chr338634 1325 1080 13217 ----
NM_024953chr1212627 ------
NM_024969chr2----1622 --
NM_024993chr211210 ------
NM_025054chr852883 1152 988 522 504 13088 1777 13401
NM_025073chr134402 3358 1315 22946 1804 ----
NM_025076chr2----1550 --
NM_025134chr1632445 2244 133 ------
NM_025160chr133571 3350 75 1650 ----
NM_025176chr203730 669 135 --1571 --
NM_025191chr132904 2798 774 ------
NM_025211chr9----154 --
NM_025221chr431283 1271 118 ------
NM_025234chr15130 ------
NM_030594chr151406 ------
NM_030621chr1433995 2635 214 ------
NM_030625chr1011674 22121 1605 ----
NM_030627chr533118 1252 182 13241 24093 1207 --
NM_030647chr714737 15467 15526 15371
NM_030648chr475302 3789 1697 886 499 389 199 --24656 3601 --
NM_030650chr223618 320 ------
NM_030664chr1011800 1808 1663 --
NM_030674chr1244059 2106 1673 84 1839 1478 24800 147
NM_030762chr1221959 637 12022 ----
NM_030780chr81300 --11385 --
NM_030791chr141398 ------
NM_030799chr512060 1714 1287 --
NM_030806chr178923 6055 5899 5858 1621 665 244 --2169 73 17971
NM_030816chr143209 2250 619 389 --13110 --
NM_030915chr23639 378 221 ----11765
NM_030920chr121967 709 ------
NM_030934chr131829 1630 291 --21857 1453 --
NM_030945chr541990 1770 1743 121 --1318 --
NM_030979chr13--1110 --189
NM_030981chr1121250 1163 ------
NM_031203chr191181 ------
NM_031243chr7----1586 --
NM_031262chr91994 1183 ----
NM_031263chr911051 1240 1764 --
NM_031283chr21918 ------
NM_031305chr42323 285 ------
NM_031369chr4--1684 ----
NM_031370chr4--1684 ----
NM_031371chr111551 11068 ----
NM_031371chr111551 11068 ----
NM_031409chr61209 21706 58 --11762
NM_031411chr51272 1849 --1176
NM_031419chr3----1512 --
NM_031435chr1211285 ----13116
NM_031439chr821468 1186 --11937 --
NM_031442chrX21187 229 1889 ----
NM_031445chr233411 3346 909 ------
NM_031476chr1642769 2127 927 884 ------
NM_031483chr2052485 2474 629 192 44 ------
NM_031844chr133757 1044 197 ------
NM_031845chr232823 884 196 --23660 603 13695
NM_031847chr232823 884 196 --23660 603 13695
NM_031849chr51272 1849 --1176
NM_031857chr51272 1849 --1176
NM_031860chr51272 1849 --1176
NM_031866chr101408 ------
NM_031890chr221525 ----1831
NM_031892chrX21004 632 ------
NM_032012chr924600 961 13784 11145 --
NM_032013chr2021155 29 1397 2523 502 --
NM_032041chr822711 357 ------
NM_032048chr182631 560 ------
NM_032050chr22--1898 ----
NM_032052chr22--11283 ----
NM_032116chr1315684 21861 1075 11752 --
NM_032144chr221577 1356 ------
NM_032153chr332452 947 323 12361 122 --
NM_032160chr1834057 3322 379 11063 ----
NM_032177chr5175 ------
NM_032181chr2------1349
NM_032199chr1033446 2897 855 ------
NM_032208chr222437 2349 --23336 610 --
NM_032221chr2022023 1365 ------
NM_032228chr1111422 23524 734 ----
NM_032239chr4--1592 ----
NM_032288chr311731 12239 --11720
NM_032291chr131250 679 662 11821 ----
NM_032299chr11126 ------
NM_032312chr2--196 ----
NM_032321chr233332 2811 2663 ----1943
NM_032373chr1025173 117 --11953 --
NM_032435chr122206 464 ------
NM_032438chr631275 532 507 ------
NM_032440chr1022045 432 ----11033
NM_032446chr523711 3240 ----13329
NM_032449chr112268 ------
NM_032456chr41541 1553 2667 148 --
NM_032457chr423925 312 22654 1023 ----
NM_032458chrX22842 726 ------
NM_032505chr311896 ------
NM_032547chr421359 198 1999 ----
NM_032552chr921951 1829 ------
NM_032557chr4--1808 ----
NM_032575chr161560 --12069 --
NM_032582chr1721559 497 ------
NM_032590chr123361 206 123 ------
NM_032594chr14185 ------
NM_032632chr141330 ------
NM_032638chr31993 ------
NM_032679chr1921192 1077 ----1347
NM_032682chr321446 1363 12469 --11241
NM_032711chr1721095 130 ------
NM_032728chr92970 608 ------
NM_032750chr32670 349 ------
NM_032765chr51662 --1763 1924
NM_032777chr811477 --11605 --
NM_032784chr61375 --1881 --
NM_032804chr1021906 792 ------
NM_032812chr10----1322 --
NM_032813chr13--2879 142 ----
NM_032832chr61117 ------
NM_032859chr1343586 2827 2810 2769 22755 2615 ----
NM_032873chr1133709 1835 1385 --24114 980 23216 783
NM_032905chr101822 ------
NM_032918chr12----1325 --
NM_032949chr131535 --1160 --
NM_032975chr1843279 2713 2501 571 11262 11114 --
NM_032980chr1843279 2713 2501 571 11262 11114 --
NM_033012chr132934 331 2753 424 ----
NM_033020chr123173 214 ------
NM_033058chr8--1235 ----
NM_033121chr1211843 ------
NM_033132chr13--1809 12077 --
NM_033138chr7--12296 ----
NM_033139chr7--12296 ----
NM_033140chr7--12296 ----
NM_033157chr7--12296 ----
NM_033181chr623724 652 ------
NM_033211chr51214 ------
NM_033224chr746333 222 157 114 23027 254 58042 3045 2450 2059 294 1704
NM_033225chr832540 2406 604 12255 --1632
NM_033272chr21359 1118 ----
NM_033274chr523640 3233 23568 399 11433 12472
NM_033281chr52761 686 ------
NM_033300chr11180 ------
NM_033326chr112622 576 --1131 --
NM_033331chr92724 655 22574 1425 --193
NM_033360chr1211117 --12854 --
NM_033389chr1744846 4179 1268 616 13576 13331 --
NM_033425chr111480 --23543 3142 --
NM_033430chr444132 3530 707 282 ------
NM_033437chr444132 3530 707 282 ------
NM_033480chr6--22300 56 12421 --
NM_033481chr6--22300 56 12421 --
NM_033495chrX142 ------
NM_033535chr4----21094 182 --
NM_033551chr5----12496 --
NM_033624chr1241890 748 405 178 ------
NM_033632chr421313 1019 166 --21146 262
NM_033644chr522570 135 ------
NM_033645chr522570 135 ------
NM_044472chr1------1270
NM_052832chr822508 2238 ------
NM_052867chr132292 247 21010 346 ----
NM_052875chr111112 ------
NM_052879chr12--13245 1495 12862
NM_052898chr831685 1667 453 ------
NM_052901chr911676 11689 ----
NM_052907chr1223179 267 14015 ----
NM_052913chr62725 423 1255 ----
NM_052927chr541555 1537 782 213 --1151 --
NM_052937chr81466 ------
NM_052964chr4--1200 ----
NM_053002chr3--11085 ----
NM_053016chr947502 7284 5239 3210 15755 --12923
NM_053023chr1122489 2244 ------
NM_053024chr311057 ------
NM_053281chrX1428 ------
NM_054016chr12301 88 ------
NM_054016chr12301 88 ------
NM_054016chr12301 88 ------
NM_057159chr931606 1528 247 ----11077
NM_057168chr7154 ----11183
NM_057175chr41734 ------
NM_058170chr121012 277 11142 ----
NM_058241chr21514 1228 ----
NM_058241chr21514 1228 ----
NM_080422chr18156 ------
NM_080423chr18156 ------
NM_080546chr942243 2193 1705 713 11583 ----
NM_080645chr632101 1814 1603 ----11579
NM_080654chr111216 --1254 --
NM_080676chr2023110 3087 ------
NM_080759chr1311649 ------
NM_080760chr1311649 ------
NM_080792chr2012269 --11596 12292
NM_080821chr20--12046 ----
NM_080872chr823446 3180 --13711 12888
NM_080927chr322451 862 13017 ----
NM_100264chr10--1343 ----
NM_100486chr10--1343 ----
NM_130391chr923484 868 1728 ----
NM_130392chr923484 868 1728 ----
NM_130393chr923484 868 1728 ----
NM_130395chr61430 --174 --
NM_130436chr2132386 1002 75 --1161 --
NM_130438chr2122963 652 --1738 --
NM_130838chr151742 1595 ----
NM_130839chr151742 1595 ----
NM_130850chr141201 ------
NM_130851chr141201 ------
NM_133172chr51295 ------
NM_133173chr51295 ------
NM_133174chr51295 ------
NM_133264chr1723682 1075 23890 2614 ----
NM_133265chrX13120 --1967 --
NM_133372chr522434 452 ------
NM_133446chr10--138 ----
NM_133496chr111628 14231 21223 566 --
NM_133631chr31462 --1605 --
NM_133644chr19----1297 --
NM_133646chr225597 5370 --1894 --
NM_138270chrX12193 11282 ----
NM_138288chr1412123 ------
NM_138340chr18--1135 ----
NM_138369chr5----1473 --
NM_138395chr221200 745 ------
NM_138423chr15--21964 1710 ----
NM_138426chr711793 1446 1870 1200
NM_138444chr1331136 633 180 23814 1337 ----
NM_138576chr1424449 3235 11647 33878 1219 378 --
NM_138609chr52552 452 ------
NM_138610chr52552 452 ------
NM_138638chr142833 322 11582 12382 1890
NM_138713chr1628252 5775 1144 ----
NM_138714chr1628252 5775 1144 ----
NM_138735chr221085 476 ------
NM_138766chr51496 ------
NM_138782chr521919 895 1537 1645 --
NM_138799chr211501 --11565 --
NM_138821chr51496 ------
NM_138822chr51496 ------
NM_138927chr21--1852 ----
NM_138931chr32701 118 2330 303 ----
NM_138966chr182598 191 ------
NM_138971chr111521 ------
NM_138971chr111521 ------
NM_138972chr111521 ------
NM_138972chr111521 ------
NM_138973chr111521 ------
NM_138973chr111521 ------
NM_139012chr61328 ------
NM_139045chr92795 670 ------
NM_139070chr51203 ------
NM_139072chr21595 ------
NM_139166chr8179 ------
NM_139168chr541668 1355 480 454 --1293 --
NM_139246chr91807 1830 ----
NM_139279chr2--2698 76 ----
NM_139312chr10139 --1186 --
NM_139316chr7--1154 ----
NM_139321chr2013344 1350 ----
NM_144571chr447039 5833 2036 1044 16768 16284 --
NM_144628chr201307 --21087 909 --
NM_144643chr42315 83 ------
NM_144658chrX163 ------
NM_144664chr1112236 ------
NM_144665chr11------1209
NM_144672chr16----1186 --
NM_144723chr5--1797 ----
NM_144726chr53956 876 194 ------
NM_144728chr12742 700 ----1919
NM_144729chr12742 700 ----1919
NM_144767chr1533044 1526 280 --14420 --
NM_144775chr1711003 14015 ----
NM_144778chr1322228 1015 ------
NM_144949chr211691 1579 ----
NM_144963chr81319 --12224 --
NM_144973chr1233650 1058 840 ------
NM_144982chr12----1641 --
NM_145012chr101974 ------
NM_145049chr51939 ------
NM_145055chr1821071 669 --1892 1691
NM_145056chr191809 1300 ----
NM_145112chr1411295 --1899 --
NM_145113chr1411567 --11171 --
NM_145115chr7--11867 11802 11550
NM_145117chr111830 11243 ----
NM_145176chr622654 365 2612 453 ----
NM_145203chr132965 753 ------
NM_145206chr1022670 142 ----1853
NM_145251chr1421534 295 --1280 --
NM_145266chr5------1113
NM_145305chrX41375 1048 403 44 ------
NM_145307chr1022862 1237 ------
NM_145320chr733400 3378 3130 1671 ----
NM_145321chr733400 3378 3130 1671 ----
NM_145322chr733400 3378 3130 1671 ----
NM_145331chr63340 239 34 1584 ----
NM_145332chr62387 182 2732 95 ----
NM_145333chr62387 182 2732 95 ----
NM_145349chr17--11687 12178 --
NM_145647chr8146 ------
NM_145686chr233320 2939 2482 ------
NM_145687chr233320 2939 2482 ------
NM_145698chr1021933 427 ------
NM_145728chr151166 12511 ----
NM_145753chr311403 ------
NM_145804chr1121240 247 ------
NM_145805chr151102 ------
NM_145808chr723134 2709 12911 ----
NM_145891chr1631085 645 67 11285 ----
NM_145892chr1631085 645 67 11285 ----
NM_145893chr1621207 189 11407 ----
NM_147150chr91101 ------
NM_147166chr71551 ------
NM_147175chrX--11371 12017 --
NM_147181chr431283 1271 118 ------
NM_147182chr431283 1271 118 ------
NM_147183chr431283 1271 118 ------
NM_148174chr822118 543 11712 11940 --
NM_148894chr421076 305 ------
NM_148898chr72822 797 ------
NM_148899chr72822 797 ------
NM_152265chr1--11629 ----
NM_152271chr82984 151 --21083 467 --
NM_152280chr11202 12687 ----
NM_152305chr31647 ------
NM_152309chr1012124 ------
NM_152348chr172861 149 ------
NM_152380chr121681 1449 ------
NM_152381chr231930 261 27 1170 ----
NM_152387chr22345 63 --1945 --
NM_152388chr213761 ------
NM_152390chr2--1146 ----
NM_152391chr2--11009 ----
NM_152400chr421794 1615 ------
NM_152417chr81173 ------
NM_152420chr91322 1494 ----
NM_152424chrX12873 --1834 --
NM_152450chr1532148 2006 1612 --1625 --
NM_152470chr1864141 4088 4050 3482 1193 257 11092 ----
NM_152487chr1------11169
NM_152512chr222578 457 ------
NM_152529chr224008 1760 ----13338
NM_152589chr121200 ------
NM_152622chr532590 2303 665 ----11399
NM_152629chr933355 2810 447 ------
NM_152641chr121802 12569 ----
NM_152660chr1186 ------
NM_152687chr5--1155 --1849
NM_152705chr131191 11361 ----
NM_152734chr625500 3326 --11531 --
NM_152742chr71605 ------
NM_152756chr553880 1237 931 791 668 --12676 --
NM_152758chr832729 2036 146 ----12261
NM_152763chr1143 ------
NM_152780chrX31182 908 46 ------
NM_152787chrX23126 383 13961 --1850
NM_152838chr2012204 ----13375
NM_152857chr6------1749
NM_152858chr6------1749
NM_152862chr21304 --1171 --
NM_152878chr2211156 ------
NM_152896chr91278 ------
NM_152903chr13----11001 --
NM_152910chr131589 ------
NM_152924chr1566719 6396 6265 4792 4610 2598 15508 ----
NM_152989chr12--11746 11655 --
NM_152998chr72210 183 ------
NM_152999chr713728 --1335 --
NM_153013chr512229 --173 --
NM_153020chr621670 1486 ------
NM_153038chr2--1653 ----
NM_153047chr61335 ------
NM_153048chr61335 ------
NM_153181chr182598 191 ------
NM_153183chrX1862 ------
NM_153188chr5--24199 1192 24307 2194 --
NM_153207chr121616 ------
NM_153240chr311148 --126 --
NM_153261chr161240 --1328 --
NM_153262chr14980 721 600 363 13023 --11246
NM_153267chr9------1147
NM_153332chr843120 839 515 87 22689 301 ----
NM_153333chrX1508 ------
NM_153426chr41226 ------
NM_153427chr41226 ------
NM_153453chr61713 ------
NM_153464chr192655 327 ------
NM_153487chr621388 291 ------
NM_153498chr10----1248 --
NM_153607chr532452 2342 2267 ------
NM_153616chr1542253 2241 1961 820 ------
NM_153617chr1542253 2241 1961 820 ------
NM_153618chr1542253 2241 1961 820 ------
NM_153619chr1533491 3479 3199 ------
NM_153633chr121755 1318 ----
NM_153634chr121472 --1533 --
NM_153649chr1------12238
NM_153685chr1211241 ------
NM_153687chr1211449 ------
NM_153690chr3--1805 ----
NM_153695chr91274 --1197 --
NM_153828chr2----1826 --
NM_170664chr16----1186 --
NM_170665chr1231664 878 236 14171 ----
NM_170731chr1122407 687 ------
NM_170732chr1122407 687 ------
NM_170733chr1122407 687 ------
NM_170734chr1122407 687 ------
NM_170735chr1122407 687 ------
NM_170751chr611209 11008 ----
NM_170752chr611209 11008 ----
NM_170768chr11----11382 --
NM_171825chr52175 38 12818 21197 826 --
NM_171999chr181809 ------
NM_172037chr831097 463 407 ------
NM_172103chr61829 ------
NM_172105chr61829 ------
NM_172337chr14----1250 --
NM_172373chr1311216 1424 ----
NM_173060chr511604 --11860 --
NM_173061chr511604 --11860 --
NM_173063chr511604 --11860 --
NM_173078chrX1142 1308 ----
NM_173172chr2--197 ----
NM_173198chr942280 1868 998 484 ------
NM_173200chr942280 1868 998 484 ------
NM_173214chr1628252 5775 1144 ----
NM_173468chr435885 2006 21 1412 14914 --
NM_173469chr151371 ------
NM_173495chrX11965 ------
NM_173500chr15------1111
NM_173518chr81271 ------
NM_173552chr332071 1865 192 ----1762
NM_173576chr1022109 1636 ----21745 1431
NM_173582chr1122289 344 ------
NM_173595chr1245174 3658 2090 679 1611 ----
NM_173607chr1412127 ------
NM_173654chr3--21976 943 --123
NM_173683chr831690 1442 63 1519 ----
NM_173694chrX12366 ----22456 2359
NM_173808chr111306 ------
NM_173824chr31262 ------
NM_173825chr322241 2205 1489 1576 --
NM_173827chr422823 2463 13118 ----
NM_173829chr545110 2304 2141 92 --11356 15063
NM_173872chr42841 74 --2303 87 --
NM_174909chr52851 245 ------
NM_175056chr332119 1355 807 ------
NM_175061chr72864 579 --1613 --
NM_175607chr321152 524 11595 1445 --
NM_175612chr321152 524 11595 1445 --
NM_175619chr41140 ------
NM_175623chr1236084 5905 2562 15867 1120 15524
NM_175624chr1236179 6000 2657 15962 1215 15619
NM_175625chr1236179 6000 2657 15962 1215 15619
NM_175733chr1122172 531 ------
NM_175747chr61781 1431 ----
NM_175748chr1411710 12042 ----
NM_175852chr12179 133 --1190 --
NM_175854chr132779 368 ------
NM_175920chr5------173
NM_176812chr20----1267 --
NM_177398chr121829 282 ------
NM_177399chr121829 282 ------
NM_177424chr11328 ------
NM_177438chr1433995 2635 214 ------
NM_177556chrX------189
NM_177967chr1331051 997 832 21022 151 ----
NM_177968chr2--11582 ----
NM_177974chr15--21964 1710 ----
NM_177990chr201434 184 12050 --
NM_177996chr2032798 492 377 1645 --13076
NM_178009chr132552 222 ------
NM_178010chr12--11746 11655 --
NM_178037chr1243327 2502 2433 1030 ------
NM_178038chr1243327 2502 2433 1030 ------
NM_178151chrX57863 7804 7767 6453 5834 27186 257 ----
NM_178152chrX57863 7804 7767 6453 5834 27186 257 ----
NM_178153chrX57863 7804 7767 6453 5834 27186 257 ----
NM_178154chr141247 ------
NM_178155chr141247 ------
NM_178156chr141247 ------
NM_178157chr141247 ------
NM_178427chr11889 1616 ----
NM_178505chr1023301 697 --13224 --
NM_178507chr112752 298 ------
NM_178509chr1713975 ------
NM_178557chr411764 ------
NM_178559chr7143 ------
NM_178585chr41406 13221 ----
NM_178812chr821063 518 --135 --
NM_178868chr3------1348
NM_181291chr14--1635 ----
NM_181332chrX21898 572 1147 ----
NM_181351chr111550 ------
NM_181354chr8--11189 ----
NM_181356chr6------1965
NM_181358chr144259 3902 3113 1471 23635 911 --21177 623
NM_181361chr31158 21330 141 ----
NM_181442chr202656 67 ------
NM_181443chr2032912 2025 79 ------
NM_181481chr1846973 756 210 167 16333 15153 --
NM_181482chr1846973 756 210 167 16333 15153 --
NM_181483chr1846973 756 210 167 16333 15153 --
NM_181504chr543509 2992 2535 1370 1295 ----
NM_181523chr543509 2992 2535 1370 1295 ----
NM_181524chr543509 2992 2535 1370 1295 ----
NM_181532chrX--1213 ----
NM_181598chr142130 71 ------
NM_181659chr2042498 2381 943 675 --13356 --
NM_181659chr2042498 2381 943 675 --13356 --
NM_181670chr121203 2503 189 --11020
NM_181702chr8--1784 --1908
NM_181704chr214451 337 319 180 ------
NM_181705chr545062 4580 1134 1023 13597 13669 --
NM_181706chr11--12142 1111 --
NM_181755chr1------1163
NM_181762chrX------1222
NM_181777chrX------1222
NM_181787chr843741 3602 2641 271 11270 ----
NM_181839chr811078 ------
NM_181861chr1232586 1794 233 ------
NM_181868chr1232586 1794 233 ------
NM_181869chr1232671 1879 318 ------
NM_181872chr91208 ------
NM_181874chr32912 432 135 ----
NM_181886chr41879 ----11259
NM_181887chr41879 ----11259
NM_181888chr41879 ----11259
NM_181889chr41879 ----11259
NM_181890chr41879 ----11259
NM_181891chr41879 ----11259
NM_181892chr41926 ----11306
NM_181893chr41879 ----11259
NM_182314chrX------2571 258
NM_182484chr214451 337 319 180 ------
NM_182485chr453464 3082 2996 935 524 11264 1806 --
NM_182526chr1422630 447 ------
NM_182540chrX------1803
NM_182551chr2--13487 ----
NM_182557chr111818 --139 --
NM_182641chr17--11538 --21422 408
NM_182643chr822179 2022 1222 21956 756 --
NM_182645chr61713 ------
NM_182646chr453464 3082 2996 935 524 11264 1806 --
NM_182663chr121735 66 ----12293
NM_182664chr121865 196 163 --12423
NM_182665chr121735 66 ----12293
NM_182678chr2159 ------
NM_182691chr711359 ------
NM_182692chr711359 ------
NM_182715chr711273 ------
NM_182763chr11772 ------
NM_182765chr1011669 --1472 --
NM_182789chr5--1368 ----
NM_182797chr20--11623 --1494
NM_182830chr1411772 --11688 --
NM_182896chr321398 485 ------
NM_182898chr726612 2230 ------
NM_182899chr726612 2230 ------
NM_182907chr622407 96 ------
NM_182915chr252292 718 223 104 84 ------
NM_182931chr71480 ----1621
NM_182948chr1--13166 1991 --
NM_182964chr111830 11243 ----
NM_182970chr2033031 716 476 ------
NM_182972chr122042 921 ------
NM_183004chr1432887 432 41 32660 1531 85 ----
NM_183043chr131820 ------
NM_183044chr131820 ------
NM_183049chr42392 92 ------
NM_183227chr6------11444
NM_183323chr5--1368 ----
NM_183353chrX1916 ------
NM_183380chr6195 ------
NM_184085chr8--1123 ----
NM_184086chr8--1123 ----
NM_184087chr8--1123 ----
NM_184234chr201826 ------
NM_194247chr223712 641 ----1213
NM_194250chr22439 161 ------
NM_194259chr16----172 --
NM_194260chr16----172 --
NM_194261chr16----172 --
NM_194282chr4--22447 886 ----
NM_194283chr513911 --13785 --
NM_194301chr141366 11079 ----
NM_194314chr12432 267 --13752 --
NM_194434chr1823770 685 11585 25807 1153 14647
NM_194442chr1------156
NM_194463chrX1459 ------
NM_197941chr512149 11006 197 --
NM_198097chr7145 ------
NM_198148chr1031037 383 40 ------
NM_198158chr322073 536 12177 ----
NM_198159chr322073 536 12177 ----
NM_198177chr322073 536 12177 ----
NM_198178chr322073 536 12177 ----
NM_198181chr1512790 12268 ----
NM_198212chr7----11845 --
NM_198225chr101537 ------
NM_198268chr144259 3902 3113 1471 23635 911 --21177 623
NM_198269chr144259 3902 3113 1471 23635 911 --21177 623
NM_198270chrX33510 3318 2369 --12294 --
NM_198279chrX1825 ----1227
NM_198281chr421178 237 12779 ----
NM_198321chr523035 2036 --11066 --
NM_198336chr711188 ------
NM_198381chr112110 61 ------
NM_198391chr2011174 184 1268 --
NM_198401chr83500 425 89 11652 ----
NM_198428chr71311 ------
NM_198467chr71597 ------
NM_198503chr1----1448 --
NM_198507chr51144 ----1528
NM_198535chr19128 ------
NM_198569chr632647 1656 48 ------
NM_198581chr227506 2050 ------
NM_198719chr1131 ------
NM_198859chr323590 2047 --1782 --
NM_198896chr1121499 119 ------
NM_198935chr20--12797 12160 22408 1159
NM_198947chr112382 81 --1189 --
NM_198968chr1323107 2999 12458 ----
NM_198988chr19136 --1238 --
NM_198991chr18--3243 108 23 1551 --
NM_198995chr181242 ------
NM_199000chr711940 ------
NM_199039chr42734 358 ----11094
NM_199040chr12----22951 92 --
NM_199072chr732979 2464 2385 ------
NM_199168chr1011197 ------
NM_199169chr2023032 1224 11392 13107 1191
NM_199170chr2023032 1224 11392 13107 1191
NM_199171chr2023032 1224 11392 13107 1191
NM_199188chr12--13245 1495 12862
NM_199189chr5--1663 ----
NM_199190chr12--13245 1495 12862
NM_199320chr442958 2321 188 122 12140 ----
NM_199320chr442958 2321 188 122 12140 ----
NM_199324chr422930 1375 1245 ----
NM_199327chr4------11084
NM_199436chr21181 --12838 --
NM_199437chr11------11619
NM_199438chr11------11619
NM_199439chr11------11619
NM_199454chr134096 1804 1261 24526 3530 34621 583 530 24158 284
NM_199478chrX11925 ------
NM_201267chr2147 ------
NM_201435chr12--1104 ----
NM_201570chr101584 ------
NM_201571chr101584 ------
NM_201572chr101584 ------
NM_201590chr101584 ------
NM_201591chr41294 ----11928
NM_201592chr41294 ----11928
NM_201593chr101584 ------
NM_201596chr101584 ------
NM_201597chr101584 ------
NM_203301chr141622 ------
NM_203341chr11346 ------
NM_203346chr242239 2044 1868 97 ------
NM_203390chr81618 --1175 --
NM_203394chr1222524 71 1512 ----
NM_203399chr1----1691 --
NM_203401chr1----1691 --
NM_203446chr2132774 2628 178 ------
NM_203463chr234371 1783 1617 --168 --
NM_203487chr1351801 1380 441 240 157 ------
NM_203504chr422452 969 1986 ----
NM_203505chr422452 969 1986 ----
NM_205860chr121035 627 12217 21262 208 --
NM_206594chr113348 13584 11401 23358 2317
NM_206595chr113348 13584 11401 23358 2317
NM_206819chr12161 --1308 --
NM_206820chr12161 --1308 --
NM_206821chr12161 --1308 --
NM_206839chr152464 38 ------
NM_206852chr14179 1490 ----
NM_206853chr63886 819 740 24027 2721 --23717 1192
NM_206854chr632147 2080 2001 35288 3982 681 --14978
NM_206855chr6--36253 4947 1646 --15943
NM_206857chr14179 1490 ----
NM_206909chr867841 7141 6377 1467 1164 201 28359 1889 15797 27378 2906
NM_206938chr1111889 ------
NM_206939chr1111889 ------
NM_206940chr1111889 ------
NM_206963chr31141 ------
NM_207015chr322306 661 --11757 --
NM_207043chr122316 261 ------
NM_207044chr122316 261 ------
NM_207047chr122316 261 ------
NM_207123chr41726 ----1794
NM_207174chr211520 ------
NM_207292chr322381 2109 13119 --22579 1083
NM_207293chr322381 2109 13119 --22579 1083
NM_207294chr322381 2109 13119 --22579 1083
NM_207295chr322381 2109 13119 --22579 1083
NM_207296chr322381 2109 13119 --22579 1083
NM_207297chr322406 2134 13144 --22604 1108
NM_207304chr1322115 902 ------
NM_207325chr1921973 703 ------
NM_207335chr333035 1012 37 ------
NM_207343chr11----1166 --
NM_207371chr1031479 1267 1180 ------
NM_207372chr1042404 1736 691 281 ------
NM_207429chr1132226 2074 113 ------
NM_207520chr2----1826 --
NM_207521chr2----1826 --
NM_207627chr211520 ------
NM_207628chr211520 ------
NM_207629chr211520 ------
NM_213589chr245354 5280 4273 1613 --24780 1771 --
NM_213611chr12--161 ----
NM_213651chr11252 ----11581
NM_213662chr171311 ------