TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-450b-3p
miRNA Sequence: UUGGGAUCAUUUUGCAUCCAUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000112chr5115521 5377 5015 4836 4257 4236 3869 2215 1657 1415 770 ------
NM_000125chr653921 1538 1200 624 267 ----23625 207
NM_000368chr954036 3397 1870 1663 885 24706 1112 14606 23939 1689
NM_000408chr263475 3453 2191 798 732 564 32353 1203 132 ----
NM_000555chrX76618 5802 3150 1943 781 614 246 25326 1296 --1455
NM_000599chr284172 4162 2956 1397 1309 1226 669 98 --14524 --
NM_000615chr1162810 2036 949 835 213 128 12533 21989 928 1643
NM_000618chr1275635 5356 2390 2150 1821 1487 47 46488 5173 4240 159 24278 587 --
NM_000719chr12116532 6190 6001 5882 5257 4522 4139 1985 1387 581 222 25909 4102 15306 15555
NM_000813chr564493 4221 2102 1906 1845 36 15183 ----
NM_000826chr432194 779 162 --1679 21828 737
NM_000875chr15115514 5392 5375 5222 4849 4840 2670 2397 2373 1859 632 11978 ----
NM_001001419chr574058 3837 1643 1458 1325 1130 437 14742 --1704
NM_001001433chr2073222 3016 2234 2112 1043 793 40 ----11000
NM_001001481chr823196 252 12349 --1536
NM_001002257chr233579 859 492 32789 999 315 ----
NM_001003681chr2252089 1847 1555 75 34 1575 ----
NM_001005474chr311453 ----1246
NM_001008220chr5123779 3654 3409 3348 3235 2619 1011 925 649 635 364 175 --13152 --
NM_001009909chr1131236 240 170 33477 3047 2894 1154 11464
NM_001012755chrX43751 1545 997 434 25067 552 21528 1248 --
NM_001013031chr1052923 2721 2391 734 581 33351 2733 2304 11246 --
NM_001017440chr7137980 7483 7414 6149 5891 5711 3216 2488 1851 1599 699 495 322 46717 5016 1500 1326 12926 16979
NM_001018067chr165232 4575 4495 1594 1286 1223 --14031 2980 75
NM_001024808chr1262814 2633 2583 1939 400 83 12185 1285 12477
NM_001025076chr1065552 4885 1639 1610 1330 955 34319 2173 1096 24073 1955 --
NM_001029875chr532923 2703 2455 1659 1382 --
NM_001033047chr462130 2020 1949 1673 1028 863 21985 171 11793 1736
NM_001034954chr1032246 1257 452 22853 367 12952 --
NM_001039538chr263527 3146 2959 1373 1153 113 ------
NM_001039762chr1052052 1980 1835 931 608 11972 21512 783 --
NM_001039937chr1354149 3967 3132 505 137 44047 2874 2587 582 ----
NM_001040152chr774383 3849 1831 1703 1382 1174 39 21321 867 --1385
NM_001040284chr1655271 4876 3883 1298 1196 25752 5342 22266 43 1431
NM_001040441chr1115381 5171 5035 4955 4617 4482 2201 1794 1661 940 281 21962 808 ----
NM_001040708chr82319 42 ----1826
NM_001042406chr61126 ----2858 445
NM_001042599chr287793 7779 7707 6482 5582 2441 1377 675 --45592 5024 3123 2563 --
NM_001042603chr1264637 3806 1377 1331 910 416 23957 603 14863 --
NM_001043351chr162177 1830 1459 848 701 344 2897 335 1544 --
NM_001044385chr273981 3647 2799 2710 2690 913 44 13442 --13955
NM_001304chr1723319 3150 23673 1501 23348 2669 --
NM_001419chr19114305 4123 3300 3030 1938 1883 1877 1783 709 500 182 1766 23866 3806 --
NM_001438chr143189 2905 829 158 ----11178
NM_001699chr1951747 1340 150 140 129 2353 259 11325 11349
NM_001789chr32547 320 ----11621
NM_001977chr42510 213 ----11072
NM_002025chrX96858 3450 3121 2222 2181 1549 1410 651 475 38001 6556 6053 48485 6550 2847 246 --
NM_002126chr1743573 1537 1325 735 33432 2958 2613 33341 613 432 13637
NM_002182chr352610 2098 1887 1846 620 12224 12212 --
NM_002202chr5--1382 --1313
NM_002270chr575514 5055 4754 3840 3783 1782 1571 2139 27 ----
NM_002356chr61683 2223 198 1192 --
NM_002522chr1763757 3268 3147 1243 850 412 13649 12909 --
NM_002581chr9125023 4743 4026 2169 1552 1261 909 862 596 252 207 110 45309 1742 1223 215 25608 2254 15591
NM_002594chr202784 89 ----12346
NM_002655chr885300 4942 4640 3250 1338 957 824 296 ------
NM_002657chr2063548 3392 2990 1521 694 121 11258 33404 214 176 1408
NM_002709chr232945 2366 288 ----13220
NM_002737chr1765961 5879 5775 5574 5399 393 25355 586 32576 1695 107 15513
NM_003043chr3114201 4137 3766 3409 3300 3146 3092 2701 1036 920 753 --33607 3580 400 --
NM_003106chr33241 184 140 ----1829
NM_003153chr1211067 11125 --11101
NM_003155chr8102008 1996 1775 1115 1091 880 773 535 504 352 1168 ----
NM_003234chr342202 386 323 109 21539 335 ----
NM_003326chr152653 2031 1064 827 134 12612 22775 996 12606
NM_003342chr1792943 2689 2660 2186 2096 1212 1202 944 429 12801 1765 --
NM_003369chr1152603 2053 1970 904 796 ----1750
NM_003458chr361410 1150 885 797 549 534 22674 766 ----
NM_003489chr21103238 3210 3069 2858 1314 1006 926 684 608 598 23228 3054 ----
NM_003574chr1885188 4863 3973 1883 1831 564 406 148 13872 25059 4957 --
NM_003583chr1263820 3176 2446 869 761 576 23380 930 ----
NM_003861chr1442354 2241 712 418 11117 --1827
NM_003913chr633993 3546 1480 --12756 11462
NM_004397chr1133320 959 408 34319 4074 748 13135 13877
NM_004745chr8107056 6868 5434 5082 2324 1938 1687 1057 649 411 14845 12310 --
NM_004768chr11756 2426 87 --1975
NM_004774chr1772924 2834 2485 2165 1983 1060 889 22181 114 ----
NM_004845chrX54141 3369 1156 1150 1012 11177 11279 1499
NM_004852chr182614091 13781 13477 12797 12670 12505 12432 10733 10553 10539 9113 4399 4198 3912 3730 3108 2808 2765 1721 1115 1040 713 356 308 269 87 214257 2507 18768 113972
NM_004857chr1494006 3989 3018 1904 1717 1701 797 662 127 11285 11868 --
NM_004932chr541562 1224 1187 688 ----11366
NM_005065chr1475316 5173 4380 3709 3683 3376 319 --14032 34660 4652 3612
NM_005156chr975296 4598 4180 1975 1789 1364 837 31957 1724 979 ----
NM_005188chr11127629 7214 6536 6258 6040 3017 2199 1964 1884 1576 921 438 58005 7518 6591 876 325 15875 13314
NM_005276chr1231124 167 83 11150 1535 1565
NM_005433chr182437 127 ----1579
NM_005578chr3124838 4386 4211 3774 3681 3310 3117 1609 882 783 414 258 24252 1746 13497 --
NM_005596chr955797 4638 4201 1683 509 11453 ----
NM_005759chr284808 4401 4334 1850 1657 1467 1175 817 1869 175 --
NM_005898chr1153180 3005 2562 250 132 ----12650
NM_005909chr564170 3692 3219 1696 1603 1130 ------
NM_005955chr184320 4300 3757 3367 2081 1821 1236 151 25545 5259 ----
NM_006054chr1131140 1033 480 1112 --21199 591
NM_006283chr884647 4383 4195 4148 4026 3823 3600 489 11358 13930 --
NM_006306chrX104819 4350 4338 2021 1892 1524 1268 725 633 34 22038 1398 21063 842 1435
NM_006380chr1773863 3776 3677 2907 2859 1193 143 1511 2785 41 --
NM_006420chr2073453 2963 2905 822 687 307 245 11274 1112 --
NM_006517chrX6799 772 755 746 717 50 --11767 12105
NM_006546chr17126245 6239 5420 5104 5063 4989 2314 2172 2053 2009 873 170 25861 590 45504 5342 4414 1357 --
NM_006595chr111819 11613 --11439
NM_006599chr1677695 7506 6265 5862 5643 2224 1020 25830 5270 27791 5107 137
NM_006609chr222108 984 3919 622 172 --1537
NM_006620chr694101 3791 3234 3223 3065 1926 1906 1731 805 1783 11461 --
NM_006644chr132625 205 ----1172
NM_006729chrX84666 4642 4434 4049 3901 2110 1551 882 44995 4590 1149 570 --15313
NM_007038chr21126035 5949 5299 5211 3999 3839 3772 3691 2309 2278 2002 935 --1669 --
NM_007124chr61714 169 --1532
NM_007249chr1399192 6677 6315 6036 2897 2662 404 110 40 12965 1524 --
NM_012096chr333139 2852 2766 --1574 12872
NM_012234chr32944 206 --11497 1736
NM_012249chr243335 2261 1178 430 ----13347
NM_012287chr344312 3548 1547 763 11136 44572 3617 1299 1188 --
NM_012301chr752099 2026 902 743 143 32032 1758 1509 --1200
NM_012316chr1145326 4954 4774 4641 3999 3802 2130 2069 1654 1401 1068 743 695 463 24890 1525 35097 3760 840 14557
NM_013255chr7128674 8598 7895 7472 7162 3555 3537 3086 3077 2408 1753 189 58498 6582 6433 6277 1583 38752 6649 1472 --
NM_014048chr1655284 5140 4960 3886 3440 24003 952 --14713
NM_014112chr854906 4457 3401 1581 874 45214 4718 1827 1364 ----
NM_014240chr373836 3702 3674 3362 3116 2804 988 1576 13323 12575
NM_014554chr1251558 846 636 175 117 ----1674
NM_014732chr16115512 5401 5343 5260 4284 4196 4083 3861 1287 1257 924 --23600 1665 15797
NM_014920chr642983 1089 762 537 11318 33604 712 234 --
NM_014982chr141869 33404 775 46 31680 344 104 --
NM_015045chr1022141 242 --11487 1502
NM_015094chr22114636 4237 4039 3535 3248 3144 1727 822 479 305 226 --33194 1721 204 --
NM_015132chr741717 1474 1418 495 1252 11535 --
NM_015526chr1941069 265 212 89 51225 1192 997 977 959 --21276 529
NM_015550chr753544 2459 910 881 747 1720 --1326
NM_015635chr972223 2031 1718 1607 778 334 53 ------
NM_016021chr652332 2216 2048 880 125 --12175 --
NM_016076chr162371 2241 2184 1978 1242 120 2865 654 ----
NM_016132chr1523472 2101 2600 175 1849 12364
NM_016206chr3107490 7450 5824 5504 2762 2646 2506 1778 688 671 37352 6804 2950 1173 --
NM_016376chr1773276 3027 2973 2669 1716 498 349 24014 1402 53646 2986 1108 167 152 1827
NM_017643chr1742700 2012 1039 967 21951 693 22247 740 --
NM_017671chr2051408 721 707 135 67 22089 908 1890 --
NM_017754chr663303 1841 1098 902 427 205 24058 3710 1420 --
NM_017813chr865378 5003 2004 1348 1010 417 35791 4479 107 23742 3533 --
NM_017896chr2053459 3102 1337 995 340 2761 498 12529 --
NM_018018chr1211706 ----1115
NM_018084chr221338 1331 22206 2046 ----
NM_018243chr473801 3190 2735 2600 2527 1383 722 12821 1898 --
NM_018440chr8158152 7983 6554 6165 6036 3442 3291 3223 3032 2363 2200 1470 1001 462 295 47740 6419 6304 477 1274 --
NM_018638chr1225058 4510 53635 1560 1510 370 66 23998 3862 --
NM_018976chr1242654 534 255 115 22519 2158 ----
NM_019035chr441538 782 694 421 1619 1434 --
NM_019063chr231682 763 686 11446 --11772
NM_019084chr102910 382 ----12019
NM_019593chr2033227 3023 2881 ----1457
NM_019610chr13860 468 30 21928 1902 ----
NM_020122chr2115511 4729 4619 4442 3976 3812 3653 1944 1136 909 222 14151 12149 --
NM_020243chr221242 1658 1294 1640
NM_020336chr2093816 2804 1473 1242 1204 1109 990 414 311 --13454 --
NM_020338chr10103726 3155 2927 2652 2641 2400 1349 328 220 42 --1347 --
NM_020341chr201302 1657 --11906
NM_020474chr1832000 1426 1273 ----1630
NM_020714chr1994600 4587 4548 4030 3372 3109 1441 732 340 --11284 --
NM_020717chrX94845 4711 4549 4384 4073 3985 3847 3382 3237 14136 13721 --
NM_020752chr1042866 2267 2206 554 2988 468 --1316
NM_020796chr541852 1156 1085 756 ----11034
NM_020805chr1831663 1398 250 ----1414
NM_020858chr1552066 1910 1501 858 224 1449 ----
NM_021964chr355053 4950 1238 866 252 32509 2460 1722 16558 --
NM_022048chr15115232 5132 4561 4383 2431 1789 1530 1367 1133 556 500 --26061 218 --
NM_022154chr421150 257 1495 21224 81 --
NM_022497chr353746 2639 1156 1125 991 13876 12554 13538
NM_022841chr1532283 1028 941 ----12146
NM_022898chr1464860 4460 4365 3087 1314 1092 24083 1086 --14178
NM_024312chr1221642 1184 1385 11501 11539
NM_024889chr1041455 554 409 46 1422 --130
NM_024949chr4104434 4347 4249 4221 4155 4045 3770 3507 3084 1267 11618 14644 --
NM_024953chr122676 651 ----12449
NM_025160chr133508 3272 3125 ----14222
NM_030647chr784920 2531 2031 1979 1948 808 703 420 21750 1313 --1905
NM_030786chr111221 ----21470 242
NM_031442chrX52421 2112 694 541 427 --1396 --
NM_031469chr653300 3219 2990 936 601 11552 13457 --
NM_031483chr2072906 2775 2358 798 767 708 260 23137 2444 12979 --
NM_032221chr2051711 1633 706 246 49 21855 1569 ----
NM_032547chr411088 --11181 171
NM_032578chr10------2617 207
NM_032682chr353587 3474 2974 972 779 23020 579 --2854 427
NM_032859chr1333801 2530 967 1146 12481 --
NM_033224chr7147941 7543 5697 5237 5116 3197 3089 1540 1213 1197 973 918 423 328 36443 5852 5375 27824 6658 15079
NM_052879chr1221535 823 ----2202 160
NM_078469chr1011225 --11380 1497
NM_080867chr1473993 3564 3398 1314 1242 951 281 --11043 11690
NM_130387chr31288 ----11247
NM_133264chr1783732 3701 3329 3193 2950 1371 168 62 --12711 1214
NM_133468chr751980 1897 1889 958 851 ----1235
NM_138473chr1284899 4648 4287 3787 3365 3229 330 161 --13238 14922
NM_139246chr922184 581 22301 2053 --21633 245
NM_139283chr123730 357 66 139 --3885 582 102
NM_144571chr4--26370 836 --1477
NM_152263chr195663 4775 4256 4037 1800 1208 1123 987 105 54995 4862 4172 1263 1237 42200 2048 1687 82 15772
NM_152424chrX114301 4285 2984 1659 1305 1240 1169 994 667 595 303 13619 ----
NM_152622chr533324 2191 690 21194 1171 --23316 473
NM_152624chr587277 6352 6292 5065 4884 1754 835 28 --25414 1746 --
NM_152686chr5112153 1993 1755 1620 972 908 822 600 303 249 179 31905 1851 553 165 11884
NM_153619chr1553304 3148 2739 1462 662 1879 3773 750 642 --
NM_172069chr22854 675 1110 --1361
NM_173576chr1041717 629 373 354 2126 64 ----
NM_173642chr196696 6684 5574 2847 2734 2245 477 111 36 --46148 3464 3388 1839 --
NM_175733chr1131924 800 52 21877 372 11833 1454
NM_178011chr1032964 953 275 23006 1017 ----
NM_181672chrX42073 1507 742 262 --1330 11317
NM_181705chr595790 4528 4247 3977 2003 1866 1598 1466 649 24124 4094 23655 3552 15116
NM_182493chr1674992 4697 4591 3464 3358 1143 962 --1109 --
NM_182757chr633280 3196 3160 --3612 506 283 12230
NM_194356chr1242028 211 105 92 1137 2804 549 11703
NM_207303chr1053738 2918 2896 2548 94 21244 329 ----