TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-450b-5p
miRNA Sequence: UUUUGCAAUAUGUUCCUGAAUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr5--2159 115 --195
NM_000038chr531331 1301 1276 2666 409 21985 102 --
NM_000084chrX86980 6843 6837 2635 1345 1241 432 23 46737 963 734 336 21576 1052 12235
NM_000109chrX12443 1312 21795 403 --
NM_000114chr202158 140 1169 1134 --
NM_000115chr133938 509 498 22457 399 ----
NM_000125chr654262 3847 849 662 223 12739 34210 3175 1165 13120
NM_000138chr1542643 2489 670 579 --42417 2307 365 357 --
NM_000163chr552063 2008 1468 387 213 1512 ----
NM_000167chrX----11726 --
NM_000176chr531400 956 822 23799 3677 --21269 895
NM_000208chr1973392 3330 3012 1655 1431 677 186 14748 33296 3224 3164 24615 1759
NM_000210chr2--11771 --22056 1449
NM_000216chrX93852 2964 2778 1610 1281 1150 1138 808 600 11487 44039 3562 2880 912 24020 4007
NM_000217chr1254598 3922 1566 1508 745 1815 34536 2098 437 44952 4911 3760 837
NM_000248chr372603 2553 1076 977 536 393 372 32597 2177 565 21116 1105 --
NM_000252chrX21404 1354 --31395 1277 1210 21162 73
NM_000253chr4--1693 21110 996 1125
NM_000259chr15115990 5789 5552 5470 4931 4837 2209 1451 1263 748 525 45431 3976 2049 1400 ----
NM_000264chr92396 221 --22764 427 --
NM_000267chr17103505 3346 3217 3100 3052 2479 1309 302 255 92 23066 2286 33257 3141 832 --
NM_000274chr101184 161 --1583
NM_000280chr11----1264 2969 900
NM_000313chr31943 ----1282
NM_000314chr1073145 2943 1219 1082 1046 904 441 ------
NM_000321chr132219 140 31234 702 511 ----
NM_000332chr6107067 6135 5725 5602 5509 2454 2363 1528 1431 929 36920 1276 518 12338 25235 978
NM_000338chr15199 --2306 78 1997
NM_000343chr22----197 --
NM_000346chr1761557 1473 763 716 579 379 --11446 --
NM_000351chrX94372 3640 2967 2921 2773 1284 1167 1080 300 1322 11497 34305 3789 778
NM_000352chr11172 --183 --
NM_000361chr2041862 1643 1561 236 21299 789 11673 --
NM_000362chr2243593 1357 892 347 --1108 --
NM_000367chr632315 2188 1873 12064 1260 1268
NM_000378chr1131236 1121 425 ----1870
NM_000393chr221523 1352 1836 --2690 269
NM_000411chr2142613 612 435 344 1922 --12433
NM_000415chr122738 677 --1323 11004
NM_000430chr1762599 1108 1099 649 189 108 23735 3329 1716 12465
NM_000441chr742321 1862 651 525 1838 22069 1532 11969
NM_000448chr1152549 2130 666 314 33 --22874 2392 1891
NM_000461chr384589 4160 4145 3527 1654 1576 1273 506 13985 34446 3978 2843 --
NM_000474chr71609 1493 1657 --
NM_000503chr841782 745 738 303 --1423 --
NM_000522chr71310 1498 21180 397 --
NM_000555chrX107804 6600 6453 5413 4847 1609 1549 1540 662 144 1257 17029 17865
NM_000610chr1132843 2523 2308 --52530 2487 1221 1016 106 1182
NM_000615chr1162969 2202 650 623 550 235 32451 775 497 ----
NM_000618chr1285924 2265 2160 1420 1102 838 693 684 54155 2537 2405 1289 882 14793 1193
NM_000621chr131388 1975 1242 --
NM_000633chr1864538 4146 3862 3630 3545 360 34048 1482 34 13614 14845
NM_000663chr1652282 2216 2110 446 199 12883 12090 22479 2043
NM_000686chrX31188 416 257 ----11566
NM_000701chr1------1253
NM_000719chr1296516 5444 5033 4777 4271 1707 1631 743 194 46270 5875 5484 1401 36730 6496 5856 --
NM_000724chr1061763 777 721 584 187 115 --1569 --
NM_000788chr41437 1156 21142 463 --
NM_000801chr2021103 768 ----1395
NM_000813chr595584 5566 4482 4086 4067 3960 1396 773 437 15422 --24775 1492
NM_000814chr1583497 2569 1618 1561 963 806 731 265 12622 24095 1509 --
NM_000824chr43295 288 128 ------
NM_000826chr462388 2096 2078 745 704 308 --31926 1680 863 12604
NM_000828chrX3627 347 204 31464 294 279 22198 2186 --
NM_000838chr632266 708 67 --12724 11730
NM_000861chr33472 356 249 --21921 913 21953 227
NM_000868chrX41728 352 133 92 --22560 2415 --
NM_000875chr1566944 6922 5754 5669 195 25 11623 11045 --
NM_000891chr1752892 2526 2512 426 279 --12957 12444
NM_000899chr12114213 3288 3166 1288 1054 898 678 652 617 425 285 13540 13911 44282 3806 3039 850
NM_000901chr442143 2039 1983 690 12519 42540 1010 896 766 --
NM_000908chr5--1684 1618 --
NM_000910chr421971 721 --11401 --
NM_000933chr2051633 1611 1108 690 98 41713 1680 1603 550 11220 21364 474
NM_000944chr432330 2030 1481 1909 1589 --
NM_000945chr251906 1328 790 603 325 ------
NM_000950chrX53519 2777 2709 1242 657 22403 320 32396 1093 446 1391
NM_000963chr132430 1893 1555 42473 877 657 581 ----
NM_000983chr151595 1548 1271 1225 155 11037 --1594
NM_001001132chr2131352 561 157 11415 1219 1411
NM_001001323chr1252715 2175 2126 803 292 12221 33170 2900 324 --
NM_001001331chr332720 1088 425 22248 1775 1539 11850
NM_001001342chr1031105 471 384 --2520 422 --
NM_001001344chrX72371 2275 1981 1715 1699 552 317 4821 590 487 105 22040 156 --
NM_001001394chr2------1474
NM_001001395chr1222754 305 12130 12217 --
NM_001001396chr194360 4242 3726 3295 3090 2721 1463 932 225 --11095 --
NM_001001419chr534952 659 218 --1691 3813 478 210
NM_001001481chr863176 2968 2646 2525 979 369 --11058 --
NM_001001484chr1031800 1589 384 32287 808 454 2663 44 --
NM_001001549chr772853 2678 2662 2329 2179 2044 1887 12717 12803 --
NM_001001664chr233794 3701 804 23954 3747 11563 1375
NM_001001665chr222782 164 1175 1152 12980
NM_001001890chr2144275 3521 3125 1598 13770 23700 3197 1517
NM_001001924chr82822 355 12015 ----
NM_001001933chr14568 528 459 391 1161 --1192
NM_001001971chr10----1885 11068
NM_001001973chr10----1143 --
NM_001001974chr1042027 1957 1821 821 1487 22215 768 --
NM_001002800chr321099 203 11092 2144 62 --
NM_001002811chr1158 --31548 1211 1168 126
NM_001002843chr1521301 248 11020 1913 1982
NM_001002860chr1434443 3650 1555 13480 24102 1300 24583 4480
NM_001002909chr1742035 1704 353 140 22245 799 ----
NM_001002919chr23552 543 470 1513 2168 116 --
NM_001003652chr18108286 8266 8158 6900 5589 2718 2474 1714 1485 428 47248 2243 2056 1169 37981 7558 1150 17031
NM_001003674chr18116973 5140 4984 4482 2372 1637 1078 780 664 543 167 --35153 4551 347 15529
NM_001003688chr41218 ----1233
NM_001003694chr31488 --1447 --
NM_001003712chr1223957 3239 44039 3662 2575 1050 1516 24009 2754
NM_001003792chr32895 179 11075 --11009
NM_001003800chr943472 809 540 271 22886 565 33108 2917 1491 --
NM_001004019chr3----1100 --
NM_001004065chr963965 2999 1537 1472 453 101 ----11296
NM_001004317chr6103993 3618 3391 3181 3069 1816 1148 881 855 57 11489 141 1772
NM_001004323chr7------190
NM_001004342chr175492 5415 3769 1813 1756 1730 103 24438 2305 46001 4341 549 475 --
NM_001004419chr1284259 3014 2830 1519 1302 952 742 362 23748 3673 ----
NM_001005404chr1744276 3789 1642 796 23573 3068 13146 13132
NM_001005463chr103633 610 179 11791 22135 2110 --
NM_001005473chr5126540 6270 5553 4598 4255 2489 1688 1178 1099 778 280 69 26610 6184 16431 24371 2239
NM_001005474chr321474 1396 --2512 359 --
NM_001005476chr22496 457 ------
NM_001005505chr311147 ----21804 1778
NM_001005849chr17------1450
NM_001005910chr31162 ------
NM_001006600chr542334 1945 876 326 --11828 11663
NM_001006610chr162953 841 ----3993 924 271
NM_001006684chrX2573 508 --1233 --
NM_001006933chrX------2255 222
NM_001006938chrX------2302 273
NM_001007075chr45950 734 417 395 358 ----11094
NM_001007097chr985004 4796 4641 4370 1742 1587 400 207 ----13984
NM_001007102chr62585 507 --3533 341 249 11277
NM_001007157chr7134 ----299 85
NM_001007246chr2111574 1445 21832 1750 --
NM_001007257chr121530 1480 --1359 1106
NM_001007466chr6115184 4985 4742 4352 3737 3716 1407 1095 786 126 59 --15220 --
NM_001007538chr1331718 1681 1261 11817 21437 1280 --
NM_001008410chr262292 1556 718 223 104 84 --2448 334 --
NM_001008493chr141670 1554 1383 1232 ------
NM_001008495chr8102293 2056 2003 1685 1595 786 672 561 193 181 --1370 --
NM_001008539chr895339 5150 4839 4514 1814 1604 1151 598 401 25371 5209 21517 736 --
NM_001008564chr1362174 1974 1621 1441 726 454 12097 ----
NM_001008703chr6----1101 --
NM_001008801chr1932080 415 387 --2488 204 --
NM_001008895chr1341493 1415 327 173 1246 1573 --
NM_001008938chr11------1307
NM_001009555chr431595 1396 547 11237 11768 --
NM_001009598chr1----1189 --
NM_001009899chr3126489 6304 6261 5696 4956 4810 4140 4010 1405 953 160 22 --26358 5601 15421
NM_001009923chr201680 --2663 103 1868
NM_001009958chr72579 124 157 2601 572 --
NM_001009993chr2124533 4255 4147 3809 3327 3118 2789 1320 924 599 430 420 44070 868 366 351 ----
NM_001010853chr663247 3145 3093 2913 2210 347 32663 2510 2176 32261 2114 183 --
NM_001010888chrX54535 3403 1739 1303 1292 33093 3063 2985 24386 4241 23391 3047
NM_001010891chr536594 6114 42 21869 826 36879 6267 4451 14500
NM_001010922chr184156 3221 3081 2763 561 445 225 184 --22955 1276 12886
NM_001010927chr64471 459 443 208 --1144 173
NM_001010942chr1281259 1181 1096 1032 877 469 364 226 ------
NM_001010971chr121004 104 --177 --
NM_001010986chrX32350 2176 148 11825 --22390 2293
NM_001011537chr332156 657 557 12239 11732 11720
NM_001011546chr204734 717 698 148 --1559 --
NM_001011553chr72662 387 1270 --1983
NM_001011663chr102903 741 --11050 --
NM_001011666chr786612 6396 6232 5211 4621 2230 1013 951 24424 1939 26345 6309 1966
NM_001011708chr222483 2066 --12750 22943 817
NM_001011713chr14182 --2657 267 1367
NM_001012300chr12----1320 --
NM_001012393chr1195138 4725 4395 4311 3437 3338 1670 1444 638 14455 34639 1876 687 --
NM_001012423chr1562854 2743 2609 2318 1852 507 22867 673 1154 --
NM_001012754chr1371986 1884 1791 1716 743 507 186 --1411 12009
NM_001012761chr552690 2276 2045 904 217 22668 2293 22618 1682 --
NM_001012979chrX------1222
NM_001013031chr1063016 2807 2298 2156 1149 690 11132 ----
NM_001013415chr431313 1019 995 166 --1262
NM_001013437chr181427 1444 144 --
NM_001013620chr1288057 7509 6746 6620 5925 2685 2249 1867 47472 7276 379 26 46772 5144 1717 971 --
NM_001013843chr155324 298 222 180 52 --1889 1607
NM_001014797chr10107986 6709 5851 5112 2592 2384 1812 1704 1590 555 1457 --38189 3189 1093
NM_001015045chr462566 2208 705 482 211 101 --11779 --
NM_001015048chr1453266 2999 2652 715 307 1952 22225 548 2734 159
NM_001015877chrX52100 758 396 216 95 12204 32963 2513 2135 --
NM_001015880chr1031676 1210 536 ----1401
NM_001015887chr341603 1526 1242 1210 1165 --11731
NM_001017371chr261228 927 900 406 353 276 2322 98 ----
NM_001017395chr383633 3327 2602 2524 1139 1002 249 162 1355 ----
NM_001017424chr161936 1753 1306 1300 728 713 21562 617 21593 425 --
NM_001017923chr1441545 1185 1072 184 1174 ----
NM_001017926chr831688 1482 202 1572 --1233
NM_001017999chr142308 2122 942 61 --32172 467 434 --
NM_001018009chr31839 --11124 --
NM_001018037chr911361 ----21332 274
NM_001018054chr11180 --21452 411 --
NM_001018056chr91411 --3547 421 172 --
NM_001018064chr912015 ----11702
NM_001018065chr975873 3849 1286 1175 965 776 99 --44644 2400 720 638 --
NM_001018067chr165189 4523 4186 3612 1210 1123 24909 933 21994 292 13413
NM_001018089chr1553638 2671 1583 1139 371 --23854 291 11569
NM_001018108chr1522116 270 32228 1971 564 --12166
NM_001018111chr764040 3803 3083 2974 2793 1440 --1894 23956 196
NM_001020658chr151637 1577 1507 1458 1118 11341 51566 1394 1112 430 174 --
NM_001023567chr1542491 2425 510 371 --12350 1155
NM_001024226chr14951 863 176 132 ----1247
NM_001024372chr861953 1568 886 370 343 303 2396 28 22278 1678 --
NM_001024455chrX41016 818 617 158 2140 120 32098 1043 935 --
NM_001024647chr1236863 772 710 37133 5867 2425 1120 25524 822
NM_001024649chr551131 948 404 362 180 22818 52 --1444
NM_001024808chr1271969 905 794 607 483 132 96 12344 ----
NM_001024947chr551088 1075 917 839 102 1714 1287 --
NM_001024948chr143218 2978 2694 2536 --12593 12564
NM_001024956chr11115801 5594 5309 4521 4299 4214 2252 1427 1039 550 424 21096 999 54900 4382 4183 1069 900 11055
NM_001025076chr1096121 5543 5363 5037 3884 1845 1304 771 543 34056 2336 271 ----
NM_001025077chr10127479 6901 6721 6395 5242 2662 2129 1901 1269 1086 834 258 25414 1629 --1848
NM_001025079chr364099 3789 2549 1419 887 820 23721 1496 13943 --
NM_001025105chr541539 1119 520 128 --2989 473 11557
NM_001025107chr141839 1073 612 553 ----22508 1872
NM_001025108chr241641 1170 735 144 43422 3099 1177 1095 24193 3483 13082
NM_001025201chr21660 ----1172
NM_001025266chr333985 3580 1881 11181 --24924 4250
NM_001025580chrX93996 3840 3501 3286 3246 2651 1376 230 39 11590 1764 1944
NM_001025780chr92594 470 2450 293 31447 643 91 1535
NM_001029863chr651216 855 345 275 54 23128 1246 21257 913 1878
NM_001029875chr542776 1897 1131 975 32093 792 284 1643 --
NM_001029884chr63759 504 104 2576 121 12758 --
NM_001029997chr193603 519 510 1714 1535 --
NM_001030007chr1663952 3772 2485 1556 738 654 33891 3816 843 23871 667 --
NM_001030055chr1454676 794 757 683 263 --11651 --
NM_001030059chr10------1322
NM_001031679chr1273468 3333 3058 1072 894 292 173 63213 3195 2443 1299 1175 409 ----
NM_001031684chr261520 1306 979 936 134 73 --11032 --
NM_001031689chr9----1126 --
NM_001031695chr2274812 4187 3603 1814 1361 61 22 13452 34898 4086 3636 13629
NM_001031748chr12----1255 --
NM_001031804chr1664377 3931 3794 3380 1688 702 --21645 668 --
NM_001031812chr542104 1936 1568 881 1742 11926 1709
NM_001032282chr8180 2437 64 1851 --
NM_001032394chr652780 1789 210 191 63 1165 32555 2286 182 1387
NM_001032999chr2045147 3723 3510 590 2863 733 14263 14543
NM_001033044chr131248 675 86 --11460 1336
NM_001033047chr42869 654 --42661 1036 712 377 --
NM_001033057chr351858 1713 1695 1537 480 --21433 576 1495
NM_001033087chr2053087 1006 799 630 254 1167 23111 2812 --
NM_001033112chr51605 ----2868 78
NM_001033506chr111423 --190 1341
NM_001033561chr172872 646 159 --1357
NM_001033566chr173788 122 100 --1247 --
NM_001033578chr862201 1697 1484 815 574 387 2519 157 --11987
NM_001033602chr1361992 1060 248 208 187 115 1280 3933 814 773 --
NM_001033659chr1721371 264 --21595 1346 --
NM_001033925chr1031560 1400 26 21513 1432 21409 793 --
NM_001034841chr16145469 5305 4093 4083 3972 3519 1925 1898 1795 1766 1459 1394 990 489 23378 92 13837 33861 1225 100
NM_001034850chr52675 372 2479 359 1637 --
NM_001034954chr1073201 3163 3008 2722 2663 2598 2221 --22897 2331 --
NM_001035003chr451410 1283 1271 1182 118 ------
NM_001037334chr1852052 1860 1713 673 553 --21869 1730 1939
NM_001037339chr11719 --1588 21672 414
NM_001037533chr11226 1328 1764 --
NM_001037553chr2184425 4280 3697 3344 2041 1227 727 672 23740 1981 11772 15118
NM_001037954chr1143326 2887 480 403 22393 2321 23543 3142 --
NM_001038493chr211335 11386 11548 --
NM_001038640chr15------1231
NM_001038702chr541730 940 646 245 12395 32205 734 690 --
NM_001039538chr252823 884 445 405 196 2637 173 23660 603 13695
NM_001039570chr2274248 2922 1781 1572 1106 980 536 11620 24498 3553 --
NM_001039577chr164064 3480 3049 2832 1068 955 --13536 14523
NM_001039585chr184221 4088 4080 4056 3688 1294 1120 1086 --1238 --
NM_001039590chrX63896 3554 2715 1371 228 202 2926 148 23724 3369 33821 3036 2783
NM_001039618chr1155304 3744 1604 1079 672 15792 25470 4958 25863 1682
NM_001039762chr1052223 1669 738 299 211 21815 233 2455 425 --
NM_001039840chrX136087 6069 4964 4904 4423 3700 2410 2380 2228 1746 1405 1375 775 65722 5608 4022 3833 1771 584 2675 559 --
NM_001039937chr1354085 2962 452 375 188 23015 1612 --1976
NM_001040020chr741564 1512 1299 78 --1176 --
NM_001040092chr8----1342 --
NM_001040100chr331290 1100 1042 --1931 11273
NM_001040101chr461606 1519 1062 1028 370 303 21141 277 2144 38 --
NM_001040135chr72796 84 --1821 --
NM_001040142chr242316 1744 713 316 22289 1557 21495 470 --
NM_001040152chr764747 4268 3560 1903 1149 798 1722 172 --
NM_001040152chr764747 4268 3560 1903 1149 798 1722 172 --
NM_001040159chr421532 140 --1295 1985
NM_001040214chr62600 131 --11797 1472
NM_001040272chr952282 1886 1716 566 379 --1242 21975 645
NM_001040284chr16125694 5216 2199 1831 1380 1148 1022 938 869 828 537 320 3735 290 173 22095 590 1796
NM_001040402chr463119 2984 2604 1065 633 197 13211 --1336
NM_001040429chr1373396 2689 2577 1368 980 646 503 1680 43217 2903 1143 1037 33497 2212 1121
NM_001040441chr1105519 5228 4674 4040 3693 3468 3322 2060 1498 997 13974 24899 3476 --
NM_001040446chr572544 2530 2341 2187 2001 1707 913 1544 --12748
NM_001040665chr764379 4277 3071 2008 1065 215 13445 44617 4286 3760 335 13212
NM_001040708chr8----1306 --
NM_001040712chr953114 2858 1323 556 336 1728 21027 518 23437 2207
NM_001042404chr1--21520 1499 11595 --
NM_001042437chr2186 --1212 1306
NM_001042473chr1041933 771 647 427 11826 --12183
NM_001042481chr1462634 2557 2331 2151 1035 736 22612 55 32088 1887 270 --
NM_001042494chr1543179 2843 688 492 1160 --12983
NM_001042510chr851970 619 252 178 162 2773 279 1408 11609
NM_001042537chrX31867 844 649 2996 286 22400 1561 21801 32
NM_001042543chr481616 1276 1260 630 359 164 34 28 ------
NM_001042555chr1294797 4619 4357 3759 3599 3430 1168 509 59 24584 3693 --11549
NM_001042599chr287761 7041 6219 5966 5245 4860 4846 1249 17096 47253 5398 1505 720 13155
NM_001042604chr374807 4666 3743 3713 3430 3114 112 14127 --23641 2983
NM_001042646chr341967 1902 1740 656 11880 --1175
NM_001042749chrX31422 1291 535 11623 11959 1818
NM_001042762chr7----11040 --
NM_001043351chr11289 11743 --22238 327
NM_001044305chr631056 626 438 11114 --1271
NM_001048183chr163674 2461 1389 922 340 283 ----23742 1141
NM_001078chr1146 1270 2715 492 --
NM_001079874chr152013 1719 1632 1567 286 1211 22138 669 --
NM_001092chr1762537 2502 2097 2081 872 671 ------
NM_001099678chr3166438 6175 6071 5927 5878 5546 5502 5467 4955 4317 2425 2221 2153 1883 1668 242 44361 4288 1941 766 46295 6186 5717 1952 25937 776
NM_001100108chr1168373 8288 8204 7323 7295 6266 5970 5962 5737 5631 2796 2371 2357 2119 772 539 23088 2182 25276 1762 --
NM_001104548chr1------1174
NM_001106chr3169570 9204 9017 8898 8797 8700 8466 8138 7674 7411 6323 6036 3705 2979 973 411 38459 3914 275 29072 1643 19522
NM_001109977chr46848 758 647 307 73 39 ------
NM_001144chr162216 172 ----11429
NM_001146chr842312 1881 625 461 2849 351 ----
NM_001148chr452001 1995 610 496 142 21707 712 --1796
NM_001149chr1031227 912 492 21163 150 1872 --
NM_001160chr1242586 2212 947 233 --12643 12837
NM_001167chrX96485 6231 5500 4776 2222 1031 888 659 543 65444 5171 5163 1736 951 653 36374 2162 1838 11144
NM_001172chr143228 192 173 --1136 --
NM_001186chr2162963 2319 2313 2032 1025 878 22535 387 12139 11015
NM_001198chr642422 2407 437 96 21585 951 ----
NM_001204chr276963 6556 5833 5671 5045 3006 546 47762 5745 157 56 22860 1584 17227
NM_001206chr932687 812 604 11227 23084 2924 22186 987
NM_001211chr151301 --1342 1310
NM_001219chr762267 2241 2066 2010 878 396 --1748 --
NM_001241chr282415 1676 1661 958 639 471 350 222 42078 2014 328 311 22150 1683 12253
NM_001256chr1762964 2832 2183 2042 539 522 --2711 460 --
NM_001259chr785898 5669 5235 4644 1881 1273 758 195 36138 4661 185 21588 487 34970 4083 2346
NM_001268chr1331069 807 117 147 11140 11001
NM_001271chr1563191 2888 2839 2126 983 955 ----23237 3105
NM_001278chr102907 838 ----1757
NM_001286chr152873 2174 2109 748 729 12607 --12827
NM_001290chr431011 248 110 --3887 738 59 1420
NM_001310chr1222067 122 23007 1213 --21920 750
NM_001315chr652048 1945 837 596 328 --22002 97 --
NM_001316chr20----1123 --
NM_001330chr16----1986 --
NM_001343chr541708 1105 249 21 --1666 1160
NM_001356chrX52533 2371 2220 1829 736 --1530 --
NM_001364chr11134586 4231 4165 2925 2890 1352 1245 1119 1060 559 331 202 109 24617 1906 2780 585 14725
NM_001390chr1843047 2713 792 571 11262 33230 2502 1114 13485
NM_001396chr2182694 2566 2534 2147 2062 2029 992 75 12774 52489 1003 907 707 161 --
NM_001401chr941606 1044 330 247 11590 --21235 1077
NM_001412chrX73728 3074 2565 2539 2426 2280 638 33264 2339 1073 1799 2927 655
NM_001420chr1942631 1931 1198 315 13014 12202 1607
NM_001422chr114869 431 110 61 11349 11397 --
NM_001423chr121591 21813 1636 12024 --
NM_001427chr751851 1813 1781 1516 1433 --1257 --
NM_001430chr261856 1796 1510 1240 771 75 --1519 --
NM_001438chr143545 3477 3348 2331 13584 11401 12317
NM_001452chr6------1711
NM_001453chr651763 1643 1146 500 494 --11531 --
NM_001455chr694956 4728 4452 3677 1874 1216 1050 1035 355 24589 231 --24936 1001
NM_001483chr711011 --1767 --
NM_001494chr10293 78 1761 ----
NM_001495chr8----21109 174 1100
NM_001498chr661335 1321 1216 1162 547 360 --31055 1028 306 11348
NM_001570chr321223 445 --21512 1409 11328
NM_001584chr1121223 822 --41112 467 249 112 21236 213
NM_001609chr1053108 3079 2735 1324 893 144 1760 --
NM_001621chr731228 1219 970 --22194 1200 11018
NM_001627chr342076 1830 855 310 --22347 1558 12016
NM_001650chr1863283 1481 1424 1115 1052 935 --33682 3431 1495 11175
NM_001663chr1472440 2329 1915 842 649 455 337 32768 2545 1882 1467 --
NM_001668chr14889 776 708 75 21421 616 --11927
NM_001679chr32331 56 1597 --2588 521
NM_001695chr85532 430 360 215 65 24158 4095 11040 --
NM_001701chr92543 462 11519 11019 11109
NM_001706chr32379 118 3766 330 303 1702 11035
NM_001709chr1132288 1132 687 12735 22833 2408 --
NM_001723chr65777 717 705 132 27 ------
NM_001730chr1351549 1436 1425 1405 563 173 1555 --
NM_001742chr741289 499 264 247 2614 527 2703 140 --
NM_001743chr2167 180 --1419
NM_001748chr131089 264 215 --1739 --
NM_001759chr1274178 1491 1298 1200 1016 295 237 35134 4470 261 31383 732 440 --
NM_001797chr16168 --1552 --
NM_001813chr41285 --2365 258 --
NM_001829chr42909 142 --2371 155 --
NM_001830chrX113993 3980 3722 3638 3535 2723 1447 1127 539 360 277 43062 1114 939 679 13013 21608 1059
NM_001845chr1321385 1282 1466 ----
NM_001854chr13525 379 76 --11492 1479
NM_001855chr9----187 --
NM_001895chr2011243 --11063 --
NM_001904chr341027 796 673 250 --1118 --
NM_001935chr2----1729 --
NM_001946chr1221122 344 11156 1820 --
NM_001949chr672859 2848 2761 2542 982 485 201 23132 502 53169 2963 2729 896 655 13030
NM_001964chr51995 ------
NM_001969chr1493800 3110 2887 2808 972 470 454 432 41 33480 2660 85 ----
NM_001981chr172431 2387 2299 757 476 402 122 11689 21581 290 1920
NM_001987chr1284129 4056 3222 3020 2945 1276 992 848 --44293 485 434 143 23692 1413
NM_001992chr532068 416 326 11817 21665 507 --
NM_001999chr551527 1441 1434 1019 439 153 ----
NM_002006chr494591 4026 2133 1645 1618 1345 1018 921 508 45777 5411 4342 4065 14018 1185
NM_002009chr1512317 12743 --2246 236
NM_002013chr14--1216 2259 97 --
NM_002014chr12------175
NM_002015chr1353168 3028 2555 1003 424 13319 2853 703 1296
NM_002017chr1121313 491 ----11383
NM_002025chrX148893 7509 7262 6863 3439 2602 2158 2072 1635 1448 921 786 758 158 49309 9222 2390 141 28919 8012 37846 3275 1738
NM_002031chr6------2719 624
NM_002035chr1883982 3835 3354 2491 1445 1219 196 147 --23480 2965 21539 961
NM_002039chr42726 197 --146 1794
NM_002040chr2123129 890 33192 2958 2315 33020 982 565 12912
NM_002049chrX------1125
NM_002054chr22319 78 --1313 --
NM_002063chrX1899 11225 151 1209
NM_002069chr761626 1620 454 273 265 80 ------
NM_002074chr141700 1131 573 206 21716 403 11272 --
NM_002128chr1372450 2197 2188 1968 1788 876 410 --21701 238 1392
NM_002137chr761509 739 692 340 298 167 --1586 22112 234
NM_002140chr921051 458 2440 240 1764 11018
NM_002166chr2----1599 --
NM_002182chr362597 1788 770 644 259 237 11877 22767 981 12351
NM_002202chr51700 ----1879
NM_002214chr795043 4857 4789 4544 4368 4095 3925 3838 815 15751 1999 25365 619
NM_002226chr14--1107 2904 229 --
NM_002239chr21244 2729 161 2758 152 --
NM_002247chr1021910 1511 1356 22121 544 22220 604
NM_002264chr364776 4646 4352 2027 1420 1333 32011 1922 1623 13633 --
NM_002265chr17----11182 1413
NM_002267chr1352446 2211 2173 186 154 21699 910 ----
NM_002268chr351801 1492 1164 614 389 ----11868
NM_002270chr585606 4924 3603 3520 3459 1745 1536 990 34199 1301 1192 24307 2194 23684 1943
NM_002271chr1342276 2220 1920 1595 42130 2097 1721 677 2970 898 21686 162
NM_002296chr141540 1124 631 609 ----156
NM_002335chr11140 ----1200
NM_002336chr1265080 5057 1881 1394 666 45 --44901 4772 1033 263 14974
NM_002345chr12--1268 2227 125 1446
NM_002349chr22592 439 21280 407 21480 1069 11224
NM_002353chr1--1296 --1670
NM_002356chr63857 489 340 --11087 22870 884
NM_002397chr541481 337 314 39 1819 1730 32105 282 138
NM_002398chr231264 960 46 11233 21217 544 11279
NM_002408chr14------2734 122
NM_002460chr653782 3770 3301 3120 612 12884 1229 --
NM_002469chr121489 --1397 2170 161
NM_002480chr1211026 11383 11463 11178
NM_002500chr241303 1250 106 99 11172 ----
NM_002514chr82259 186 11074 --11166
NM_002515chr143671 150 115 1537 --178
NM_002519chr111284 31412 940 242 2273 171 1217
NM_002547chrX84059 3694 3520 3045 2771 1571 1279 693 1712 12585 --
NM_002568chr81323 ----198
NM_002577chr333176 942 313 ----21381 163
NM_002581chr975418 4893 4788 4113 1728 735 651 24303 983 11126 25235 479
NM_002595chr1231229 479 377 21294 622 21925 1536 --
NM_002601chr2------1455
NM_002608chr22--11600 11550 --
NM_002612chr751947 1827 1767 613 419 2636 185 --11562
NM_002613chr1665401 4540 3809 1058 1039 129 13266 25230 4072 13636
NM_002645chr1152162 2013 1936 1091 707 --32007 1069 609 --
NM_002655chr894651 1879 1870 1864 1801 1768 1762 1239 400 25115 4545 11377 14631
NM_002657chr2073697 3274 2431 1471 1423 647 416 --23815 3753 11201
NM_002687chr1431057 179 36 1222 178 1112
NM_002709chr263598 3580 2648 1273 1147 184 175 --12722
NM_002710chr122342 35 --1232 --
NM_002713chr11309 --11063 --
NM_002725chr164308 4088 3018 1765 1581 1327 ----13824
NM_002731chr152984 2938 2612 2000 1071 33166 3044 2584 23023 991 12041
NM_002737chr1756583 5633 2064 1572 707 --11228 14664
NM_002745chr22104482 3963 3772 3388 1628 1402 1101 867 798 546 --33816 3278 3231 13870
NM_002755chr15----1805 --
NM_002796chr1----186 --
NM_002806chr14------2260 52
NM_002811chr16----133 --
NM_002819chr1911192 ------
NM_002822chr1231119 532 23 11362 1578 --
NM_002828chr1841025 841 255 201 --1823 --
NM_002834chr1243925 3832 3212 122 --34075 4042 319 --
NM_002835chr73563 542 518 --1557 --
NM_002841chr3----132 --
NM_002849chr121191 ----1404
NM_002851chr71184 ----2793 177
NM_002852chr31589 --1576 1542
NM_002858chr11311 ----21248 76
NM_002869chr1151800 1648 1594 1499 119 --21906 1580 --
NM_002874chr94984 774 467 246 2267 217 12405 --
NM_002886chr3114885 4459 3962 3194 1959 1404 1239 1042 642 621 228 --11005 --
NM_002892chr143643 596 541 21693 1360 21671 1306 21644 174
NM_002906chr1122208 1923 32284 1792 810 169 11573
NM_002912chr62703 668 1874 1276 --
NM_002941chr321008 462 1552 2605 588 --
NM_002942chr351446 1082 307 130 119 ----1882
NM_002968chr1641116 330 279 221 --2308 210 --
NM_002998chr872173 2078 1425 816 781 628 532 1648 21406 885 --
NM_003010chr1742452 1997 1758 175 12303 --11766
NM_003013chr41805 --1720 1780
NM_003016chr1771941 1933 1705 1661 1655 1449 501 21724 168 1330 --
NM_003017chr611399 21346 1312 1896 --
NM_003028chr973843 3720 3467 3354 3173 719 669 --1265 --
NM_003045chr13105042 4839 3925 3912 3871 3468 3139 1829 1266 738 24105 1644 --15002
NM_003062chr5------1145
NM_003068chr83881 384 330 2761 170 ----
NM_003070chr93670 603 195 1168 1796 --
NM_003081chr201941 ----1354
NM_003095chr12------1288
NM_003099chr15105867 4652 4351 2468 2193 1798 1648 1541 1417 683 --25978 2170 16262
NM_003101chr141629 1584 1578 553 --11197 --
NM_003106chr33911 899 387 2168 70 --1400
NM_003107chr622612 1779 --12085 21952 1748
NM_003108chr297050 1078 844 723 604 489 388 353 40 15892 14558 47276 7141 7100 5282
NM_003112chr7123199 3047 2805 2792 2441 2329 2091 1274 1031 891 622 328 1945 33252 2124 918 13211
NM_003114chr8--1810 1187 172
NM_003142chr21247 ------
NM_003161chr17103622 3605 2825 1331 798 659 496 423 400 68 2591 177 --22538 1230
NM_003178chr342031 1935 515 192 --11697 --
NM_003185chr2071276 1247 1091 949 916 417 55 --139 --
NM_003188chr65750 592 340 239 34 ------
NM_003189chr132772 1330 530 23271 2712 32256 1342 1286 --
NM_003198chr1----1279 --
NM_003205chr1572149 1935 1843 920 476 355 240 --32217 935 258 --
NM_003206chr6------1332
NM_003215chr4----1576 --
NM_003223chr161147 --1837 --
NM_003234chr342293 595 361 258 11627 1778 11577
NM_003243chr151283 1083 984 894 813 1460 1125 --
NM_003246chr1531647 801 607 --21378 1362 --
NM_003247chr611922 1610 21849 708 12024
NM_003253chr21----11918 --
NM_003255chr1722386 769 135 12123 2404 382
NM_003257chr1521129 260 --21236 987 --
NM_003262chr354012 3968 3821 1156 429 14728 11593 13755
NM_003270chrX----1326 --
NM_003274chr2152993 2690 2323 2292 984 --32053 1163 1023 --
NM_003286chr2041086 979 392 350 1989 --1132
NM_003291chr133322 275 175 1754 1711 1775
NM_003298chr396149 4811 4182 3876 2231 942 828 772 89 35503 5066 4305 15733 12402
NM_003304chr341613 602 157 70 1113 11444 2342 210
NM_003318chr6----1292 --
NM_003325chr222708 490 1716 --1657
NM_003336chrX--11117 21146 1036 1222
NM_003338chr1021528 677 21676 40 1575 --
NM_003339chr521353 1262 --21519 1440 11029
NM_003340chr43941 879 213 11029 1873 11259
NM_003342chr1752591 1221 1041 1009 365 --23236 252 --
NM_003350chr82719 133 180 21031 884 --
NM_003371chr921691 1536 --12146 1822
NM_003378chr7----1430 --
NM_003392chr373838 3170 3017 2826 1480 1262 114 1468 2646 453 23348 782
NM_003400chr22346 312 1325 2565 95 --
NM_003403chr14--1537 1244 --
NM_003404chr202737 296 12050 1404 --
NM_003405chr223666 634 611 ------
NM_003406chr811941 3695 531 308 1608 11825
NM_003410chrX42976 1016 845 830 23003 2447 23107 2922 --
NM_003412chr372792 2044 890 785 666 406 85 --42549 2482 1253 363 --
NM_003413chrX4804 635 582 130 --21862 600 11555
NM_003432chr51550 ----1359
NM_003453chr132253 143 ------
NM_003463chr663044 2474 2198 909 883 815 --12314 21228 1001
NM_003478chr1133184 2926 2142 12031 32330 800 64 13359
NM_003483chr1272735 2719 2007 886 387 242 202 ----11825
NM_003487chr171258 ----1230
NM_003488chr175931 669 660 640 633 ------
NM_003489chr2142872 2769 1205 988 21136 305 23217 2921 1875
NM_003505chr721599 290 31988 1350 155 3721 410 267 --
NM_003506chr8171 --11263 1523
NM_003507chr241953 1720 1664 229 1683 21937 148 31905 624 45
NM_003558chr91688 ----1649
NM_003566chr1243147 869 268 104 23083 673 23044 714 21240 1163
NM_003574chr1843770 2150 685 465 21759 1585 35807 1153 327 11682
NM_003583chr1253602 3418 3265 2911 1555 23757 2763 1708 13134
NM_003590chr2124064 3861 3460 3092 2664 2529 1556 1078 729 642 439 365 13929 22572 1540 --
NM_003592chr73524 500 194 ------
NM_003603chr42692 558 11689 1778 --
NM_003615chr383328 2894 2705 1123 735 662 254 141 12433 12941 13433
NM_003618chr24520 505 344 115 ----11319
NM_003620chr171219 1209 1169 --
NM_003626chr1141012 928 393 218 --31114 1037 376 --
NM_003633chr551990 1912 1625 267 211 --1152 22549 123
NM_003672chr111731 1392 11716 --
NM_003701chr131224 2753 424 ----
NM_003712chr19------1297
NM_003713chr151666 1298 1208 1083 366 11739 11682 133
NM_003714chr542574 2283 2106 2017 1467 12331 --
NM_003718chr71343 ------
NM_003722chr332035 993 279 11693 12064 1215
NM_003743chr221398 289 12250 2888 204 --
NM_003749chr1331841 1653 94 11587 1871 11637
NM_003754chr11----1145 --
NM_003758chr1551626 644 412 306 161 ------
NM_003762chr1--21465 1316 2528 484 1449
NM_003773chr3----1301 --
NM_003778chr35604 578 228 180 48 ----1704
NM_003783chr13860 447 402 --21078 36 --
NM_003787chr1831526 1459 40 11334 ----
NM_003794chr3--11018 1897 1980
NM_003796chr19------1596
NM_003800chr642426 1941 1637 160 1593 21880 847 --
NM_003812chr2----192 --
NM_003822chr142868 1035 627 262 12217 42984 2037 1952 208 --
NM_003861chr1432915 1862 1063 22699 2208 31911 1101 735 --
NM_003873chr1022366 2238 12255 22415 2189 --
NM_003877chr122672 268 160 ----
NM_003884chr331402 1257 623 --31786 1279 108 11823
NM_003885chr1762391 2195 2076 2047 1851 952 --12320 --
NM_003887chr222207 572 --11947 1740
NM_003895chr2151964 1818 792 627 97 --11825 --
NM_003899chr1362590 1970 1802 867 566 154 11650 1346 --
NM_003910chr7------1153
NM_003913chr674296 3773 2643 1421 1234 669 259 23154 2863 21194 1119 --
NM_003930chr772562 2466 925 655 360 193 39 --31929 598 236 --
NM_003934chr94448 359 344 61 --183 --
NM_003941chr761763 1680 428 216 168 88 22062 76 1650 11633
NM_003966chr5117807 7145 3113 2192 2067 1999 1825 1094 901 366 349 46751 2819 844 726 47292 6983 5485 29 12277
NM_003968chr32183 143 --1520 1493
NM_003971chr172508 253 ----1433
NM_003980chr641339 595 583 558 1362 1479 --
NM_003998chr4129 --1606 1508
NM_004004chr1341386 1369 1336 562 ----11325
NM_004064chr1221277 827 11087 11182 --
NM_004071chr2----2189 90 --
NM_004093chr1393197 3095 2942 2759 2682 2408 757 698 470 62619 2397 2147 2028 308 227 ----
NM_004098chr1021206 968 ----11056
NM_004099chr911559 12063 21492 162 1372
NM_004100chr642435 2252 829 488 12309 12669 --
NM_004113chr351545 515 501 313 194 1647 --21889 1656
NM_004119chr13----1305 1177
NM_004124chr142924 667 1143 1189 11222
NM_004136chr1553278 2460 560 127 43 --1287 12325
NM_004143chrX----151 --
NM_004161chr22547 40 1539 1139 11570
NM_004170chr921662 1615 --21413 1221 11189
NM_004171chr11139152 8943 8709 8127 7799 7553 7002 6283 5873 3072 2975 2540 1418 79580 9415 8775 5860 3504 1216 311 48347 8196 7073 3840 --
NM_004180chr2----2510 77 --
NM_004200chr1153126 3071 2730 2265 1076 12596 --13239
NM_004225chr82474 131 21265 437 21390 968 --
NM_004232chr18113902 3694 3626 3498 3333 3210 3109 2449 1378 1372 985 2247 123 23820 720 --
NM_004237chr55670 627 615 122 99 ----1231
NM_004241chr102748 681 --1509 1501
NM_004242chr6----181 --
NM_004249chr4----131 --
NM_004261chr13719 273 249 1854 ----
NM_004272chr531517 456 166 1424 ----
NM_004274chr1453181 2398 2315 1994 519 12075 13229 --
NM_004277chr621679 503 --11492 11573
NM_004280chr63180 135 80 ------
NM_004302chr1232889 2879 2873 22837 1895 ----
NM_004326chr1------1429
NM_004329chr10--138 11018 1445
NM_004330chr1521094 1077 --3890 470 180 --
NM_004331chr842492 716 373 86 1426 22426 255 --
NM_004342chr742159 1715 779 458 22296 1782 ----
NM_004346chr42183 105 --11468 1555
NM_004367chr661674 1614 1516 1221 1077 306 31706 559 58 1210 11762
NM_004370chr662144 2006 1814 1603 608 383 --21994 408 32103 1579 881
NM_004379chr231732 1125 500 --1291 11250
NM_004392chr1362405 2345 2234 1649 954 46 22561 505 22206 219 --
NM_004397chr1171713 1611 1570 1421 822 721 454 --1997 --
NM_004420chr1152444 1732 1672 890 71 --1325 --
NM_004432chr972241 895 788 577 526 363 91 ------
NM_004437chr122317 288 --13008 13487
NM_004438chr253296 3036 1326 1108 819 1260 --33278 3270 2265
NM_004439chr41145 --149 --
NM_004440chr661986 1975 1966 1559 1351 670 21918 41 31677 1582 714 11574
NM_004449chr2121492 353 11333 --1247
NM_004458chrX42071 987 585 357 --21630 289 22594 1993
NM_004459chr1721957 1282 21839 1538 1773 21422 408
NM_004480chr141247 --1741 1652
NM_004491chr1954065 2767 1482 566 199 14329 11725 14382
NM_004496chr1431347 1271 245 1163 1867 1387
NM_004499chr51456 ------
NM_004501chr173757 2513 1514 1435 1044 903 179 32633 662 267 1792 14124
NM_004502chr171366 ------
NM_004504chr252689 2218 860 600 332 2954 160 1256 12857
NM_004505chr1751892 1752 1349 486 232 --21822 1537 --
NM_004506chr6----2166 88 1482
NM_004525chr2----1262 --
NM_004575chr431396 403 295 --11322 1661
NM_004582chr11337 ----1153
NM_004586chrX95439 4648 4268 3789 3583 1703 1297 826 91 11420 25277 464 --
NM_004592chr12----1185 --
NM_004598chr543148 2664 2520 2033 --143 12076
NM_004604chr16------1243
NM_004612chr994477 4325 4257 4170 3944 3645 1375 1281 119 11223 13639 --
NM_004622chr252077 1926 734 590 260 1576 11897 --
NM_004626chr11----1448 --
NM_004627chr21----1604 --
NM_004637chr311334 ------
NM_004654chrY61332 942 230 205 155 145 ------
NM_004663chr153978 568 72 11099 11515 --
NM_004687chr172320 164 22091 1699 ----
NM_004690chr6186 ----136
NM_004709chrX41805 1773 1668 1178 11165 21750 1193 --
NM_004715chr184713 655 644 201 --1121 1154
NM_004719chr1241907 990 397 42 --32202 1124 497 --
NM_004721chr31314 ----1359
NM_004730chr552135 1868 1596 636 367 --21824 708 21762 649
NM_004733chr31615 --1474 --
NM_004734chr1343071 715 524 350 22440 182 --11155
NM_004745chr896789 6228 5618 5445 4665 4331 2679 2059 1801 57018 5150 1897 1786 1018 1803 15645
NM_004774chr1753167 1075 941 884 593 --13070 --
NM_004775chr1852442 1763 689 393 367 --12436 --
NM_004776chr20--1634 22174 620 13028
NM_004779chr5----21299 205 11327
NM_004787chr4------1103
NM_004795chr1351878 1570 188 94 45 1308 --21541 389
NM_004808chr1093125 2464 1116 1055 932 681 622 546 250 11195 11273 12898
NM_004822chr1743973 3951 1101 1019 12961 13784 --
NM_004824chr631424 1322 1209 21008 250 ----
NM_004831chr191358 1682 1221 2973 40
NM_004834chr2103358 3320 2939 2482 2226 1315 731 508 120 70 ----1919
NM_004840chrX82207 2043 2031 1821 892 694 688 481 --1416 --
NM_004841chr11781 ------
NM_004849chr641520 1357 560 121 1263 21440 464 1479
NM_004852chr182012356 11661 11547 11529 11442 11131 10704 9936 9765 9633 9619 8873 4707 3186 2595 1296 922 890 382 212 513681 11311 4510 4024 2544 412419 9456 1538 135 313085 10025 1241
NM_004857chr1484247 3145 3113 1556 1299 854 490 220 43074 983 567 227 13327 24649 1190
NM_004863chr1442101 1736 893 267 13798 43855 914 351 161 --
NM_004866chr534320 3327 3317 33098 701 527 11689 21365 205
NM_004869chr18--31720 1463 418 21521 322 --
NM_004902chr202838 826 3690 556 295 1569 --
NM_004906chr62700 212 ------
NM_004921chr152242 2109 1812 374 335 1174 1958 --
NM_004926chr1461837 1824 1701 1479 1364 379 21534 1427 ----
NM_004929chr851501 1057 185 169 97 1944 1342 --
NM_004947chr332556 2062 777 --42236 1839 1611 474 12202
NM_004956chr774032 3920 1449 1334 660 494 404 33761 2845 53 1603 33793 1747 541
NM_004973chr661708 1262 1132 1078 320 43 ----11504
NM_004975chr203807 224 113 1823 --1895
NM_004981chr22----1435 --
NM_004992chrX57556 7189 6206 1863 284 58151 7419 6754 2467 1751 123 16765
NM_005014chr93711 574 191 --1837 2861 793
NM_005045chr71242 ----1818
NM_005056chr12115598 5164 5118 4976 4373 2183 1841 1216 894 438 150 ----25489 4409
NM_005065chr1444965 4624 3959 3462 2714 408 44405 3897 1771 427 --
NM_005066chr11610 --1133 --
NM_005069chr2131621 487 99 11699 11463 --
NM_005113chr141464 158 --1424
NM_005114chr42570 503 ----1106
NM_005116chr2073334 3065 2850 1735 1134 1065 133 13993 21315 1033 12824
NM_005121chr1763574 2744 1268 619 586 452 126 23060 737 --
NM_005126chr331692 624 588 ----22186 1619
NM_005147chr1631205 791 299 11185 1944 11225
NM_005156chr9115212 5147 5013 5004 4763 4713 4492 4331 4210 1244 1186 22041 1585 ----
NM_005168chr21627 21499 44 --21634 637
NM_005171chr121988 11276 11176 --
NM_005180chr1031678 1634 658 21661 1468 ----
NM_005204chr105930 908 876 768 682 --2885 750 --
NM_005238chr1142412 1389 646 146 23448 2305 12296 --
NM_005239chr2142021 1634 528 371 1392 2659 620 --
NM_005257chr1831018 964 522 --1999 21251 511
NM_005259chr21139 --21441 979 11299
NM_005261chr811009 1784 --2908 176
NM_005277chr441320 584 294 191 1265 --11928
NM_005295chr7----1116 160
NM_005308chr10----1340 --
NM_005313chr1531323 1253 941 ----128
NM_005316chr111800 21029 754 1236 1727
NM_005324chr1762102 1950 1338 733 325 75 3213 143 43 ----
NM_005339chr463693 1606 1570 958 191 165 32953 788 237 --21245 820
NM_005342chrX1339 ----1409
NM_005358chr1341874 1643 1157 427 1449 2713 32 --
NM_005359chr1876287 5747 5328 1133 908 606 538 45262 1902 988 330 36121 1232 565 --
NM_005381chr2------1364
NM_005385chr352607 2254 1724 1062 282 --22625 35 --
NM_005389chr63631 248 37 1323 1595 152
NM_005399chr144263 3890 1685 1592 1798 31457 460 162 13035
NM_005400chr241082 335 221 48 42907 2886 2711 37 23023 2023 --
NM_005402chr741835 1489 1379 569 21237 460 ----
NM_005433chr1852781 2630 2253 2075 835 11753 12476 --
NM_005436chr1053768 3397 3001 1162 842 3926 826 389 22677 144 22608 343
NM_005445chr10170 ----1218
NM_005458chr932404 738 261 170 12461 1293
NM_005460chr5--1233 180 --
NM_005475chr1273265 3096 3053 2357 2350 1998 688 ------
NM_005499chr191166 1503 --1616
NM_005502chr943263 2430 836 350 ----13139
NM_005504chr12106201 5969 5909 5861 5798 2468 2080 1466 1166 174 14301 36585 6317 6236 11394
NM_005506chr442510 2484 1895 83 12789 --2932 444
NM_005509chr541546 1540 1449 719 11903 31655 1500 349 --
NM_005520chr5------1501
NM_005530chr1521409 324 1150 21317 248 11334
NM_005542chr721767 1276 11841 --11833
NM_005544chr21643 --31000 931 412 --
NM_005562chr141351 1211 1193 497 ----11243
NM_005565chr5----1207 --
NM_005573chr54520 475 123 63 ----2198 168
NM_005578chr395124 4232 3112 1170 831 603 566 550 442 24088 1266 44873 1726 1410 1038 --
NM_005587chr153925 218 199 --21005 314 1358
NM_005593chr121513 --3182 126 118 --
NM_005595chr14832 293 208 171 ----2922 589
NM_005596chr9116321 5264 5193 5172 4246 3921 2141 2096 1992 1734 251 46427 5612 5507 4628 46285 5722 4036 2216 --
NM_005603chr1851982 1948 1898 1799 1384 --31873 1786 1340 11329
NM_005610chr1----1695 --
NM_005618chr62585 461 ----1438
NM_005632chr161992 ------
NM_005644chr11378 --1333 --
NM_005650chr22----11183 --
NM_005663chr4------1559
NM_005665chr134888 3529 1146 1239 13003 11111
NM_005668chr534424 734 166 11454 --24623 4615
NM_005692chr7----122 --
NM_005715chr622308 561 --12758 1333
NM_005717chr131219 1200 137 11230 --21295 460
NM_005730chr1253050 997 880 523 434 --12982 12502
NM_005735chr2----1863 --
NM_005737chr241162 956 915 196 22150 738 12350 11124
NM_005739chr1532188 638 381 32355 2009 218 12380 --
NM_005748chr1263284 2208 661 363 164 47 52511 2308 2107 1337 1119 11307 --
NM_005749chr17------1460
NM_005751chr7----153 --
NM_005786chr18--21277 1044 1895 --
NM_005795chr23799 523 199 22787 356 1930 1903
NM_005802chr9------1156
NM_005806chr2131154 995 154 1501 21181 381 21313 1271
NM_005813chr23868 699 98 --42589 2426 2238 1019 12326
NM_005822chr632275 1807 401 --12211 11610
NM_005832chr351403 1298 521 158 83 21330 141 --1588
NM_005839chr12103 25 1134 1709 1162
NM_005841chr421053 286 11185 11035 11084
NM_005842chr133719 615 519 --1306 1298
NM_005853chr161159 1525 --1518
NM_005857chr121067 991 11479 --1256
NM_005859chr551463 1409 1267 1119 81 ----1402
NM_005871chr103912 330 323 ----1790
NM_005880chr161644 --2537 353 --
NM_005898chr1152949 2175 2158 1994 806 43196 2428 666 619 1114 --
NM_005902chr1574603 4365 3926 2799 1244 1141 437 24220 3979 --24474 1447
NM_005907chr62562 130 1340 1671 1405
NM_005909chr554279 1540 1197 746 147 32776 414 225 11439 --
NM_005910chr1733231 1274 1017 14130 23994 982 12655
NM_005920chr121399 900 13359 23877 1289 --
NM_005924chr711012 21117 934 11172 1890
NM_005930chr141724 --1138 --
NM_005935chr454084 3880 2030 603 524 35304 5176 191 21678 333 13807
NM_005937chr1721605 250 --23994 2815 24184 551
NM_005940chr22----1691 --
NM_005941chr883766 3638 3484 2895 2595 1619 1064 33 33662 3580 3425 13885 --
NM_005955chr1114922 4702 4452 4074 3865 1599 1224 1085 950 721 672 25284 1459 1795 13540
NM_005966chr241722 503 282 202 --12134 11474
NM_005986chr1342497 1091 818 680 --1646 1588
NM_005990chr532776 1712 444 22243 2116 --22743 346
NM_006016chr622037 323 12279 32175 2016 619 --
NM_006023chr10------1180
NM_006037chr294903 4602 4335 3893 3474 1281 1262 1058 455 13813 43785 3421 3133 1269 --
NM_006047chr2032669 2522 2204 23300 3251 42842 2636 2606 602 23375 259
NM_006060chr734218 1261 126 --13646 --
NM_006064chrX----1411 --
NM_006073chr612106 12139 11576 1335
NM_006080chr782977 2704 2649 2611 2601 2113 2092 226 22739 2595 12352 --
NM_006089chrX----11668 21490 130
NM_006094chr862340 2022 1606 964 700 362 1222 42180 1956 1767 756 --
NM_006106chr1142914 2131 1104 82 32697 2227 2174 --13116
NM_006136chr741033 933 856 489 --1951 159
NM_006143chr12------1119
NM_006153chr3----1524 --
NM_006154chr1532485 2077 718 12916 12014 --
NM_006162chr183667 488 193 --11109 --
NM_006164chr2--1107 --1344
NM_006185chr11----1640 --
NM_006186chr251303 918 892 486 370 ----1830
NM_006191chr121660 --1628 --
NM_006194chr1411166 --11057 2408 190
NM_006195chr931050 1016 973 31169 376 110 11118 --
NM_006206chr4112929 2442 2113 2073 1931 646 361 352 203 80 74 12026 --11094
NM_006207chr81260 ----1310
NM_006241chr342338 2308 1533 41 ----1257
NM_006243chr151030 1007 393 188 128 164 ----
NM_006251chr563268 2658 2586 2521 75 29 22825 173 22619 2408 --
NM_006253chr12------11290
NM_006256chr152707 2357 2303 2161 978 --22472 2212 --
NM_006265chr841373 1344 1013 947 ----11399
NM_006283chr843353 1402 1252 341 23134 3051 197 44921 1928 1504 1005
NM_006306chrX64968 4675 2335 2270 1629 1329 65607 5533 5308 4061 2309 919 11910 1378
NM_006313chr1231628 600 123 1377 21419 1253 --
NM_006315chr433988 3657 255 11123 44360 4302 4283 2740 14383
NM_006322chr131729 --2848 196 1903
NM_006330chr851642 1181 1094 98 56 --1117 --
NM_006333chr22135 116 ------
NM_006338chr1------1628
NM_006343chr2--1365 --1377
NM_006345chr451402 1360 923 317 144 1107 11354 --
NM_006353chr631163 1106 985 ------
NM_006375chrX11261 --21351 735 3655 571 258
NM_006379chr721810 1504 22053 288 --1583
NM_006380chr1784349 4320 3933 3771 3160 1659 1259 435 2847 677 --2295 155
NM_006393chr10124551 4438 4205 3921 3750 3190 3098 2993 2878 1382 714 486 21656 1577 14491 --
NM_006401chr91324 --1364 --
NM_006416chr6----1259 --
NM_006421chr841158 334 150 101 21173 898 ----
NM_006449chr251622 874 844 739 90 11773 3837 676 273 31832 567 161
NM_006451chr51965 1368 1953 --
NM_006460chr1731598 1115 1104 --1376 1492
NM_006496chr121849 735 1120 11405 21261 419
NM_006504chr1082925 2896 1051 675 491 475 320 306 1336 --32904 1033 53
NM_006526chr2062196 1549 637 413 173 153 --1428 11691
NM_006527chr41681 1671 3724 568 205 1777
NM_006534chr2042890 2498 2381 418 11002 43436 3356 2165 971 23093 645
NM_006538chr284161 4151 4071 3355 3198 1008 217 33 --32992 2793 661 12724
NM_006540chr821242 1214 2426 274 11389 --
NM_006544chr1455842 5549 4547 2445 1858 --26097 1016 11748
NM_006557chr951707 1608 1591 338 246 11382 ----
NM_006558chr82451 430 1187 ----
NM_006565chr16----1383 --
NM_006571chr8--1281 --1121
NM_006575chr141290 11334 2534 120 1454
NM_006577chr21367 ------
NM_006589chr1----1518 --
NM_006595chr1142070 2032 290 211 11478 11827 12002
NM_006599chr16108267 7485 6440 6247 5775 5349 2514 2486 566 170 32669 729 144 ----
NM_006602chr20------1161
NM_006614chr3--2461 232 12489 13170
NM_006620chr674858 4317 3949 3645 1012 349 145 54341 4173 3974 3962 172 24358 615 --
NM_006624chr1052093 2044 1995 761 659 11760 11473 21936 1533
NM_006626chr922306 78 11818 1304 12319
NM_006628chr1574380 4268 1755 1047 975 834 115 11016 33834 1826 723 1414
NM_006646chr1352949 2843 2517 891 327 1373 12970 32824 2234 691
NM_006658chr7--1791 128 --
NM_006667chrX31098 385 51 1975 --21063 41
NM_006681chr41137 --1149 --
NM_006704chr13----1441 --
NM_006713chr51124 2748 225 --1114
NM_006729chrX145628 5551 4006 3464 2232 2208 1811 1396 1374 1109 251 233 150 112 --1652 1163
NM_006734chr62378 328 --1595 --
NM_006738chr1564535 4501 3315 3044 1214 1116 13636 44633 4420 1540 1527 --
NM_006747chr11----1155 --
NM_006750chr16138108 8093 7691 6520 6472 6080 5955 2477 1777 1708 1380 446 123 33030 2524 1631 37292 5553 653 --
NM_006751chr21860 ----1388
NM_006754chr741273 819 197 179 ------
NM_006756chr851517 1336 610 91 51 --11216 --
NM_006772chr611469 --11376 --
NM_006775chr642907 2265 658 568 32866 958 843 ----
NM_006777chrX62592 2489 2132 1112 568 83 2646 67 1914 --
NM_006788chr1872013 1895 1817 1533 1449 482 101 ----11915
NM_006805chr541385 1301 1223 405 11124 11392 11197
NM_006807chr1721326 1309 1251 --21276 288
NM_006813chr64878 600 264 96 127 1167 1111
NM_006824chr1----195 --
NM_006827chr1443387 2359 1282 223 --13361 --
NM_006842chr11----1126 --
NM_006854chr731764 1607 317 21324 140 1117 --
NM_006873chr253122 2844 2815 862 652 33250 2916 2375 ----
NM_006885chr1653953 3691 2594 1703 1014 21582 1169 ----
NM_006888chr1473419 3048 2942 2931 2566 1343 970 21275 493 33488 915 845 172
NM_006902chr133283 3074 1175 --11162 13308
NM_006908chr731329 1142 424 11128 1375 11436
NM_006910chr16166 --185 --
NM_006915chrX42568 1564 884 238 --21624 553 --
NM_006920chr251693 1286 757 295 184 22058 1435 1456 1696
NM_006939chr141267 1277 21107 44 --
NM_006951chr10----1812 --
NM_006981chr952992 2280 1868 998 484 --1187 --
NM_006997chr101385 --1459 --
NM_007006chr1652954 2332 339 180 111 22344 1125 33505 576 514 1715
NM_007007chr12164698 4692 4033 3904 3607 3241 1839 1112 996 737 552 443 414 377 294 251 14573 14483 21281 746
NM_007008chr22203 97 2935 848 3826 330 300 --
NM_007011chr1576719 5601 4843 4792 2598 1215 785 15508 ----
NM_007027chr31164 ------
NM_007038chr2165259 4708 2022 1545 1387 199 36077 5774 264 66128 6044 5581 5568 5396 390 14989
NM_007039chr1462314 2201 1907 715 259 164 --11916 12152
NM_007040chr191764 --1415 --
NM_007043chr1221841 636 1488 2575 42 12021
NM_007050chr20138062 8017 7770 7548 6817 6758 6265 5817 5797 5742 4922 2834 510 27455 924 18040 23057 767
NM_007084chr1331520 1463 1286 --21280 590 11055
NM_007114chr373310 2687 2650 2298 2047 759 360 1121 33245 2285 884 12611
NM_007124chr661915 1876 1662 1538 237 231 11826 ----
NM_007126chr9------2527 168
NM_007129chr132891 862 --1769 1427
NM_007137chrX94675 4154 4058 2049 1451 870 737 642 343 35292 481 334 24390 911 --
NM_007144chr1711307 ------
NM_007146chr1772887 2649 2094 1841 1073 662 592 12878 21140 359 --
NM_007150chrX--12003 22089 425 22025 513
NM_007159chr321539 222 --21683 1610 --
NM_007170chr1------1908
NM_007173chr1121676 1508 12029 32383 1912 311 22405 157
NM_007175chr853526 3394 2861 489 23 12641 21376 233 22802 595
NM_007178chr12----1390 --
NM_007191chr12----1646 --
NM_007212chr111557 --11398 12237
NM_007214chr671296 1235 876 479 346 237 42 11335 11133 --
NM_007231chrX32418 2273 2139 --22450 272 --
NM_007246chr4------1358
NM_007249chr13159148 7982 7682 7502 7071 5883 3621 3122 3034 1749 1543 1486 820 563 535 19117 29084 8931 11090
NM_007269chr12409 92 1482 --1394
NM_007276chr72946 427 --11101 --
NM_007285chr161113 --149 --
NM_007347chr1552828 2219 2203 1180 348 1635 12168 --
NM_007353chr792913 2868 2776 2428 2403 2006 1889 916 685 --2893 403 22595 1205
NM_007373chr102592 360 11723 ----
NM_007375chr192607 2368 2331 2167 1914 1757 939 856 595 12131 12288 178
NM_012062chr122297 96 --1822 1159
NM_012069chrX42483 2368 2121 934 ------
NM_012072chr2064275 4177 3652 3494 2917 126 43934 3829 3058 982 44308 3348 1320 671 --
NM_012081chr583773 3561 1098 771 628 611 448 394 23187 2657 12545 12521
NM_012090chr121184 150 1105 2455 327 --
NM_012092chr261740 1656 1548 1505 370 222 164 ----
NM_012096chr363520 3479 2994 2524 731 318 13492 21100 470 12891
NM_012104chr1163809 2592 2549 1047 751 521 23793 2405 ----
NM_012115chr61616 1470 --1424
NM_012120chr642779 2625 2437 863 --21043 227 --
NM_012129chr752474 2107 1645 393 60 12487 12065 --
NM_012156chr2073313 3226 2798 2584 1161 794 492 1645 1278 13076
NM_012161chr41164 --31094 381 182 --
NM_012164chr997030 6977 6963 6710 6522 6439 4799 4781 571 24687 882 15632 32976 2150 1900
NM_012175chr112888 68 1710 1776 --
NM_012214chr295645 5249 4655 2236 2097 1803 1617 1040 571 25267 870 24998 1629 --
NM_012215chr102777 192 31978 1966 138 41584 718 658 548 --
NM_012231chr141763 1299 1249 1240 --1674 11842
NM_012233chr231178 876 369 1408 --1842
NM_012234chr373317 3298 2362 1339 1084 868 771 12769 12881 11454
NM_012238chr1031148 436 386 11248 ----
NM_012242chr103299 232 187 --1206 --
NM_012243chr11775 1283 1342 1307
NM_012259chr641409 513 502 22 21426 1347 ----
NM_012262chr1105154 5042 4339 4012 3812 3591 1480 1397 961 799 25246 4458 45132 3418 1385 791 --
NM_012266chr911131 21149 116 ----
NM_012281chr742299 1588 621 92 21567 340 ----
NM_012286chrX2453 42 ----174
NM_012287chr323899 1601 --44518 4467 3756 2903 --
NM_012288chr685506 5422 4229 2188 1575 421 376 130 25613 1030 35306 4133 618 24840 1932
NM_012290chr231615 1067 318 11125 11507 11440
NM_012294chr763548 2918 2688 1377 680 648 13990 1851 --
NM_012297chr432452 1021 969 1986 --11696
NM_012300chr582570 2302 2248 2111 1902 1868 282 135 ------
NM_012301chr751664 1564 1558 1447 776 --1480 11673
NM_012302chr161233 1194 1150 496 485 148 1128 1343 --
NM_012308chr1111929 ------
NM_012309chr1174437 4388 3506 1686 954 711 513 23681 3413 13457 --
NM_012322chr71150 ------
NM_012325chr2041505 604 386 340 21315 63 1146 --
NM_012329chr171565 11676 2556 498 1335
NM_012330chr1051360 672 607 398 248 1108 11605 --
NM_012333chr1----11150 --
NM_012345chr134493 168 115 104 1409 21656 642 1777
NM_012347chr643012 2890 2209 954 12300 22421 2170 12293
NM_012382chr5114215 4138 4097 3797 3553 3530 3484 3215 664 623 265 13576 --1107
NM_012388chr1553149 3043 3035 3020 1201 12899 12589 1964
NM_012398chr1972739 2440 2343 2187 2079 2065 458 ------
NM_012399chr2271973 1742 1706 1612 1432 606 115 21941 343 ----
NM_012414chr1--3783 754 672 1726 2772 122
NM_012425chr1062745 2599 1836 1052 912 259 21865 624 1958 --
NM_012426chr16----1351 --
NM_012428chr153716 659 203 --1386 --
NM_012431chr743616 3236 1323 995 2750 428 13277 33316 3307 889
NM_012463chr1221150 569 --21483 172 --
NM_013231chr1454040 3553 3505 2864 213 --24121 1131 --
NM_013233chr211440 1914 --11048
NM_013254chr121124 --1142 --
NM_013261chr452975 2304 1162 924 895 1655 180 11296
NM_013262chr62401 349 1166 1479 11412
NM_013293chr7--1522 1262 --
NM_013302chr1643212 1841 1331 818 23428 1710 14330 23040 118
NM_013309chr1582253 1886 1860 1721 1628 887 653 69 1881 22627 1674 --
NM_013320chr12----1124 --
NM_013322chr731715 1525 190 --11437 --
NM_013354chr821147 563 11200 11464 11429
NM_013372chr1532253 843 574 12088 1237 1715
NM_013374chr362812 2500 819 448 277 199 --13123 22652 2538
NM_013381chr121481 22418 447 21484 233 1797
NM_013396chr213447 278 162 1125 41553 1414 1355 400 --
NM_013956chr81102 2150 33 ----
NM_014003chr162364 334 ----1410
NM_014007chr9159 ----11209
NM_014011chr221864 1691 1579 21046 960 --
NM_014016chr341459 1123 1098 694 31517 1049 50 --2316 256
NM_014021chr183476 3409 3328 3122 2801 2361 2321 2243 --22625 327 --
NM_014023chr1052779 2648 2018 725 538 ------
NM_014028chr642410 2294 2107 446 32192 1019 260 33165 1263 546 1600
NM_014033chr1232166 2093 1503 ----12301
NM_014043chr331247 423 64 2239 185 --2374 96
NM_014044chr2----174 166
NM_014048chr16114894 4626 4317 4205 3839 3743 3288 1431 1346 1157 98 24798 654 14142 --
NM_014106chr1532923 1929 505 --32641 2372 244 12268
NM_014112chr875457 5026 4468 4271 3748 1671 65 45229 5069 4825 3878 44891 4369 1714 1631 11198
NM_014117chr1651009 780 575 456 178 12384 172 11677
NM_014155chr1177466 7218 5844 5099 4910 1899 964 15205 47173 2642 1622 719 --
NM_014166chr13175 ----11092
NM_014181chr232380 2302 1013 22878 802 1593 1756
NM_014212chr12----1815 --
NM_014220chr32134 48 ----180
NM_014240chr374148 3893 3082 1640 1465 848 524 21526 514 13161 --
NM_014243chr431491 478 466 31855 1771 849 11796 1495
NM_014251chr7----1967 --
NM_014253chrX62380 2270 1733 1707 779 101 21002 491 ----
NM_014264chr43464 432 133 --2650 494 --
NM_014267chr11--1712 1191 --
NM_014271chrX1643 --1245 --
NM_014294chr8--11277 11285 1515
NM_014305chr131548 2581 145 --1510
NM_014313chr121446 79 ----21393 266
NM_014319chr1261821 1799 1760 1697 1407 1263 21887 1721 --11709
NM_014342chr111979 --1594 2372 328
NM_014361chr11----1192 --
NM_014363chr1321121 503 21081 217 1113 11074
NM_014368chr922154 2061 --12123 12078
NM_014372chr161949 670 630 280 206 137 1645 11583 --
NM_014382chr351641 1417 654 497 40 --127 --
NM_014415chr331694 1321 613 --11463 --
NM_014421chr442093 2078 527 227 21809 90 130 21486 603
NM_014423chr555292 4490 4277 2139 276 --15561 15147
NM_014432chr641394 445 238 38 31520 383 277 ----
NM_014445chr342407 2058 983 965 11809 --1200
NM_014454chr64995 714 382 343 ------
NM_014458chr11312 41013 447 187 158 --11222
NM_014461chr31142 ------
NM_014462chr8----1312 --
NM_014469chr111549 --1302 --
NM_014491chr75822 797 713 681 433 ------
NM_014494chr161665 21532 820 --31579 610 355
NM_014504chr722076 229 2458 442 31538 449 408 --
NM_014572chr13--1437 --11251
NM_014575chr31370 1563 --159
NM_014577chr222734 355 --2615 306 --
NM_014584chr14----1123 --
NM_014585chr211089 2377 69 --21255 1244
NM_014586chr2144682 3752 3686 3213 14288 24520 1511 --
NM_014591chr10----11337 --
NM_014616chr363310 3080 2304 672 652 407 22343 1215 1968 --
NM_014618chr9----1318 199
NM_014620chr121755 1318 --1748
NM_014646chr1842500 2156 1186 819 --13171 13219
NM_014648chr32358 77 1945 --11412
NM_014667chr352364 1908 1519 718 706 11978 --1128
NM_014674chr353899 3867 3680 2980 2501 21253 558 --23939 2719
NM_014679chr11----21230 273 --
NM_014682chr862191 2139 1479 1463 804 118 1287 32207 1877 275 --
NM_014701chr1563430 2982 834 550 232 46 1947 33088 2828 2731 --
NM_014702chr632514 2130 498 23059 875 32859 699 267 12295
NM_014705chr741791 1739 465 441 11497 21731 522 --
NM_014706chr122874 860 ------
NM_014707chr76715 604 598 552 390 102 --12239 1783
NM_014717chr192636 87 1827 1244 --
NM_014729chr832288 1922 475 2822 714 1413 --
NM_014742chr20----11792 --
NM_014747chr165571 5518 4978 4022 3807 1260 24897 3817 --22213 2146
NM_014751chr852160 1805 1469 723 447 --1201 32002 1788 301
NM_014755chr2113816 3169 3080 2598 1629 1206 774 703 660 327 264 43669 3278 3132 728 13955 1374
NM_014761chr16176 ------
NM_014765chr152652 2629 2442 976 406 12452 1641 22599 1021
NM_014774chr1----1444 --
NM_014776chr1222758 2324 --12140 23122 2884
NM_014787chr172227 2167 2079 1047 526 453 29 --12187 1238
NM_014795chr231388 924 296 1199 --11363
NM_014802chr122929 270 1941 1997 --
NM_014810chr1133694 3647 3597 3515 3478 3345 3335 3237 3061 1462 1275 1074 867 23612 3135 23430 3405 --
NM_014813chr1----1600 --
NM_014819chr572479 2403 982 910 373 71 47 --1247 1168
NM_014820chr362076 669 656 284 192 184 2676 425 22060 256 --
NM_014829chr51232 42040 1526 1496 628 182 21833 887
NM_014839chr11485 1195 42477 989 263 159 22193 426
NM_014841chr631003 887 246 ------
NM_014849chr11160 ----11310
NM_014871chr12----2624 175 1218
NM_014872chr92551 259 2401 308 1691 1334
NM_014873chr1144711 4688 4185 3632 1664 1567 1474 1089 903 743 532 509 486 79 34435 4307 3025 34742 4391 3096 1722
NM_014877chr17127484 6908 5134 4804 1797 1339 890 881 638 596 363 150 26715 5476 33079 2661 1790 26425 1529
NM_014892chr61440 --135 1500
NM_014893chrY52179 2125 1832 787 646 4536 500 129 54 --1603
NM_014897chr1733232 2414 969 21304 826 --1675
NM_014899chr543164 2845 238 226 11248 23088 2297 12125
NM_014903chr1242270 1514 346 176 --32431 2405 2322 --
NM_014906chr1773943 3771 3624 1173 1125 1095 132 1568 13875 33647 2577 203
NM_014910chr191152 --1635 --
NM_014912chr1063519 3449 3412 2190 669 577 22277 195 43044 3027 2741 202 --
NM_014913chr184532 250 210 125 --11448 --
NM_014918chr1541256 458 336 324 --11525 --
NM_014924chr1453132 2799 2708 2368 2311 ------
NM_014926chr3----11102 --
NM_014929chr21524 ----145
NM_014936chr672879 2677 1963 992 777 317 75 --22162 398 --
NM_014939chr181151 1118 --1547
NM_014946chr231252 300 181 3903 843 26 32838 2702 326 --
NM_014947chr1103075 3058 2943 2764 2698 2587 2424 2187 360 331 12632 22788 1130 --
NM_014950chr1461462 1294 1226 364 234 197 11195 1149 --
NM_014951chr1032523 1797 421 --1214 11790
NM_014961chr452227 1776 589 416 398 12086 --153
NM_014962chr2082912 2869 2432 2059 2025 464 106 79 1605 ----
NM_014982chr1421337 1194 15082 15328 --
NM_014988chr442423 698 529 240 32174 414 405 ----
NM_014989chr622062 1613 ----11445
NM_014991chr433016 2529 2255 33221 3146 2444 3426 407 390 43114 2049 1090 874
NM_015000chr1262907 2351 1973 938 770 423 --22371 2151 --
NM_015002chr1241890 748 405 178 ------
NM_015025chr252117 2069 936 704 321 1172 11832 1543
NM_015026chr1264416 2992 2928 1924 1063 92 31592 1508 431 --11728
NM_015027chr162664 456 --2651 509 --
NM_015032chr1392813 2777 2702 2280 2165 1131 991 924 628 12722 1256 --
NM_015039chr164291 3144 1537 1391 1232 147 24365 3815 ----
NM_015040chr223405 2913 12928 43246 2837 2719 2285 13188
NM_015045chr1042089 1929 1452 396 11689 22250 2077 --
NM_015046chr932608 2559 93 12115 143 2296 182
NM_015049chr243113 2795 962 950 22514 1132 11074 --
NM_015054chr12--2446 340 --1519
NM_015071chr576199 5970 5318 4559 4449 3977 1453 24811 201 31692 1497 256 --
NM_015076chr664021 3354 1538 1431 639 86 11411 ----
NM_015091chr144752 686 332 131 1320 ----
NM_015092chr1654520 3556 3440 3245 1734 24184 4104 13521 13787
NM_015093chr641847 1539 1369 575 --21549 385 --
NM_015097chr352122 1900 1741 768 555 2631 412 12385 --
NM_015100chr1----21388 1267 --
NM_015113chr1732405 2197 1937 22374 222 ----
NM_015125chr19----1143 --
NM_015137chr841974 972 645 418 42167 1786 829 461 135 --
NM_015138chr1522044 1769 1726 12848 11905
NM_015144chr16103648 2902 1496 1413 1399 1204 707 523 270 264 1572 33905 3868 943 --
NM_015153chr61695 1689 160 1126
NM_015155chr1063284 3166 2350 651 328 100 13327 --12837
NM_015156chr1483845 3831 3551 3097 2668 1495 994 979 23988 2648 23759 837 --
NM_015170chr821817 21 --1845 12244
NM_015184chr3--1601 1631 --
NM_015187chr43659 127 119 ------
NM_015192chr2072996 2952 2617 2331 986 529 276 1359 21987 513 12154
NM_015194chr1741722 1506 775 366 32069 1938 1303 ----
NM_015199chr382970 2537 2459 1181 907 849 326 264 --12498 1436
NM_015202chr1621313 659 --11180 11715
NM_015205chr1365254 4631 3709 3574 2054 409 13267 14000 14793
NM_015206chr1562825 2741 1272 956 586 69 63873 3830 3673 3455 1259 1124 --33032 2665 2414
NM_015215chr163189 3067 3054 3039 2287 2278 33123 3011 1264 22232 655 --
NM_015230chr41684 1560 1214 11445
NM_015231chr116764 380 300 101 94 26 ------
NM_015236chr431087 1081 932 --11035 11487
NM_015251chr16--1701 32135 2079 152 12230
NM_015263chr151925 11169 --1946
NM_015265chr282604 2338 2043 1906 1786 949 925 472 --22584 2395 12027
NM_015267chr1232199 1884 147 --3724 693 430 --
NM_015271chr483924 3551 3543 3489 3335 899 603 325 11540 1291 1546
NM_015272chr1661714 1659 1421 700 641 75 11414 --11956
NM_015275chr1261875 1686 1440 1385 325 310 ----12096
NM_015278chr683315 3278 2610 2112 734 394 286 93 ----23361 1015
NM_015288chr573583 3240 2980 2551 1057 551 295 22867 2405 --11336
NM_015310chr8258397 8245 7841 7815 7141 7112 6877 6669 6567 6377 5875 5533 5369 5175 3244 3036 1788 1773 1724 1631 1301 1164 1157 297 201 35912 1889 1813 15797 47378 6127 5377 2906
NM_015313chr1164530 4301 1527 1426 941 88 2928 494 11320 13820
NM_015315chr513440 13336 12496 --
NM_015317chr241155 804 714 563 11927 41140 321 306 145 --
NM_015331chr1----1638 --
NM_015335chr1242462 1816 1690 79 52398 2286 2084 1669 573 21802 1763 --
NM_015336chr1222628 604 42123 1860 935 880 --12682
NM_015344chr861902 1338 780 537 491 144 1725 ----
NM_015347chr1252876 2803 2737 1026 879 12967 22755 197 --
NM_015349chr673088 2973 2196 1970 1066 641 454 1883 22374 1946 32948 2924 2139
NM_015355chr1741356 1236 504 360 21943 1633 ----
NM_015378chr172918 2842 900 807 795 384 367 --22468 325 --
NM_015393chr473814 3559 2904 2458 1250 699 220 11022 13515 --
NM_015396chr3------21237 125
NM_015409chr1222636 2051 --22699 2688 --
NM_015446chr12221 118 --2106 37 11048
NM_015455chr573943 3881 3676 3214 1552 1179 983 --53317 1488 526 424 39 1584
NM_015458chr875112 5082 4630 4542 4523 4124 954 --11017 24807 803
NM_015460chr321888 633 --21798 480 --
NM_015463chr2------1795
NM_015464chr7--21041 810 1900 --
NM_015516chr1111292 --1522 11259
NM_015542chr1041272 1192 775 222 --21185 119 --
NM_015548chr61119 163 --2735 97
NM_015550chr753400 3378 3368 1182 128 1671 13503 1933
NM_015553chr685083 4587 4544 2054 1724 1660 1378 1289 --13261 2497 63
NM_015554chr1572918 2804 2642 2185 2135 1999 601 42940 2589 2313 990 22862 2786 12485
NM_015560chr392857 2444 2422 2297 2204 1991 1810 989 585 --12158 --
NM_015565chr2122125 1815 22207 1413 42019 1828 703 188 --
NM_015569chr164008 1195 1123 955 942 71 21795 46 23279 582 --
NM_015570chr731843 1660 473 41411 437 398 353 21705 525 21495 128
NM_015576chr372879 2746 1018 992 605 267 104 12472 11878 --
NM_015577chr551804 1661 1315 703 690 ------
NM_015578chr1942108 1723 1500 366 --32061 355 76 2728 609
NM_015601chr101953 134 1405 2911 115
NM_015630chr25874 753 468 445 269 167 11071 3383 187 162
NM_015678chr1331738 1658 219 11684 11675 1471
NM_015690chr2----1587 --
NM_015691chrX62465 2391 2231 483 341 95 22769 2287 1619 1121
NM_015695chr631784 1325 772 --12095 11626
NM_015850chr842138 1500 328 209 11581 --22272 2115
NM_015878chr872160 2118 2093 2071 543 460 36 21712 495 21940 373 --
NM_015879chr1896956 6304 5740 3273 3016 3010 2302 1874 1570 37534 6999 2532 48448 6742 6735 2925 27407 3155
NM_015885chr115754 638 283 224 180 1253 1554 --
NM_015886chr8105693 4983 4328 4215 3643 1713 1668 823 761 729 35117 4892 3809 --1541
NM_015888chr143314 941 733 460 13095 23173 2702 22224 1290
NM_015906chr164741 4648 4250 3173 1081 509 1948 2980 215 --
NM_015912chr831570 736 459 12410 32280 2219 1639 22438 909
NM_015914chr16----185 --
NM_015960chr10------1375
NM_015995chr15115486 4536 3701 2186 1670 1519 1446 584 553 94 64 25503 3581 15526 --
NM_016018chr82662 214 --2929 412 1698
NM_016019chr731020 920 426 11053 1951 2779 323
NM_016023chr831558 476 418 ----11619
NM_016040chr152553 1887 520 326 163 --32231 374 282 21826 216
NM_016041chr171340 ----179
NM_016045chr2061594 1494 1240 1156 742 632 1476 --11454
NM_016070chr17186 --1258 --
NM_016072chr1242339 849 623 100 1296 22409 527 --
NM_016073chr1511119 11038 ----
NM_016075chr1352981 2724 2365 921 124 22095 236 1324 12309
NM_016076chr163114 2102 517 192 148 98 ------
NM_016078chr173963 926 87 11110 1875 --
NM_016081chr422246 1871 21721 284 21519 727 --
NM_016083chr663724 3649 3528 3418 3370 334 ----1426
NM_016087chr731502 104 54 1659 --11183
NM_016097chr1831034 379 118 21016 293 11113 --
NM_016120chrX41060 916 847 98 1934 1760 --
NM_016121chr11939 --21020 455 --
NM_016123chr1251284 1087 876 358 115 1459 1480 1488
NM_016131chr231462 489 328 2666 59 ----
NM_016133chr231605 359 194 188 1205 --
NM_016147chr11----144 --
NM_016169chr1073297 3211 2714 2563 1230 544 397 --12928 13141
NM_016195chr10----170 --
NM_016205chr42485 373 --11003 11382
NM_016206chr3138326 8137 8044 7918 7821 6335 2921 2710 2703 2444 2182 1677 30 38376 7020 1536 28498 3468 33613 3450 474
NM_016216chr31683 ------
NM_016224chr6----11589 1127
NM_016231chr1721367 64 --1182 --
NM_016250chr14--1539 ----
NM_016255chr663272 3244 2275 934 793 769 1871 1394 11074
NM_016269chr441187 928 775 38 2272 221 --1969
NM_016271chr1841590 704 276 36 1216 31885 1837 610 21546 437
NM_016275chr321820 305 32448 540 162 22755 2257 151
NM_016277chr61542 21453 408 1245 11444
NM_016279chr5----1380 --
NM_016289chr231423 566 525 11872 1656 1878
NM_016322chr953186 3097 2452 2185 414 --22076 1020 21285 133
NM_016338chr541174 1057 157 144 1247 ----
NM_016340chr54986 853 283 185 11324 11269 --
NM_016356chr621061 446 --52902 2491 742 697 280 11090
NM_016359chr15----257 22 --
NM_016374chr141551 1475 1153 622 11068 ----
NM_016410chr91581 ----130
NM_016422chr1121161 326 --22661 682 12182
NM_016426chr2251878 1758 1630 1518 97 1585 --1658
NM_016436chr2032577 1666 839 12417 32108 894 348 12689
NM_016441chr232192 481 440 1166 21813 1789 12281
NM_016488chr123667 317 250 41982 475 303 68 21956 1854 --
NM_016500chrX194 --1269 --
NM_016520chr9122 --1577 --
NM_016530chr1553999 3838 2709 2575 954 13866 --33149 2725 267
NM_016531chr454119 4019 3430 861 301 13485 53569 3121 2741 1237 1045 --
NM_016544chr243583 3223 2544 40 23499 2502 33917 3534 3525 23472 547
NM_016559chr32333 298 --1288 21373 434
NM_016575chr1275402 4860 4715 4688 1997 1651 1579 24474 742 23963 3548 --
NM_016577chr384280 4208 3443 2779 1463 1328 821 224 24495 1055 1364 11779
NM_016605chr532260 640 615 --12333 --
NM_016617chr1322064 1427 12141 1425 166
NM_016628chr104913 709 330 44 1343 1225 1179
NM_016631chr214301 283 69 52 187 2907 759 --
NM_016649chr201355 1541 1528 --
NM_016929chr634114 1418 614 34510 3021 33 13571 14394
NM_017415chr564152 3647 2874 2805 2794 1569 24289 599 14195 14469
NM_017420chr1472821 1482 1430 1269 638 371 189 12876 22726 109 13409
NM_017423chr432109 2055 1885 --21798 821 11733
NM_017540chr563035 2266 2036 680 527 50 198 11066 --
NM_017544chrX2906 335 1949 3723 79 24 --
NM_017548chr361983 1506 653 427 251 105 22172 499 11556 --
NM_017572chr19----1242 --
NM_017580chr1041888 1876 1621 1566 1583 1262 1214
NM_017594chr963134 3076 2981 2373 2292 2268 --13199 --
NM_017628chr474590 4216 3293 3227 1172 1045 613 31513 643 173 34407 4087 27 23396 1706
NM_017629chr1101960 1941 1544 1240 642 602 586 506 255 149 --11820 --
NM_017632chr41422 --1160 1119
NM_017633chr663769 3679 3241 3121 1189 688 2681 244 43940 3402 2390 960 13690
NM_017635chr1121005 176 --21379 1033 1246
NM_017637chr9149433 9394 9104 8493 8470 7916 7809 7549 6537 2948 2710 2342 2033 527 37050 558 412 76630 5766 3664 3367 2583 1810 1388 --
NM_017641chr1221071 941 --41151 1062 886 24 11019
NM_017643chr1742366 559 373 244 1473 23045 1928 --
NM_017644chr3114771 4760 3242 3193 2058 1587 1413 996 831 261 251 21294 102 12009 --
NM_017658chr1464165 3194 1669 1564 812 455 34678 1802 1588 44450 3955 1869 529 13119
NM_017664chr1341000 984 956 948 ------
NM_017670chr11----182 --
NM_017709chr154241 3936 3584 2726 667 24264 1661 23628 790 --
NM_017724chr31815 --1719 1563
NM_017736chr1642840 2512 1169 795 42624 2251 2213 1072 31179 398 225 1408
NM_017752chrX11958 ----11942
NM_017776chrX41043 633 253 63 31302 1092 262 ----
NM_017780chr84966 911 669 318 --1835 --
NM_017785chr5----1412 2425 396
NM_017789chr2----1842 --
NM_017799chr1421623 750 21897 188 --1631
NM_017813chr8105446 4645 4554 4432 3823 1736 1586 1302 797 631 33606 2282 166 15667 --
NM_017824chr1082228 1958 1805 941 514 474 308 292 ----21755 850
NM_017847chr112035 12271 22260 1879 --
NM_017848chrX54306 4082 3818 3138 1856 --11662 1733
NM_017851chr1511195 --11229 --
NM_017896chr2032454 1176 215 177 43366 2710 492 181 --
NM_017902chr10115070 4572 3916 3785 3538 2311 2240 1875 1332 899 842 --15726 --
NM_017913chr9----1144 --
NM_017918chr4------1119
NM_017919chr955776 5767 4461 749 513 44058 3544 1210 569 13779 --
NM_017922chr144664 275 264 74 2616 478 ----
NM_017925chr931850 1589 1416 11732 11372 --
NM_017944chr11102911 2445 2122 1018 862 776 742 675 390 214 1234 43065 1975 1160 588 --
NM_017964chr2----11026 1160
NM_017987chr1022180 451 --1273 --
NM_017988chr123886 850 636 --2650 367 --
NM_017998chr941150 905 531 471 11437 1568 1498
NM_018011chr131631 ----1106
NM_018018chr12--21367 152 31824 1237 640 --
NM_018023chr341895 1690 1595 779 --1266 11930
NM_018027chr1043028 1200 823 763 33146 3076 2086 22719 2458 23289 3214
NM_018036chr1473610 3478 3448 3225 3106 3061 1380 --34030 3754 574 11720
NM_018046chr531437 720 143 11810 21880 1737 21888 462
NM_018061chr12618 155 ----21709 1675
NM_018084chr263355 2620 2113 1198 914 450 22630 598 ----
NM_018092chr1621509 1254 --11293 --
NM_018098chr33412 294 81 2936 196 11214 --
NM_018121chr1042456 1005 677 229 12725 12434 1835
NM_018126chr411468 1308 173 11155
NM_018131chr101907 --1848 --
NM_018133chr311807 11885 31933 1852 166 11655
NM_018142chr81203 --1239 1214
NM_018149chr17----1183 --
NM_018164chr12--1316 --2286 38
NM_018169chr122355 21 --1461 --
NM_018206chr16--1263 1723 1496
NM_018208chr1----11162 --
NM_018211chr142098 1942 745 466 21955 543 11662 --
NM_018214chr63453 257 234 1986 11111 1909
NM_018222chr11--11917 ----
NM_018225chr974382 3668 1736 1415 1407 1149 1014 45113 3994 1189 885 1343 15215
NM_018227chr453189 2298 1138 1116 423 22412 2119 52738 2459 2205 1081 842 --
NM_018264chr72632 308 1954 ----
NM_018293chr342038 1948 1835 571 32759 2097 1126 1841 --
NM_018318chr121901 1847 1263 1335
NM_018323chr411577 11319 11795 11714
NM_018327chr2091730 1706 1584 1328 400 338 309 175 37 ----11299
NM_018351chr1263861 3600 3129 1493 378 350 --14727 1702
NM_018361chr872952 1162 1088 904 424 339 100 11479 23148 305 1603
NM_018362chr1152607 1399 585 257 90 23993 788 33034 2497 1623 --
NM_018364chr174111 3542 2606 2507 1545 456 170 --13778 14072
NM_018371chr8147 1193 --1353
NM_018373chr14126240 5933 5887 5305 4867 3977 2057 1640 1503 991 748 525 25680 2304 26050 4723 14577
NM_018374chr785115 4806 3796 1997 1552 977 733 158 12024 --35249 4798 613
NM_018387chr92377 155 --2517 117 --
NM_018394chr33371 157 26 21318 1167 1110 --
NM_018403chr343481 2968 1082 473 33788 1624 948 24106 4044 --
NM_018413chr12----190 --
NM_018437chr9----1385 181
NM_018439chr182701 79 11770 32115 990 638 12317
NM_018440chr8158713 8669 8652 8587 8108 7722 7519 6593 6360 3009 2432 2011 1538 1382 1045 36466 6264 3151 27878 1966 26769 3313
NM_018445chr15------1472
NM_018448chr1211178 ----2402 213
NM_018449chr9----1183 --
NM_018482chr842365 2074 910 625 31685 692 43 2315 151 --
NM_018489chr152168 1750 808 681 589 12025 22295 360 11911
NM_018490chr1141655 1647 1411 1356 --11541 --
NM_018566chr184944 3795 3495 1980 1134 1045 610 174 13393 23324 1246 --
NM_018584chr131123 841 298 2911 209 --21079 468
NM_018602chr1551351 1235 1103 164 51 11621 ----
NM_018638chr1295687 5671 4931 4745 4348 4297 4227 4090 459 23747 231 ----
NM_018650chr122171 1685 1156 ----
NM_018652chr15------1231
NM_018682chr72535 208 --1481 1621
NM_018704chr121757 355 31592 1496 341 11743 1849
NM_018836chr1--183 --1225
NM_018837chr20--1689 --2941 849
NM_018844chr741959 454 138 22 --1182 --
NM_018898chr551793 696 543 354 41 2849 128 12278 11832
NM_018945chr653478 3418 2734 798 419 1448 2954 916 --
NM_018970chr772560 2504 2196 2162 545 208 142 1804 23095 453 --
NM_018976chr1242795 2605 851 111 21893 139 12406 --
NM_018993chr2071478 1333 1260 960 544 507 358 1308 11439 --
NM_018999chr10114919 4377 4073 3771 3523 1642 1535 837 798 343 177 44895 3395 1230 645 21753 495 23229 425
NM_019004chr711973 22403 2266 12243 --
NM_019022chr1832483 2152 1988 11064 13206 22909 2540
NM_019045chrX1653 1755 1845 --
NM_019050chr462211 1776 1721 1469 685 88 12116 32190 1730 1712 --
NM_019072chr554244 3847 1385 648 614 23823 2649 13602 --
NM_019080chr1331022 577 62 11144 31282 1048 353 11116
NM_019084chr1012507 --22542 69 --
NM_019091chr221037 870 144 1857 2189 120
NM_019094chr1223432 114 1179 52951 2701 2663 2521 92 1816
NM_019098chr851848 1625 655 439 63 11447 ----
NM_019106chr2242531 2510 1035 249 13305 13137 1587
NM_019116chr1673606 3282 1379 1358 983 432 211 23496 482 22963 413 --
NM_019555chr361615 1247 1241 1201 610 594 31505 1270 622 2567 420 --
NM_019556chrX21453 1198 1172 21486 124 21390 1232
NM_019593chr2053127 2915 2663 2649 2477 1997 1153 --
NM_019610chr151711 1680 738 705 260 2602 487 1778 12090
NM_019884chr191375 ------
NM_019885chr232452 2334 1958 --22752 2507 --
NM_020066chr14818 778 186 35 --2713 671 21033 231
NM_020116chr421175 251 ----11422
NM_020122chr264915 4072 3710 1299 386 90 53761 2125 2037 1145 248 12372 --
NM_020130chr8----1953 --
NM_020148chr18--53021 2952 2102 878 592 22595 1104 --
NM_020177chr573372 3061 2266 2235 1261 1018 504 --12917 --
NM_020182chr2043442 3032 803 750 --23107 559 1191
NM_020198chr1751573 1362 1348 1292 438 ------
NM_020199chr541270 1053 317 66 ------
NM_020214chr15----1240 --
NM_020311chr24762 711 639 203 --1669 --
NM_020337chr462913 2814 2690 863 501 257 --33167 2869 994 12949
NM_020338chr1053711 3362 3029 2708 2549 11140 13558 13099
NM_020341chr2031547 445 434 21708 84 12050 11884
NM_020346chr1171718 1601 1567 1301 1214 581 85 3364 173 123 193 1398
NM_020348chr1032067 830 292 --22778 2271 12647
NM_020383chr10------131
NM_020390chr344541 3364 746 48 34712 4175 3038 1148 --
NM_020403chr1371801 1380 1142 505 441 240 157 --21617 532 --
NM_020416chr462089 595 394 119 78 42 11737 21945 589 --
NM_020424chr165783 332 143 55 26 ------
NM_020426chr17----1216 --
NM_020432chr71588 --21412 606 12215
NM_020436chr20267 31 ----1189
NM_020437chr221310 1396 ----
NM_020440chr163182 2757 2704 1043 963 805 23241 2179 12972 11119
NM_020452chr11743 ----12127
NM_020453chr411964 --31734 1529 22 2265 246
NM_020463chr231266 1127 998 11501 1383 --
NM_020466chr654735 4549 518 320 277 1711 13175 21934 1707
NM_020526chr111235 11289 --11735
NM_020546chr542441 2292 1067 122 23048 1041 21212 630 --
NM_020640chr311550 12064 21791 442 --
NM_020651chr231804 616 609 11729 2531 371 1381
NM_020665chrX1115 --1462 1602
NM_020666chr51121 --190 --
NM_020673chr20147769 7757 7610 7542 7508 7134 4887 2865 2571 2084 933 881 304 199 27159 118 27654 330 --
NM_020699chr155401 4102 4010 3628 514 23658 1245 45418 3308 508 469 1939
NM_020718chr1655997 5946 4263 1255 32 16066 85072 4470 4458 4168 1724 1326 541 167 --
NM_020734chr1243393 2766 664 75 ----22741 36
NM_020742chrX52664 2194 1898 1040 572 2972 147 --1617
NM_020747chr51658 1902 1130 --
NM_020748chr1782046 2033 1866 525 510 504 415 393 1720 1591 21594 1494
NM_020752chr1032915 2907 2723 12609 32653 574 360 --
NM_020753chr17----1599 --
NM_020771chr631111 511 413 11538 11525 1553
NM_020772chr17128282 7661 7080 5520 5484 2846 1911 1885 1769 1130 1002 307 11346 --36834 6602 803
NM_020774chr1865707 5469 5017 1937 1301 136 1964 54293 1829 1571 935 316 25171 3966
NM_020783chr18102420 2406 2324 2223 2054 1835 1551 890 541 492 --31989 1487 79 1703
NM_020791chr17--1344 21082 141 --
NM_020794chr121526 413 11184 ----
NM_020795chr17----12043 --
NM_020796chr562963 2391 2081 1144 607 196 42498 1909 999 457 12878 12887
NM_020800chr311145 31514 149 137 --1388
NM_020801chr532529 1703 661 21926 1716 1288 --
NM_020805chr1831934 1908 632 ----21551 290
NM_020808chr12368 239 --1699 1404
NM_020810chr1432782 897 825 32946 2345 2219 ----
NM_020825chr1653340 2983 2430 1162 946 --33823 3717 806 12381
NM_020843chr151319 ------
NM_020858chr1572410 2374 2241 2144 2119 1961 65 22078 1578 22353 821 11813
NM_020860chr451056 907 798 740 43 11143 --1364
NM_020861chr621360 157 1434 ----
NM_020871chrX42575 2009 760 628 12175 1688 --
NM_020872chr321135 573 ----21324 1281
NM_020918chr1053353 3272 3055 669 197 13101 12344 13638
NM_020921chr1443626 2955 2447 917 23343 345 13642 --
NM_020927chr1632231 855 626 11573 2921 289 --
NM_020937chr142817 615 --188 --
NM_020959chr19--176 --1258
NM_020960chr964943 4848 4839 3996 3529 1206 45024 4886 3090 1898 35015 4749 3751 --
NM_020964chr1894834 4046 3849 1822 1458 743 367 274 130 21786 566 24517 1866 --
NM_020975chr1022062 2031 21918 1684 --11983
NM_021003chr141641 --3282 237 189 --
NM_021005chr151842 11096 1910 --
NM_021033chr1363493 3427 2764 2246 2201 1068 2657 77 --32149 920 86
NM_021038chr332381 2160 549 13119 --22579 1083
NM_021072chr552283 1985 1761 860 274 32032 914 147 1714 --
NM_021109chrX3397 92 84 ------
NM_021111chr941327 863 531 522 ----1919
NM_021116chr7129043 8408 8274 6463 6010 2748 2592 2180 1721 1386 1083 1076 38258 7068 1892 37476 3533 1924 --
NM_021132chr1021006 89 --1850 --
NM_021163chr772904 2765 2511 2362 1315 957 553 23234 1384 1755 1359
NM_021167chr732073 844 326 12761 12215 12057
NM_021183chrX52564 2536 2380 912 645 1944 11807 42495 547 481 98
NM_021201chr1141889 1663 589 391 ------
NM_021215chr2042031 1727 994 801 --2596 220 11717
NM_021239chr1421477 1050 2549 485 2302 177 1334
NM_021240chr9--1612 --1231
NM_021249chr14------1619
NM_021252chr1061934 1736 1337 781 192 92 --42017 1920 1890 1303 1137
NM_021255chr1473522 2898 1129 1032 313 242 82 13143 42660 2619 1383 1069 14017
NM_021572chr63868 308 188 ----21012 103
NM_021614chr5----171 --
NM_021619chr921263 1066 --11194 11102
NM_021627chr34835 198 186 173 --1372 11197
NM_021629chr393998 3977 1935 1564 1434 1098 993 390 92 ----14568
NM_021638chr474828 3786 3237 1976 1955 1612 1119 34361 4307 181 34896 3284 1721 14675
NM_021813chr685388 5317 5118 4549 4244 4076 1731 902 55780 4618 2008 1716 485 55876 5763 4763 4632 826 25654 4992
NM_021814chr661414 1151 1134 490 377 44 --21596 371 --
NM_021818chr1421403 30 --31395 1292 67 --
NM_021914chr1462424 833 518 413 322 269 11582 12382 1890
NM_021935chr34956 938 920 49 1997 1146 --
NM_021942chr43926 802 674 ----1908
NM_021943chr632183 1581 1553 11661 ----
NM_021950chr1111536 --1895 22237 600
NM_021951chr95916 765 752 667 163 1594 1634 --
NM_021956chr641201 978 515 159 41451 1163 553 94 ----
NM_021958chr1----1330 --
NM_021960chr131031 888 783 1427 1677 1690
NM_021961chr11207237 6803 6740 6675 6573 5969 5946 4894 4778 4575 2845 2444 1616 1112 1019 839 513 472 318 94 65808 5494 4826 4544 2892 1906 27404 6212 47265 7064 1672 223
NM_021964chr386388 5429 5331 5278 5082 4649 2290 73 46172 6042 4064 1072 15915 15641
NM_021977chr683612 3478 3174 2818 1411 1191 182 115 23905 3427 271 56 12484
NM_021998chrX21428 1121 11447 ----
NM_022039chr10------1605
NM_022041chr1682271 1987 1059 1032 671 641 621 407 22364 301 12540 12565
NM_022048chr1546261 6008 5742 4783 36173 4043 415 24914 4476 --
NM_022051chr1----1462 1680
NM_022058chr232034 788 703 1298 31681 336 176 --
NM_022090chr5------150
NM_022104chr20------1243
NM_022114chr174279 3024 1825 1422 945 745 464 13530 44621 4358 583 530 --
NM_022118chr13------185
NM_022130chr541271 1130 1083 557 ----11387
NM_022133chr821256 1237 191 ----
NM_022143chr721558 188 ----1468
NM_022145chr51685 --193 1129
NM_022150chr71498 1511 --1163
NM_022166chr16115938 5910 4715 4371 2505 2451 2063 2034 1890 1634 514 16338 25443 4801 36248 6160 3935
NM_022338chr11----1196 --
NM_022351chr873792 3313 3226 2620 825 406 239 139 33461 3215 389 --
NM_022374chr2----1163 --
NM_022459chr1375905 5389 2354 1496 1391 276 40 24555 1557 25296 4444 12140
NM_022465chr1233012 2690 2677 --12985 --
NM_022469chr172525 2237 2159 2102 1069 898 321 --1832 --
NM_022473chr1584055 3445 2777 1491 849 696 469 361 14365 34430 1658 1356 --
NM_022474chr1411946 ----12826
NM_022482chr2031821 121 94 42103 1923 1864 635 2793 329 21809 855
NM_022497chr333849 3318 2950 21479 150 ----
NM_022662chr2----1205 --
NM_022726chr641625 1542 629 545 --21702 1411 11136
NM_022739chr17------1466
NM_022756chr151390 1110 494 409 245 21482 1455 ----
NM_022763chr31402 1169 43138 3071 2099 318 --
NM_022771chr1241064 827 112 41 --1283 1919
NM_022780chr241851 1304 28 21 ------
NM_022782chr12----1365 --
NM_022828chr561702 1682 1504 1302 337 211 ------
NM_022832chr472555 2420 2385 2369 1861 512 490 12061 12180 --
NM_022843chr1351363 1176 1125 376 260 --2530 127 --
NM_022893chr242812 2747 2607 2422 22870 1051 12857 12121
NM_022894chr231663 1205 393 --21567 1229 --
NM_022898chr1484449 4435 4116 3953 3235 1433 246 155 23829 1647 43878 3653 3069 1219 --
NM_022902chr5162 --1333 --
NM_022912chr242334 449 443 407 33016 2057 587 1549 --
NM_022913chr5------170
NM_022918chr1142052 2005 1906 572 21938 1931 --11334
NM_023012chr121174 1642 1140 --
NM_023016chr292888 2228 2047 1894 596 416 341 66 26 22179 533 --12880
NM_023076chr1642138 1171 628 251 11866 1391 --
NM_024007chr5102338 2140 2112 1088 985 662 618 399 187 126 13143 2957 159 13128
NM_024095chr1231417 1038 627 ----1247
NM_024293chr2----1210 --
NM_024295chr84763 620 417 230 --22082 2052 21654 238
NM_024297chr17----1568 --
NM_024337chr5199 --1301 --
NM_024345chr9105250 4874 4703 2016 1493 1219 1053 695 590 214 24856 1384 35647 5353 2146 --
NM_024511chr453513 3220 2964 1379 262 1957 ----
NM_024524chr332685 2566 2553 --13182 --
NM_024539chrX41262 1218 459 441 2840 448 ----
NM_024557chr1121427 284 --11114 2398 180
NM_024561chr13--11381 11241 --
NM_024590chr441911 1570 1444 785 11309 1203 --
NM_024594chr541818 1539 762 285 11209 ----
NM_024613chr831376 1196 123 --1212 11157
NM_024629chr4----2757 93 1282
NM_024632chr5----198 --
NM_024646chr153609 3074 2450 1570 353 13364 33896 2686 401 --
NM_024665chr354660 4448 4131 3468 451 23260 3241 --14441
NM_024680chr114508 484 462 100 --1500 --
NM_024692chr241524 1406 1272 46 11224 11292 11508
NM_024700chr111082 --11203 --
NM_024769chr1121090 414 1204 1393 1979
NM_024814chr7--1378 --1279
NM_024817chr1585961 5073 4961 4810 4300 4174 1689 839 25120 4017 15877 --
NM_024818chr31986 11438 --21229 1201
NM_024828chr961251 1160 980 487 481 269 ------
NM_024834chr1041590 1584 1406 361 41869 1807 582 243 --21631 54
NM_024835chr17--1399 --1364
NM_024837chr1521905 641 21766 1228 1323 11918
NM_024841chr1122000 38 --2929 164 --
NM_024852chr1------1449
NM_024884chr1444290 4141 3629 1610 13650 24274 874 13467
NM_024900chr462320 2310 2216 1434 235 23 1157 ----
NM_024913chr731760 1539 1424 ------
NM_024949chr414413 24863 3197 1167 1289
NM_024953chr1222627 737 12132 --12113
NM_024989chr2128021 7844 5104 3140 2759 2274 1354 1299 741 357 345 149 25534 617 27778 5224 --
NM_024993chr231210 1172 357 --1474 --
NM_025010chr3------22558 755
NM_025045chr22----1371 --
NM_025054chr884182 2883 1324 1152 988 504 434 271 54059 4013 3088 1312 601 34161 2640 777 43898 3786 3401 763
NM_025132chr4----1276 --
NM_025134chr1692521 2445 2314 2258 2244 1818 1030 310 133 31597 929 223 165 --
NM_025146chr32537 257 --32165 2155 1882 --
NM_025164chr1121351 795 11776 22057 53 --
NM_025176chr202730 669 1629 1571 1202
NM_025191chr173553 2904 2837 2798 2342 774 293 13468 13533 --
NM_025235chr1072187 1943 1641 1545 1527 451 405 ----1398
NM_025237chr1721258 1059 11503 1104 1553
NM_030571chr541631 1011 387 243 51254 544 192 172 90 ----
NM_030621chr14114226 4180 4034 3995 3390 2766 2703 2635 1201 1043 796 34172 3584 2741 23869 2794 --
NM_030623chr241695 1408 1392 344 --11736 --
NM_030625chr1052358 1981 1674 1648 826 52121 1794 1605 558 366 1606 11731
NM_030627chr5124137 3649 3557 3433 3253 3155 3118 2652 1252 1242 1162 182 43241 3234 3125 762 34093 3459 1207 --
NM_030647chr786111 5132 4737 4575 1892 1061 1001 762 35467 5211 4942 --15371
NM_030648chr4175603 5553 5302 4462 4208 4076 3961 3804 1736 1697 1113 886 820 745 499 389 199 25507 1237 11148 13791
NM_030763chrX----152 --
NM_030768chr2----1109 --
NM_030806chr1169063 8923 8560 8096 7688 7547 6055 5899 5858 1928 1621 1021 688 665 244 42 48976 2320 1517 827 33027 169 73 27971 2876
NM_030811chr20----1361 --
NM_030820chr61974 1931 1236 --
NM_030918chr145442 4184 3500 2138 44366 3661 1202 80 13508 --
NM_030920chr131967 1491 709 11598 ----
NM_030962chr1131549 467 138 ----11492
NM_030964chr533679 2471 1222 11478 12364 --
NM_030979chr131166 1110 --189
NM_031217chr111482 --1509 --
NM_031296chr432341 2248 2058 --12690 12456
NM_031372chr42609 52 1316 --1104
NM_031418chr1182674 2388 2229 998 907 724 350 223 ----12323
NM_031435chr1222605 1285 12927 --33116 703 582
NM_031439chr811186 --11937 11721
NM_031442chrX83148 2730 2716 2522 2309 2026 772 229 11154 11188 --
NM_031476chr1632769 2127 1012 11819 22727 885 11850
NM_031483chr20102745 2620 2555 2474 2347 629 432 347 192 44 --12630 181
NM_031890chr221525 22401 1203 --1831
NM_031911chr442213 2191 2083 794 --12567 --
NM_032042chr552833 2359 2262 882 598 11844 12247 --
NM_032048chr182631 560 1424 --143
NM_032102chr1152625 642 636 445 210 12581 2851 771 --
NM_032109chr511521 ----11068
NM_032121chrX22113 717 --12363 22221 286
NM_032124chr1821098 200 2976 791 --1879
NM_032144chr251656 1577 1451 1356 432 --21505 1437 --
NM_032153chr392701 2489 2452 2134 1747 1736 947 486 154 12361 22687 2312 --
NM_032172chr71998 21014 371 1664 1241
NM_032192chr17----1756 --
NM_032199chr1073446 3076 2897 2823 855 738 675 --13591 --
NM_032208chr253141 2437 2349 574 340 43316 2646 551 272 23336 610 --
NM_032217chr441252 350 308 26 11415 --1130
NM_032228chr1153181 2635 2463 1021 985 163 22688 2393 --
NM_032229chr132813 230 --3925 869 63 --
NM_032239chr4--2592 224 --1965
NM_032291chr161985 1779 688 679 662 333 21821 720 21251 241 11338
NM_032334chr8----194 --
NM_032373chr10125595 5173 4826 4591 4110 1256 1215 927 543 368 242 117 11617 35688 5496 1953 15739
NM_032379chr111799 2858 132 --1876
NM_032410chr81312 --21205 1157 --
NM_032431chr11----11041 --
NM_032440chr1062706 2422 2189 2045 945 432 --22594 114 11033
NM_032446chr563711 3552 3240 931 313 259 1911 1897 43329 2514 678 289
NM_032456chr43541 461 29 1553 2667 148 --
NM_032457chr463925 3895 3707 2925 1533 642 12654 1313 --
NM_032458chrX72430 1088 726 546 425 231 187 12534 33293 2843 2465 --
NM_032547chr441412 1359 1111 198 1999 --1472
NM_032558chr911300 --21261 243 --
NM_032581chr751520 1313 569 331 165 ----11841
NM_032582chr1751904 1764 1368 497 244 --21834 1560 --
NM_032583chr16----1322 1343
NM_032590chr1241032 979 736 361 1469 21002 124 --
NM_032682chr352860 1446 1363 1054 395 --1293 33218 2879 1241
NM_032717chr43750 207 186 1421 11022 1247
NM_032784chr62776 375 --1881 --
NM_032801chr1142164 1900 809 532 ----1574
NM_032804chr1032233 1906 792 32400 986 926 1775 --
NM_032825chr19--1132 2411 68 123
NM_032842chr731401 1221 328 --11468 1167
NM_032860chr61181 --1173 --
NM_032866chr1553156 2826 2584 1138 191 12982 1488 --
NM_032869chr831364 190 169 1785 --11572
NM_032873chr1184511 4008 3709 3530 1447 1385 941 158 21427 356 44441 4114 4002 980 23216 783
NM_032951chr7----1632 --
NM_032968chrX123978 3799 3217 1646 1638 1596 1242 1209 789 551 173 107 23749 2823 195 --
NM_032973chrY103791 3212 1640 1595 1242 1209 789 551 173 107 23741 2818 195 --
NM_033055chr111120 ----31001 438 410
NM_033081chr202936 136 21351 1091 1294 --
NM_033103chr191124 --1250 --
NM_033121chr1251843 1807 272 208 137 1146 3735 414 370 --
NM_033132chr1331927 627 253 1809 1539 1603
NM_033211chr531828 1638 214 1644 ----
NM_033224chr7108086 7574 7436 5294 4886 2913 2736 2517 2323 222 48104 7929 3027 1916 48042 7461 2450 2059 56405 6335 6197 2957 2275
NM_033225chr842406 2152 1119 604 53041 2898 2756 2255 1043 12767 22943 1022
NM_033254chr3--1545 1131 --
NM_033274chr583640 3363 3233 2955 2781 2538 724 50 13568 23047 1433 32472 2450 362
NM_033285chr884430 3736 3440 3152 3024 2942 1078 710 ----12933
NM_033389chr1764854 4407 3893 3747 1268 616 23576 1933 34180 3331 1763 2902 45
NM_033393chr462859 2843 2343 2067 740 303 --1695 12185
NM_033394chr221391 522 --11195 11368
NM_033407chr1131 1620 --1592
NM_033426chr1432732 2698 2338 ----12919
NM_033427chr71263 1651 1148 --
NM_033505chr2116748 5891 5791 5611 5232 1651 838 822 669 398 34 34993 4197 1642 21569 48 26453 1448
NM_033631chr152636 2540 1065 731 642 11451 --12623
NM_033656chr2166002 5260 4291 3835 3654 812 15994 11002 11980
NM_044472chr11669 ----1270
NM_052832chr842611 2508 2238 2081 1219 --1386
NM_052855chr17----2661 611 --
NM_052867chr1311402 11010 --11516
NM_052879chr1263843 2606 1645 1575 1518 948 23080 416 33060 495 287 22862 682
NM_052896chr132451 2351 238 2581 562 22401 2072 --
NM_052898chr851807 1509 1472 1315 453 --21686 691 11669
NM_052900chr841811 1793 1242 657 --21747 1511 21843 1781
NM_052905chr25702 659 513 446 280 --31413 1209 352 --
NM_052907chr1253901 3810 3179 1052 267 14015 13949 --
NM_052910chr1342091 2027 1532 732 --1477 --
NM_052951chr20----1180 --
NM_052962chr631269 593 222 11717 1180 --
NM_053023chr1153307 3147 2489 2479 2256 13220 ----
NM_057175chr462435 2125 1785 1021 734 686 2962 780 ----
NM_058170chr141558 1192 1012 587 11142 1127 1279
NM_058229chr81229 --185 --
NM_078483chr543668 2598 1636 1482 23345 967 --13907
NM_080546chr942243 1789 1705 713 11583 1848 --
NM_080607chr20----1921 --
NM_080872chr883734 3660 3446 3254 3180 2794 896 706 --23826 2726 22888 453
NM_080927chr382757 2651 2451 920 862 795 570 517 13017 --13294
NM_130469chr14----1927 --
NM_130809chr543135 2885 2846 300 11244 13127 12173
NM_133264chr1733682 3234 1075 12614 13457 12803
NM_133265chrX63120 2342 1368 1152 833 23 22567 546 1967 13506
NM_133334chr476386 6212 5507 2245 1584 1235 354 22414 2156 25283 927 --
NM_133369chr51988 ------
NM_133433chr51808 1693 --1647
NM_133445chr973652 2997 2728 2391 2355 77 64 --12336 12759
NM_133496chr123815 1628 34231 4017 1019 43838 1754 1223 566 --
NM_138285chr21216 ------
NM_138288chr1422123 841 --1444 --
NM_138290chr7----139 --
NM_138333chr942268 840 789 30 12466 --12408
NM_138423chr15--31964 1710 41 2104 82 --
NM_138426chr712307 1446 1870 1200
NM_138453chr5----161 --
NM_138455chr8----1341 --
NM_138468chr2134654 4577 4092 3939 2405 1743 1577 1381 416 263 194 82 48 1714 15961 16311
NM_138694chr663731 3448 3437 3399 1121 200 23411 696 11434 --
NM_138782chr542385 2318 1919 895 22159 537 52356 2261 905 645 198 --
NM_138799chr252049 1649 1501 610 480 --11565 --
NM_138811chr73977 849 440 ----140
NM_138927chr21--2267 253 2762 224 --
NM_138959chr176816 6581 6457 2372 2357 1647 268 46784 6402 5227 4703 26573 2312 11620
NM_139279chr263517 3308 3037 2681 1087 876 3966 760 76 13505 13458
NM_139321chr2054034 3344 2811 926 634 23525 350 14054 24131 874
NM_144567chr142088 641 238 60 --1380 1228
NM_144571chr4117039 6260 5833 4812 4503 2454 2114 2036 1901 1804 1044 26768 6305 36284 2410 57 12694
NM_144578chr14105402 4997 4725 4591 4456 4343 3489 1948 1058 703 15464 34775 4134 1167 --
NM_144599chr15105471 5032 4805 4547 4428 2113 1531 1464 998 846 35343 5314 1589 13522 14882
NM_144635chr3----11299 --
NM_144658chrX2340 63 1299 ----
NM_144664chr1172445 2236 1897 1848 536 138 38 --32134 1744 262 2651 168
NM_144665chr11135 ----1209
NM_144703chr2051217 1198 1192 934 871 11113 --1288
NM_144718chr362136 1986 1928 1893 1807 643 --12528 --
NM_144778chr1372727 2687 2228 2045 1868 1050 1015 1348 ----
NM_144973chr1284218 4081 3650 1839 1058 840 372 223 11147 --14026
NM_145048chr42853 250 --2776 88 1273
NM_145115chr7165 21867 728 11625 11550
NM_145206chr1053167 2670 2540 894 142 22275 152 22630 535 1853
NM_145251chr1431534 362 295 175 1280 --
NM_145284chrX42540 2233 1742 662 ----11907
NM_145307chr1034272 3512 599 23368 218 22863 1120 21239 188
NM_145332chr64898 740 387 182 195 ----
NM_145753chr371556 1485 1403 1355 653 570 113 --21599 449 1155
NM_145808chr762895 2709 2565 2132 1069 422 22911 1243 32949 2183 2031 13136
NM_145891chr1651383 1085 645 320 67 11285 --1432
NM_147156chr10--21185 585 11445 21384 553
NM_152271chr831069 984 151 --21083 467 11131
NM_152275chr23532 383 118 ----12150
NM_152277chr521615 315 --12088 --
NM_152280chr172558 2488 2352 1378 1235 931 163 22687 782 2667 203 13501
NM_152295chr5--1358 1293 --
NM_152381chr261930 1651 731 532 82 27 41831 648 224 170 --1235
NM_152384chr242007 1956 311 119 --1653 --
NM_152409chr531116 570 463 33608 1439 1350 12692 --
NM_152423chrX21559 272 1129 --21569 1198
NM_152444chr141800 1456 31189 775 249 --
NM_152450chr1532148 1612 537 --2625 520 --
NM_152470chr1884141 4050 3503 3482 3377 1112 115 67 11092 14089 --
NM_152586chr1021001 278 --11051 145
NM_152588chr1241579 1494 1337 237 --11764 --
NM_152594chr1522052 664 11672 --1221
NM_152622chr583105 2735 2590 2325 841 665 557 416 12450 1901 22305 1399
NM_152638chr121115 ------
NM_152641chr1282692 2654 2387 1015 819 802 790 737 22569 1931 21067 617 1343
NM_152667chr202485 169 --11364 --
NM_152678chr352597 2499 2277 1979 995 --21890 323 12489
NM_152688chr6------1723
NM_152754chr773862 3590 1403 1383 978 824 293 21435 1303 22839 253 13001
NM_152756chr5113982 3880 3728 1485 1457 1445 1237 931 791 668 541 2350 263 33282 2655 1281 13969
NM_152758chr882862 2729 2054 2036 972 854 304 261 ----12261
NM_152772chr12----1294 --
NM_152774chr792138 2028 952 787 741 671 475 366 331 --1522 --
NM_152787chrX73238 3126 2696 952 893 538 383 23961 3768 33820 3545 2782 22984 2904
NM_152835chr132912 618 211 22038 743 22742 394 --
NM_152857chr61145 1159 --1749
NM_152890chr12336 52 --1936 1816
NM_153020chr631670 1486 292 11171 ----
NM_153026chr121118 --1357 --
NM_153035chr11998 12856 32916 2785 136 11177
NM_153042chr621765 142 21834 1543 ----
NM_153183chrX2852 381 1969 1863 --
NM_153207chr1272939 2746 2644 1109 675 616 160 23397 1473 21442 1090 1559
NM_153223chr561598 1349 516 432 406 196 --21579 481 158
NM_153234chr572101 810 738 626 525 486 68 --1766 --
NM_153261chr1661577 1295 548 338 240 100 --2328 252 --
NM_153262chr161274 1140 864 600 434 363 13023 22475 722 11246
NM_153267chr91375 --1708 1147
NM_153354chr51683 --1803 1913
NM_153365chr442384 2097 2004 924 --11898 --
NM_153374chr15------1493
NM_153607chr572452 2342 2078 1952 893 573 99 12984 22268 60 --
NM_153613chr15------1159
NM_153634chr122472 172 --21114 533 --
NM_153686chr431981 1958 793 --2341 199 1380
NM_153689chr232261 590 242 11662 1493 --
NM_153810chr1053880 3252 622 153 55 13773 13421 23314 1520
NM_170665chr12104536 4384 4228 4209 3026 1639 1134 1056 766 236 44171 4100 3020 675 --23860 1126
NM_170746chr11------1168
NM_171998chrX22393 688 1537 --11946
NM_172037chr831212 1097 146 --41382 1335 1280 464 --
NM_172071chr186650 6581 6563 5421 2932 2784 1851 229 14661 47434 7379 4831 1155 14648
NM_172373chr1341216 1173 107 61 1424 1330 --
NM_173075chr4--1475 1252 --
NM_173078chrX3452 438 142 1308 1333 --
NM_173083chr131316 1248 344 21236 925 --1991
NM_173172chr231611 1226 1200 197 1109 11138
NM_173355chr2255 36 ----2712 163
NM_173465chr5------159
NM_173468chr495985 5885 5740 5069 4621 2006 1289 488 21 4858 766 412 286 24914 568 15366
NM_173469chr152371 63 1621 31549 1517 1209 --
NM_173470chrX32482 687 395 2804 719 --1260
NM_173473chr1042278 1977 1915 41 --1437 1608
NM_173496chr1021994 784 1888 21949 1097 --
NM_173500chr1521212 945 183 11325 1111
NM_173510chr2252667 2515 1887 1863 528 12747 11954 12338
NM_173511chr222640 2621 23464 397 13583 13658
NM_173552chr342071 1865 632 192 ----22079 762
NM_173582chr1152289 2262 1975 1455 1017 25078 2222 1779 --
NM_173602chr1232697 2404 1491 23456 532 11021 --
NM_173626chr172744 32 ----2569 547
NM_173630chr18------1298
NM_173683chr841442 1252 1098 234 1519 11691 165
NM_173825chr342205 1951 298 244 43106 2803 489 232 1576 --
NM_173827chr463194 2861 2839 2823 812 32 --12312 22727 650
NM_173851chr851452 1406 1177 276 223 1815 13644 --
NM_174907chr3------1115
NM_174916chr1572365 1530 883 814 769 687 436 1827 11984 32358 935 455
NM_175056chr342119 1355 807 775 12188 ----
NM_175061chr732184 864 378 11848 1613 --
NM_175085chr212628 606 ----1734
NM_175607chr341665 1345 1152 524 41595 1485 1083 354 21739 445 --
NM_175747chr63781 698 441 1431 1357 1879
NM_175854chr1352132 1082 779 530 514 11772 22624 369 1423
NM_175907chr1832810 2013 1936 12246 22443 2059 --
NM_176814chr721025 535 1990 ----
NM_177424chr132002 1893 1632 ------
NM_177538chr2168807 8078 7970 7705 7246 6911 6729 3129 2384 2347 2069 1735 1673 1019 598 100 --28177 132 26516 334
NM_177968chr252116 1490 783 580 452 11582 ----
NM_178011chr1072250 2173 2045 628 466 189 42 53232 2155 1064 530 288 32220 2192 323 --
NM_178140chr552745 2643 1889 658 451 ----12513
NM_178509chr1743975 3512 1136 300 ----1153
NM_178554chr332929 707 246 11364 42349 2227 423 262 --
NM_178566chr931806 1233 720 11345 21552 1260 --
NM_178812chr851223 1186 1163 1063 518 --135 --
NM_178839chr2--1303 1339 --
NM_178868chr3--153 1301 1348
NM_180989chr1322056 685 11678 11526 --
NM_181077chr1531887 510 371 ----1155
NM_181354chr82624 569 11189 21598 1271 --
NM_181358chr1114259 4063 4057 3902 3113 2924 2612 1525 1471 1327 1229 44158 4085 3635 911 --21177 623
NM_181457chr231292 501 457 11337 --11320
NM_181503chr13------134
NM_181504chr554061 3215 2992 1370 509 2295 101 --12537
NM_181521chr1696423 6398 4564 2771 2477 2142 1386 957 308 36286 2109 1492 56694 5386 2283 1803 749 --
NM_181670chr12--2503 470 --11020
NM_181704chr2151284 451 337 319 180 ------
NM_181704chr2151284 451 337 319 180 ------
NM_181705chr5105796 5684 5062 4429 4355 4034 2060 1655 1038 78 33682 3597 885 13669 11025
NM_181714chr621622 797 11607 31587 676 33 --
NM_181723chr831898 1759 770 --12293 1926
NM_181784chr232630 2235 1735 22525 695 1944 --
NM_181836chr542188 2075 1731 689 21774 654 42535 1699 1651 179 --
NM_182485chr4133733 3464 3438 3361 3120 3082 2996 2981 1022 1003 935 623 269 21264 81 33025 806 675 1526
NM_182503chr695488 4011 3901 3552 2083 1551 1509 1163 435 1950 24278 186 14742
NM_182569chr17----1205 --
NM_182663chr171496 1479 1463 882 459 269 66 ----12293
NM_182664chr161626 1609 1593 589 399 196 163 --12423
NM_182691chr781422 1393 1359 1139 989 493 480 335 ------
NM_182700chr771973 1870 1853 1525 1479 714 256 --21844 168 11256
NM_182717chr101325 3605 303 220 --11067
NM_182765chr1031794 1669 550 --1472 --
NM_182767chr122812 716 3658 527 193 1204 --
NM_182830chr1442008 1772 1650 437 42019 1963 1431 889 31688 1496 65 --
NM_194247chr294288 4073 3712 2795 886 641 552 531 335 22924 112 --23561 213
NM_194250chr23439 415 161 --1310 --
NM_194282chr422803 413 53108 2447 2385 1961 886 --22330 2035
NM_194286chr1245978 5384 2480 1885 35299 5269 1819 25114 4727 25444 4264
NM_194292chr131721 1661 1650 11668 41584 1431 1405 1222 --
NM_194294chr84778 768 634 28 1252 1623 1694
NM_194318chr1332444 736 347 ------
NM_197941chr563010 2987 2149 1044 764 715 21006 821 22924 97 --
NM_198215chr10----11440 11068
NM_198270chrX83510 3335 3318 3283 2394 758 481 453 --23293 2294 --
NM_198279chrX11017 --1826 1227
NM_198401chr851531 1104 1074 500 135 11652 31633 1481 656 21443 427
NM_198463chr33349 335 301 --1141 --
NM_198507chr51144 1405 --1528
NM_198513chr851983 1407 551 385 364 --11444 --
NM_198581chr256133 2259 2050 564 64 1469 37507 6252 252 --
NM_198859chr394823 4170 3590 3516 2047 1797 461 426 48 25116 4190 55157 3917 2013 782 415 --
NM_198935chr20--12797 12160 22408 1159
NM_198965chr12399 90 36 1415 1439 --
NM_198991chr18--3243 197 23 1551 --
NM_199000chr732275 2132 1940 22308 332 1356 --
NM_199247chr17------192
NM_199320chr492958 2684 2321 1844 1101 554 219 188 122 12140 12572 --
NM_201435chr122524 309 --1730 --
NM_203390chr84670 618 138 38 2551 446 1175 --
NM_203394chr1252679 2663 2483 690 71 22153 512 --22395 921
NM_203406chr552645 2493 713 453 232 --1612 1977
NM_203434chr91276 --1202 21089 158
NM_203459chr122145 148 42572 2113 1953 171 1671 1587
NM_203463chr284041 3891 3099 1921 1869 1783 1617 1003 21529 437 3719 276 68 --
NM_206853chr653959 2886 886 740 270 44027 3990 2721 426 34130 3807 516 23717 1192
NM_207015chr342306 661 212 150 1396 11757 --
NM_207321chr104957 916 391 105 --2895 270 --
NM_207372chr1042404 2391 1736 691 1749 1441 --
NM_207406chr485884 4919 4829 4617 4466 4373 2197 566 45666 4766 4759 4722 14511 --
NM_207429chr1162226 2086 2074 1004 994 113 ------
NM_207645chr1111294 --1178 11063
NM_212554chr102323 175 11627 ----
NM_212558chr9124066 4046 3796 3482 3284 3116 2929 2640 1701 1047 346 154 ----1284
NM_213589chr2105546 5512 5354 4806 4712 4416 4018 3892 1613 1574 24288 1621 24780 4274 14883