TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4511
miRNA Sequence: GAAGAACUGUUGCAUUUGCCCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5------11238
NM_000037chr822400 390 ------
NM_000038chr531534 421 130 ------
NM_000045chr62114 98 ------
NM_000052chrX63393 3314 2799 2177 652 485 ------
NM_000081chr13239 181 69 --1604 --
NM_000084chrX45093 2709 2357 1433 26158 1880 11892 12172
NM_000088chr171549 11358 11285 1174
NM_000092chr254266 3933 3493 3212 1689 ------
NM_000093chr932429 576 567 1485 22508 838 --
NM_000096chr31952 ------
NM_000109chrX52588 2416 2300 2118 666 1121 --12512
NM_000112chr5125291 4743 4465 3861 3699 1698 1688 1165 1127 869 502 494 13880 24416 4205 1542
NM_000117chrX2292 112 ------
NM_000125chr622953 1095 23711 806 --1160
NM_000142chr411362 ----11308
NM_000151chr1731782 1692 423 ----1670
NM_000163chr51698 1311 ----
NM_000168chr762849 681 488 212 88 80 ------
NM_000173chr171416 ------
NM_000176chr513297 --13722 --
NM_000189chr241754 1511 1503 245 --1815 1733
NM_000192chr1251333 1323 1315 1177 360 ------
NM_000208chr1974129 994 724 504 495 469 277 23452 327 ----
NM_000210chr222299 322 22228 1880 ----
NM_000214chr2081691 1559 1471 711 415 380 349 121 --152 --
NM_000216chrX73383 3091 2847 2625 1190 470 312 13129 ----
NM_000217chr1275299 4011 3705 3645 1949 1486 1294 ------
NM_000222chr432123 1845 1663 1610 ----
NM_000232chr453023 2999 2078 772 540 32130 273 72 22100 1275 --
NM_000240chrX32011 1522 1456 1318 ----
NM_000245chr72528 49 ------
NM_000248chr383082 3054 2209 1980 1142 1005 951 708 22761 2234 1736 --
NM_000251chr2157 ------
NM_000252chrX21118 1030 --2568 249 --
NM_000259chr1585994 5587 4989 4910 1707 1688 1594 730 --12255 26080 1440
NM_000276chrX31898 226 113 ------
NM_000280chr1151011 905 404 347 122 1818 ----
NM_000297chr411851 --21653 1597 --
NM_000304chr1721067 331 ------
NM_000310chr121233 258 ------
NM_000314chr1072849 2328 2154 1223 1128 1002 297 ------
NM_000321chr13185 1386 --11583
NM_000325chr41546 ------
NM_000327chr11----1269 --
NM_000328chrX1150 --1374 1304
NM_000332chr6126472 6405 5747 5273 4385 2731 2696 2484 2472 2033 1793 1495 26379 4773 15988 21955 1576
NM_000333chr361112 1043 914 790 304 293 --1287 --
NM_000337chr596002 5827 5262 4650 2325 2125 1732 1090 628 15089 ----
NM_000346chr1761737 1391 680 125 107 99 11262 11278 --
NM_000351chrX64038 3798 2916 1084 1047 888 13183 11642 --
NM_000368chr984550 3902 3563 2969 1071 630 608 163 --13034 --
NM_000390chrX33418 2681 592 22674 1025 ----
NM_000393chr232007 1565 195 ----12129
NM_000397chrX52397 1763 901 721 630 12374 12407 1418
NM_000408chr253333 1386 1371 323 252 33187 2940 914 ----
NM_000430chr1781508 1191 1030 982 936 885 876 347 ------
NM_000439chr582381 2202 968 962 956 748 436 250 ------
NM_000448chr1172865 2690 2521 2368 2355 2313 29 ------
NM_000459chr92853 847 ------
NM_000461chr354326 4276 3651 3297 1622 --23505 895 --
NM_000462chr1531715 585 302 ------
NM_000489chrX143459 2878 2736 2433 2298 2238 1347 1276 1233 1161 1112 897 495 134 12524 --1413
NM_000492chr721412 1075 --1129 --
NM_000495chrX11121 2849 421 1875 --
NM_000503chr831770 1203 664 --11710 --
NM_000509chr41147 ------
NM_000523chr24357 223 190 131 2252 237 ----
NM_000530chr1--1972 ----
NM_000555chrX67831 7247 6697 6157 4761 1388 16741 26685 1175 1107
NM_000582chr41364 ------
NM_000589chr5----122 --
NM_000598chr721114 154 ----11486
NM_000600chr7--1396 ----
NM_000609chr1043150 1906 1159 832 11167 ----
NM_000610chr11102953 2861 2664 894 887 880 874 576 158 144 ------
NM_000633chr1854997 4918 4310 4083 1833 23719 1842 14821 --
NM_000663chr1642847 2419 2298 291 --12508 --
NM_000668chr42539 426 ------
NM_000701chr11247 1230 ----
NM_000718chr9161 ------
NM_000719chr1255449 4334 1797 955 765 ------
NM_000726chr2--11179 11376 --
NM_000739chr7176 ------
NM_000756chr81322 ------
NM_000767chr1941207 969 232 226 ------
NM_000783chr10------154
NM_000788chr471315 1219 1078 960 505 187 114 ----1105
NM_000801chr2041093 948 742 34 ------
NM_000806chr521782 493 ------
NM_000809chr4168921 7446 6811 5929 3502 3400 3294 2689 2247 2153 1720 1503 1277 1246 1232 184 46990 3213 1648 65 11289 15717
NM_000812chr42141 50 ------
NM_000813chr5115284 5256 5131 5125 5119 4954 4878 4498 1983 1051 879 1922 14123 13634
NM_000814chr1514116 13342 1314 172
NM_000817chr241180 792 387 182 ------
NM_000826chr422323 1894 22633 2116 --11963
NM_000827chr572582 2561 2554 2427 471 408 196 ------
NM_000829chr1131581 930 229 --1348 --
NM_000840chr7--132 2371 23 --
NM_000842chr111509 ------
NM_000844chr31969 ------
NM_000859chr581351 1113 647 486 319 165 138 42 ------
NM_000868chrX52303 1916 1043 503 179 1118 ----
NM_000872chr1011020 ------
NM_000875chr15126906 6755 6491 5932 5452 5300 4880 2600 2447 1289 1164 74 14727 12584 --
NM_000880chr8----175 --
NM_000891chr1773314 3128 2656 2425 651 435 260 43231 2456 344 241 13421 --
NM_000895chr121101 ------
NM_000899chr1264242 3846 3274 2934 1496 131 13957 11389 --
NM_000901chr441603 1587 315 167 182 12023 12209
NM_000903chr1661434 1196 1174 308 261 96 ----182
NM_000912chr823463 3143 1637 2670 31 13178
NM_000917chr106939 762 709 315 217 169 ------
NM_000922chr11--1798 ----
NM_000935chr33832 805 790 11174 ----
NM_000944chr44938 786 730 95 ------
NM_000945chr231938 1577 468 --22025 734 --
NM_000950chrX93638 3512 3166 2653 2538 2440 2270 2232 148 11208 ----
NM_000958chr541247 1163 991 266 ------
NM_000959chr143065 2886 666 194 13914 11313 --
NM_000963chr132355 1673 246 ----2349 213
NM_000964chr1721407 940 1518 ----
NM_000965chr331140 357 135 --2864 92 --
NM_000966chr1221075 133 ------
NM_000975chr1137 ------
NM_000983chr121604 606 11080 135 --
NM_000990chr11103773 2652 2610 1043 1035 692 417 402 110 65 14050 23645 932 --
NM_001001132chr212953 329 ------
NM_001001323chr1232987 2447 1267 12839 ----
NM_001001330chr102869 195 1149 2527 505 --
NM_001001331chr362414 2302 2278 1687 389 368 12690 1475 --
NM_001001342chr1051201 1016 466 395 369 ------
NM_001001389chr11102953 2861 2664 894 887 880 874 576 158 144 ------
NM_001001390chr11102953 2861 2664 894 887 880 874 576 158 144 ------
NM_001001391chr11102953 2861 2664 894 887 880 874 576 158 144 ------
NM_001001392chr11102999 2907 2710 940 933 926 920 622 204 190 ------
NM_001001395chr1241819 617 334 251 12830 ----
NM_001001396chr184413 4051 3520 3391 3272 2832 2762 756 34333 3249 1111 33288 2845 845 11170
NM_001001419chr5105208 4545 3994 1754 1089 1010 622 579 515 383 --44748 4217 2093 1786 24567 872
NM_001001420chr5105208 4545 3994 1754 1089 1010 622 579 515 383 --44748 4217 2093 1786 24567 872
NM_001001433chr2062598 2021 671 253 194 188 1427 ----
NM_001001481chr853495 3381 2927 1331 382 --42204 1370 1235 1049 12894
NM_001001484chr1061990 1552 1528 868 418 293 ------
NM_001001520chr192186 128 ------
NM_001001549chr742882 2514 2112 485 11763 ----
NM_001001550chr742882 2514 2112 485 11763 ----
NM_001001555chr742882 2514 2112 485 11763 ----
NM_001001557chr811649 21340 495 22083 1656 --
NM_001001664chr253897 2499 1218 481 428 24041 1389 23975 1325 --
NM_001001701chr452226 2182 1791 496 36 21507 400 --1205
NM_001001715chr13------2460 409
NM_001001872chr141601 ------
NM_001001890chr214868 698 678 640 43428 3266 1019 544 22940 2754 --
NM_001001928chr2288335 7683 5830 3173 1928 1404 932 37 26096 1169 11490 --
NM_001001937chr18137 ------
NM_001001938chr941575 1520 1066 634 1369 1115 --
NM_001001971chr10182 1130 ----
NM_001001974chr1031497 903 763 194 ----
NM_001001992chr21--1194 ----
NM_001001995chrX21813 1696 ------
NM_001002026chr311615 12348 ----
NM_001002257chr253528 3498 1384 1104 919 --12581 12749
NM_001002259chr121104 ------
NM_001002295chr103918 438 112 ------
NM_001002759chr104524 508 493 480 ------
NM_001002762chr1042418 2221 1801 934 12720 12256 --
NM_001002838chrX61729 1502 1276 218 88 34 11546 ----
NM_001002843chr15----21285 1087 1209
NM_001002860chr1484151 3799 3358 3082 1534 1179 461 179 --1129 11577
NM_001002909chr171131 ------
NM_001003396chr6129 ------
NM_001003397chr6129 ------
NM_001003407chr1064855 4713 3585 3480 3460 1059 34362 3379 1019 54800 3575 3239 1698 947 13971
NM_001003408chr1064855 4713 3585 3480 3460 1059 34362 3379 1019 54800 3575 3239 1698 947 13971
NM_001003652chr18228690 8541 8365 8296 7623 7429 6762 6633 6545 6212 6200 6072 3448 3066 2767 2620 2147 1594 1048 675 665 658 46249 5311 1363 1224 57877 7564 6306 6150 1327 17297
NM_001003656chr10--1579 ----
NM_001003674chr18105434 4725 4373 2451 2438 2155 1980 1571 1167 634 37045 5734 4977 14836 36951 6153 5926
NM_001003675chr18105434 4725 4373 2451 2438 2155 1980 1571 1167 634 37045 5734 4977 14836 36951 6153 5926
NM_001003681chr2232056 1653 659 11429 --12033
NM_001003688chr41844 ----1961
NM_001003712chr1273845 3091 1349 1090 886 805 433 11236 1629 13508
NM_001003792chr32473 125 ----2982 166
NM_001003793chr32473 125 ----2982 166
NM_001003810chr42333 176 --1634 --
NM_001003940chr1553818 2456 1518 358 97 22475 559 ----
NM_001003942chr1553818 2456 1518 358 97 22475 559 ----
NM_001003943chr1553822 2460 1522 362 101 22479 563 ----
NM_001004065chr953821 2804 2789 2469 1523 --33048 2607 633 14011
NM_001004106chr521014 66 ------
NM_001004127chr131688 ------
NM_001004304chr1263094 3087 2148 926 385 379 1505 --23171 214
NM_001004317chr663534 1360 567 434 412 22 44346 4252 1021 553 ----
NM_001004342chr156069 5157 5036 3777 1606 14265 --2912 905
NM_001004346chr42186 155 11138 ----
NM_001004360chr221828 250 1526 11925 --
NM_001004419chr1254312 4090 1564 1325 1274 ----11606
NM_001004441chr531500 640 363 ------
NM_001004720chr2----11063 --
NM_001004722chr2----11232 --
NM_001005158chr3--1488 ----
NM_001005159chr3--1488 ----
NM_001005242chr1231629 1559 560 1542 ----
NM_001005266chr152300 37 ------
NM_001005267chr152300 37 ------
NM_001005268chr152300 37 ------
NM_001005269chr152300 37 ------
NM_001005335chr19171 ------
NM_001005375chrY4283 254 231 150 --11598 1420
NM_001005386chr272401 2304 1990 1640 1606 777 129 ----11765
NM_001005404chr1794529 4349 4225 3009 2774 1309 1141 641 238 23542 1124 23653 3301 13778
NM_001005463chr1022072 991 ------
NM_001005473chr5124997 4594 4445 4305 4057 2648 2420 2316 675 472 315 262 26602 4191 34633 4042 1183 --
NM_001005474chr321303 1189 --11392 --
NM_001005476chr21128 ------
NM_001005526chr2--1111 ----
NM_001005732chr21----1124 1558
NM_001005733chr21----1124 1515
NM_001005739chr21867 1813 ----
NM_001005743chr1421128 376 --1863 --
NM_001005744chr1421128 376 --1863 --
NM_001005745chr1421128 376 --1863 --
NM_001005746chr2--11179 11376 --
NM_001005747chr2--11179 11376 --
NM_001005753chr232315 2269 109 22332 165 12061 --
NM_001005781chr22544 162 ------
NM_001005782chr21993 --2401 60 --
NM_001005849chr174558 433 115 38 ------
NM_001005861chr35983 920 909 667 223 ----1306
NM_001005862chr171502 ----1483
NM_001006600chr572387 2137 1789 959 718 426 270 32021 626 227 --1764
NM_001006605chr121155 902 ------
NM_001006605chr121155 902 ------
NM_001006610chr1651002 903 375 329 285 ------
NM_001006612chrX1452 ------
NM_001006613chrX1452 ------
NM_001006614chrX1452 ------
NM_001006618chr91198 ------
NM_001006626chr7176 ------
NM_001006627chr7176 ------
NM_001006628chr7176 ------
NM_001006629chr7176 ------
NM_001006630chr7176 ------
NM_001006631chr7176 ------
NM_001006632chr7176 ------
NM_001006636chr2--1360 ----
NM_001006656chr1981707 1693 1452 1379 1126 601 521 134 1494 1538 --
NM_001006657chr283013 2700 2351 2167 1056 1019 264 94 12091 ----
NM_001006946chr221223 512 --1534 --
NM_001007024chr1743038 2917 2804 290 1212 34301 3458 2897 --
NM_001007025chr1743038 2917 2804 290 1212 34301 3458 2897 --
NM_001007067chr82751 381 ------
NM_001007068chr82751 381 ------
NM_001007069chr82751 381 ------
NM_001007070chr82751 381 ------
NM_001007075chr4----11026 --
NM_001007097chr954944 4558 1826 1818 1531 14732 ----
NM_001007099chr12703 150 --1808 --
NM_001007100chr12703 150 --1808 --
NM_001007102chr641602 1447 1020 220 --11589 --
NM_001007157chr7121 ------
NM_001007214chr13732 620 404 21625 1290 1714 --
NM_001007226chr1741259 1185 1003 390 ------
NM_001007227chr1741259 1185 1003 390 ------
NM_001007228chr1741259 1185 1003 390 ------
NM_001007229chr1741259 1185 1003 390 ------
NM_001007230chr1741259 1185 1003 390 ------
NM_001007237chr142821 2708 524 475 1247 ----
NM_001007245chr71166 ----181
NM_001007257chr141407 945 547 315 ------
NM_001007267chr22842 655 ------
NM_001007277chr112423 360 ------
NM_001007278chr13113676 3529 3355 3335 3327 2076 1992 946 938 333 24 25204 4057 24332 1633 12018
NM_001007466chr6164937 4705 4594 1872 1752 1587 1581 1575 1568 1555 1542 993 934 551 361 300 13646 14571 --
NM_001007468chr221264 ----1301
NM_001007471chr9----168 --
NM_001007544chr13474 396 31 ------
NM_001007546chr211238 11539 ----
NM_001007553chr151234 1197 891 134 66 ------
NM_001007559chr18112016 1926 1722 1624 1617 1610 1604 1596 1430 703 667 --1106 --
NM_001007595chr15--1292 1327 --
NM_001007794chr13765 722 695 ------
NM_001008225chr7--1518 ----
NM_001008226chr1561779 1371 598 478 196 47 ------
NM_001008239chr18133803 3708 3686 3190 3154 2691 2676 1449 1348 1342 1327 1317 1097 --22716 346 13669
NM_001008272chr31123 ------
NM_001008273chr31123 ------
NM_001008392chr352535 2332 1047 858 151 22561 2378 ----
NM_001008393chr472928 2881 2479 2241 2070 148 105 12306 --12088
NM_001008401chr1921301 1084 11218 ----
NM_001008405chr72127 81 --31799 1586 284 --
NM_001008408chr7114523 4232 4054 2566 2282 1333 926 824 377 367 299 --24948 249 --
NM_001008495chr882178 1728 1535 461 420 393 253 85 12266 22012 1869 1123
NM_001008540chr23444 437 357 1367 1137 198
NM_001008541chr1011583 --11795 --
NM_001008541chr1011583 --11795 --
NM_001008564chr1342124 874 306 109 ------
NM_001008660chr1111367 ------
NM_001008701chr1913075 ------
NM_001008708chr2----1240 1527
NM_001008711chr851479 486 244 198 57 --1480 --
NM_001008738chr552933 2498 2371 2180 448 1806 --1393
NM_001008801chr1961761 1468 799 548 279 194 52004 1897 1637 466 111 11982 --
NM_001008895chr131309 --2209 197 --
NM_001008925chr43778 741 599 --4902 730 533 428 13224
NM_001009554chr4104566 4423 3869 3410 3365 2984 2874 492 439 419 24039 3442 ----
NM_001009554chr4104566 4423 3869 3410 3365 2984 2874 492 439 419 24039 3442 ----
NM_001009555chr461728 1391 1322 1275 1135 73 ------
NM_001009567chr103580 552 448 ----1466
NM_001009571chr751170 1112 216 179 50 1540 ----
NM_001009880chr2284773 4255 3996 3680 3296 1157 840 427 14459 ----
NM_001009881chr1--2421 197 --1239
NM_001009882chr1--2421 197 --1239
NM_001009899chr364722 1768 1322 813 627 119 34004 2391 1638 ----
NM_001009955chr11376 ------
NM_001009955chr11376 ------
NM_001009959chr222079 754 11816 ----
NM_001009993chr284565 4313 4285 3055 1520 1031 816 552 1837 ----
NM_001010000chr1863337 3194 2451 2344 1253 344 ----13265
NM_001010853chr682925 2735 2319 2150 1250 1235 980 83 --22883 2236 --
NM_001010854chr142277 189 ------
NM_001010861chr142195 2111 2065 747 1467 ----
NM_001010862chrX93243 3027 3009 2672 1306 1001 540 493 152 ------
NM_001010867chr196592 6229 5341 5144 5022 2298 1962 1592 709 26041 5456 1925 --
NM_001010888chrX94500 4412 4177 3885 3012 1127 822 719 377 ----11247
NM_001010891chr5216669 6549 6497 6430 5960 5924 5458 5085 4926 4863 4473 4259 2670 2268 2128 2103 1444 1220 916 728 389 24487 1200 1698 --
NM_001010895chr921445 279 --31557 543 44 --
NM_001010911chr101209 --1395 1182
NM_001010934chr72908 791 1153 ----
NM_001010986chrX--21668 891 12429 --
NM_001010989chr162575 364 ----1102
NM_001010990chr162575 364 ----1102
NM_001011513chr463906 3531 2528 1514 1107 96 ----1506
NM_001011537chr352316 2186 1454 709 139 21894 209 --12173
NM_001011551chrX1174 ------
NM_001011553chr72150 96 ------
NM_001011657chrX51143 1092 983 308 132 --1938 --
NM_001011663chr102915 314 ------
NM_001011666chr7116296 6282 6010 5861 4980 2519 2310 2050 1958 605 240 24130 862 35414 4305 108 --
NM_001011708chr221915 1849 --12582 --
NM_001011713chr1451212 1059 1001 443 412 --2615 211 --
NM_001011885chr1531592 554 122 ----11814
NM_001012393chr1194054 3709 3297 2072 1507 1286 205 135 100 --25013 3362 --
NM_001012410chr3------1346
NM_001012418chr654217 3568 1393 691 82 ------
NM_001012420chr1522817 2056 1359 ----
NM_001012423chr1522817 2056 1359 ----
NM_001012456chr71104 --123 --
NM_001012614chr42531 253 ----1271
NM_001012751chr1021931 701 --1635 --
NM_001012754chr1342097 1488 178 130 11770 ----
NM_001012755chrX114924 4697 4665 4370 3914 3313 3236 1817 1789 1562 56 --23727 1133 --
NM_001012756chr1962767 2440 2367 2361 839 664 1681 ----
NM_001012761chr572406 1026 816 741 221 192 24 --11066 --
NM_001012977chrX11113 11416 11366 --
NM_001012979chrX1242 ------
NM_001013031chr1043461 3451 3177 976 22478 139 1859 --
NM_001013398chr721114 154 ----11486
NM_001013399chr62416 215 1804 1150 --
NM_001013406chr71480 --21292 51 --
NM_001013415chr441615 1248 518 373 --11290 --
NM_001013437chr18174 ------
NM_001013438chr32982 643 --1183 --
NM_001013439chr31828 --129 --
NM_001013629chr1051816 1652 1385 1317 203 12137 ----
NM_001013703chr15----1452 --
NM_001014286chr13180 ------
NM_001014380chr1395812 5465 5169 4962 4784 1876 1795 1547 1487 --1342 24030 1322
NM_001014431chr142905 145 2668 82 1719 --
NM_001014432chr142905 145 2668 82 1719 --
NM_001014434chr11691 --1270 126
NM_001014446chr4----129 --
NM_001014797chr10117387 7230 5945 5406 3163 1907 1108 782 768 762 496 --46829 5475 5056 1157 --
NM_001014809chr45874 862 700 88 73 ------
NM_001014811chr111104 ------
NM_001014831chr193800 261 166 ------
NM_001014832chr193800 261 166 ------
NM_001014834chr193800 261 166 ------
NM_001014835chr193800 261 166 ------
NM_001015048chr1483121 3012 2266 928 751 618 541 516 22970 254 12931 12124
NM_001015049chr1483121 3012 2266 928 751 618 541 516 22970 254 12931 12124
NM_001015508chr81221 --2576 208 1562
NM_001015877chrX72933 2727 2578 2479 2338 2047 1068 1749 ----
NM_001015880chr1011185 21711 1298 11458 --
NM_001015881chrX31287 1029 68 --154 --
NM_001015892chr51154 ------
NM_001017368chr172948 234 ------
NM_001017371chr221243 1136 ----173
NM_001017395chr383252 2691 2684 2342 863 725 139 86 1922 22293 195 --
NM_001017415chr11812 2241 128 ----
NM_001017416chr11812 2241 128 ----
NM_001017424chr121380 576 ----1353
NM_001017425chr121380 576 ----1353
NM_001017922chr151730 1183 1143 439 162 ------
NM_001017926chr841603 1284 1200 192 ------
NM_001017930chrX41425 976 968 116 1592 3385 317 280 --
NM_001017962chr106939 762 709 315 217 169 ------
NM_001017969chr91243 --1581 126
NM_001017977chr11105 --1114 --
NM_001017999chr15527 363 357 351 316 --12167 1736
NM_001017999chr15527 363 357 351 316 --12167 1736
NM_001018000chr15527 363 357 351 316 --12167 1736
NM_001018000chr15527 363 357 351 316 --12167 1736
NM_001018001chr15527 363 357 351 316 --12167 1736
NM_001018004chr152680 454 152 ----
NM_001018006chr152680 454 152 ----
NM_001018007chr152680 454 152 ----
NM_001018020chr152680 454 152 ----
NM_001018037chr921257 1089 --1505 --
NM_001018053chr151713 1688 1628 1340 747 11236 1603 --
NM_001018056chr9--1157 ----
NM_001018064chr921581 569 1561 ----
NM_001018065chr965819 5441 3999 2149 542 84 24721 1931 25409 3720 15351
NM_001018066chr965819 5441 3999 2149 542 84 24721 1931 25409 3720 15351
NM_001018067chr1145305 5208 4955 4532 4255 3245 1526 1473 1346 861 845 540 367 201 23849 1639 --15254
NM_001018068chr1145305 5208 4955 4532 4255 3245 1526 1473 1346 861 845 540 367 201 23849 1639 --15254
NM_001018069chr1145305 5208 4955 4532 4255 3245 1526 1473 1346 861 845 540 367 201 23849 1639 --15254
NM_001018074chr513297 --13722 --
NM_001018075chr513297 --13722 --
NM_001018076chr513297 --13722 --
NM_001018077chr513297 --13722 --
NM_001018100chr151769 ------
NM_001020658chr141286 1273 1165 425 1399 ----
NM_001020658chr141286 1273 1165 425 1399 ----
NM_001020818chr1941904 1535 60 46 --1170 --
NM_001020819chr1941904 1535 60 46 --1170 --
NM_001020820chr1941904 1535 60 46 --1170 --
NM_001020821chr1941904 1535 60 46 --1170 --
NM_001023567chr1552361 2241 2209 1735 1656 ------
NM_001024094chr513297 --13722 --
NM_001024218chr142319 83 ------
NM_001024226chr111139 1389 1184 --
NM_001024227chr111139 1389 1184 --
NM_001024228chr111139 1389 1184 --
NM_001024401chr16--12862 ----
NM_001024455chrX32117 1916 382 --11956 --
NM_001024649chr522809 2029 1290 12707 1410
NM_001024660chr371427 1397 1215 1108 508 390 106 --1631 --
NM_001024688chr851990 1823 1581 753 664 1513 --11544
NM_001024808chr1222025 1850 1467 ----
NM_001024809chr1721407 940 1518 ----
NM_001024847chr352337 2244 1579 894 497 ------
NM_001024855chr3--1222 ----
NM_001024934chr6--1517 ----
NM_001024935chr6--1517 ----
NM_001024936chr6--1517 ----
NM_001024947chr521056 300 ------
NM_001024948chr183254 3233 3175 3074 2754 2412 1260 268 11130 ----
NM_001025068chr311852 ------
NM_001025069chr311852 ------
NM_001025076chr10146173 5879 5577 4420 4037 2027 1721 1574 1424 1299 1051 966 833 165 --55462 3911 3818 2066 549 24306 523
NM_001025077chr10147531 7237 6935 5778 5395 2932 2782 2657 2409 2324 2191 1523 1395 947 --56820 5269 5176 1907 1322 45664 4636 1881 669
NM_001025079chr394185 4172 3840 3305 2845 2832 2816 2629 1248 13609 43436 2639 1391 239 23461 166
NM_001025108chr263935 3017 2695 1344 834 57 --21331 1266 24126 2546
NM_001025233chr1252537 2430 1792 835 278 ------
NM_001025366chr651649 1382 1294 658 314 --11816 --
NM_001025366chr651649 1382 1294 658 314 --11816 --
NM_001025367chr651649 1382 1294 658 314 --11816 --
NM_001025367chr651649 1382 1294 658 314 --11816 --
NM_001025368chr651649 1382 1294 658 314 --11816 --
NM_001025368chr651649 1382 1294 658 314 --11816 --
NM_001025369chr651665 1398 1310 674 330 --11832 --
NM_001025369chr651665 1398 1310 674 330 --11832 --
NM_001025370chr651649 1382 1294 658 314 --11816 --
NM_001025370chr651649 1382 1294 658 314 --11816 --
NM_001025580chrX114280 4055 3747 2995 1226 642 611 482 460 310 251 13100 13971 1430
NM_001025595chr431286 1106 323 --11331 --
NM_001025596chr111485 ------
NM_001025616chr431325 640 568 --21340 234 --
NM_001025777chr221151 377 11420 2302 65 147
NM_001025780chr911505 ------
NM_001029835chr71327 ------
NM_001029863chr64988 385 141 94 --12529 --
NM_001029875chr592868 2642 2417 2133 1980 1167 1088 315 94 1220 1934 --
NM_001029882chr11277 ------
NM_001029882chr11277 ------
NM_001029884chr652239 1838 1822 541 362 12132 11805 22598 267
NM_001029998chr411421 ------
NM_001030007chr1643670 3611 2889 2465 ------
NM_001030055chr1484575 4376 4244 4046 2885 1820 1494 1455 --24681 2990 13758
NM_001030272chr11159 1352 ----
NM_001030273chr11159 1352 ----
NM_001031623chr63553 428 122 11238 1341 --
NM_001031679chr121109 --22847 297 --
NM_001031684chr231383 1182 1121 1206 ----
NM_001031685chr12788 782 1932 1898 --
NM_001031692chr7131 1300 ----
NM_001031695chr2294741 4555 4543 3590 2151 1745 1147 627 171 35449 3789 1721 24210 675 --
NM_001031700chr442309 703 424 296 159 ----
NM_001031710chr72932 83 11091 ----
NM_001031712chr61387 ------
NM_001031716chr23995 372 335 1150 --130
NM_001031732chr472987 1380 1276 1176 1150 489 325 1286 --12377
NM_001031748chr12--1621 1557 1235
NM_001031801chr221162 ------
NM_001031803chr17------2309 233
NM_001031804chr1674063 3621 3438 822 726 314 78 13356 3646 626 384 11492
NM_001031812chr541989 1971 370 212 --22370 308 --
NM_001032221chr92451 198 1392 ----
NM_001032280chr641724 1426 1274 306 --1599 --
NM_001032282chr831257 1199 1024 ------
NM_001032283chr122306 177 ------
NM_001032284chr122306 177 ------
NM_001032288chr2031525 1410 1111 ------
NM_001032293chr17--1247 ----
NM_001032296chr1382777 2738 2695 2613 2196 2109 1907 30 32923 2328 253 12014 12050
NM_001032380chr1032005 1801 1243 11464 ----
NM_001032393chrX1202 ------
NM_001032394chr672844 2339 2325 1768 1129 1055 131 ------
NM_001032395chr652711 2206 2192 996 922 ------
NM_001032410chr21--1194 ----
NM_001032999chr2055236 4291 1374 1355 705 15182 14713 --
NM_001033047chr441005 582 491 146 11741 --1360
NM_001033057chr352121 1838 619 485 42 --1453 --
NM_001033059chr651986 1838 1687 1543 522 --1544 --
NM_001033087chr2052860 2648 2333 1010 914 23076 2981 ----
NM_001033112chr52784 565 --1122 --
NM_001033503chr52463 115 ----1380
NM_001033557chr221250 112 --11156 1250
NM_001033561chr173749 185 156 1680 ----
NM_001033566chr172293 68 1736 ----
NM_001033568chr172293 68 1736 ----
NM_001033576chr1732679 2502 66 --1329 --
NM_001033578chr872239 2233 1956 1597 917 341 296 ------
NM_001033602chr1392589 2262 824 768 697 450 392 310 256 ------
NM_001033659chr1721474 355 1375 ----
NM_001033756chr651583 1316 1228 592 248 --11750 --
NM_001033756chr651583 1316 1228 592 248 --11750 --
NM_001033925chr1051930 1846 1681 578 170 1363 1186 --
NM_001034841chr16115523 5297 5155 4397 4029 4023 4017 3412 1634 1162 505 21052 362 34983 3780 418 11963
NM_001034850chr531420 1147 1141 21106 274 1346 --
NM_001034852chr141163 --3567 371 252 --
NM_001034915chr81345 --11533 --
NM_001034954chr1063004 2997 2083 1156 872 852 --32964 2822 2254 --
NM_001034955chr1063004 2997 2083 1156 872 852 --32964 2822 2254 --
NM_001034956chr1063004 2997 2083 1156 872 852 --32964 2822 2254 --
NM_001034957chr1063004 2997 2083 1156 872 852 --32964 2822 2254 --
NM_001035chr121060 1021 ------
NM_001035003chr43563 341 273 ------
NM_001035004chr43563 341 273 ------
NM_001035260chr1011286 1608 ----
NM_001035521chr21655 ------
NM_001037132chr7--1710 ----
NM_001037133chr7--1710 ----
NM_001037164chr741773 1448 1440 655 11942 22015 1476 --
NM_001037165chr7148918 8880 8860 8566 8544 8337 7524 7315 3023 2578 1839 1501 1401 1215 --58331 7647 7309 2743 575 --
NM_001037172chr351374 1201 995 883 70 ------
NM_001037317chr142195 2111 2065 747 1467 ----
NM_001037332chr512341 ------
NM_001037333chr512341 ------
NM_001037339chr121358 1250 ----11348
NM_001037340chr121358 1250 ----11348
NM_001037341chr121358 1250 ----11348
NM_001037341chr121358 1250 ----11348
NM_001037535chrX41552 1075 611 93 ------
NM_001037536chrX41552 1075 611 93 ------
NM_001037540chrX41552 1075 611 93 ------
NM_001037553chr2154473 3806 1493 934 732 2690 342 ----
NM_001037582chr43216 195 140 --11704 --
NM_001037631chr21722 11110 ----
NM_001037637chr51266 --1248 --
NM_001037954chr1163470 2516 2231 1318 715 664 ------
NM_001038493chr211495 ------
NM_001038702chr532704 1922 1077 --2250 158 --
NM_001038707chr182194 1924 1710 1602 807 680 291 21 21682 351 ----
NM_001038707chr182194 1924 1710 1602 807 680 291 21 21682 351 ----
NM_001039091chrX3290 243 52 --1183 --
NM_001039199chr2084662 4151 3968 1775 986 709 678 465 1309 13042 --
NM_001039348chr21849 1954 --1412
NM_001039349chr21849 1954 --1412
NM_001039459chr721023 988 --21109 1000 --
NM_001039538chr253644 3211 2462 2257 920 --33358 1454 476 12302
NM_001039550chr21894 ------
NM_001039577chr164193 4009 3892 1641 951 146 1517 12872 --
NM_001039580chr444373 4193 3083 1349 31464 415 223 ----
NM_001039585chr143322 3143 923 451 24171 2618 11570 --
NM_001039590chrX63734 3566 3182 2876 1499 1492 --33719 3632 3422 --
NM_001039591chrX63734 3566 3182 2876 1499 1492 --33719 3632 3422 --
NM_001039618chr11145686 4973 4917 4706 4693 4659 4627 3749 2166 1591 1474 1340 1163 801 11803 12359 --
NM_001039693chr284050 3747 2774 1638 1021 1014 942 714 --23684 698 11623
NM_001039709chr2055236 4291 1374 1355 705 15182 14713 --
NM_001039762chr1072010 1946 1900 1588 918 772 206 11913 12376 --
NM_001039802chr15480 467 420 281 97 ------
NM_001039840chrX65543 5492 5094 4291 1170 1067 15560 15338 --
NM_001039960chr1241429 1218 246 53 --11251 --
NM_001040001chr651918 1617 1576 391 379 11522 1256 --
NM_001040020chr711135 --11569 21123 986
NM_001040031chr191271 ------
NM_001040058chr41364 ------
NM_001040060chr41364 ------
NM_001040092chr82154 59 --1436 --
NM_001040101chr4----11225 --
NM_001040102chr1052453 2425 2220 1656 744 --21718 636 --
NM_001040103chr1052453 2425 2220 1656 744 --21718 636 --
NM_001040110chr761674 1618 1607 1506 1339 110 --1497 --
NM_001040135chr7----1707 1540
NM_001040142chr222221 1532 2638 112 ----
NM_001040143chr222221 1532 2638 112 ----
NM_001040147chr18----2702 620 --
NM_001040152chr753776 3452 1791 1756 769 --24524 4006 --
NM_001040153chr13----2321 246 --
NM_001040157chr452572 2488 2102 1034 320 12900 1103 --
NM_001040158chr54416 399 158 111 1178 ----
NM_001040159chr41250 1565 1274 1193
NM_001040167chr761149 1100 850 844 809 181 1949 ----
NM_001040202chr452322 813 584 551 91 22285 1936 ----
NM_001040214chr612064 --11534 --
NM_001040260chr4----11024 --
NM_001040261chr4----11024 --
NM_001040284chr1695156 4362 4355 2140 1936 688 670 458 127 25564 2152 35174 2311 2128 14311
NM_001040402chr4144 22874 2744 12034 --
NM_001040429chr1351451 1191 1185 836 156 12318 ----
NM_001040441chr144835 2144 2138 1999 44375 3582 1476 1089 ----
NM_001040450chr1532123 607 121 ------
NM_001040453chr1532123 607 121 ------
NM_001040458chr531903 1790 606 --1160 --
NM_001040624chr832755 2335 1889 21736 844 ----
NM_001040625chr832755 2335 1889 21736 844 ----
NM_001040626chr832755 2335 1889 21736 844 ----
NM_001040627chr832755 2335 1889 21736 844 ----
NM_001040628chr832755 2335 1889 21736 844 ----
NM_001040629chr832755 2335 1889 21736 844 ----
NM_001040630chr832755 2335 1889 21736 844 ----
NM_001040633chr741034 1016 896 269 ------
NM_001040665chr763988 1475 941 910 147 36 23950 3198 24669 4093 --
NM_001040668chr191118 ------
NM_001040708chr84967 374 325 176 1402 --1205
NM_001040709chr111833 11770 11699 --
NM_001040712chr963384 3234 2730 846 781 647 --43569 1002 986 506 --
NM_001040876chr451649 700 683 267 154 1586 ----
NM_001042355chr1643452 743 223 74 --1547 --
NM_001042388chr181844 1726 ----
NM_001042412chr1643452 743 223 74 --1547 --
NM_001042413chr9114108 3879 3668 1463 1406 1207 1059 774 744 615 133 ------
NM_001042414chr13----1118 --
NM_001042425chr641724 1426 1274 306 --1599 --
NM_001042453chrX31262 1218 1169 ----11344
NM_001042465chr10145 ------
NM_001042466chr10145 ------
NM_001042473chr1011621 2857 742 12059 1633
NM_001042481chr1432270 2245 1830 12402 168 --
NM_001042486chr2031180 458 74 ------
NM_001042494chr1583871 3828 3590 2950 1059 896 820 719 --13785 --
NM_001042495chr1583871 3828 3590 2950 1059 896 820 719 --13785 --
NM_001042496chr1583871 3828 3590 2950 1059 896 820 719 --13785 --
NM_001042497chr1583871 3828 3590 2950 1059 896 820 719 --13785 --
NM_001042510chr861762 1710 1703 1614 878 722 --21754 842 11641
NM_001042511chr861762 1710 1703 1614 878 722 --21754 842 11641
NM_001042517chr132904 105 --1250 --
NM_001042533chr342522 2268 401 314 23131 2398 13300 --
NM_001042537chrX3343 264 189 ----1944
NM_001042548chr23794 653 210 1319 ----
NM_001042550chr951339 691 685 236 35 --21414 498 --
NM_001042555chr1284340 4303 3797 3603 3523 3442 1642 931 12960 54756 4450 3576 852 776 143
NM_001042599chr2107697 6604 6161 5038 2962 2372 1110 962 647 103 ----14986
NM_001042601chr362914 2429 1304 900 883 144 22941 246 32893 2799 103 --
NM_001042603chr12124710 4619 4119 3579 3500 3442 3384 3326 2137 1733 1568 733 11145 ----
NM_001042604chr384375 4311 3963 3739 3450 3075 1349 598 23565 1650 33486 3119 1196 --
NM_001042632chr2042278 2208 2049 2009 --1193 --
NM_001042633chr2042278 2208 2049 2009 --1193 --
NM_001042669chr431325 640 568 --21340 234 --
NM_001042681chr142098 1757 511 296 --21854 42 --
NM_001042682chr142098 1757 511 296 --21854 42 --
NM_001042682chr142098 1757 511 296 --21854 42 --
NM_001042683chr641174 398 358 75 21834 1140 --1751
NM_001042728chr1221075 133 ------
NM_001042749chrX1158 1475 21378 216 21756 1471
NM_001042750chrX1158 1475 21378 216 21756 1471
NM_001042751chrX1158 1475 21378 216 21756 1471
NM_001042762chr73685 171 108 ------
NM_001043351chr142325 1730 816 596 --12245 --
NM_001044722chr541989 1971 370 212 --22370 308 --
NM_001044723chr541989 1971 370 212 --22370 308 --
NM_001046chr522634 250 21042 415 12316 --
NM_001050chr17--21090 353 1933 --
NM_001068chr31118 ------
NM_001077628chr1176 ----1604
NM_001083620chr422321 1892 22631 2114 --11961
NM_001094chr173809 782 660 ------
NM_001099678chr376157 6097 2309 1566 302 258 246 --16181 --
NM_001100108chr1218223 7922 7625 6986 5375 5083 3181 2908 2747 2437 2404 2397 2389 2379 1977 1666 1500 902 803 141 74 18191 ----
NM_001106chr3169772 8864 8807 8293 6989 6731 6301 5927 3249 3116 3009 2743 2710 2674 1236 329 17216 69704 9158 8638 3673 2939 2266 1199
NM_001109977chr43249 234 29 1776 ----
NM_001113490chrX41390 535 114 70 --32606 2476 2422 --
NM_001115chr8121 ------
NM_001117chr1822186 159 1341 ----
NM_001121chr1031176 519 220 ------
NM_001122679chr5------11238
NM_001123chr101324 ------
NM_001126chr14429 394 357 250 1351 1324 --
NM_001128chr1643670 3611 2889 2465 ------
NM_001144chr1611107 11421 --11260
NM_001146chr82704 145 --22318 2030 21616 867
NM_001148chr44703 441 317 185 ------
NM_001149chr101484 ----134
NM_001153chr2--1263 ----
NM_001159chr22704 512 ----1718
NM_001160chr1252110 1045 586 462 196 22118 1961 ----
NM_001167chrX66659 6489 5510 2323 2178 1046 42628 710 474 35 44724 2234 1087 977 11390
NM_001173chr1484575 4376 4244 4046 2885 1820 1494 1455 --24681 2990 13758
NM_001174chrX42323 1962 1833 267 --12144 --
NM_001178chr11159 1352 ----
NM_001186chr2172756 2374 990 558 462 101 47 13229 12437 --
NM_001187chr211506 ------
NM_001191chr203366 343 159 ----11207
NM_001201chr473845 2909 2453 501 465 320 70 1278 33359 826 476 13822
NM_001204chr2167635 6668 6614 6506 6223 5684 5193 2647 2111 1925 1657 1512 1115 629 205 197 11726 47736 7184 2451 1362 1444
NM_001206chr9113079 3031 2970 2763 2110 2056 2040 298 292 286 278 1165 ----
NM_001207chr51266 --1248 --
NM_001219chr712250 11612 ----
NM_001222chr101208 ------
NM_001237chr43946 913 723 ----165
NM_001237chr43946 913 723 ----165
NM_001238chr193529 189 167 ------
NM_001253chr62253 112 ------
NM_001256chr1792499 2378 2210 1896 1872 1169 440 398 261 22519 389 ----
NM_001257chr1621041 131 ------
NM_001258chr171181 ------
NM_001259chr775218 5154 4691 2195 1022 968 662 25248 975 25762 2334 --
NM_001268chr13----122 --
NM_001269chr12974 902 ------
NM_001270chr51885 1313 1413 --
NM_001271chr1543092 563 232 100 ------
NM_001278chr106745 475 449 388 177 67 11226 11201 --
NM_001280chr195687 587 274 211 127 ------
NM_001289chrX171 11523 ----
NM_001304chr1773819 3622 2971 2628 1112 440 161 --23601 491 13763
NM_001310chr1272927 2649 2618 2473 1879 461 410 --11229 --
NM_001313chr45874 862 700 88 73 ------
NM_001319chr19----11030 --
NM_001326chr114384 317 139 93 1424 1307 --
NM_001328chr42531 253 ----1271
NM_001329chr1041475 1193 1161 1025 --1245 --
NM_001330chr161956 ------
NM_001331chr112852 296 --22111 284 12130
NM_001332chr551585 1110 1103 583 75 --1635 --
NM_001338chr2141235 986 953 253 ------
NM_001351chr33188 159 143 1320 21858 1572 --
NM_001356chrX52300 2186 1785 997 611 1853 ----
NM_001357chr1170 ------
NM_001363chrX2518 113 --1715 --
NM_001364chr1164458 1642 1241 763 105 88 --21080 542 --
NM_001365chr171514 ------
NM_001379chr19--168 1216 1279
NM_001380chr103735 678 148 2853 777 ----
NM_001386chr862305 2020 1829 1680 429 96 12256 ----
NM_001387chr563032 2783 2716 2620 601 595 --11071 --
NM_001390chr1823008 2654 13659 23201 2297 1862
NM_001395chrX1954 ------
NM_001396chr2142441 398 279 54 42094 2021 486 38 --12368
NM_001401chr911051 ------
NM_001406chr1741730 1529 1238 434 ------
NM_001407chr321176 484 11146 ----
NM_001408chr131693 1661 1314 11540 1259 --
NM_001412chrX113218 2908 2857 2769 1152 1146 1139 1133 536 206 147 ----11202
NM_001415chrX61790 1576 1559 316 289 283 --1672 --
NM_001417chr1251951 1771 1659 1291 541 ----1407
NM_001418chr114622 590 261 156 ------
NM_001418chr114622 590 261 156 ------
NM_001419chr19114673 4448 4391 4315 2987 1574 1225 1154 1086 1064 385 34241 1166 139 14817 34621 1534 393
NM_001420chr1952470 2242 2115 1191 285 ------
NM_001427chr771940 1791 1474 1357 581 243 128 --1207 --
NM_001430chr271860 1695 1545 657 532 359 71 1229 1710 --
NM_001431chr62992 494 --1246 --
NM_001432chr453057 2790 1444 1023 394 33690 3554 139 --23445 3370
NM_001438chr133039 2862 841 13112 ----
NM_001440chr821090 459 1314 ----
NM_001448chrX41291 330 306 168 --11117 1116
NM_001452chr6--1574 ----
NM_001454chr17------1995
NM_001461chr1127 --1434 --
NM_001463chr23797 259 227 ------
NM_001482chr151785 2625 317 ----
NM_001494chr10----1293 --
NM_001495chr82296 114 --1169 --
NM_001497chr942180 1886 750 701 ------
NM_001498chr651103 1023 880 371 301 ----1898
NM_001514chr1----1395 --
NM_001518chr721019 159 --3843 422 414 --
NM_001521chr21655 ------
NM_001530chr1421067 180 --1218 --
NM_001533chr19171 ------
NM_001540chr7193 ------
NM_001541chr111166 ------
NM_001542chr142821 2708 524 475 1247 ----
NM_001543chr554872 4432 3613 952 677 23547 1074 --13598
NM_001546chr63989 983 272 ----1935
NM_001550chr71166 ----181
NM_001587chrX31898 226 113 ------
NM_001604chr1151011 905 404 347 122 1818 ----
NM_001609chr1054109 3509 2872 1286 987 2442 251 13669 --
NM_001614chr171592 ------
NM_001614chr171592 ------
NM_001616chr243282 3086 3078 801 1431 22759 1010 --
NM_001619chr11--11089 ----
NM_001621chr762924 2845 2341 1170 378 29 --1437 --
NM_001621chr762924 2845 2341 1170 378 29 --1437 --
NM_001627chr321720 212 1391 --1959
NM_001634chr651986 1838 1687 1543 522 --1544 --
NM_001635chr72746 675 143 ----
NM_001642chr1141221 1210 1169 262 ------
NM_001650chr1833845 1321 855 23483 228 1476 --
NM_001655chr1142015 1944 771 724 1715 175 --
NM_001656chr521378 29 --1271 --
NM_001658chr111139 1389 1184 --
NM_001660chr33721 586 300 1624 1768 --
NM_001663chr1472731 2639 1958 863 723 699 561 --1320 --
NM_001664chr331059 963 668 ------
NM_001668chr152207 2087 1780 1672 366 154 ----
NM_001681chr12--162 ----
NM_001682chr1242701 2161 1133 981 12553 ----
NM_001683chr362414 2302 2278 1687 389 368 12690 1475 --
NM_001684chr174130 3768 3237 3108 2989 2549 473 34050 2966 828 33005 2562 562 1887
NM_001690chr342395 2179 1874 148 11904 ----
NM_001702chr81389 ------
NM_001704chr62527 194 --1415 --
NM_001706chr33852 795 308 ------
NM_001709chr1182843 2586 2565 1957 592 568 430 145 12904 ----
NM_001718chr621328 312 ------
NM_001719chr20----2177 38 --
NM_001723chr63256 228 162 ------
NM_001726chr11139 ------
NM_001730chr1311371 31285 502 312 31332 592 422 --
NM_001730chr1311371 31285 502 312 31332 592 422 --
NM_001731chr121689 ------
NM_001735chr9164 ------
NM_001744chr51105 ------
NM_001746chr522809 2029 1290 12707 1410
NM_001753chr731594 670 146 ------
NM_001754chr214868 698 678 640 43428 3266 1019 544 22940 2754 --
NM_001755chr1621889 827 1534 1274 --
NM_001759chr12133758 3517 3413 3354 1940 1932 1912 1680 1349 1122 1108 75 69 15143 11851 14831
NM_001774chr191271 ------
NM_001777chr394185 4172 3840 3305 2845 2832 2816 2629 1248 13609 43436 2639 1391 239 23461 166
NM_001788chr72150 96 ------
NM_001791chr15480 467 420 281 97 ------
NM_001792chr1841047 795 276 23 ----1949
NM_001794chr20--1276 ----
NM_001795chr1621467 1417 ------
NM_001797chr161119 ----1676
NM_001799chr51186 ------
NM_001806chr1952890 822 713 363 209 1281 1568 --
NM_001826chr12345 339 ----1465
NM_001829chr42855 138 ------
NM_001830chrX43969 3144 446 437 23370 1570 13493 --
NM_001845chr131475 1913 ----
NM_001854chr12398 80 --11030 --
NM_001855chr92543 29 --1100 --
NM_001858chr6115175 5077 4903 3954 3561 3135 760 749 586 487 249 24087 3971 1286 --
NM_001859chr943448 389 299 204 --13088 --
NM_001880chr2126 ------
NM_001881chr101343 --1403 --
NM_001882chr51388 1508 --146
NM_001884chr53161 58 26 ------
NM_001893chr171373 ------
NM_001895chr201847 ------
NM_001901chr621001 109 1690 1959 --
NM_001902chr12284 169 1381 ----
NM_001903chr51898 ------
NM_001904chr34916 684 233 24 ------
NM_001924chr11457 --146 --
NM_001935chr2--1283 ----
NM_001938chr181653 1504 1464 1238 663 620 464 41 ------
NM_001942chr1812073 ------
NM_001949chr662801 2793 2787 2053 891 677 12266 1790 --
NM_001962chr51599 ------
NM_001968chr42822 677 ------
NM_001969chr1441481 1351 508 306 13248 23310 3219 --
NM_001977chr41535 ------
NM_001980chr1232165 1730 788 12016 ----
NM_001981chr142318 2308 2147 521 1392 --1892
NM_001982chr1211077 ------
NM_001987chr1273864 3273 2965 627 328 322 316 ------
NM_001992chr51589 12213 ----
NM_001999chr541490 1474 1400 464 ------
NM_002006chr474347 3902 3617 1748 1262 955 455 --23712 523 --
NM_002009chr1582782 2690 2558 2552 2290 1996 930 867 --21946 802 --
NM_002014chr12169 ------
NM_002015chr1373180 2726 728 379 372 330 103 11108 12476 12936
NM_002017chr115936 506 288 132 100 31036 1023 322 ----
NM_002024chrX52169 1373 748 742 255 12193 1346 --
NM_002025chrX96985 6433 5658 3143 2307 1045 775 734 708 49049 8942 5768 118 27747 5750 --
NM_002030chr1951209 1091 783 149 75 ------
NM_002039chr44884 643 577 356 --1350 1602
NM_002040chr2142194 2116 989 770 22424 2042 12358 12571
NM_002051chr103918 438 112 ------
NM_002054chr21177 ------
NM_002056chr21872 1806 ----
NM_002061chr131776 1577 146 ------
NM_002069chr74583 422 306 146 1615 ----
NM_002076chr1283124 3116 2960 2703 2048 1124 1113 625 22986 1210 1294 --
NM_002082chr52977 29 ------
NM_002086chr1722164 436 ----1218
NM_002092chr4144700 4519 4159 4153 4147 3429 3173 3091 1883 1819 1711 1200 517 351 --14460 11208
NM_002106chr4--1261 ----
NM_002107chr1178 1464 1176 --
NM_002126chr1763812 3557 1608 1078 705 563 11130 11446 1439
NM_002128chr1342486 1739 649 265 1117 52382 2031 1627 312 21 --
NM_002129chr42344 322 ------
NM_002130chr541722 1507 1195 428 1297 --11079
NM_002133chr222516 417 1494 ----
NM_002137chr752073 1848 915 435 388 11478 11992 --
NM_002138chr42333 176 --1634 --
NM_002140chr931037 885 759 --153 --
NM_002154chr5------1112
NM_002158chr253240 765 605 134 80 2692 142 33746 2750 1260 --
NM_002165chr202387 373 ------
NM_002166chr21507 ------
NM_002188chr51691 ------
NM_002193chr221600 738 ------
NM_002196chr201929 ------
NM_002196chr201929 ------
NM_002202chr5--1281 ----
NM_002203chr533926 849 503 --14054 --
NM_002210chr253364 3160 2852 2349 1346 1213 1895 2955 250
NM_002211chr1021108 923 ------
NM_002214chr7104667 3545 1989 1844 1648 1266 1069 863 783 582 --13639 11564
NM_002222chr351215 1134 347 125 70 ------
NM_002232chr121261 538 ------
NM_002235chr1241378 1326 667 346 11408 ----
NM_002239chr22260 110 ------
NM_002247chr1032297 1761 1615 11703 --1676
NM_002264chr344624 4240 3436 3420 13496 1483 --
NM_002265chr173786 779 760 ------
NM_002267chr1352390 2321 2257 1654 938 ------
NM_002268chr311526 11501 ----
NM_002270chr5155273 5200 4771 4582 4138 3858 3807 3777 3481 2165 2155 2109 1995 591 489 --45575 4929 4911 476 --
NM_002271chr1361885 1754 883 777 530 80 1716 12150 1826
NM_002285chr263935 3017 2695 1344 834 57 --21331 1266 24126 2546
NM_002293chr152468 2212 1969 1089 1048 --12063 --
NM_002296chr141767 1731 446 353 11720 21548 626 --
NM_002310chr595979 5352 2392 2217 1617 1482 1461 1314 953 36560 4819 4352 16017 --
NM_002313chr1064855 4713 3585 3480 3460 1059 34362 3379 1019 54800 3575 3239 1698 947 13971
NM_002335chr11147 ------
NM_002336chr1284556 4329 3350 1277 1264 1025 898 252 --11906 --
NM_002345chr123239 54 39 ------
NM_002355chr122332 189 11086 1355 --
NM_002356chr682879 2654 2515 2064 1831 978 308 164 1800 ----
NM_002358chr44646 620 504 238 ------
NM_002374chr253644 3211 2462 2257 920 --33358 1454 476 12302
NM_002376chr142556 503 ------
NM_002381chr21953 ------
NM_002387chr5105114 5065 4793 4608 2066 1722 1311 1276 1256 24 --11829 34805 4044 3804
NM_002395chr631222 543 517 ------
NM_002397chr51775 11618 124 --
NM_002398chr21374 ----1268
NM_002401chr1742205 2145 698 407 11560 ----
NM_002402chr731153 304 246 --1469 --
NM_002403chr1------1413
NM_002408chr143788 742 663 ------
NM_002425chr111272 135 ----
NM_002430chr2242182 1789 720 517 --2209 126 --
NM_002438chr103580 552 448 ----1466
NM_002442chr1231768 1465 422 11517 ----
NM_002444chrX31977 1963 1943 11644 ----
NM_002449chr5--1254 ----
NM_002451chr923205 743 12931 23034 942 --
NM_002455chr1130 ------
NM_002467chr8--1430 ----
NM_002473chr221348 ------
NM_002480chr1241046 204 197 177 --1446 --
NM_002481chr1167901 7715 7347 6451 5865 5555 5418 3091 2852 2540 2509 1832 615 217 206 184 --21781 1501 --
NM_002482chr14659 459 128 38 ------
NM_002485chr851990 1823 1581 753 664 1513 --11544
NM_002486chr932391 2026 30 1431 ----
NM_002487chr152732 119 ------
NM_002493chr91273 ------
NM_002499chr1552169 1704 1581 1542 543 12467 11535 --
NM_002501chr1922550 229 22628 2572 12578 --
NM_002505chr631580 1300 497 ----1131
NM_002509chr203672 666 654 ------
NM_002515chr1461977 1839 687 487 342 329 1731 189 11809
NM_002518chr241203 1192 484 218 ------
NM_002519chr112957 335 1323 1545 --
NM_002527chr12--182 ----
NM_002538chr53606 226 121 ------
NM_002539chr2185 1315 ----
NM_002543chr1241538 1339 1201 42 2516 484 ----
NM_002545chr1194054 3709 3297 2072 1507 1286 205 135 100 --25013 3362 --
NM_002547chrX94055 4048 3817 3627 3448 3305 843 329 49 13115 33576 3442 1284 1964
NM_002577chr3104053 3771 3461 2792 2483 1598 1355 1344 964 659 --33931 3554 376 --
NM_002578chrX3469 416 105 1350 ----
NM_002581chr9105670 5505 4590 4109 4039 3868 3483 3467 1424 387 15376 13992 --
NM_002583chr122470 450 ------
NM_002588chr541737 680 568 445 ------
NM_002591chr202643 511 ------
NM_002592chr202295 282 ------
NM_002594chr2012210 12328 ----
NM_002595chr1221855 1580 31771 447 162 11715 --
NM_002600chr121358 1250 ----11348
NM_002601chr2138 --1408 --
NM_002605chr1521197 1099 11054 ----
NM_002607chr721286 1215 ------
NM_002610chr232181 410 240 32735 2497 2267 1312 --
NM_002612chr732076 290 278 --11792 11685
NM_002628chr31861 ----1897
NM_002641chrX4392 91 85 44 ----1351
NM_002648chr651314 1182 966 851 341 ------
NM_002655chr864907 4157 4076 4039 1306 1146 23444 1652 13268 12032
NM_002657chr2031394 946 921 23909 3807 31527 1439 29 --
NM_002667chr61313 ------
NM_002670chr351613 1506 1102 341 332 ------
NM_002687chr142820 484 1503 11262 1523
NM_002690chr8--188 ----
NM_002699chr131016 550 414 21227 561 ----
NM_002706chr23533 135 110 143 ----
NM_002709chr243331 2390 2289 397 23018 965 ----
NM_002710chr123760 403 209 ------
NM_002713chr11774 ------
NM_002715chr53911 468 456 11186 11243 --
NM_002716chr1183715 2619 2576 2277 930 854 797 181 3587 222 66 --1945
NM_002718chr342690 1903 1862 304 1140 ----
NM_002719chr1482255 2241 2058 766 519 483 467 353 --140 1927
NM_002720chr16--1259 ----
NM_002721chr91398 --1185 --
NM_002727chr102200 130 ------
NM_002731chr173144 2970 2571 2092 822 815 647 12750 ----
NM_002734chr1731932 1399 211 11784 1581 11992
NM_002736chr782069 1971 1940 810 804 553 484 109 12088 ----
NM_002737chr1786492 4290 4278 4269 4072 2086 1401 1370 14854 --25674 5479
NM_002738chr16176 ------
NM_002740chr352513 2068 966 456 231 42744 2546 2497 2430 1465 1240
NM_002742chr142528 515 ------
NM_002747chr1831959 1749 587 11906 ----
NM_002748chr152173 133 21088 1075 2407 127 --
NM_002755chr151699 ------
NM_002756chr172691 636 1890 ----
NM_002765chrX3290 243 52 --1183 --
NM_002767chr171511 ------
NM_002772chr211386 1111 ----
NM_002778chr10145 ------
NM_002786chr11--1247 ----
NM_002814chrX3648 595 104 ------
NM_002815chr171166 ------
NM_002819chr1921247 1014 1139 ----
NM_002821chr66791 785 777 761 598 233 1798 ----
NM_002822chr1221553 297 1146 134 --
NM_002824chr121508 ------
NM_002826chr11292 ------
NM_002828chr183968 707 330 --1750 --
NM_002835chr71783 ------
NM_002837chr1233745 3395 705 23219 55 11564 --
NM_002839chr963384 3234 2730 846 781 647 --43569 1002 986 506 --
NM_002840chr13659 650 448 ------
NM_002841chr31124 --1666 --
NM_002843chr1153204 3129 3103 2197 755 2992 83 ----
NM_002844chr61447 --31057 921 550 21433 189
NM_002849chr122808 220 ------
NM_002851chr74634 577 569 80 1776 --1735
NM_002858chr121240 1220 --196 --
NM_002868chr1262373 2366 2297 1905 1768 398 1547 22342 2087 --
NM_002869chr1132201 841 486 1806 12166 --
NM_002874chr922156 784 ------
NM_002882chr22--186 ----
NM_002886chr3144834 4715 4700 4088 4009 3754 3619 3436 1954 943 937 472 457 395 24954 3288 24468 1858 --
NM_002887chr5--132 ----
NM_002890chr52958 346 ------
NM_002892chr1461417 1341 690 462 446 249 ----21386 1189
NM_002894chr18----138 1207
NM_002902chr151502 1423 ----
NM_002906chr1151536 829 823 328 27 --1612 --
NM_002912chr61909 ------
NM_002940chr451649 700 683 267 154 1586 ----
NM_002941chr31315 41166 1060 168 123 1505 --
NM_002942chr321191 175 1348 1905 --
NM_002943chr151187 ------
NM_002956chr121206 11043 11031 --
NM_002958chr35983 920 909 667 223 ----1306
NM_002959chr1134232 3949 3544 3526 3194 2983 1582 1519 1509 1346 1249 292 286 --21719 1395 22825 1228
NM_002971chr33817 303 296 11138 --1316
NM_002973chr121589 1101 ----
NM_002979chr12703 150 --1808 --
NM_002994chr44632 274 122 55 21643 1301 ----
NM_002997chr221223 512 --1534 --
NM_002998chr822251 86 1864 1857 --
NM_003010chr1732425 1518 697 2887 85 ----
NM_003012chr893072 2800 2711 2405 1988 1209 938 819 137 1235 ----
NM_003014chr711405 --1168 --
NM_003016chr171730 1256 ----
NM_003017chr63492 320 76 21176 968 ----
NM_003022chrX1889 --2865 464 --
NM_003026chr951216 1171 976 840 268 ------
NM_003031chr1651002 903 375 329 285 ------
NM_003032chr342567 2432 922 332 ----12364
NM_003035chr12330 175 --1940 --
NM_003036chr12494 154 11027 ----
NM_003042chr332270 1775 526 11373 11418 --
NM_003045chr1374784 4725 3718 3135 1627 961 181 --1782 --
NM_003048chr211075 22728 669 ----
NM_003060chr521314 1274 ------
NM_003068chr821030 915 --11012 --
NM_003069chrX1166 ------
NM_003070chr91644 ------
NM_003071chr351848 1622 594 71 46 21784 542 11665 --
NM_003073chr221264 ----1301
NM_003074chr342182 1747 1429 799 --1350 --
NM_003076chr1261623 1569 1149 654 648 545 11552 ----
NM_003079chr17154 ------
NM_003082chr143879 149 36 --1474 124
NM_003093chr62173 85 ------
NM_003095chr12161 ------
NM_003096chr2----1181 --
NM_003106chr32733 363 ----11069
NM_003107chr652441 2189 2004 1639 423 12448 ----
NM_003108chr2126752 5761 5708 5570 5563 4847 2130 1800 1523 1067 1010 349 --27282 5819 24478 240
NM_003111chr221243 1136 ----173
NM_003112chr733230 3093 2433 11126 12850 --
NM_003113chr23804 257 133 1114 2304 21 --
NM_003115chr11332 ------
NM_003129chr8----1279 --
NM_003130chr731131 164 153 ------
NM_003131chr61788 ------
NM_003136chr14--1308 ----
NM_003137chr631964 803 121 11821 ----
NM_003144chr661771 1619 811 751 410 199 --12134 11550
NM_003155chr862612 2391 946 832 271 67 --12410 --
NM_003161chr1772874 2717 2600 1321 1167 1109 335 1917 12360 --
NM_003174chr103333 116 89 1705 ----
NM_003178chr32134 109 2670 318 ----
NM_003182chr7--1463 ----
NM_003182chr7--1463 ----
NM_003184chr82202 138 1978 1726 --
NM_003185chr2031031 350 111 ----11304
NM_003187chr51154 ------
NM_003188chr61630 ------
NM_003189chr133420 2126 665 140 ----
NM_003194chr62435 368 ----1389
NM_003198chr11296 ------
NM_003199chr18105560 5171 4414 4231 4225 4219 4207 3688 2006 462 35664 5656 4238 22000 1781 --
NM_003201chr102989 419 --1291 --
NM_003202chr521916 1361 ------
NM_003206chr61416 ------
NM_003211chr1231635 189 39 ----1474
NM_003217chr1251971 1249 787 781 439 --11781 --
NM_003220chr641724 1426 1274 306 --1599 --
NM_003223chr165867 713 702 673 321 ------
NM_003234chr352130 1805 1666 1567 922 12059 1715 --
NM_003242chr352337 2244 1579 894 497 ------
NM_003246chr1541916 1895 1711 174 ------
NM_003247chr661863 1410 1389 1383 1377 131 ------
NM_003253chr2131583 617 135 11894 --11848
NM_003259chr19------1154
NM_003262chr385008 4401 4230 3729 1697 1152 898 313 24719 835 --1452
NM_003274chr2172714 2605 1898 1197 922 799 158 32739 2181 1137 12020 --
NM_003286chr2021055 23 2375 251 ----
NM_003291chr13140 ------
NM_003292chr121894 134 1410 11473 --
NM_003295chr13--1159 ----
NM_003298chr356065 5752 5203 4332 794 --24162 2275 15799
NM_003304chr341111 1000 651 284 --2592 180 --
NM_003317chr141204 ----1659
NM_003319chr24789 278 240 107 --1930 --
NM_003336chrX3837 267 140 --2742 243 --
NM_003337chr51267 --1375 --
NM_003338chr1041421 1324 369 51 41661 1349 329 237 11975 --
NM_003340chr421124 888 --1176 --
NM_003341chr32639 216 ----1436
NM_003342chr1763211 3176 2806 2410 1276 68 1802 23168 1098 --
NM_003349chr2031525 1410 1111 ------
NM_003352chr21993 --2401 60 --
NM_003360chr42285 218 ------
NM_003362chr124961 840 785 400 1755 1847 --
NM_003367chr191108 ------
NM_003368chr11812 2241 128 ----
NM_003369chr1172672 2634 2567 2502 2406 1787 632 ----1821
NM_003370chr19----1639 1802
NM_003372chrX2709 30 ----1701
NM_003374chr52742 596 ------
NM_003376chr651649 1382 1294 658 314 --11816 --
NM_003376chr651649 1382 1294 658 314 --11816 --
NM_003379chr62732 716 ------
NM_003383chr9--1157 ----
NM_003390chr113884 835 109 1865 1975 --
NM_003392chr393585 3544 3520 3338 3285 1665 1211 930 73 23648 81 23310 1579 12992
NM_003400chr23623 135 22 --1614 --
NM_003403chr141239 ------
NM_003404chr2042011 1865 1370 218 ------
NM_003405chr221600 ------
NM_003406chr821371 1332 21399 151 184 --
NM_003409chr1881307 1289 1227 576 566 507 423 182 11157 ----
NM_003410chrX72760 2391 2306 2183 1236 1194 268 12062 33102 2621 1930 --
NM_003411chrY31740 1260 648 11630 ----
NM_003413chrX41988 1924 1524 87 --11712 --
NM_003418chr3------1790
NM_003420chr32335 125 ------
NM_003423chr1952391 2138 1984 703 522 11900 ----
NM_003427chr61649 ------
NM_003432chr53515 214 43 ------
NM_003442chr112712 94 ------
NM_003452chr94710 671 381 57 21005 881 ----
NM_003453chr132484 107 ------
NM_003454chr1631514 1202 64 --11399 --
NM_003457chr17--1247 ----
NM_003458chr323804 3391 11160 1467 --
NM_003462chr131765 1453 1369 ------
NM_003463chr633072 1187 126 ------
NM_003467chr23444 437 357 1367 1137 198
NM_003468chr244071 3570 1390 65 1869 14121 --
NM_003469chr21427 ----1341
NM_003472chr6--21506 306 1617 --
NM_003477chr111614 ------
NM_003478chr1163035 2997 2773 2191 2153 323 1425 22063 689 --
NM_003482chr1262742 2470 2463 2359 1923 1775 22771 840 --12299
NM_003483chr1222816 2658 21937 1810 --12055
NM_003487chr172284 60 ------
NM_003489chr2143421 2305 858 22 22756 824 ----
NM_003498chr1682529 2422 2060 1080 998 677 644 288 ------
NM_003505chr731886 1636 329 ----1347
NM_003506chr841202 1110 1055 907 11079 ----
NM_003507chr21594 --21507 142 11693
NM_003557chr131490 1404 485 --1436 --
NM_003558chr92698 143 ------
NM_003563chr1741259 1185 1003 390 ------
NM_003565chr1221405 1102 --1693 --
NM_003566chr1263212 2733 1222 1187 616 416 1852 33251 3118 2856 --
NM_003567chr12314 74 ------
NM_003574chr1865802 4808 3940 1047 926 279 24436 4050 45360 4389 1863 543 --
NM_003576chr1382777 2738 2695 2613 2196 2109 1907 30 32923 2328 253 12014 12050
NM_003580chr81106 ----1517
NM_003581chr2----11063 --
NM_003583chr1253832 3630 1278 1041 452 43655 347 165 88 12590 1198
NM_003589chr131309 --2209 197 --
NM_003590chr263894 3673 3615 2886 2794 1055 1795 162 --
NM_003592chr71481 ------
NM_003597chr242170 1505 902 222 1377 2468 208 --
NM_003603chr422066 642 --12115 --
NM_003607chr184101 4080 3881 2971 2889 2769 1642 143 ------
NM_003615chr343684 3614 3603 3161 2205 118 33646 1282 871 1583
NM_003618chr231332 1205 1108 ------
NM_003620chr174874 801 138 25 ------
NM_003622chr1232411 1748 213 22198 1637 ----
NM_003626chr1111279 1298 --1148
NM_003628chr21128 ------
NM_003629chr163372 768 264 236 181 27 ----152
NM_003630chr62695 580 --1199 --
NM_003644chr1786610 5054 4572 2348 1706 1097 818 303 24535 4152 14429 --
NM_003654chr11--2562 65 ----
NM_003659chr2148 ----11055
NM_003663chr383417 2825 2375 1198 1055 844 269 117 21012 482 ----
NM_003668chr12123 ------
NM_003670chr331327 1064 903 11181 170 --
NM_003671chr953353 3292 2822 848 376 12981 12269 --
NM_003672chr181987 1675 1669 719 692 466 239 30 11369 --1535
NM_003676chr11645 ------
NM_003677chr1241679 1521 902 323 ----11903
NM_003684chr1--1701 ----
NM_003685chr194927 897 837 818 1735 --1715
NM_003692chr92244 154 1187 ----
NM_003701chr133953 918 709 1214 ----
NM_003705chr22786 223 ------
NM_003713chr151585 1131 560 482 27 --21121 55 --
NM_003716chr32877 713 ------
NM_003718chr72564 393 ------
NM_003722chr362591 2457 2004 1852 1053 1039 --52416 2371 1943 774 567 --
NM_003735chr541737 680 568 445 ------
NM_003736chr541737 680 568 445 ------
NM_003741chr31378 ------
NM_003743chr22785 187 --11769 --
NM_003744chr1421128 376 --1863 --
NM_003749chr1321805 98 ----11796
NM_003750chr102964 384 --1697 --
NM_003759chr464218 3689 1396 947 937 193 1356 23378 240 12640
NM_003763chr2062598 2021 671 253 194 188 1427 ----
NM_003772chr1111019 1929 1905 --
NM_003774chr1263305 2893 1184 970 939 233 13212 ----
NM_003777chr71557 ------
NM_003783chr12478 89 ----21223 1091
NM_003784chr18----2702 620 --
NM_003786chr171359 ------
NM_003787chr1831058 682 512 --21410 1353 --
NM_003794chr32916 682 ------
NM_003800chr641659 1644 1528 1507 11517 22250 580 --
NM_003816chr841498 1474 1238 335 --11225 --
NM_003825chr1571289 611 573 555 352 285 82 --1486 --
NM_003829chr91771 1251 ----
NM_003831chr1821575 1548 11518 --11314
NM_003845chr12187 ------
NM_003860chr111141 --1348 --
NM_003861chr1452674 2648 1875 376 318 ------
NM_003864chr4273 53 ------
NM_003873chr1031013 602 590 12064 11986 --
NM_003878chr81195 ------
NM_003884chr361854 1781 1430 1291 649 558 --168 --
NM_003885chr1752485 2369 2304 137 68 --1779 --
NM_003887chr241564 1558 1445 358 1173 31551 1415 748 --
NM_003893chr10----1493 --
NM_003895chr2162008 1648 1625 787 428 202 ------
NM_003899chr1372337 1766 954 791 380 295 37 12021 ----
NM_003901chr1062640 2374 2073 1975 155 49 1182 ----
NM_003902chr12788 103 2731 217 1827 --
NM_003906chr21--150 ----
NM_003908chr201320 11176 ----
NM_003909chr832332 2295 286 12440 1628 --
NM_003913chr664087 3722 3027 1375 988 857 1325 23356 1316 11391
NM_003921chr131799 1786 332 21265 1156 ----
NM_003922chr151372 1171 ----
NM_003924chr431671 1448 1400 11254 ----
NM_003927chr183844 752 331 ------
NM_003930chr742422 2283 2136 1678 --1448 31890 1704 255
NM_003931chr6--1517 ----
NM_003932chr2261798 1778 1640 728 696 659 ------
NM_003934chr921259 1161 21241 73 1349 --
NM_003947chr31873 --1412 --
NM_003948chr452647 2631 2180 1690 287 ----11715
NM_003953chr142451 2187 2162 255 --32796 572 561 --
NM_003955chr1761418 1387 1302 1296 1290 1284 --11277 --
NM_003957chr111773 ------
NM_003966chr596629 6406 5852 2789 2689 2663 1934 1328 281 11556 --1236
NM_003971chr171415 ------
NM_003972chr101365 2389 287 ----
NM_003980chr631493 1126 461 21188 526 1110 --
NM_003983chr1684165 3792 3704 3175 3108 2968 529 247 --1398 --
NM_003994chr1264242 3846 3274 2934 1496 131 13957 11389 --
NM_003998chr41615 ------
NM_004006chrX52588 2416 2300 2118 666 1121 --12512
NM_004007chrX52588 2416 2300 2118 666 1121 --12512
NM_004009chrX52588 2416 2300 2118 666 1121 --12512
NM_004010chrX52588 2416 2300 2118 666 1121 --12512
NM_004011chrX52588 2416 2300 2118 666 1121 --12512
NM_004012chrX52588 2416 2300 2118 666 1121 --12512
NM_004013chrX52588 2416 2300 2118 666 1121 --12512
NM_004014chrX52588 2416 2300 2118 666 1121 --12512
NM_004015chrX52588 2416 2300 2118 666 1121 --12512
NM_004016chrX52502 2330 2214 2032 580 135 --12426
NM_004017chrX52588 2416 2300 2118 666 1121 --12512
NM_004018chrX52502 2330 2214 2032 580 135 --12426
NM_004020chrX52588 2416 2300 2118 666 1121 --12512
NM_004021chrX52502 2330 2214 2032 580 135 --12426
NM_004022chrX52502 2330 2214 2032 580 135 --12426
NM_004023chrX52502 2330 2214 2032 580 135 --12426
NM_004028chr1833845 1321 855 23483 228 1476 --
NM_004035chr1765182 5011 4750 1196 1022 954 24609 368 14470 --
NM_004040chr241325 1262 1085 850 1967 11347 --
NM_004046chr18137 ------
NM_004060chr511213 1865 ----
NM_004061chr52262 195 ------
NM_004063chr821069 981 ------
NM_004067chr71998 11050 ----
NM_004080chr7----2546 128 1183
NM_004081chrY4283 254 231 150 --11598 1420
NM_004087chr351581 1345 1301 1270 609 1656 ----
NM_004089chrX31287 1029 68 --154 --
NM_004094chr1463068 932 658 568 258 77 1782 1889 12387
NM_004096chr1041894 1549 770 307 12144 ----
NM_004098chr1021119 498 ------
NM_004100chr641668 1057 1011 227 1879 ----
NM_004105chr21849 1954 --1412
NM_004117chr642221 2004 775 459 12180 11660 11529
NM_004124chr1493454 2605 2566 2499 2365 2339 1382 1025 711 13228 --12222
NM_004126chr72288 53 ------
NM_004136chr1573189 3020 2505 2188 1230 1219 349 --12729 12346
NM_004145chr192377 354 ------
NM_004161chr221497 1030 11292 1457 --
NM_004162chr311309 ------
NM_004170chr961740 1402 748 556 542 224 1355 ----
NM_004171chr11138767 8746 8637 7364 6700 5832 3835 3119 2392 1761 1334 593 280 38394 6080 2783 25998 2601 13434
NM_004172chr542058 1910 1322 402 ------
NM_004180chr23405 181 31 2419 53 ----
NM_004205chr11--1541 ----
NM_004225chr841438 1251 597 379 ------
NM_004229chrX2367 356 11645 --11652
NM_004232chr1873379 3235 1510 1401 1008 187 113 23510 1266 --23001 498
NM_004235chr92872 735 ------
NM_004237chr53918 580 329 ------
NM_004238chr21306 --1229 1266
NM_004242chr6--1288 1320 --
NM_004244chr12----2439 109 --
NM_004253chr92715 44 ------
NM_004261chr15807 784 677 302 79 --1938 --
NM_004263chr261621 1346 514 418 303 105 ------
NM_004268chr111241 1109 1821 --
NM_004272chr541910 1663 1567 1395 11873 1585 --
NM_004274chr1473186 1160 1062 1038 487 355 214 --22902 730 --
NM_004277chr621481 166 21669 1150 11172 --
NM_004280chr62176 163 ------
NM_004281chr10--195 ----
NM_004282chr61156 --179 --
NM_004286chr2221998 1754 ----1273
NM_004290chr541333 925 519 37 1871 ----
NM_004291chr5--1424 --1102
NM_004293chr962699 1110 676 101 45 25 13267 ----
NM_004302chr1252959 2809 2674 2185 1955 22758 1988 ----
NM_004326chr13382 376 204 ------
NM_004327chr221217 1304 ----
NM_004329chr1041443 1347 232 98 2258 48 ----
NM_004331chr832046 1674 451 1115 12554 --
NM_004338chr18105434 4725 4373 2451 2438 2155 1980 1571 1167 634 37045 5734 4977 14836 36951 6153 5926
NM_004342chr732054 1530 383 --1377 --
NM_004346chr42384 24 ------
NM_004349chr851125 1076 873 420 84 ------
NM_004354chr42728 651 ------
NM_004360chr1641909 1884 385 70 ------
NM_004365chr53269 258 230 --195 --
NM_004380chr1682025 1011 959 254 234 207 74 37 12193 ----
NM_004384chr541989 1971 370 212 --22370 308 --
NM_004385chr51249 ------
NM_004392chr1372482 2076 1880 687 321 166 128 12546 11830 1241
NM_004393chr321458 398 12330 --1493
NM_004395chr51736 ------
NM_004396chr172190 32 ------
NM_004397chr1194304 4213 2991 2655 1529 1130 541 420 87 1249 33724 3513 1006 --
NM_004412chr10135676 4668 4631 4450 4124 4091 3793 3759 1892 1850 1537 842 711 15476 1381 --
NM_004417chr52530 451 ------
NM_004426chr124695 424 232 203 --1495 --
NM_004428chr12785 758 1611 1743 --
NM_004429chrX41363 1357 420 112 1371 ----
NM_004430chr812230 32787 2512 1821 ----
NM_004432chr921999 1905 1227 ----
NM_004437chr192586 1404 1310 1229 1027 925 630 269 260 1905 22438 1303 --
NM_004438chr242925 2083 946 300 12769 ----
NM_004440chr611890 11265 ----
NM_004447chr122803 33 ------
NM_004448chr171502 ----1483
NM_004449chr2131163 1105 391 ----11323
NM_004454chr372147 2135 2129 1406 814 585 84 ------
NM_004457chr211577 ----1299
NM_004458chrX52642 1651 284 188 178 22649 256 ----
NM_004459chr1732081 1498 1333 42000 1349 125 83 ----
NM_004464chr4114126 3895 3631 3090 2913 2744 1379 632 414 160 69 24079 597 ----
NM_004480chr145550 526 520 514 504 --1827 --
NM_004481chr122013 581 12393 --12355
NM_004482chr2----2364 76 --
NM_004491chr1954272 4256 4184 1729 1683 ------
NM_004494chr111314 1899 ----
NM_004500chr142688 205 1286 31858 1422 334 --
NM_004501chr153697 3034 2649 557 250 11633 1960 --
NM_004502chr171205 ------
NM_004504chr262809 2557 2481 1112 648 640 --11052 --
NM_004505chr1742025 1464 570 435 ------
NM_004506chr62695 667 ------
NM_004514chr1753052 2225 1925 559 553 12037 ----
NM_004520chr51269 ------
NM_004523chr101527 --1544 --
NM_004524chr17------2281 205
NM_004525chr241532 1444 1112 942 ------
NM_004529chr941302 83 54 40 ----11463
NM_004535chr203498 321 309 ------
NM_004537chr1231465 131 125 ----2250 171
NM_004543chr23362 107 88 ------
NM_004571chr2163273 2926 1054 763 351 61 --12943 --
NM_004575chr431488 1204 1132 31514 566 356 11255 --
NM_004576chr52284 164 --1374 158
NM_004577chr72532 224 ------
NM_004578chr12907 702 --2609 71 --
NM_004586chrX55338 4231 1265 459 54 14876 24772 4382 25087 4945
NM_004593chr32771 300 ------
NM_004595chrX4310 304 185 110 ------
NM_004596chr191217 ------
NM_004598chr532745 205 28 11301 1530 12733
NM_004600chr141457 550 529 275 ------
NM_004612chr994457 3948 3437 1601 1465 786 774 592 269 23719 1560 24211 478 --
NM_004615chrX1748 ------
NM_004627chr212138 83 ------
NM_004642chr125626 459 229 220 112 ------
NM_004643chr145866 714 706 690 684 ------
NM_004654chrY1201 --11115 --
NM_004655chr1751215 1024 896 881 450 ------
NM_004660chrY42293 2090 607 528 --2851 577 --
NM_004661chr5--11084 ----
NM_004663chr1541236 1162 974 556 ------
NM_004670chr1011185 21711 1298 11458 --
NM_004671chr18177 --1311 --
NM_004674chr8264 58 ------
NM_004685chr1372751 2208 2015 1974 554 521 206 ------
NM_004687chr1741620 1585 1381 645 ------
NM_004694chr17--1205 ----
NM_004701chr152159 120 ------
NM_004703chr1711957 2849 41 ----
NM_004707chr541387 540 320 70 ------
NM_004709chrX3333 177 143 ----2702 79
NM_004715chr182718 176 1167 ----
NM_004719chr1252670 2218 2210 1095 642 --11875 --
NM_004725chr104575 269 256 145 ------
NM_004726chrX104460 4295 4202 3969 3710 1840 1833 1701 1568 1411 13657 13599 --
NM_004730chr521608 1467 ----21939 266
NM_004731chr12267 55 --11839 1162
NM_004733chr3147 ------
NM_004734chr1352767 2048 1212 723 648 13222 ----
NM_004736chr132147 1911 619 2796 417 ----
NM_004740chr17136 ------
NM_004741chr1031559 193 177 ----1590
NM_004742chr331758 1650 1374 1556 11594 --
NM_004744chr453905 3754 3608 849 309 --12797 --
NM_004745chr8106895 6666 6512 6360 4395 4361 2614 1747 1414 638 15579 14863 17042
NM_004747chr1031420 1329 494 ------
NM_004748chr1513519 11273 14178 1886
NM_004760chr762350 2281 1879 1735 577 444 ----11711
NM_004762chr1741985 1971 1893 1772 11946 11853 --
NM_004768chr11234 ------
NM_004772chr5------1174
NM_004774chr1763085 2896 2518 1975 1025 309 22030 622 ----
NM_004775chr1852241 1768 677 563 397 --11947 12042
NM_004779chr511024 31316 461 164 ----
NM_004781chr121120 153 ------
NM_004781chr121120 153 ------
NM_004785chr161360 ------
NM_004788chr1142416 2363 2219 79 --11753 --
NM_004791chr131118 ------
NM_004792chr21197 ------
NM_004794chrX----144 --
NM_004796chr1492448 2166 1652 1525 612 557 436 149 30 ------
NM_004798chr2063588 3202 2660 1254 499 359 ------
NM_004800chr13284 66 ------
NM_004805chr22410 300 ------
NM_004808chr1032710 674 314 21309 1181 12249 --
NM_004817chr93794 566 79 ----1542
NM_004821chr51509 ----1674
NM_004824chr631261 1060 163 ----11431
NM_004834chr253091 1011 897 738 138 21182 977 ----
NM_004836chr24669 220 187 98 1848 ----
NM_004842chr6----1601 --
NM_004845chrX73933 3644 3067 2988 2947 649 157 ------
NM_004850chr231425 1419 511 --11408 --
NM_004855chr151211 ------
NM_004857chr1443939 3170 2914 1010 14562 24642 4135 1412
NM_004859chr1792843 2080 2042 1937 980 934 860 853 98 11187 22620 972 --
NM_004863chr1495186 4394 3732 3446 2043 1957 1134 712 522 11964 23363 1827 --
NM_004867chrX3512 464 199 ------
NM_004869chr1811611 ----1543
NM_004871chr1743038 2917 2804 290 1212 34301 3458 2897 --
NM_004873chr1483121 3012 2266 928 751 618 541 516 22970 254 12931 12124
NM_004874chr82379 189 ------
NM_004879chr112301 238 ------
NM_004883chr5--1199 ----
NM_004893chr54416 399 158 111 1178 ----
NM_004896chr1011201 1523 ----
NM_004898chr482841 2608 2271 1870 945 691 356 223 --1746 11940
NM_004902chr20--1322 ----
NM_004904chr7116296 6282 6010 5861 4980 2519 2310 2050 1958 605 240 24130 862 35414 4305 108 --
NM_004906chr63143 130 117 --2534 470 1608
NM_004912chr71480 --21292 51 --
NM_004921chr162496 2463 2355 1757 432 270 1650 ----
NM_004926chr1451863 1685 1664 1539 1332 ------
NM_004927chr113583 280 270 ----11425
NM_004946chr51416 1333 ----
NM_004947chr341903 1688 1601 290 12333 ----
NM_004949chr1872177 1780 1754 1348 852 773 312 ----11858
NM_004956chr763398 2950 1506 526 300 29 --11494 --
NM_004965chr21----195 1303
NM_004966chr10------1998
NM_004967chr41497 ------
NM_004969chr101578 ------
NM_004972chr94962 820 772 51 --1167 1376
NM_004973chr621393 1255 --21767 1714 --
NM_004985chr12113815 3312 3003 2960 2861 1528 1337 1312 921 208 201 1427 43961 3399 1620 168 --
NM_004992chrX118373 7073 7016 6310 5804 5412 5316 3271 1967 932 187 37041 2754 1954 48280 6253 5425 1827 --
NM_004992chrX118373 7073 7016 6310 5804 5412 5316 3271 1967 932 187 37041 2754 1954 48280 6253 5425 1827 --
NM_004993chr1451230 976 502 484 231 --11502 --
NM_004995chr1411505 ------
NM_004996chr1651702 1512 647 508 320 11196 ----
NM_004999chr6114146 3809 3211 2876 2844 1745 1714 1187 763 751 574 11627 23744 1685 11253
NM_005010chr7--1710 ----
NM_005011chr761674 1618 1607 1506 1339 110 --1497 --
NM_005016chr122310 234 ------
NM_005022chr172217 207 ------
NM_005023chr541514 1485 1095 614 1221 ----
NM_005028chr1031951 1900 694 --21936 467 --
NM_005036chr2288335 7683 5830 3173 1928 1404 932 37 26096 1169 11490 --
NM_005045chr72861 832 ------
NM_005053chr192585 56 ------
NM_005054chr221410 1278 11214 11522 --
NM_005056chr12114954 4863 4363 3823 3744 3686 3628 3570 1977 1812 977 11389 ----
NM_005057chr131871 723 707 11181 ----
NM_005063chr1053629 3481 3429 2568 988 --23189 950 --
NM_005065chr1444127 3842 3721 1141 --1672 25023 352
NM_005066chr1140 1779 ----
NM_005067chr33971 812 797 164 1992 --
NM_005078chr1541442 1429 325 215 11865 ----
NM_005087chr31828 --129 --
NM_005093chr2055236 4291 1374 1355 705 15182 14713 --
NM_005095chr142181 1575 871 199 ----22193 219
NM_005096chrX--11125 ----
NM_005102chr23794 653 210 1319 ----
NM_005104chr61597 1758 ----
NM_005109chr382394 2383 1832 1826 787 560 478 139 1733 ----
NM_005112chr42918 171 1851 --1700
NM_005114chr43551 204 43 ------
NM_005116chr2064472 4418 4372 3386 1647 1447 14288 24324 1507 14449
NM_005119chr13978 340 252 ------
NM_005121chr1773517 3500 2531 1454 1045 966 392 13299 --23152 459
NM_005125chr111150 ------
NM_005126chr321947 383 --11878 --
NM_005134chr181844 1726 ----
NM_005135chr1583871 3828 3590 2950 1059 896 820 719 --13785 --
NM_005156chr995056 4645 4163 3698 3577 3401 1414 1142 987 12005 24327 3319 24970 1219
NM_005160chr22126601 5556 5454 4307 4267 2408 1811 1519 1386 1283 756 731 36761 5692 1729 24375 207 --
NM_005163chr142905 145 2668 82 1719 --
NM_005168chr261464 1395 715 610 471 336 ----1210
NM_005171chr12166 --1890 11073
NM_005190chr62416 215 1804 1150 --
NM_005194chr201470 ------
NM_005197chr14125751 5337 4191 4009 1861 1554 1527 1521 1514 1508 1502 111 --35079 3856 1333 25145 3967
NM_005201chr32922 339 ------
NM_005203chr10166 ------
NM_005207chr2283476 3277 2884 2686 2598 1220 584 550 1914 22659 220 --
NM_005214chr2--11073 ----
NM_005222chr71953 ------
NM_005224chr192546 456 1590 ----
NM_005229chrX1453 ------
NM_005230chr122226 169 2615 233 ----
NM_005235chr2107697 6604 6161 5038 2962 2372 1110 962 647 103 ----14986
NM_005238chr1153430 2653 1319 1036 515 2667 418 23524 3470 --
NM_005239chr2141760 757 733 291 ----1814
NM_005241chr31467 --11021 --
NM_005242chr521316 531 --11129 --
NM_005243chr221322 ------
NM_005245chr4170 1743 --1698
NM_005252chr141616 1643 1537 --
NM_005254chr153927 345 289 11400 2216 150 --
NM_005256chr111621 ------
NM_005257chr1821126 140 ----11379
NM_005259chr23353 307 205 --1223 --
NM_005264chr102610 372 ------
NM_005273chr7----1340 --
NM_005277chr431901 397 259 1650 11509 --
NM_005295chr7143 ------
NM_005296chrX2822 408 ----1147
NM_005302chr71296 ----162
NM_005308chr101335 ------
NM_005311chr742882 2514 2112 485 11763 ----
NM_005313chr1511044 ------
NM_005316chr1151050 787 744 418 404 ------
NM_005318chr2231050 813 414 ------
NM_005328chr81588 2779 512 --1615
NM_005329chr1642238 2128 1973 382 1778 12346 --
NM_005338chr744059 648 635 206 ------
NM_005339chr441675 1591 1302 1239 1413 2881 753 1964
NM_005342chrX62783 2424 2051 1847 823 381 22618 685 --1670
NM_005349chr41575 --1247 --
NM_005358chr131353 21495 369 11842 --
NM_005359chr18176551 6211 5434 5335 5126 4999 4437 2407 2254 2008 1933 1921 1503 1440 1421 616 395 --24270 1110 --
NM_005373chr11516 --11245 11499
NM_005375chr63978 861 345 ------
NM_005376chr111028 1853 1222 --
NM_005381chr23397 335 329 156 ----
NM_005385chr372603 2289 1898 1834 692 359 351 1527 12050 --
NM_005387chr11--1679 ----
NM_005388chr931656 1337 98 --1690 --
NM_005392chr931877 1517 1166 11660 ----
NM_005398chr1021212 911 1459 ----
NM_005399chr164422 4344 915 864 656 484 --23469 470 --
NM_005400chr272750 2506 2244 1960 1210 897 201 32010 1972 1065 22638 325 --
NM_005406chr185448 442 326 169 133 --21025 469 --
NM_005407chr1421452 1233 11355 --1109
NM_005414chr3144 ------
NM_005418chr112506 197 ------
NM_005426chr12788 782 1932 1898 --
NM_005433chr1862719 2664 2114 2089 1040 553 1108 2484 448 11738
NM_005436chr1084006 3553 3465 3455 3443 3422 2907 1217 --13691 --
NM_005445chr101100 ------
NM_005450chr171227 ------
NM_005460chr51508 ------
NM_005461chr2061967 1945 1770 1570 1450 590 21868 1818 11505 --
NM_005465chr11197 --2353 191 --
NM_005476chr911185 --158 11303
NM_005487chr2232056 1653 659 11429 --12033
NM_005493chr62591 115 ------
NM_005494chr71535 ------
NM_005497chr17126170 5818 5760 5463 5120 4714 4692 2247 1565 1515 1341 1105 24998 203 2770 293 2561 472
NM_005499chr192526 197 1469 ----
NM_005502chr933298 3045 1065 --2511 243 --
NM_005504chr1255014 4085 1949 1462 502 16057 15897 26115 5771
NM_005506chr442909 2783 795 220 12734 21085 1054 --
NM_005509chr53675 664 343 1111 ----
NM_005517chr141083 237 157 73 1342 ----
NM_005524chr32262 126 ------
NM_005530chr152394 240 ------
NM_005539chr1041296 535 313 226 ----1322
NM_005542chr761925 1910 1520 1442 1227 362 ------
NM_005565chr52431 390 ------
NM_005570chr181986 ----11119
NM_005573chr53688 286 162 ------
NM_005576chr151296 1228 ----
NM_005578chr395108 4472 4450 3790 3368 2022 1950 1070 102 --21658 360 11671
NM_005585chr152389 141 ------
NM_005587chr151971 --1309 --
NM_005591chr1192768 2255 2016 2010 1085 737 436 364 165 1501 21724 542 --
NM_005595chr13955 866 643 --1633 --
NM_005596chr9106308 6261 4949 4578 3995 1859 1792 1769 1173 454 --45202 4379 2331 1004 --
NM_005599chr141456 1096 1086 334 --21535 1142 --
NM_005604chr672399 2386 1910 1739 691 491 101 1906 ----
NM_005607chr82247 198 --1694 --
NM_005610chr12657 638 1709 1309 --
NM_005611chr1611127 11029 1836 --
NM_005613chr132051 656 319 ------
NM_005614chr711099 ------
NM_005618chr62489 141 --1601 --
NM_005625chr82751 381 ------
NM_005634chrX2463 141 ------
NM_005637chr18112016 1926 1722 1624 1617 1610 1604 1596 1430 703 667 --1106 --
NM_005638chrX31508 1403 433 21622 295 ----
NM_005639chr1241592 1310 1265 1196 1362 --11367
NM_005647chrX53243 3148 3131 2141 564 ----23267 179
NM_005648chr81142 ------
NM_005650chr2231323 1211 178 ------
NM_005655chr831257 1199 1024 ------
NM_005657chr151116 ------
NM_005660chrX----1228 --
NM_005665chr1154946 4678 4633 4248 3337 3102 1843 1779 1713 951 944 822 502 484 248 --21485 1442 14756
NM_005667chr2174 ------
NM_005668chr574324 3846 1686 1608 1285 971 522 --34160 3493 1380 1634
NM_005685chr7----1100 --
NM_005688chr3--1221 21124 214 --
NM_005708chr131329 ------
NM_005711chr52777 95 1151 1434 --
NM_005713chr51105 ------
NM_005715chr642692 1075 1029 690 12016 150 --
NM_005717chr161255 1196 1082 942 502 319 ------
NM_005721chr22701 195 --2879 252 --
NM_005722chr272401 2304 1990 1640 1606 777 129 ----11765
NM_005733chr51183 ------
NM_005734chr113704 672 252 ------
NM_005737chr252787 2451 1979 748 507 ------
NM_005738chr741773 1448 1440 655 11942 22015 1476 --
NM_005739chr1542406 1628 1572 895 12057 12386 11920
NM_005740chr222834 87 1918 ----
NM_005746chr762652 2502 2014 1816 1805 1775 2812 654 --11013
NM_005748chr12103263 3073 2587 2544 1185 874 624 559 456 120 ------
NM_005752chr1621215 1126 ------
NM_005759chr274423 4014 3927 3887 1456 826 388 23610 1754 --14519
NM_005762chr19--1130 ----
NM_005765chrX3563 154 127 ------
NM_005766chr133347 225 149 --1366 --
NM_005768chr121571 --1717 --
NM_005776chr14--1707 ----
NM_005779chr562717 2707 794 756 440 251 11254 21048 424 --
NM_005780chr13198 --1374 --
NM_005789chr1732104 402 155 2607 123 ----
NM_005797chr1141476 1416 1299 115 --11661 11275
NM_005798chr13113676 3529 3355 3335 3327 2076 1992 946 938 333 24 25204 4057 24332 1633 12018
NM_005801chr173763 746 739 ------
NM_005802chr91744 ------
NM_005807chr1--1123 ----
NM_005808chr352535 2332 1047 858 151 22561 2378 ----
NM_005813chr242222 543 356 70 --11691 --
NM_005822chr671960 1909 1719 1712 1470 876 216 ------
NM_005826chr13598 447 417 1513 ----
NM_005828chr1751645 1609 1333 936 222 11533 11911 --
NM_005832chr3----11316 --
NM_005839chr17892 801 696 682 367 341 329 ------
NM_005840chrX86981 6574 4889 2661 2404 2088 705 176 17059 1911 --
NM_005841chr45388 76 70 64 57 ------
NM_005842chr131635 1483 1275 --
NM_005843chr261755 1727 1536 1487 244 163 --11233 11449
NM_005845chr1331732 328 206 1341 21350 50 --
NM_005857chr141473 974 946 221 2208 77 11057 11114
NM_005859chr511232 --1520 --
NM_005862chr32269 111 1887 ----
NM_005863chr106996 920 557 134 124 60 1525 ----
NM_005871chr1031067 684 677 11101 ----
NM_005875chr3139 ------
NM_005880chr1641570 563 551 304 11247 1543 --
NM_005884chr193800 261 166 ------
NM_005885chr521389 1368 1100 ----
NM_005895chr12104071 3737 3517 3474 3274 3196 544 477 106 83 14024 ----
NM_005897chr11107 1869 1806 --
NM_005898chr1152635 2385 2211 1101 950 13020 32753 2679 2072 --
NM_005899chr1741603 1512 1134 1083 1409 1227 --
NM_005900chr41844 ----1961
NM_005901chr18228690 8541 8365 8296 7623 7429 6762 6633 6545 6212 6200 6072 3448 3066 2767 2620 2147 1594 1048 675 665 658 46249 5311 1363 1224 57877 7564 6306 6150 1327 17297
NM_005902chr1554133 1720 1530 1503 583 14011 ----
NM_005903chr5105208 4545 3994 1754 1089 1010 622 579 515 383 --44748 4217 2093 1786 24567 872
NM_005904chr1841471 1437 215 113 11094 ----
NM_005907chr631667 1587 278 1232 1218 1117
NM_005909chr551514 1505 1265 563 441 --1168 --
NM_005920chr163844 2833 1456 1340 537 518 --1843 --
NM_005923chr61484 1518 ----
NM_005924chr72328 138 11142 ----
NM_005933chr1122505 943 ------
NM_005934chr1942622 2116 1020 543 12465 ----
NM_005935chr484191 3936 3646 3638 1948 1780 946 481 11442 25153 4919 24200 3497
NM_005937chr1774160 3646 3429 3316 1637 1540 1526 ------
NM_005938chrX1219 ------
NM_005941chr851485 801 416 244 212 11129 ----
NM_005955chr1115267 4917 4575 4459 4401 3783 3665 3432 1871 765 395 ------
NM_005962chr1011583 --11795 --
NM_005962chr1011583 --11795 --
NM_005964chr1731202 1092 407 ------
NM_005966chr222356 1904 ----22125 1817
NM_005967chr121463 ------
NM_005977chr132879 30 1251 ----
NM_005994chr17----1720 --
NM_005999chr141495 1253 1112 982 ------
NM_006007chr9133983 3969 3812 3803 3796 3626 2838 1376 1349 1207 1182 1063 108 21519 36 --21323 932
NM_006011chr1543965 3179 856 769 14223 ----
NM_006015chr131156 1138 1095 1398 ----
NM_006016chr662182 2170 2114 1433 706 515 ----11787
NM_006017chr431132 803 258 ------
NM_006035chr1431326 1220 159 11228 ----
NM_006037chr264726 4437 3500 3358 1915 1729 34355 1710 1694 24427 3391 11502
NM_006047chr2053515 3408 2686 1255 628 1997 --12468
NM_006048chr11850 ------
NM_006055chr283212 2776 2401 2371 2272 2186 803 622 1910 1772 --
NM_006060chr754097 3228 3154 141 134 11688 13543 --
NM_006063chr2172 ------
NM_006067chr162829 299 1166 --1416
NM_006079chr62202 191 1280 ----
NM_006080chr722876 2323 1973 1740 --
NM_006086chr161232 ------
NM_006089chrX41898 1230 1188 161 1654 3663 271 84 --
NM_006090chr13765 722 695 ------
NM_006092chr7129 ------
NM_006094chr862217 1525 1487 861 771 79 ------
NM_006095chr4104355 4238 4101 4048 3791 3690 3233 1425 1374 553 --1910 --
NM_006100chr33243 212 40 2557 228 --1591
NM_006106chr1182140 1367 1352 880 739 730 723 86 ------
NM_006107chr172507 337 --1157 --
NM_006108chr1141628 1563 571 101 --12076 2919 691
NM_006121chr123391 176 33 ------
NM_006135chr1--1422 11228 --
NM_006136chr721234 1052 --2376 283 --
NM_006141chr1632203 2170 396 2982 887 199 12266
NM_006153chr32267 227 ------
NM_006154chr1532953 670 42 32764 1141 29 1359 --
NM_006157chr112102 85 ------
NM_006158chr811451 ------
NM_006160chr1721072 623 ------
NM_006164chr2----136 --
NM_006166chr1232646 860 677 ------
NM_006180chr921581 569 1561 ----
NM_006186chr21476 ------
NM_006187chr1232611 2469 2052 ----22961 2560
NM_006190chr21297 --21092 946 --
NM_006195chr931144 146 79 ------
NM_006197chr861991 1966 631 496 284 205 ----11687
NM_006203chr585422 5153 4932 3960 1863 1268 941 695 45527 4420 1239 225 1173 25609 1485
NM_006206chr442912 2160 1839 999 --21100 774 --
NM_006207chr81304 ----1248
NM_006209chr82154 59 --1436 --
NM_006211chr8----1233 --
NM_006212chr1135394 5250 5074 5047 4607 3593 1992 1630 1491 1468 965 774 188 1834 33385 1902 749 11167
NM_006216chr22526 81 ----1126
NM_006223chrX127 ------
NM_006235chr1111325 ------
NM_006237chr1362267 2248 2128 852 653 318 11436 ----
NM_006238chr6--12041 ----
NM_006241chr382205 713 703 697 686 675 668 74 12005 1744 11855
NM_006243chr1139 1944 ----
NM_006246chr1431194 1059 74 11106 ----
NM_006251chr563231 2995 2795 2766 964 506 --12986 --
NM_006252chr1107379 7041 6251 6066 5524 2546 2229 2118 1867 1860 34739 2284 2247 46591 5201 1224 531 26465 4664
NM_006256chr132298 1931 982 1117 22647 100 --
NM_006265chr851505 1477 1385 1171 952 --1334 --
NM_006268chr1141035 865 820 387 11215 ----
NM_006275chr2062191 1906 1647 847 344 279 --11621 --
NM_006281chr811142 123 ----
NM_006281chr811142 123 ----
NM_006282chr2094482 4404 3037 878 439 338 310 295 246 24694 4366 1588 11692
NM_006289chr91358 ------
NM_006300chr1922357 1664 ------
NM_006304chr71127 ------
NM_006306chrX55907 5879 4599 1680 835 33830 1939 1806 14104 --
NM_006311chr17--1284 150 1260
NM_006312chr121609 ------
NM_006313chr1231600 1372 658 --1401 --
NM_006315chr452943 2936 1203 1057 285 12781 23893 1618 14548
NM_006320chr4--1433 ----
NM_006325chr12137 ------
NM_006328chr111110 ------
NM_006329chr14--1512 ----
NM_006335chr1--182 ----
NM_006345chr4--2458 233 --11278
NM_006350chr5----152 --
NM_006352chr172039 1554 395 366 359 213 127 --21801 351 --
NM_006353chr651206 392 242 229 74 ------
NM_006359chrX3343 264 189 ----1944
NM_006364chr1451154 994 902 827 229 1940 ----
NM_006366chr621251 458 ------
NM_006374chr23591 535 44 ------
NM_006375chrX21418 769 11432 ----
NM_006379chr731936 569 131 ----1540
NM_006380chr1764255 4018 3829 1672 1513 522 1276 13361 14137
NM_006386chr2262322 2117 1852 1554 697 379 ----1892
NM_006387chr191829 ----199
NM_006390chr1251748 1462 1188 618 320 11230 ----
NM_006393chr1064465 3679 3200 2804 1481 945 12900 ----
NM_006401chr91393 ------
NM_006407chr321433 83 11129 --1465
NM_006413chr1031434 319 134 ------
NM_006415chr91994 ------
NM_006420chr2073412 3044 2829 1230 655 552 484 ----12545
NM_006421chr821163 289 --11250 --
NM_006425chr51562 --1247 --
NM_006434chr1063004 2997 2083 1156 872 852 --32964 2822 2254 --
NM_006439chr41464 ------
NM_006447chr21--1194 ----
NM_006449chr241990 1626 1617 94 --1785 1534
NM_006451chr53972 799 25 ------
NM_006457chr463906 3531 2528 1514 1107 96 ----1506
NM_006460chr1731239 1228 180 1286 21791 235 --
NM_006464chr244628 4314 3856 250 --1934 --
NM_006467chr542218 1779 789 245 ------
NM_006469chr141526 1285 1189 393 21579 476 ----
NM_006472chr121295 354 2795 488 ----
NM_006482chr1253832 3630 1278 1041 452 43655 347 165 88 12590 1198
NM_006489chr1461977 1839 687 487 342 329 1731 189 11809
NM_006496chr13688 669 369 1513 --11700
NM_006504chr1042961 2138 2092 496 12640 ----
NM_006509chr19----1397 --
NM_006520chrX31630 1524 1298 --1444 --
NM_006526chr2031963 1648 529 ------
NM_006529chr451321 1246 1059 609 242 --31654 1496 1284 --
NM_006532chr1951833 1804 1754 1534 327 ------
NM_006534chr2053105 791 463 243 194 12546 13006 12470
NM_006537chr152123 54 ------
NM_006538chr263727 2763 1283 333 261 107 --1588 --
NM_006540chr851600 1210 1183 1171 113 ------
NM_006544chr14115909 5685 5503 5212 3800 3707 2354 2026 1910 1707 341 35477 4056 284 --24127 441
NM_006546chr1766614 6587 6308 4377 1722 408 --16397 --
NM_006547chr772048 1707 1625 1503 759 655 475 --21351 1309 1109
NM_006549chr1222948 138 1290 ----
NM_006558chr8----1381 --
NM_006559chr13405 372 115 ------
NM_006560chr111485 ------
NM_006561chr10146173 5879 5577 4420 4037 2027 1721 1574 1424 1299 1051 966 833 165 --55462 3911 3818 2066 549 24306 523
NM_006565chr1651062 499 422 411 348 ----1375
NM_006572chr1752182 603 486 66 41 12600 12520 --
NM_006575chr1441454 1145 997 448 ------
NM_006577chr221152 221 21262 981 ----
NM_006593chr2------1576
NM_006595chr1151533 413 391 286 179 --1450 --
NM_006599chr16187466 6792 6432 6196 6182 5705 5622 3131 2829 1917 1901 1710 1590 1367 1357 669 516 377 18182 16396 --
NM_006601chr121146 ------
NM_006603chrX1158 1475 21378 216 21756 1471
NM_006609chr252880 2630 2494 2399 889 11066 21842 220 1418
NM_006614chr373687 2803 1092 1014 694 622 358 11178 ----
NM_006620chr6104115 3439 3099 3032 1885 1326 934 669 412 353 34289 3761 107 ----
NM_006621chr12149 128 ----1637
NM_006624chr1062069 1941 1702 1694 589 57 --1180 --
NM_006626chr942291 983 852 483 ------
NM_006628chr15144568 3538 3277 3160 2883 2841 1841 1667 1185 1107 735 632 293 272 13140 1165 --
NM_006629chr1852414 2337 1824 1767 1089 11069 32180 1125 269 --
NM_006633chr5--2764 74 --1510
NM_006646chr1362829 2726 2039 685 451 439 ----22779 951
NM_006654chr1284340 4303 3797 3603 3523 3442 1642 931 12960 54756 4450 3576 852 776 143
NM_006660chr15----1248 --
NM_006662chr161339 ------
NM_006667chrX3284 241 101 1912 1122 --
NM_006675chr1232144 1055 974 23415 3404 ----
NM_006680chr111104 ------
NM_006682chr732080 1922 1102 1126 ----
NM_006690chr2022357 1659 ------
NM_006698chr20------11038
NM_006700chr12--1750 1102 --
NM_006703chr6--1190 ----
NM_006706chr52526 294 166 ----
NM_006717chr993153 3063 2710 2268 2121 1085 1036 985 858 ------
NM_006720chr1064855 4713 3585 3480 3460 1059 34362 3379 1019 54800 3575 3239 1698 947 13971
NM_006721chr101324 ------
NM_006722chr383082 3054 2209 1980 1142 1005 951 708 22761 2234 1736 --
NM_006729chrX75421 3476 2236 1799 1774 1246 302 --14538 --
NM_006734chr631605 58 52 --11118 --
NM_006736chr211904 ------
NM_006738chr1554525 3261 3124 2821 1641 ------
NM_006746chrX41552 1075 611 93 ------
NM_006751chr23979 778 717 1801 ----
NM_006754chr71845 ------
NM_006756chr831102 129 83 1234 11532 --
NM_006761chr173230 167 144 1844 --1179
NM_006763chr131858 1601 844 12092 1155 --
NM_006766chr841732 1053 898 705 --12155 --
NM_006769chr11562 ------
NM_006775chr653030 2523 2196 643 224 ----12576
NM_006777chrX92891 2399 1098 753 456 303 222 172 26 11078 22268 2187 12926
NM_006788chr182577 221 --11684 --
NM_006791chr154631 599 539 426 154 ----
NM_006801chr193662 582 266 --2246 201 --
NM_006803chr861845 1555 1437 831 713 214 --21581 1546 --
NM_006805chr541175 661 576 320 1285 ----
NM_006807chr17165 --31350 1237 409 --
NM_006808chr9----1157 --
NM_006813chr62807 226 ------
NM_006815chr1221172 950 --11307 1282
NM_006818chr11140 --1867 1772
NM_006822chr17----2606 534 --
NM_006823chr8--1449 11322 --
NM_006827chr1432911 2285 730 11198 21155 384 --
NM_006832chr142849 695 --1758 --
NM_006838chr122361 215 11279 ----
NM_006851chr1232771 823 809 ------
NM_006852chr1762906 2726 2396 2345 775 420 ------
NM_006861chr121122 11475 ----
NM_006868chr1843225 3041 2859 1949 --13076 1468
NM_006873chr263104 2983 1375 1326 924 189 11197 ----
NM_006874chr461013 962 952 887 435 334 ------
NM_006877chr61303 ------
NM_006885chr16174032 4023 3616 3430 2905 2899 2893 2887 2695 2689 2683 1599 1505 1487 806 558 424 12775 53848 3407 2843 1468 567 --
NM_006888chr1473293 3196 2706 2410 2236 404 219 1728 23353 311 --
NM_006892chr2021243 515 21181 1124 11380 --
NM_006892chr2021243 515 21181 1124 11380 --
NM_006898chr21615 ------
NM_006902chr182519 2105 1288 1044 733 616 487 404 11225 12328 --
NM_006906chr11123 1894 --1278
NM_006908chr761324 1109 1042 605 447 21 11452 --11156
NM_006912chr132176 936 247 12118 1335 1131
NM_006914chr91201 1414 ----
NM_006915chrX62496 2066 1903 321 242 195 195 32111 1649 689 1781
NM_006916chr22556 416 2484 231 ----
NM_006922chr262050 2044 2037 1859 1796 1695 1213 ----
NM_006924chr1784336 4052 3995 3941 3279 1678 1078 46 23970 818 --1331
NM_006930chr551333 1287 557 231 187 --11803 --
NM_006937chr174558 433 115 38 ------
NM_006938chr1841066 948 816 126 --1220 2933 77
NM_006939chr141756 --150 31176 456 443
NM_006940chr1251833 1298 466 448 437 1629 ----
NM_006947chr431629 1546 502 130 11264 --
NM_006948chr2132498 986 606 ----1363
NM_006951chr102581 101 140 1764 1792
NM_006965chr181361 --21208 93 --
NM_006981chr942900 2631 2432 1899 ------
NM_006996chr151830 1550 735 678 622 ------
NM_006999chr551697 1651 1526 838 468 11401 22065 1338 --
NM_007005chr941509 1069 540 531 ------
NM_007006chr1663535 3482 3210 2467 673 213 22894 1170 21306 90 --
NM_007007chr12104106 3823 3769 3399 1621 1544 1271 562 345 329 63359 3200 1391 1320 955 700 13993 13659
NM_007011chr1554666 2733 1932 1194 552 15178 24730 246 11227
NM_007013chr841028 409 298 134 2915 798 ----
NM_007017chr52891 365 ------
NM_007019chr201120 ------
NM_007027chr31146 140 ----
NM_007033chr151761 812 494 155 42 2681 573 ----
NM_007034chr11267 1791 ----
NM_007039chr1432081 881 664 ----1392
NM_007042chr362320 1695 865 858 847 377 12050 12017 --
NM_007046chr21378 ------
NM_007050chr2047899 6695 6302 694 --36000 1630 679 --
NM_007052chrX1202 ----2212 195
NM_007054chr573562 3552 3456 973 846 689 606 33743 3594 3532 12541 --
NM_007064chr371427 1397 1215 1108 508 390 106 --1631 --
NM_007078chr1063031 2964 2338 793 785 145 ----1388
NM_007084chr132394 364 ----11428
NM_007106chr1332747 2126 240 ----12094
NM_007107chr352333 2254 1798 367 162 22168 99 1557 --
NM_007111chr13----1300 --
NM_007112chr12240 179 ------
NM_007114chr313026 ----1841
NM_007118chr51826 ------
NM_007125chrY31395 979 470 11046 21004 453 --
NM_007137chrX115460 5383 4974 4434 4408 4385 3710 1921 1310 1158 1142 --13764 11911
NM_007145chr1921008 276 ------
NM_007146chr1732634 2282 2110 31962 1934 468 --11027
NM_007147chr1921244 1229 1920 ----
NM_007150chrX31986 1681 67 --1552 --
NM_007158chr151234 1197 891 134 66 ------
NM_007166chr1111367 ------
NM_007173chr1151796 447 439 306 70 145 ----
NM_007174chr1221890 391 ------
NM_007175chr853518 3239 3024 1274 725 32828 2584 1057 12739 --
NM_007178chr12--1469 ----
NM_007191chr122719 167 ------
NM_007192chr1481192 1176 1108 1013 457 392 224 104 ------
NM_007195chr1842829 1486 809 455 --13327 13553
NM_007200chr1554525 3261 3124 2821 1641 ------
NM_007203chr953821 2804 2789 2469 1523 --33048 2607 633 14011
NM_007207chr1173 ------
NM_007212chr1102156 2112 1536 1416 827 789 679 606 443 247 21835 1526 1571 --
NM_007214chr61378 --1115 --
NM_007218chr82902 640 --2741 363 --
NM_007222chr841603 1284 1200 192 ------
NM_007246chr42864 352 --11004 1294
NM_007249chr13159477 9055 8514 8480 7962 7146 5931 3320 2805 2157 2100 1638 1394 1287 665 29235 2469 22419 2178 18891
NM_007260chr12759 749 ------
NM_007269chr1----1451 --
NM_007274chr11126 ------
NM_007276chr741132 972 374 158 1443 ----
NM_007285chr161182 --1195 --
NM_007292chr1765182 5011 4750 1196 1022 954 24609 368 14470 --
NM_007315chr261358 1280 1237 1084 475 37 ----11463
NM_007331chr46852 825 809 788 742 344 12722 --1264
NM_007345chr1831873 1754 1745 --2480 115 --
NM_007347chr1552637 1991 942 451 368 --12232 --
NM_007353chr722884 2477 12367 ----
NM_007357chr1------1225
NM_007358chr1----1325 --
NM_007373chr1051619 1492 1296 221 195 ------
NM_007375chr14973 477 463 192 22756 1030 11023 --
NM_012064chr1231071 284 137 ------
NM_012081chr593495 3401 3229 3152 3042 1017 890 882 874 --32808 2741 282 --
NM_012082chr81787 ------
NM_012089chr161408 1349 1214 1048 628 186 ------
NM_012096chr373776 3239 2928 2355 1485 901 702 --22650 1472 1868
NM_012102chr142098 1757 511 296 --21854 42 --
NM_012104chr1141530 1484 1440 675 --13096 13121
NM_012104chr1141530 1484 1440 675 --13096 13121
NM_012108chr42386 353 ----162
NM_012115chr62621 210 ------
NM_012120chr6--11917 41994 1925 938 295 --
NM_012124chr111344 1136 ----
NM_012129chr72874 98 12214 22249 2045 1157
NM_012137chr132886 2374 2125 ------
NM_012155chr191216 --1225 --
NM_012157chr33941 304 165 ------
NM_012158chr1371716 1668 1261 1141 164 72 57 ------
NM_012160chr6--178 1525 --
NM_012164chr9117245 7099 5980 5503 5458 5001 2635 2084 969 650 95 27008 4859 66478 6272 6207 5741 2857 659 32941 2689 2510
NM_012177chr61126 ------
NM_012183chr11454 ------
NM_012193chr1185455 4919 1898 1888 1487 1212 491 78 ------
NM_012199chr163874 3784 3671 3457 3294 1750 ------
NM_012207chr1051098 953 825 747 308 ------
NM_012214chr235039 4071 1050 --1545 --
NM_012215chr1061671 1661 1408 1343 1235 713 21540 1227 ----
NM_012218chr1941042 851 411 61 --2257 249 --
NM_012219chr35914 892 814 564 552 ------
NM_012223chr24968 434 245 166 --1115 --
NM_012224chr441025 865 456 390 1780 11046 --
NM_012234chr393527 3283 3277 2457 2450 1001 463 332 325 1900 23755 432 13261
NM_012238chr1051737 1537 1404 353 143 ----11182
NM_012242chr10198 --1548 --
NM_012243chr12125 26 1370 ----
NM_012247chr10--134 ----
NM_012249chr252823 2494 1344 1242 406 --12503 23183 2833
NM_012250chr112403 298 11244 ----
NM_012255chr20145 ----188
NM_012259chr621184 422 --11248 --
NM_012261chr201673 ------
NM_012262chr175014 3790 1065 720 465 333 318 --14120 --
NM_012266chr91850 11104 11115 --
NM_012272chr122450 443 ------
NM_012278chrX1145 ------
NM_012281chr742353 2080 960 905 12095 --11595
NM_012287chr344446 3113 924 491 --1745 --
NM_012289chr19155 ------
NM_012290chr231520 1175 365 --1384 21247 1156
NM_012294chr763814 3485 2655 405 293 102 ----23522 391
NM_012296chr1133881 507 81 --23724 3424 --
NM_012297chr462334 2077 2021 1967 1795 1736 ------
NM_012300chr542170 2050 1843 115 2989 945 11790 --
NM_012307chr181280 ------
NM_012309chr1153448 3232 1597 1533 1083 --1240 --
NM_012316chr165671 5418 3462 1158 512 238 ------
NM_012327chr1811566 --11501 1998
NM_012328chr731464 939 146 --11320 --
NM_012329chr1741072 662 619 467 --1492 --
NM_012330chr1021575 181 --1535 --
NM_012333chr131498 1326 663 ------
NM_012334chr594774 4760 4473 4054 3209 1571 1475 1368 1267 --13145 --
NM_012339chr101678 --1539 --
NM_012341chr101470 ------
NM_012345chr1341715 1671 1437 161 1401 ----
NM_012347chr633019 1967 450 --1180 --
NM_012384chr2042419 2235 1657 521 1704 ----
NM_012388chr1532932 2523 179 12049 23082 200 1359
NM_012399chr2221897 170 1755 11360 1705
NM_012406chr12--181 ----
NM_012417chr17154 ------
NM_012426chr161360 ----1479
NM_012463chr1231433 1312 211 --1426 --
NM_012464chr431834 1792 340 --31130 744 701 --
NM_012471chrX31494 628 165 1590 ----
NM_012479chr752346 2139 1968 542 352 12465 ----
NM_013229chr1252110 1045 586 462 196 22118 1961 ----
NM_013230chrY2539 374 ------
NM_013231chr1463935 3785 3678 1195 1061 209 --23989 3773 --
NM_013233chr231030 526 197 ------
NM_013257chr872239 2233 1956 1597 917 341 296 ------
NM_013259chr31123 ------
NM_013261chr472918 2494 1482 1470 1137 973 639 ------
NM_013269chr1254239 4017 1491 1252 1201 ----11533
NM_013281chr20139 --11006 --
NM_013282chr1971341 1223 1084 1078 973 401 340 177 2874 230 --
NM_013283chr53856 799 82 ------
NM_013286chr363463 2999 2341 1425 621 253 ----1164
NM_013296chr12472 363 ------
NM_013313chr2262790 2728 2711 929 435 239 11054 ----
NM_013322chr711614 ------
NM_013341chr221915 1849 --12582 --
NM_013346chrX--155 ----
NM_013352chr63879 307 220 ------
NM_013354chr83480 425 395 11451 ----
NM_013357chr81670 --183 --
NM_013368chr19183 ------
NM_013371chr11330 ------
NM_013372chr1563166 2637 2361 581 333 319 1186 ----
NM_013373chr22--11005 ----
NM_013374chr342742 2577 1234 379 1585 ----
NM_013377chr121163 189 ----
NM_013380chr191807 --144 --
NM_013381chr1242345 2278 1510 953 ----1142
NM_013390chr951746 1699 1685 1570 509 1295 11551 --
NM_013396chr2121277 421 --1624 297 48
NM_013423chrX41285 924 795 95 --11106 --
NM_013427chrX41285 924 795 95 --11106 --
NM_013433chr1931843 1771 1612 --11649 --
NM_013436chr22271 96 ------
NM_013437chr8183 1348 ----
NM_013448chr142245 184 1633 1698 --
NM_013449chr1232609 577 393 --12509 --
NM_013450chr231185 916 347 ------
NM_013958chr81471 ------
NM_013959chr81471 ------
NM_013961chr81471 ------
NM_013962chr81471 ------
NM_013981chr5--1199 ----
NM_013982chr5--1199 ----
NM_013983chr5--1199 ----
NM_013986chr221322 ------
NM_013995chrX92540 2484 2425 2407 1946 1723 1713 251 182 22084 566 ----
NM_013996chr7--1463 ----
NM_013996chr7--1463 ----
NM_013997chr7--1463 ----
NM_013997chr7--1463 ----
NM_013998chr7--1463 ----
NM_013998chr7--1463 ----
NM_014010chr92434 407 ------
NM_014011chr212304 22267 255 1397 --
NM_014021chr173461 3206 2797 2632 2300 414 221 12392 1697 --
NM_014023chr1052451 1173 622 533 128 --12866 12733
NM_014034chr611366 ------
NM_014035chr521253 1203 11413 ----
NM_014038chr71156 1168 1406 --
NM_014043chr351671 1594 1259 1230 1089 ------
NM_014048chr1675082 4878 4182 3952 3208 581 558 11233 34856 1969 1956 169
NM_014055chr123442 172 130 ------
NM_014089chr1342124 874 306 109 ------
NM_014106chr1522126 1068 ------
NM_014110chr11774 ------
NM_014112chr865512 5438 5354 4746 4388 1602 25361 630 11742 --
NM_014117chr1672561 2490 2351 1959 1825 729 150 1532 ----
NM_014141chr795369 5110 5094 5077 3820 3474 1144 343 206 1354 11007 1557
NM_014154chr341116 546 371 352 21075 116 ----
NM_014155chr11117500 7240 6520 4729 2829 2565 1070 732 301 295 276 46859 5082 2665 2251 37129 5325 1998 25728 1652
NM_014178chr143235 131 125 ----162
NM_014181chr262440 1984 479 473 467 460 ------
NM_014183chr201306 ------
NM_014203chr19164 ------
NM_014211chr531516 671 394 11725 1462 1543
NM_014216chr1451614 1574 1293 487 117 ------
NM_014217chr121380 576 ----1353
NM_014225chr191357 1384 ----
NM_014231chr1242041 1876 800 566 ------
NM_014232chr171199 ------
NM_014232chr171199 ------
NM_014241chr10161 --1282 --
NM_014243chr4----11617 --
NM_014245chr32681 171 ------
NM_014248chr221111 ------
NM_014250chr2232056 1653 659 11429 --12033
NM_014253chrX72266 2130 1991 1758 616 329 260 145 1205 --
NM_014255chr12--185 ----
NM_014271chrX3813 317 149 1331 ----
NM_014278chr42131 119 197 ----
NM_014279chr94933 727 629 314 ------
NM_014282chr93909 514 432 1221 1884 --
NM_014283chr14451 240 184 46 11249 ----
NM_014290chr91158 ------
NM_014300chr15140 ------
NM_014302chr71104 --123 --
NM_014305chr13--1692 --1555
NM_014309chr2294731 4545 4533 3580 2141 1735 1137 617 161 35439 3779 1711 24200 665 --
NM_014313chr121159 52 --11290 1432
NM_014319chr1221929 240 --22002 207 --
NM_014329chr161309 ------
NM_014331chr477550 6494 6194 5134 1421 712 690 26695 2725 36118 2337 986 --
NM_014333chr11102675 2634 2578 2569 2164 2150 961 305 168 95 12682 1459 --
NM_014335chr1531301 123 83 --11216 --
NM_014361chr112437 187 ------
NM_014363chr131121 1348 1920 --
NM_014368chr92366 266 11438 ----
NM_014372chr131700 1502 479 --1500 --
NM_014376chr512341 ------
NM_014382chr341356 1285 639 581 --1545 11211
NM_014392chr4----11225 --
NM_014394chr1031043 842 458 --21167 968 --
NM_014397chr911177 ----1434
NM_014399chr72701 164 ------
NM_014411chr731347 1317 170 ------
NM_014423chr574613 3918 2015 1473 1103 141 111 11901 22221 1576 --
NM_014429chr32660 250 1637 ----
NM_014445chr341739 553 524 172 21526 411 1286 --
NM_014447chr431285 1105 323 --11330 --
NM_014452chr62938 55 --2279 173 --
NM_014455chr11139 ------
NM_014456chr1071824 1742 613 340 293 188 170 11308 175 --
NM_014458chr121046 224 --11173 --
NM_014469chr112331 190 1108 ----
NM_014470chr12----1105 --
NM_014487chr4--1155 ----
NM_014494chr1672231 1734 939 906 898 772 730 1476 22373 597 --
NM_014507chr221903 ------
NM_014515chr121212 ------
NM_014516chr191268 ------
NM_014517chr331938 1711 1612 ------
NM_014521chr2--1360 ----
NM_014548chr151319 ------
NM_014554chr1272162 1931 1843 1729 1722 1657 269 ------
NM_014570chr224828 703 168 92 ------
NM_014572chr1351738 1184 1164 505 499 21114 727 1670 11512
NM_014574chr1441412 1401 1391 1186 1264 1310 1589
NM_014575chr33545 456 354 ------
NM_014577chr221149 ------
NM_014583chr32512 326 ------
NM_014603chr1721176 384 ------
NM_014606chr431146 238 232 11431 11464 --
NM_014607chr24824 785 550 538 ----1484
NM_014612chr961434 1270 1209 1089 527 176 --1493 --
NM_014613chr552940 2528 2237 511 349 ------
NM_014614chr231137 603 86 11091 11037 --
NM_014615chr165932 897 816 371 365 21015 827 22626 235 --
NM_014620chr124824 720 263 113 --1529 --
NM_014635chr221378 1241 11177 11494 --
NM_014636chr954243 4039 1413 1135 314 13705 ----
NM_014637chr821073 261 --11221 --
NM_014644chr1----11025 --
NM_014647chr1672205 1838 1807 1723 1481 594 145 ------
NM_014655chr172170 2032 2003 1540 874 561 369 ----12353
NM_014660chr711004 ------
NM_014663chr11965 ------
NM_014667chr342397 622 616 159 --12311 11567
NM_014670chr231615 1136 343 21317 76 11544 --
NM_014671chr721607 1536 --11038 1274
NM_014674chr363954 3722 2440 1484 1299 993 --1694 --
NM_014675chr11492 1513 ----
NM_014676chr141286 1273 1165 425 1399 ----
NM_014677chr821096 245 11395 ----
NM_014679chr1121253 204 --3488 322 289 --
NM_014682chr831796 821 237 11763 1335 --
NM_014685chr162575 364 ----1102
NM_014686chr1932261 2093 1927 2489 339 --11828
NM_014689chr2196 1392 ----
NM_014701chr1552823 2151 1101 707 327 ----22798 2420
NM_014702chr653448 2723 432 213 35 22822 139 22406 906 13350
NM_014705chr721735 550 1357 ----
NM_014707chr731688 1512 1433 --22307 378 --
NM_014709chr2281 67 1406 ----
NM_014711chr1662093 1847 1799 822 808 347 11900 ----
NM_014712chr161213 ------
NM_014713chr21178 --1209 --
NM_014720chr1031641 265 136 1156 ----
NM_014721chr6107145 6752 6088 5905 5376 5333 2739 2513 1427 1279 27418 6839 12900 17262
NM_014729chr85576 460 256 207 83 ------
NM_014730chr12105270 4865 4820 3589 1681 1351 1215 1191 875 765 --1973 15022
NM_014730chr12105270 4865 4820 3589 1681 1351 1215 1191 875 765 --1973 15022
NM_014733chr541870 915 632 459 1709 12095 --
NM_014735chrX62088 1706 1467 1445 1300 811 --2861 146 1171
NM_014742chr2051270 1182 1173 201 181 --21110 218 --
NM_014743chr483078 2953 2302 2170 1265 1053 1015 782 32978 2792 2417 ----
NM_014746chr244196 3773 886 633 1454 13041 --
NM_014749chr14192 ----1167
NM_014751chr831989 1977 1782 --12104 11897
NM_014752chr1151650 764 713 592 258 --11398 --
NM_014755chr2104277 4084 4000 3922 2758 1083 990 589 365 65 23585 1073 43351 3041 1680 140 --
NM_014757chr532238 847 256 2479 23 ----
NM_014765chr172670 2330 2121 960 914 793 328 --12071 --
NM_014774chr143191 2141 2122 712 12958 11246 --
NM_014779chr36941 928 421 294 195 67 11084 ----
NM_014781chr841013 223 215 209 ------
NM_014783chr1521537 191 --11399 --
NM_014787chr111793 --12653 --
NM_014793chr152535 47 ------
NM_014795chr231288 1189 920 --11044 --
NM_014800chr721023 988 --21109 1000 --
NM_014803chr1072747 2636 2630 2390 2042 1170 198 12608 32803 584 310 --
NM_014819chr51588 --12408 --
NM_014820chr321470 558 11773 --11853
NM_014824chr1161653 1562 1546 1316 790 68 1289 21718 1490 --
NM_014826chr184101 4080 3881 2971 2889 2769 1642 143 ------
NM_014827chr151531 1220 1054 335 239 ------
NM_014828chr1452347 918 911 881 64 ------
NM_014829chr542347 2201 1531 907 1568 1510 --
NM_014830chr1283817 3380 2851 2398 1514 319 240 218 13917 13290 --
NM_014832chr1341781 1682 1317 202 --1581 --
NM_014836chr1032005 1801 1243 11464 ----
NM_014838chr2252302 2289 2117 507 286 --21756 277 1495
NM_014839chr12642 226 --22030 739 12094
NM_014840chr1273412 2968 2839 2435 2195 1043 190 13425 ----
NM_014841chr631075 965 353 1913 ----
NM_014847chr12480 469 ------
NM_014849chr11205 ----11297
NM_014868chr124806 49 43 37 1244 ----
NM_014873chr1124872 4370 4299 4001 3900 3736 3441 1650 1061 806 613 399 14327 ----
NM_014874chr121850 1190 11806 ----
NM_014876chr2272187 1677 871 583 570 325 206 --1112 --
NM_014877chr17197673 7633 7220 6758 6273 5908 5902 5220 4865 2973 2707 1947 1466 1135 950 758 663 570 511 37592 6628 732 17726 37291 6213 2239
NM_014888chr711135 --11569 21123 986
NM_014893chrY41481 864 551 99 11923 ----
NM_014897chr1752629 2452 2179 871 87 --1583 --
NM_014898chr1932265 123 71 22411 930 1420 --
NM_014899chr562646 2444 2430 2202 509 140 23140 1181 11015 --
NM_014901chr522227 2098 12077 1790 --
NM_014902chr2031180 458 74 ------
NM_014903chr1242308 1905 1566 719 1670 ----
NM_014904chr1032960 1543 136 22917 541 1744 11134
NM_014905chr241960 1931 1333 129 ----1757
NM_014906chr1733823 3500 2699 ------
NM_014912chr1012330 12149 33438 2670 993 --
NM_014918chr1541349 587 566 414 130 175 --
NM_014920chr642833 2332 953 910 --1164 --
NM_014921chr1913075 ------
NM_014923chr1342378 1877 1551 207 --1592 --
NM_014924chr1482986 2741 2249 2171 608 484 393 279 --2470 45 1708
NM_014932chr311914 ----2696 406
NM_014936chr652711 2546 1976 1916 374 22701 2491 ----
NM_014939chr184598 586 476 416 --142 --
NM_014942chr662629 2566 2332 1797 218 48 ------
NM_014946chr282697 2567 2456 2111 1116 1110 614 397 13108 ----
NM_014947chr133002 2783 2640 --22754 396 1439
NM_014949chr13358 341 21 1662 ----
NM_014950chr14--11759 ----
NM_014951chr1052136 1670 636 589 426 12515 --12619
NM_014953chr1344213 4131 3843 2739 23398 624 13737 23643 2781
NM_014962chr2052612 1003 455 301 130 31982 235 215 ----
NM_014969chr121094 346 ------
NM_014970chr1--1119 ----
NM_014974chr1031799 1215 377 ------
NM_014977chr141581 ------
NM_014982chr1474855 3945 3495 2051 2034 1655 257 14351 35369 3463 286 --
NM_014988chr462557 2325 977 190 168 144 1522 ----
NM_014989chr61419 --3513 474 128 --
NM_014990chr143945 460 414 ------
NM_014991chr442195 1193 564 252 12906 ----
NM_014992chr14----1648 --
NM_014996chr331045 1012 58 ------
NM_014997chr72811 154 --1796 --
NM_014999chr1271691 1410 1155 242 232 221 211 ------
NM_015000chr12102881 2826 2543 2536 2516 2186 2158 1987 1214 568 ------
NM_015001chr13979 965 737 1327 ----
NM_015008chr383252 2691 2684 2342 863 725 139 86 1922 22293 195 --
NM_015009chr3----183 --
NM_015013chr13288 282 214 ------
NM_015017chr131017 196 22 ------
NM_015018chr6----181 --
NM_015023chr111335 ------
NM_015025chr242270 1962 642 52 --1180 --
NM_015026chr12114724 4668 4181 3564 3126 1901 1698 1545 892 521 386 24493 801 23992 3685 --
NM_015027chr1672019 1862 1756 1500 1401 386 57 11316 ----
NM_015032chr1362350 2256 1945 1090 1047 976 --21180 652 2861 815
NM_015035chr20126311 6060 5768 4864 4613 4362 4287 2428 1838 1749 1236 211 --25196 222 --
NM_015040chr2123334 3182 3162 3099 3093 3087 1040 771 602 431 186 124 22094 622 ----
NM_015045chr1032245 2052 1889 21996 1405 11872 --
NM_015046chr952507 1994 932 395 88 12065 ----
NM_015050chr6--11104 ----
NM_015051chr92467 262 22126 131 43370 2990 2604 2297 --
NM_015061chr93836 256 87 ------
NM_015068chr732628 643 608 11012 23376 2858 --
NM_015071chr564696 4159 2266 2207 1726 1017 11945 22075 2004 12236
NM_015074chr164523 3783 1820 932 888 426 1246 14873 --
NM_015076chr634282 1458 410 13968 11357 1928
NM_015080chr111297 --1926 --
NM_015087chr1342613 2230 920 791 22685 2505 12511 --
NM_015091chr142748 613 ------
NM_015092chr1684681 4268 3611 3364 3357 3316 1164 1088 11460 24293 2935 13074
NM_015093chr621741 1722 ----11768
NM_015094chr2273352 3112 1535 906 634 615 448 ------
NM_015097chr371690 1578 732 625 440 116 76 --21658 123 --
NM_015100chr152036 1598 1462 397 251 ------
NM_015101chr182408 2348 2097 913 646 225 82 49 1101 1976 --
NM_015107chrX72382 2085 2067 2061 1906 1589 304 11967 ----
NM_015110chr931910 562 252 2953 727 21886 223 --
NM_015115chr4144 22874 2744 12034 --
NM_015120chr2--1274 ----
NM_015129chrX31743 1737 1187 11796 ----
NM_015130chr421316 59 1444 174 --
NM_015132chr751303 1235 793 576 149 ------
NM_015134chr171647 ------
NM_015137chr862545 2406 2048 640 315 157 12061 12620 --
NM_015138chr1522799 281 22652 1057 ----
NM_015139chr1------141
NM_015143chr42920 430 1504 --11400
NM_015144chr1683924 3863 3464 3030 2791 2680 536 378 33989 3934 692 ----
NM_015149chr11839 ----11466
NM_015153chr62297 232 --1503 --
NM_015155chr1053244 2069 1248 972 638 12310 1347 --
NM_015163chr1461883 1774 1627 1517 1488 568 2493 35 ----
NM_015170chr852279 1989 1834 1707 215 11916 ----
NM_015172chr131275 434 416 11158 ----
NM_015173chr431344 405 184 1197 11181 --
NM_015180chr141740 ------
NM_015185chrX42797 510 436 291 ------
NM_015192chr2082909 2663 2656 2634 2524 2490 2463 615 1339 ----
NM_015199chr361032 589 460 169 156 23 12411 33022 2493 574 --
NM_015200chr442467 2264 1908 513 1792 --1361
NM_015203chr1--178 ----
NM_015206chr1563335 3245 2884 1101 807 316 1451 ----
NM_015208chr1853260 2912 2666 492 477 --23759 3543 --
NM_015209chr15527 363 357 351 316 --12167 1736
NM_015213chr111653 1712 ----
NM_015215chr183044 2604 2114 1949 1939 1133 980 148 32257 633 66 ----
NM_015225chr953037 2621 1179 536 45 11066 ----
NM_015229chr172761 179 11153 11196 --
NM_015231chr112806 601 --1926 --
NM_015233chr1392589 2262 824 768 697 450 392 310 256 ------
NM_015236chr421029 472 ------
NM_015238chr51709 1558 ----
NM_015246chr1621320 1299 12031 ----
NM_015247chr1643452 743 223 74 --1547 --
NM_015250chr92678 322 1167 ----
NM_015263chr1521216 355 1368 --11200
NM_015264chr2284773 4255 3996 3680 3296 1157 840 427 14459 ----
NM_015265chr272591 2345 146 107 99 93 86 --171 21948 504
NM_015267chr1241756 456 157 139 11437 ----
NM_015269chr1--2421 197 --1239
NM_015271chr454125 3992 1584 651 233 ----192
NM_015272chr1652164 1905 450 223 151 --32048 1306 646 --
NM_015275chr1232079 1588 1370 ----1130
NM_015277chr1851298 681 667 42 30 11703 ----
NM_015278chr673311 2726 2345 2134 787 535 207 33266 2545 795 12416 --
NM_015282chr272904 2895 2887 1012 962 943 406 ----1306
NM_015291chr193463 3457 3141 3005 2749 2699 1341 643 630 12737 ----
NM_015296chr1331023 448 340 11179 ----
NM_015308chr113178 147 70 ------
NM_015310chr8137914 7808 7786 7401 5871 5822 5161 2414 1539 1288 1087 402 50 28338 8277 ----
NM_015313chr1134563 4170 422 11759 23340 167 --
NM_015314chr792535 2304 2190 2097 1887 1033 860 697 449 --12169 --
NM_015315chr593053 2901 2467 2461 2455 2449 2238 890 300 ------
NM_015317chr232865 2556 159 ----1340
NM_015320chr21752 --157 --
NM_015326chr181921 1026 964 922 738 514 116 105 1244 1834 --
NM_015328chr783005 2942 2635 2254 771 680 374 313 12842 13061 --
NM_015331chr11611 ------
NM_015335chr1262421 2076 2011 940 839 632 11894 22190 2038 --
NM_015336chr1252338 2057 1892 709 354 22545 235 12455 12378
NM_015344chr82452 277 1748 1814 --
NM_015347chr12--12764 11084 --
NM_015349chr692589 2476 963 920 542 471 463 304 163 22316 748 1495 --
NM_015350chr12526 510 ------
NM_015354chr91368 ------
NM_015355chr1771546 782 746 526 349 154 76 21974 83 --11448
NM_015358chr2131104 1073 301 11219 ----
NM_015361chr21227 1629 ----
NM_015365chrX114280 4055 3747 2995 1226 642 611 482 460 310 251 13100 13971 1430
NM_015382chr141697 --1152 --
NM_015385chr1063004 2997 2083 1156 872 852 --32964 2822 2254 --
NM_015387chr242079 1392 439 117 1205 1502 --
NM_015393chr431325 130 38 ------
NM_015394chr121671 ------
NM_015396chr31220 ------
NM_015397chr931776 1640 595 21908 1310 11482 --
NM_015419chrX----1876 1421
NM_015423chr1121621 489 11381 1105 --
NM_015428chr1981707 1693 1452 1379 1126 601 521 134 1494 1538 --
NM_015436chr441296 597 560 418 --4721 549 352 247 13043
NM_015442chr31185 ------
NM_015443chr1731159 486 176 ----1108
NM_015446chr12483 318 11556 ----
NM_015458chr874279 3683 1901 1718 943 533 435 15236 11282 1899
NM_015464chr71249 1267 2188 173 --
NM_015475chr231026 352 330 ------
NM_015483chr73912 801 420 ------
NM_015511chr2031147 1087 852 ------
NM_015517chr111529 ------
NM_015530chr22991 698 ------
NM_015534chr141069 435 401 387 ------
NM_015535chr253666 2646 437 35 24 13965 23409 3303 --
NM_015541chr351257 1056 939 367 226 --2430 21 --
NM_015542chr102947 936 ------
NM_015548chr6--1370 ----
NM_015550chr762309 1178 1087 978 836 653 ----13050
NM_015554chr1572833 2430 2424 2086 1079 829 105 --32950 2388 1008 --
NM_015555chr63553 428 122 11238 1341 --
NM_015564chr533447 2848 446 --1131 --
NM_015567chr1311023 ------
NM_015569chr164801 3956 1269 888 312 123 11909 ----
NM_015570chr741624 1489 1279 743 ------
NM_015571chr642603 2269 1752 1639 1910 1949 --
NM_015575chr2113443 3314 3308 3302 2771 2578 2435 2397 671 635 381 13334 ----
NM_015576chr342666 1973 166 29 --11872 --
NM_015577chr511196 --1660 11787
NM_015578chr1971733 808 779 319 142 131 125 11294 11917 11867
NM_015599chr61274 ------
NM_015601chr103868 257 56 --1648 --
NM_015602chr141424 676 529 36 21692 1463 11641 --
NM_015607chr13225 219 212 ------
NM_015622chr7----1283 --
NM_015626chr172305 123 187 11235 --
NM_015640chr1145305 5208 4955 4532 4255 3245 1526 1473 1346 861 845 540 367 201 23849 1639 --15254
NM_015641chr71356 11099 11022 --
NM_015642chr33213 126 120 ------
NM_015652chr101253 1261 ----
NM_015660chr71247 ------
NM_015670chr171117 ------
NM_015686chrX11773 ------
NM_015691chrX112889 2745 2708 2452 2255 2134 2019 2001 466 418 190 ----2270 59
NM_015693chr41299 ------
NM_015695chr641398 810 175 157 ------
NM_015702chr21296 ----181
NM_015723chr71573 ------
NM_015850chr831860 1853 1675 1794 11795 --
NM_015866chr141407 945 547 315 ------
NM_015874chr41575 --1247 --
NM_015878chr862058 1622 680 656 618 572 22203 1500 12077 1342
NM_015879chr18128295 6933 5980 5648 5452 3392 2777 2268 2101 1423 614 159 28625 2548 ----
NM_015885chr113643 209 24 ------
NM_015886chr875751 5605 4564 3943 3596 2179 657 12221 33969 2056 1433 --
NM_015888chr142438 1296 653 407 ------
NM_015891chr642009 1880 486 179 11646 1620 --
NM_015906chr1114863 4797 4676 3472 3106 1753 1127 1031 896 832 538 --14703 1571
NM_015907chr42276 63 ------
NM_015920chr152584 166 --1154 --
NM_015955chr21366 ------
NM_015975chrX61643 1494 1485 1314 257 172 ------
NM_015982chr17----155 --
NM_015990chr4----11026 --
NM_015995chr1535312 4235 333 ------
NM_015999chr11577 ------
NM_016019chr72228 214 11071 ----
NM_016022chr1------1996
NM_016023chr842168 2069 1891 115 2322 143 1689 --
NM_016025chr1662001 1829 1592 1577 800 359 2475 180 ----
NM_016037chr12729 183 --11141 --
NM_016040chr152518 554 413 406 351 21733 342 ----
NM_016045chr203738 628 456 --1102 11510
NM_016048chr52973 329 ------
NM_016061chr211020 1372 ----
NM_016072chr12102317 2035 2028 1910 1690 936 669 556 281 107 ------
NM_016073chr15--11069 ----
NM_016076chr162928 2833 2526 2256 2109 211 1689 2983 126 --
NM_016079chr232315 2269 109 22332 165 12061 --
NM_016083chr622759 1468 --11215 --
NM_016087chr721515 1153 11416 ----
NM_016096chr861762 1710 1703 1614 878 722 --21754 842 11641
NM_016097chr1831008 365 156 21043 958 ----
NM_016103chr52463 115 ----1380
NM_016107chr541083 510 480 58 --1129 --
NM_016120chrX21162 1037 --1158 --
NM_016121chr141143 957 875 803 ----180
NM_016129chr4--1384 ----
NM_016131chr252226 2094 1521 907 144 ----1283
NM_016132chr1573376 3368 3362 1327 1321 799 449 2239 188 23146 313 --
NM_016133chr231380 1021 106 --11215 --
NM_016138chr1651422 327 283 180 135 ------
NM_016147chr1111145 1792 ----
NM_016151chr162335 311 ------
NM_016152chr331140 357 135 --2864 92 --
NM_016166chr151181 ------
NM_016169chr101575 ----13158
NM_016192chr21199 --1243 --
NM_016200chr7------178
NM_016203chr741034 1016 896 269 ------
NM_016206chr3157743 7375 7359 6239 6089 5561 2088 1720 1582 1170 1041 707 604 487 74 57690 6714 5934 988 659 55644 5441 1561 736 284 --
NM_016213chr15138 ------
NM_016216chr3240 23 ------
NM_016217chr653382 2837 2727 1426 835 --11472 --
NM_016224chr621486 1469 12140 --1381
NM_016227chr14451 240 184 46 11249 ----
NM_016230chr6164 --1544 --
NM_016231chr1741533 1452 321 112 --11052 --
NM_016239chr171755 ------
NM_016248chr13123961 3896 3623 3602 3596 3554 3279 2617 2442 1401 1136 1041 22646 494 24015 2745 23613 996
NM_016255chr651341 990 760 708 573 12876 ----
NM_016258chr13608 311 290 ------
NM_016260chr2177297 6639 5801 5476 5454 5168 4990 2780 2669 2147 1561 784 708 698 551 476 383 27342 4959 27173 1063 17609
NM_016269chr41255 11025 ----
NM_016270chr192486 467 1443 ----
NM_016271chr1842307 1992 1540 495 --1126 --
NM_016272chr2252559 2526 1082 1076 280 ------
NM_016275chr352215 1077 825 414 277 12354 11092 --
NM_016277chr611547 21431 646 ----
NM_016287chr141600 702 685 77 1294 11838 --
NM_016289chr242178 253 142 122 12075 1872 --
NM_016290chr5197 ------
NM_016300chr31440 1522 ----
NM_016303chrX1452 ------
NM_016306chr3281 67 2363 88 ----
NM_016308chr151928 1893 1734 385 157 11391 21977 451 11563
NM_016315chr231420 292 103 21833 432 ----
NM_016322chr973117 2825 2143 1999 1027 977 465 ----12179
NM_016328chr7----1100 --
NM_016329chr3--1488 ----
NM_016337chr141184 ------
NM_016338chr51357 ------
NM_016351chr71578 ------
NM_016352chr761402 1396 573 552 222 189 ----1928
NM_016356chr662941 2855 2622 987 950 871 ----12848
NM_016377chr6----1601 --
NM_016383chrX2750 744 ------
NM_016395chr152365 58 --186 1347
NM_016396chr1542830 1194 1157 551 --1577 --
NM_016400chr15172 ------
NM_016404chr111122 --121 --
NM_016417chr141442 ------
NM_016424chr1742012 1842 799 367 --21662 517 --
NM_016436chr2042735 2478 1793 1673 11966 --11996
NM_016441chr242356 2343 2139 1710 --1899 21508 228
NM_016463chr5--1141 ----
NM_016475chr143480 404 273 ------
NM_016480chr52784 565 --1122 --
NM_016485chr652211 873 448 177 87 ------
NM_016486chr12444 352 ------
NM_016488chr1251869 1831 1462 1423 783 --1732 --
NM_016506chr11191 --1726 --
NM_016507chr1783108 2458 2267 2130 1001 450 388 58 --12818 --
NM_016513chr642833 2332 953 910 --1164 --
NM_016516chr21867 1813 ----
NM_016522chr1131061 232 181 ------
NM_016529chr131353 ------
NM_016530chr1584075 3305 3188 3143 1212 1099 368 241 11127 33920 3226 2524 --
NM_016542chrX31262 1218 1169 ----11344
NM_016544chr2113796 3738 3614 3594 3021 2948 2673 2480 1186 564 80 12656 13239 --
NM_016545chr11865 ------
NM_016559chr341503 1289 318 309 --1577 --
NM_016562chrX21340 1225 11046 ----
NM_016586chr142466 173 ------
NM_016587chr741132 972 374 158 1443 ----
NM_016598chr311315 ------
NM_016604chr521040 1033 11307 ----
NM_016605chr542743 2709 2253 579 --1529 --
NM_016607chrX198 11343 11632 --
NM_016612chr81540 1558 1474 --
NM_016613chr442309 703 424 296 159 ----
NM_016618chr23395 365 103 ------
NM_016620chr14575 550 327 219 1203 11274 --
NM_016621chr11124555 4540 4518 3976 1206 1087 1022 1001 995 651 240 112 --14534 --
NM_016623chr81509 1152 168 --
NM_016625chr3--159 ----
NM_016626chr1841748 1137 466 446 11306 ----
NM_016628chr101562 ------
NM_016641chr16--11451 ----
NM_016644chr5126 --1454 --
NM_016651chr146938 760 317 263 245 35 11081 ----
NM_016653chr22847 67 --1121 --
NM_016654chr153927 345 289 11400 2216 150 --
NM_016824chr1031176 519 220 ------
NM_016831chr11585 22348 779 21732 1516 --
NM_016929chr654190 3398 3340 3239 872 --1934 --
NM_016931chr111361 ------
NM_016936chr165858 713 670 123 104 --1866 --
NM_016937chrX11025 2980 955 ----
NM_016950chr41250 1565 1274 1193
NM_016953chr2136099 5850 5665 5559 1572 1558 1536 874 858 710 679 588 81 16138 ----
NM_017412chr81457 1491 ----
NM_017420chr14123531 2626 2457 1447 1309 1052 967 932 802 650 397 104 12368 23303 320 --
NM_017423chr432215 1633 1538 ------
NM_017426chr43637 515 122 --1451 --
NM_017440chr12----188 --
NM_017447chr2184059 3840 3589 2989 1685 1561 479 93 11291 23103 2837 21190 725
NM_017456chr1741985 1971 1893 1772 11946 11853 --
NM_017459chr1------1413
NM_017491chr42918 171 1851 --1700
NM_017514chrX1930 --1909 --
NM_017519chr66855 488 307 285 223 71 ------
NM_017520chr13298 28 --1220 --
NM_017526chr12164 104 ------
NM_017548chr372092 1452 1366 805 756 485 233 --1850 --
NM_017563chr346369 5411 4136 2157 14759 14639 --
NM_017572chr191194 185 ----
NM_017593chr41326 ------
NM_017594chr973099 2643 2193 2116 2058 1058 879 1545 22684 701 1710
NM_017610chr152528 351 --1760 11555
NM_017617chr91261 21266 111 ----
NM_017626chr1021256 639 11558 11094 --
NM_017628chr4115030 4999 4855 4842 4632 4429 3552 1652 1639 1632 1215 11358 31158 1041 115 --
NM_017629chr171982 1901 1793 659 558 549 539 ------
NM_017631chr4162 --148 --
NM_017632chr42137 113 ------
NM_017633chr643026 2452 601 279 33303 3101 1149 ----
NM_017635chr1141352 1273 1149 488 11097 21174 327 --
NM_017637chr9118814 8165 7882 7484 3659 3290 2734 2424 2029 346 221 29276 717 27557 3451 --
NM_017638chr1289 73 ------
NM_017640chr62759 92 --1358 --
NM_017641chr121187 1806 ----
NM_017643chr1742479 2463 837 619 22864 2618 ----
NM_017644chr374493 4074 3977 3656 1379 520 461 35083 4688 626 --1758
NM_017649chr101388 21092 367 ----
NM_017650chr795167 4489 2215 1837 1367 1346 1339 1118 709 ------
NM_017658chr14104492 3927 3757 1751 1341 1329 285 165 135 71 --31744 884 774 --
NM_017660chr1953418 3131 1362 904 313 11187 ----
NM_017661chr15----21285 1087 1209
NM_017666chrX62193 1991 883 518 253 68 21785 1667 ----
NM_017667chr71118 2498 384 169 --
NM_017672chr1511112 ------
NM_017691chr152422 36 ------
NM_017693chr1361653 1328 1279 457 388 137 1560 1508 --
NM_017697chr81345 ------
NM_017703chr19135 ------
NM_017709chr183909 2730 1536 1411 1066 1057 1051 1022 14019 13152 --
NM_017714chr201860 164 ----
NM_017719chr321939 649 1944 ----
NM_017724chr33326 277 102 1232 ----
NM_017736chr1683164 2967 2808 2394 2285 2115 488 335 22749 2695 42154 453 163 93 1357
NM_017737chr171963 1942 1884 1783 1463 636 509 1175 ----
NM_017738chr921260 1159 11179 ----
NM_017739chr1--1117 ----
NM_017742chr1811756 ------
NM_017744chr182474 2008 2001 1994 1988 1951 1851 784 ------
NM_017745chrX2584 164 1257 --1193
NM_017753chr93754 324 28 ------
NM_017757chr1821157 341 11103 ----
NM_017758chr1771451 193 117 110 103 97 79 ------
NM_017769chr1443116 3108 2290 175 22520 542 12827 12970
NM_017772chr621422 223 21239 1198 --11732
NM_017778chr831137 295 288 1303 --1384
NM_017779chr142090 1820 635 362 3533 330 227 --12435
NM_017780chr83847 627 90 ------
NM_017784chr321080 41 --1344 11011
NM_017787chr1062433 2386 1166 720 677 229 ------
NM_017798chr2011234 1304 --1796
NM_017801chr372442 2217 1652 1005 980 512 140 21807 265 ----
NM_017811chr973003 2645 2613 2553 1010 1004 700 1334 --11254
NM_017813chr8135716 5513 5162 5148 5065 5056 4562 4360 4189 4174 4076 1655 835 55708 4805 3988 1821 670 35487 3976 28 15438
NM_017824chr1032208 1931 28 22699 1070 1782 11779
NM_017831chr1811765 14800 13336 13066
NM_017845chr43586 318 295 ------
NM_017848chrX64378 3722 460 450 362 202 14270 13143 --
NM_017857chr11----1653 --
NM_017880chr2----1466 --
NM_017893chr10--11299 ----
NM_017896chr2093547 3325 3307 2988 788 689 602 449 441 13528 1422 --
NM_017913chr92171 109 ------
NM_017919chr965260 4388 4203 4181 3749 983 34376 4354 4268 1764 --
NM_017921chr1731618 796 408 ------
NM_017925chr921872 1319 11385 171 --
NM_017933chr251503 1217 1178 304 243 1123 ----
NM_017938chrX61620 1341 841 746 487 108 11549 ----
NM_017944chr1142089 1028 977 35 1567 33120 3019 1184 --
NM_017948chr92477 72 ------
NM_017954chr751170 1112 216 179 50 1540 ----
NM_017958chr242857 2661 236 103 --12124 192
NM_017987chr1061998 741 380 351 304 180 ----11482
NM_017988chr121114 1230 1181 --
NM_017994chr772771 1968 771 584 576 570 378 --1556 --
NM_017998chr951166 1001 940 303 247 ------
NM_018003chr1541942 970 916 136 --12399 --
NM_018004chr3155 --122 --
NM_018008chr31276 ------
NM_018011chr13493 87 81 74 1590 ----
NM_018015chrX31151 998 132 ------
NM_018017chr1092815 2756 2352 2341 1901 808 524 483 206 12824 1785 1674
NM_018026chr1141434 1306 1018 509 --21277 995 --
NM_018027chr1053033 2962 1103 687 649 11171 ----
NM_018030chr181942 160 ----
NM_018032chr163629 317 311 1344 ----
NM_018040chr1180 ------
NM_018043chr111181 ------
NM_018045chr153139 2986 2048 1990 284 --1106 --
NM_018046chr531505 703 342 --133 --
NM_018047chr52925 736 1933 ----
NM_018048chr1242004 1277 671 286 180 2483 279 --
NM_018049chr192104 97 ------
NM_018061chr13708 243 222 21102 626 ----
NM_018067chr1--1136 ----
NM_018070chr11376 ------
NM_018078chr42929 709 1965 21047 73 --
NM_018084chr263249 2836 1152 892 770 740 ------
NM_018086chr251809 1651 1414 610 233 ------
NM_018092chr1621148 519 1148 ----
NM_018095chr11191 --1726 --
NM_018105chr841097 1091 276 187 ------
NM_018110chr1641097 1083 1073 355 ------
NM_018112chr93984 865 250 ------
NM_018115chr43638 632 623 2506 152 ----
NM_018121chr1053058 2535 2185 2137 1192 21077 595 ----
NM_018126chr451360 1284 1259 486 181 --1253 --
NM_018128chr171430 --1173 --
NM_018133chr392221 2017 1861 1814 1644 1521 726 67 50 12129 --2546 208
NM_018151chr25791 762 230 67 27 1723 ----
NM_018155chr341074 971 516 131 --23252 910 12427
NM_018157chr1252264 2219 950 653 166 12640 1837 --
NM_018164chr12--2257 112 ----
NM_018177chr42261 142 ------
NM_018178chr151708 1362 1275 327 69 --11944 --
NM_018179chr121242 158 ----
NM_018181chr1831833 1229 1216 1431 11867 1327
NM_018191chr1341964 278 114 21 11431 ----
NM_018195chr1161984 1950 1899 1892 1804 1344 --1601 150
NM_018200chr1592584 2553 2537 1978 1905 1899 1761 523 402 21643 42 ----
NM_018202chr11337 --2331 181 --
NM_018214chr641196 1021 395 275 ------
NM_018227chr493223 3216 2920 2662 2491 2021 957 948 255 23164 1089 ----
NM_018237chr101260 ------
NM_018241chr42899 156 ------
NM_018243chr443501 1361 82 75 ------
NM_018246chr842197 286 238 144 --12454 --
NM_018247chr622962 1965 32689 926 726 ----
NM_018254chr152421 1592 837 328 120 1304 21707 292 --
NM_018263chr262542 2176 1829 997 635 63 ------
NM_018270chr201261 ----1769
NM_018286chr172906 834 1892 ----
NM_018293chr332295 1075 217 12411 ----
NM_018299chr853495 3381 2927 1331 382 --42204 1370 1235 1049 12894
NM_018307chr172293 68 1736 ----
NM_018312chr1161794 1352 822 812 553 326 --22046 569 --
NM_018313chr372445 2262 2132 366 344 325 280 --12093 --
NM_018315chr441615 1248 518 373 --11290 --
NM_018317chr4----136 --
NM_018323chr421835 575 149 21610 157 --
NM_018325chr961516 1031 668 609 307 141 ------
NM_018327chr2031622 665 543 21753 152 11562 11498
NM_018330chr1081613 1375 1338 1100 444 419 333 60 ------
NM_018332chr16--11349 ----
NM_018334chr7----1385 --
NM_018339chr921164 652 --11679 11526
NM_018351chr1264617 4467 3255 3028 851 175 1693 11777 13345
NM_018362chr11133925 3172 3166 3159 2672 2652 2641 2514 1482 447 387 353 50 23478 236 23124 590 1657
NM_018364chr183571 3506 2947 2692 979 504 84 61 43969 3450 2723 373 14097 --
NM_018370chr121320 1214 ----
NM_018374chr7105105 3970 1780 1597 1590 1556 1297 1171 679 553 34524 3626 379 33734 3427 154 13719
NM_018388chrX1382 1499 --11080
NM_018403chr3104141 4080 3859 3678 3514 3491 1646 934 784 446 23835 607 12704 21509 490
NM_018412chr71155 ------
NM_018416chr1262666 2620 1996 437 208 123 --1219 --
NM_018426chr66603 593 585 573 562 392 ------
NM_018429chr532414 2260 1068 ----42655 2371 2271 2014
NM_018440chr8138727 8701 8431 7648 7343 5419 2477 2463 2217 1904 1826 727 391 58362 7020 3177 3057 1260 26883 2759 --
NM_018442chr11105 --1114 --
NM_018444chr831653 1633 552 21640 674 1508 --
NM_018448chr1221080 163 --1871 --
NM_018461chr10--1579 ----
NM_018462chr31121 ------
NM_018466chrX2761 681 ------
NM_018477chr1421011 773 11064 1875 --
NM_018482chr872153 1976 1928 1614 1040 1034 427 --32547 2332 2116 --
NM_018489chr152035 1995 1742 328 183 1769 2785 677 --
NM_018490chr1131758 1676 1274 1605 1287 --
NM_018502chr51293 ------
NM_018534chr22587 189 ------
NM_018553chr1761840 1642 1277 1261 589 207 11730 ----
NM_018555chr1961827 866 860 854 848 428 11618 ----
NM_018557chr221619 1335 --1141 --
NM_018566chr184640 3467 3348 1797 1478 1383 1182 1041 24444 3148 1926 --
NM_018569chr441320 1150 1142 1030 21204 1164 11248 --
NM_018590chr1051711 1615 1437 267 117 21657 602 ----
NM_018638chr12125704 5408 5013 3842 2265 2100 1831 1225 854 783 388 326 33622 1720 1042 34343 3919 380 14198
NM_018640chr1241819 617 334 251 12830 ----
NM_018641chr72270 143 --2430 61 --
NM_018649chr101542 ------
NM_018650chr121735 354 21961 384 21596 57 1642
NM_018657chr32804 246 2715 166 ----
NM_018682chr72751 229 ------
NM_018685chr72884 33 --31046 750 398 --
NM_018695chr572387 2137 1789 959 718 426 270 32021 626 227 --1764
NM_018700chr541356 1197 483 209 11229 ----
NM_018704chr11843 --21618 718 --
NM_018712chr1121098 261 ------
NM_018718chr751882 1492 421 316 34 1297 1303 --
NM_018724chr12647 521 ------
NM_018834chr5144 2390 53 1201 --
NM_018840chr20------1364
NM_018844chr72369 323 --32041 1828 526 --
NM_018846chr72932 83 ------
NM_018847chr931937 1715 310 1684 21732 412 --
NM_018890chr761324 1109 1042 605 447 21 11452 --11156
NM_018898chr521582 372 --137 --
NM_018899chr521582 372 --137 --
NM_018900chr521582 372 --137 --
NM_018901chr521582 372 --137 --
NM_018902chr521582 372 --137 --
NM_018903chr521582 372 --137 --
NM_018904chr521582 372 --137 --
NM_018905chr521582 372 --137 --
NM_018906chr521582 372 --137 --
NM_018907chr521582 372 --137 --
NM_018908chr521582 372 --137 --
NM_018909chr521582 372 --137 --
NM_018910chr521582 372 --137 --
NM_018911chr521582 372 --137 --
NM_018912chr541737 680 568 445 ------
NM_018913chr541737 680 568 445 ------
NM_018914chr541737 680 568 445 ------
NM_018915chr541737 680 568 445 ------
NM_018916chr541737 680 568 445 ------
NM_018917chr541737 680 568 445 ------
NM_018918chr541737 680 568 445 ------
NM_018919chr541737 680 568 445 ------
NM_018920chr541737 680 568 445 ------
NM_018921chr541737 680 568 445 ------
NM_018922chr541737 680 568 445 ------
NM_018923chr541737 680 568 445 ------
NM_018924chr541737 680 568 445 ------
NM_018925chr541737 680 568 445 ------
NM_018926chr541737 680 568 445 ------
NM_018927chr541737 680 568 445 ------
NM_018928chr541737 680 568 445 ------
NM_018929chr541737 680 568 445 ------
NM_018932chr51611 ----1667
NM_018945chr643656 3565 2483 892 --12654 --
NM_018947chr783815 3723 3699 1946 1773 1481 1138 486 --1183 --
NM_018951chr751185 946 904 799 25 11271 1931 --
NM_018957chr221320 ------
NM_018958chr1593864 3423 3356 3302 2970 1420 1146 682 638 23791 3692 ----
NM_018959chr191563 1170 ----
NM_018964chr2121056 1004 1882 ----
NM_018970chr782816 2414 1958 1207 792 685 550 109 --1707 --
NM_018976chr122170 126 --1691 --
NM_018977chrX2985 968 ----11010
NM_018979chr122717 667 22043 139 ----
NM_018983chr41257 ------
NM_018992chr1631551 335 255 ------
NM_018994chr11492 ------
NM_018999chr10134837 4525 4157 3573 3378 3069 2993 1915 1901 1894 1557 1285 1193 14447 34613 4438 371 --
NM_019000chr531420 1147 1141 21106 274 1346 --
NM_019001chr384375 4311 3963 3739 3450 3075 1349 598 23565 1650 33486 3119 1196 --
NM_019004chr741550 744 552 404 ----21960 1795
NM_019005chr72265 142 ------
NM_019006chr152461 61 ------
NM_019022chr1873217 3145 2837 2492 2194 2053 1105 12596 ----
NM_019027chr482494 2486 917 910 883 300 288 155 11652 1166 11823
NM_019035chr42356 272 12014 ----
NM_019044chr233885 499 79 --14330 14764
NM_019045chrX------1795
NM_019049chr11743 ------
NM_019050chr442121 1974 690 573 --31834 1805 1756 11576
NM_019063chr231749 526 178 12205 11936 --
NM_019071chr7----1804 --
NM_019072chr543836 2643 1339 1291 --1389 1696
NM_019074chr152904 90 ----1894
NM_019080chr1341565 1306 453 152 ------
NM_019084chr1032621 1045 448 ----21862 1783
NM_019087chr511208 11728 21509 1157 --
NM_019091chr241160 1073 1046 722 11126 183 --
NM_019094chr1242389 2360 1246 139 --22646 296 --
NM_019114chr932150 2042 439 1811 1196 --
NM_019116chr1693580 3532 2785 2538 1362 1013 449 355 89 --2605 576 --
NM_019117chrX73336 3026 2369 1322 1085 875 85 23349 177 21241 383 --
NM_019555chr311793 --11326 --
NM_019557chr12598 285 ------
NM_019558chr2--1262 ----
NM_019590chr1041239 1071 956 262 ------
NM_019591chr122413 355 ------
NM_019592chr91625 ------
NM_019594chr91650 --2657 343 --
NM_019597chrX1202 ------
NM_019600chr151694 ----2542 128
NM_019605chr12250 85 ------
NM_019610chr131571 307 156 ------
NM_019860chr1011099 ------
NM_019862chr1651702 1512 647 508 320 11196 ----
NM_019885chr242856 2071 1166 311 12780 12701 --
NM_019891chr1--2453 292 11304 --
NM_019896chr21299 ------
NM_019898chr1651702 1512 647 508 320 11196 ----
NM_019899chr1651702 1512 647 508 320 11196 ----
NM_019900chr1651702 1512 647 508 320 11196 ----
NM_019903chr1031176 519 220 ------
NM_020116chr41145 11411 ----
NM_020120chr221151 377 11420 2302 65 147
NM_020122chr2104410 4175 3903 1766 1645 1505 1380 1070 400 381 1900 34280 1289 1222 1782
NM_020127chr131538 1236 481 --11139 1461
NM_020132chr2154473 3806 1493 934 732 2690 342 ----
NM_020135chr62362 317 --1156 --
NM_020141chr141995 844 622 324 ----12013
NM_020144chr71822 ------
NM_020148chr1832358 1095 733 --22327 293 --
NM_020150chr1051901 1597 1584 415 29 ------
NM_020152chr212255 219 ------
NM_020156chr71239 --1507 --
NM_020159chr441705 421 251 216 21245 1193 1443 --
NM_020168chr1521309 325 1452 ----
NM_020177chr521156 715 --1448 --
NM_020178chr17------1937
NM_020182chr2043298 3102 3042 2870 --11003 --
NM_020193chr1141130 1001 434 293 11017 21286 415 11193
NM_020194chr24605 273 267 209 1635 ----
NM_020198chr1721321 24 1579 11018 --
NM_020204chr11691 --1270 126
NM_020205chr163328 3321 2581 2307 1093 384 33497 2698 2650 23479 407 13294
NM_020210chr15--1953 ----
NM_020216chr12413 379 ------
NM_020225chr4----1107 --
NM_020226chr41266 ------
NM_020228chr1161878 1769 1732 470 201 125 22279 933 1690 --
NM_020234chr15169 ------
NM_020239chr182194 1924 1710 1602 807 680 291 21 21682 351 ----
NM_020240chr532704 1922 1077 --2250 158 --
NM_020245chr6164843 4611 4500 1778 1658 1493 1487 1481 1474 1461 1448 899 840 457 267 206 13552 14477 --
NM_020311chr24750 583 199 40 ------
NM_020337chr442954 2714 2161 47 22275 2099 12048 --
NM_020338chr1053239 3180 1085 1016 375 23251 3089 ----
NM_020341chr2021629 465 ------
NM_020342chr282567 2049 1988 1710 932 745 731 695 11898 ----
NM_020348chr1052511 1963 1933 1087 336 32104 1831 696 ----
NM_020353chr351921 1538 1502 1327 309 11434 21476 564 --
NM_020354chr101856 1949 1893 11006
NM_020379chr13373 339 333 ------
NM_020381chr65595 556 349 199 141 ------
NM_020382chr122525 237 1121 ----
NM_020383chr10125 ------
NM_020390chr3104581 4552 4075 3833 3579 3215 1823 785 143 62 --13114 1730
NM_020403chr1341771 1414 178 153 11592 ----
NM_020416chr452480 1655 557 497 292 12495 ----
NM_020420chrY4283 254 231 150 --11598 1420
NM_020432chr752313 1873 1725 1558 1437 11760 11648 --
NM_020440chr143358 3137 1167 157 --1374 --
NM_020443chr1106715 6480 5926 5157 5087 4381 2169 1516 908 153 1834 16639 --
NM_020445chr7----1707 1540
NM_020449chrX2782 300 ------
NM_020453chr421326 88 11473 --1411
NM_020455chr672844 2339 2325 1768 1129 1055 131 ------
NM_020457chr162695 648 ------
NM_020463chr231099 595 152 --11404 --
NM_020466chr675004 4401 4279 3275 3048 1452 1245 11902 33920 3820 3744 1211
NM_020473chrX4392 91 85 44 ----1351
NM_020474chr1831866 1327 732 --1752 --
NM_020475chr822337 327 ------
NM_020476chr822337 327 ------
NM_020477chr822337 327 ------
NM_020478chr822400 390 ------
NM_020480chr822337 327 ------
NM_020529chr14155 ------
NM_020546chr5112816 2586 2437 2380 2045 1953 1207 650 585 340 85 ------
NM_020548chr2161 ----1189
NM_020640chr321680 922 ------
NM_020644chr113368 353 320 ------
NM_020647chr832306 1909 55 21813 440 1315 --
NM_020651chr251695 1427 448 284 222 21493 661 186 --
NM_020654chr351545 1531 1174 1051 108 ------
NM_020655chr161183 ------
NM_020662chr641862 1654 1390 625 1245 2375 28 --
NM_020666chr5------1736
NM_020673chr20137602 7364 7063 5768 5418 5373 5140 3027 2917 1010 300 144 84 21394 358 25905 3056 --
NM_020682chr1031152 885 55 ------
NM_020686chr1642847 2419 2298 291 --12508 --
NM_020689chr2011317 ------
NM_020693chr11171 ------
NM_020697chr83932 515 385 1169 --21292 157
NM_020699chr175023 4029 2007 1495 570 242 213 ------
NM_020711chr222079 754 11816 ----
NM_020715chr1431715 1440 662 ------
NM_020718chr16116097 5800 5719 5703 4779 4611 4435 2047 1925 1491 1321 22216 1184 11512 36231 5587 1667
NM_020727chr21113802 3770 3433 3405 2904 2874 1250 390 327 320 204 33632 2725 414 ----
NM_020728chr763048 2410 2052 1942 485 128 12538 ----
NM_020732chr66855 488 307 285 223 71 ------
NM_020734chr1253356 1326 1017 557 334 23318 2811 22893 1199 --
NM_020739chr1513519 11273 14178 1886
NM_020742chrX62674 2668 2512 1694 565 117 11990 ----
NM_020747chr52830 788 --1971 --
NM_020748chr1742114 1808 776 541 --11525 --
NM_020752chr1042832 2690 827 743 22545 1848 ----
NM_020755chr631135 207 87 ------
NM_020760chr231748 799 763 --21435 238 --
NM_020766chrX104553 3615 3353 2907 1619 1611 921 769 417 90 --11321 --
NM_020768chr562657 2365 1181 1017 432 337 ----22746 966
NM_020771chr631411 1175 402 --11517 --
NM_020772chr17127424 7303 5302 2594 2230 2135 2127 1584 964 693 342 268 56665 6516 1206 1078 293 37866 2341 286 --
NM_020773chr422261 2254 --22552 461 --
NM_020774chr18105957 4948 4921 4684 1854 920 404 192 185 80 35251 1746 817 11442 11486
NM_020779chr283013 2700 2351 2167 1056 1019 264 94 12091 ----
NM_020782chr1284868 4459 3928 3922 3889 3655 3232 508 --44298 3967 1494 43 1907
NM_020783chr1822378 2022 135 --11998
NM_020791chr171206 ------
NM_020792chr372401 2022 1086 719 708 332 237 --1348 12110
NM_020794chr151127 255 249 237 201 1262 11415 --
NM_020796chr572329 2218 2175 2107 1994 1116 71 22366 1968 12769 --
NM_020801chr532661 2315 897 11675 ----
NM_020802chr1162640 1285 1064 999 307 196 ------
NM_020803chr471968 1721 1602 940 690 391 345 12041 --11866
NM_020806chr142319 83 ------
NM_020808chr13331 105 73 ------
NM_020809chr1141965 1486 676 649 1426 ----
NM_020810chr1463086 3006 2932 1432 669 570 43191 677 490 90 1755 --
NM_020818chr142384 364 ------
NM_020819chr641152 1116 994 91 ------
NM_020824chr103547 514 312 --1540 --
NM_020825chr1642882 896 721 237 13831 1191 --
NM_020830chr2113280 3270 3264 3244 3178 3117 2831 2561 2549 397 294 --12394 --
NM_020841chr1273845 3091 1349 1090 886 805 433 11236 1629 13508
NM_020844chr8117359 7303 2655 2642 2170 1718 1711 563 524 404 314 22468 653 27074 4964 --
NM_020854chr1861586 1574 1500 244 104 96 --1294 --
NM_020856chr1941398 1303 466 86 1100 ----
NM_020858chr1511941 12396 ----
NM_020861chr641349 1123 1113 81 1478 --11367
NM_020866chr131293 1856 ----
NM_020868chr221828 250 1526 11925 --
NM_020870chr452113 1560 804 543 358 1717 ----
NM_020871chrX2743 470 12194 1921 --
NM_020872chr321268 87 1251 11290 1679
NM_020873chr32811 48 1220 1859 --
NM_020890chr32192 152 ------
NM_020918chr1063658 3362 2471 953 907 479 1614 12994 --
NM_020919chr231198 907 823 --1232 --
NM_020921chr1473549 3350 465 459 315 288 66 21036 423 2300 139 13438
NM_020922chrX61729 1502 1276 218 88 34 11546 ----
NM_020926chrX----131 --
NM_020927chr1652214 1689 273 260 159 ------
NM_020940chr1042080 1030 648 209 12397 12186 --
NM_020948chr153558 2929 2376 1432 831 12328 13628 --
NM_020951chr1942400 2361 2131 23 1113 2310 227 --
NM_020952chr9----168 --
NM_020975chr1021588 132 --11611 --
NM_020977chr44703 441 317 185 ------
NM_020981chr21308 --3823 136 116 --
NM_020987chr101484 ----134
NM_020993chr1222025 1850 1467 ----
NM_021003chr142552 275 ------
NM_021005chr1541063 475 463 420 --1868 --
NM_021007chr222221 1532 2638 112 ----
NM_021012chr1723144 1051 1376 ----
NM_021025chr51347 ------
NM_021033chr1353125 2776 1357 555 190 23160 3145 12631 --
NM_021035chr20183 ------
NM_021069chr422066 642 --12115 --
NM_021072chr542485 2198 819 791 --1347 --
NM_021083chrX113347 2729 2482 2271 943 862 509 404 383 351 243 23070 2611 ----
NM_021097chr251201 976 648 367 291 ------
NM_021102chr191351 --1373 --
NM_021110chr82753 258 --1605 --
NM_021120chrX72619 2610 1266 1085 157 143 105 --1176 --
NM_021132chr1031070 1037 345 ----1540
NM_021136chr142527 300 2232 147 ----
NM_021140chrX5862 846 743 74 59 --1894 --
NM_021144chr91483 --1558 --
NM_021148chr772527 2020 845 822 794 750 96 32313 1740 1712 1692 --
NM_021151chr71962 ----11079
NM_021155chr19102701 2428 2296 2263 2209 1864 1163 924 165 77 ------
NM_021159chr41681 11263 ----
NM_021163chr783556 2739 915 760 684 587 510 237 1715 --1453
NM_021174chr82764 740 ------
NM_021177chr62129 102 ------
NM_021180chr1--1708 ----
NM_021183chrX42056 1032 800 627 11778 --2983 273
NM_021188chr142430 348 ------
NM_021190chr141090 1012 108 102 --21186 430 21320 540
NM_021191chr1232538 2184 417 12280 ----
NM_021192chr21368 ------
NM_021194chr11232 ------
NM_021203chr35853 342 276 184 46 1697 ----
NM_021204chr43801 699 345 1679 ----
NM_021215chr2082349 2335 2251 2243 2237 2118 1678 89 --12092 --
NM_021224chr92409 401 ------
NM_021227chr4156 ------
NM_021229chr1231028 980 176 11245 11067 --
NM_021238chr1241678 359 251 102 ----21688 592
NM_021239chr1431276 1014 198 11444 ----
NM_021240chr91540 ------
NM_021249chr1421636 1326 1426 --1647
NM_021252chr1042059 1612 1369 653 --21752 204 --
NM_021255chr1483844 3455 3409 3359 1618 1467 1054 942 1290 1301 --
NM_021574chr221217 1304 ----
NM_021619chr911145 ------
NM_021622chr1031497 903 763 194 ----
NM_021627chr32991 38 --1959 --
NM_021629chr354331 4100 1578 727 386 35028 4827 1528 33478 3184 1257 23590 1225
NM_021637chrX31341 1227 76 ------
NM_021643chr241895 1735 1503 1381 --164 --
NM_021644chr1051098 953 825 747 308 ------
NM_021647chr4104566 4423 3869 3410 3365 2984 2874 492 439 419 24039 3442 ----
NM_021705chr631580 1300 497 ----1131
NM_021723chr71578 ------
NM_021738chr103333 116 89 1705 ----
NM_021809chr2052508 1786 998 986 890 --1914 --
NM_021813chr6205788 5633 5519 5441 4281 4275 4268 2339 2235 2229 1577 1563 1271 869 812 806 800 771 409 51 15646 --15595
NM_021815chr252716 819 359 234 56 12082 --1295
NM_021818chr14126 --21370 1229 --
NM_021830chr102871 308 ------
NM_021911chr5115284 5256 5131 5125 5119 4954 4878 4498 1983 1051 879 1922 14123 13634
NM_021912chr1514116 13342 1314 172
NM_021914chr1462055 1895 694 556 417 85 ------
NM_021935chr31758 1229 1807 --
NM_021943chr632151 2145 1588 135 1882 --
NM_021945chr643490 3064 2986 533 1786 ----
NM_021946chrX51448 423 184 166 160 ------
NM_021951chr93612 349 267 ------
NM_021954chr1362654 2636 2385 1056 1033 853 32773 2734 181 ----
NM_021956chr6----21183 1124 --
NM_021957chr121507 1266 ----
NM_021960chr172785 2680 2179 1061 1035 969 847 12332 1759 12244
NM_021961chr11136144 5537 4799 4620 2862 2542 2453 1719 1612 1084 405 253 208 --24853 1660 --
NM_021964chr3176246 5974 5747 5605 4246 4209 4121 2516 2185 1955 1915 1881 1863 1461 1343 802 576 35587 4510 1803 26564 376 22381 2219
NM_021970chr42671 617 ------
NM_021973chr42708 658 ------
NM_021979chr141181 ------
NM_021988chr2031525 1410 1111 ------
NM_021998chrX31322 1216 503 ------
NM_022037chr21345 ----1833
NM_022048chr1596047 5790 4809 4766 4615 4597 4583 4464 1619 36239 666 356 1761 --
NM_022049chr11338 21337 603 21176 510 --
NM_022051chr1--1248 ----
NM_022062chr1111780 ------
NM_022066chr171991 ------
NM_022075chr12849 117 ------
NM_022079chr103868 257 56 --1648 --
NM_022080chr2062492 1927 1727 751 406 45 22196 316 12532 --
NM_022114chr164236 4220 3906 1658 1210 538 ------
NM_022116chr73685 171 108 ------
NM_022118chr13--1243 ----
NM_022123chr141461 1592 ----
NM_022130chr51207 2926 196 152 --
NM_022136chr211498 ------
NM_022137chr141163 --3567 371 252 --
NM_022160chr91136 --133 --
NM_022166chr1665947 4992 4051 4045 1877 1630 25305 1147 14763 15850
NM_022170chr72451 216 1166 ----
NM_022173chr21345 ----1833
NM_022351chr893747 2834 2767 1388 1347 1205 769 754 608 33693 3489 51 --13570
NM_022373chr72721 118 --1185 1746
NM_022374chr21340 ------
NM_022442chr2031525 1410 1111 ------
NM_022443chr3129 ------
NM_022454chr83343 112 91 1744 ----
NM_022459chr13136036 6030 5695 5689 5596 4611 4247 4047 2222 1889 1826 1506 552 --14698 --
NM_022462chr19143189 3081 2768 2740 2495 2376 1487 1389 1363 1307 1241 789 373 267 1471 12350 --
NM_022465chr1263052 2653 724 473 213 87 11182 12938 --
NM_022469chr123140 2862 --12563 --
NM_022473chr1563363 2945 1189 1038 503 452 1380 21086 183 13378
NM_022474chr1452511 2412 1927 1875 215 1129 3930 894 635 --
NM_022496chr122351 334 --1499 --
NM_022552chr251037 508 493 486 474 ------
NM_022553chr62435 96 ------
NM_022566chr151540 ----1590
NM_022574chr761340 791 350 342 336 196 ------
NM_022650chr52958 346 ------
NM_022659chr81361 ------
NM_022716chr182363 1949 1132 888 577 460 331 248 11069 12172 --
NM_022728chr71741 ------
NM_022733chr13933 878 868 ------
NM_022739chr17--2793 755 ----
NM_022753chr162778 2469 2306 1909 254 69 11837 22828 244 --
NM_022754chr541815 688 253 89 1696 ----
NM_022755chr951008 923 865 724 101 21985 501 1276 --
NM_022756chr131522 488 451 2979 466 ----
NM_022758chr633222 374 161 22091 580 ----
NM_022763chr362567 2138 2053 1262 984 91 12851 ----
NM_022770chr16--11264 ----
NM_022778chr111046 11253 ----
NM_022780chr261505 729 722 708 405 259 ------
NM_022781chr9103156 3092 2763 2734 2723 2713 813 602 537 267 --22348 1239 --
NM_022782chr121111 ----1381
NM_022783chr83510 283 146 ------
NM_022802chr1041475 1193 1161 1025 --1245 --
NM_022817chr251633 518 478 233 147 1207 12107 --
NM_022824chr5------1241
NM_022826chr22840 244 ------
NM_022828chr541762 1457 678 596 ----1316
NM_022831chr14701 658 561 482 1234 ----
NM_022832chr432068 1873 1769 1157 1697 --
NM_022841chr1532768 2735 2546 --1956 1169
NM_022843chr13--31465 449 147 ----
NM_022845chr1621843 781 1488 1228 --
NM_022893chr273133 3106 1007 759 517 348 191 13026 12752 --
NM_022894chr24371 362 143 67 ----1311
NM_022898chr1461866 1021 822 609 603 340 11295 33064 1572 568 --
NM_022909chr53527 219 202 ------
NM_022912chr243043 565 480 358 12552 --1433
NM_022918chr1132093 453 136 ------
NM_022965chr411362 ----11308
NM_022977chrX52642 1651 284 188 178 22649 256 ----
NM_023000chr1461417 1341 690 462 446 249 ----21386 1189
NM_023001chr1461417 1341 690 462 446 249 ----21386 1189
NM_023010chrX3588 576 334 --1595 --
NM_023015chr13743 733 721 1782 ----
NM_023016chr242277 790 636 140 1474 12803 1363
NM_023037chr131987 --11107 --
NM_023039chr5163 2387 110 ----
NM_023079chr1721880 551 --11872 --
NM_023105chr831860 1853 1675 1794 11795 --
NM_023106chr831860 1853 1675 1794 11795 --
NM_023110chr831860 1853 1675 1794 11795 --
NM_023111chr831860 1853 1675 1794 11795 --
NM_023925chr121104 ------
NM_023927chr53842 537 177 2983 913 11356 --
NM_023929chr842614 1895 513 433 22422 1038 ----
NM_023931chr1611248 ------
NM_024007chr532830 2436 1192 21238 387 ----
NM_024036chr11--2251 96 ----
NM_024050chr19------1174
NM_024052chr1762811 1258 1027 983 954 205 33007 2595 243 1786 --
NM_024055chr51644 ------
NM_024065chr2--195 ----
NM_024090chr411940 ------
NM_024104chr193996 945 84 --1930 --
NM_024294chr633222 374 161 22091 580 ----
NM_024295chr821961 462 --11290 --
NM_024312chr1241223 1132 569 404 --11108 --
NM_024334chr341864 1735 1248 746 11781 1694 --
NM_024345chr966023 5500 4085 3976 1333 396 25868 119 1259 16042
NM_024408chr152716 2576 892 861 636 23165 135 --12597
NM_024415chr5153 ----169
NM_024422chr1861969 1572 1546 644 565 104 --2753 684 11650
NM_024429chr741034 1016 896 269 ------
NM_024496chr142706 570 ------
NM_024501chr21739 --1503 --
NM_024519chr161291 ------
NM_024524chr362880 2625 2187 1040 880 326 --32487 933 340 12691
NM_024525chr11598 --1653 --
NM_024529chr121187 1137 --1233 1893
NM_024539chrX2409 277 ------
NM_024545chr24781 627 304 75 --1551 --
NM_024546chr137950 909 337 293 281 188 85 --1882 --
NM_024548chr341401 643 498 169 ------
NM_024556chr114450 401 381 181 ------
NM_024561chr133375 208 145 ------
NM_024569chr142528 2264 2239 332 --32873 649 638 --
NM_024576chr61144 ------
NM_024582chr421017 985 ----1883
NM_024590chr431324 595 537 1769 --142
NM_024594chr541829 1790 1595 508 --11479 --
NM_024613chr811636 11867 ----
NM_024617chr9--1308 ----
NM_024624chr261640 1548 1444 1150 388 272 --2598 245 --
NM_024626chr151643 1359 1337 364 87 ------
NM_024639chr622917 2317 --21960 889 12610
NM_024640chr12941 300 ------
NM_024646chr133937 3916 283 ------
NM_024657chrX2624 184 1735 ----
NM_024659chr2--1360 ----
NM_024665chr3174500 4468 4038 3833 3812 3564 3294 1355 1023 995 987 797 758 485 466 259 182 24339 1254 33935 2861 325 13041
NM_024670chr1041149 422 416 96 ------
NM_024674chr163042 1189 861 445 215 43 ------
NM_024675chr16165 ------
NM_024692chr23497 316 189 11160 1149 --
NM_024700chr141008 860 790 416 ------
NM_024713chr1531583 1429 33 11298 ----
NM_024715chr52632 406 1230 1425 --
NM_024721chr842327 799 605 134 --32513 1822 256 --
NM_024740chr1183591 3294 2804 2674 1519 955 719 280 --11414 --
NM_024744chr222367 425 12484 --12077
NM_024749chr15719 713 497 433 268 12226 1562 --
NM_024757chr931098 1089 1022 ------
NM_024761chr973663 1319 1267 899 634 422 305 --24024 1746 1469
NM_024766chr2------1401
NM_024789chr10173 --296 63 --
NM_024803chr101365 ------
NM_024811chr1131849 1233 31 11825 ----
NM_024813chr1197 ------
NM_024814chr7----1347 --
NM_024824chr1461661 678 593 200 125 44 1212 ----
NM_024828chr91430 ----11211
NM_024834chr1051699 1570 1256 419 411 ------
NM_024847chr1631013 977 934 ------
NM_024871chr31268 ------
NM_024893chr20--1152 ----
NM_024896chr922341 779 12385 11027 --
NM_024909chr61451 ------
NM_024920chr421409 293 --21422 1246 --
NM_024930chr582796 2468 1921 606 229 223 217 211 --1537 --
NM_024941chr521325 994 ------
NM_024945chr91385 21137 793 ----
NM_024947chr3119208 8913 8709 5925 2798 2744 2029 683 666 407 34 17676 38217 6006 640 29159 2530
NM_024949chr484947 4474 4389 4359 1460 1067 95 76 --13864 --
NM_024953chr1262352 2335 2318 2162 1802 1011 --3623 612 403 --
NM_024969chr22702 140 ------
NM_024971chr9----168 --
NM_024979chr1321203 418 --11647 --
NM_024989chr2136967 6400 6192 5914 3221 3181 3023 2843 2191 1659 1431 1326 145 28075 5261 42821 1547 1279 518 17350
NM_024991chr1063004 2997 2083 1156 872 852 --32964 2822 2254 --
NM_024993chr251514 1324 1180 485 338 11049 ----
NM_025047chr32326 61 ------
NM_025054chr863930 3679 3349 3341 3275 3046 12861 1266 23973 1577
NM_025065chr15874 544 537 229 220 ------
NM_025073chr1114683 4649 4587 4294 3499 3108 2913 1022 964 831 166 14037 31752 810 281 --
NM_025076chr2----2525 259 --
NM_025077chr11233 ------
NM_025106chr121882 1635 ------
NM_025126chr121766 ------
NM_025133chr21804 1297 1896 --
NM_025134chr1642131 794 652 361 ------
NM_025138chr1321464 1077 --11190 11181
NM_025146chr382542 1715 1672 692 253 152 121 115 1441 12646 12414
NM_025154chr751557 1146 553 463 336 1261 ----
NM_025160chr144342 2961 2781 618 --11235 --
NM_025164chr1152154 312 276 166 157 ------
NM_025179chr164864 3575 3545 847 290 257 14796 ----
NM_025181chr21767 --2121 70 --
NM_025184chrX3845 748 157 ------
NM_025187chr16----11043 --
NM_025191chr1103570 2882 2818 2708 2455 2432 1139 1133 1061 661 11146 22753 2395 --
NM_025208chr1172401 2170 2042 821 764 697 297 22360 1793 12392 --
NM_025211chr9----2241 100 --
NM_025214chr1842680 2570 671 662 22108 354 ----
NM_025221chr43563 341 273 ------
NM_025224chr2052342 2240 1607 1587 413 ------
NM_025230chr1421301 757 1295 --11222
NM_025235chr1051986 890 848 356 200 ------
NM_025248chr1731294 189 177 --23220 1124 --
NM_025250chr752924 2916 2214 1887 791 ------
NM_025268chr141396 ------
NM_030571chr531389 1248 457 11516 ----
NM_030594chr153526 257 182 --11362 1898
NM_030621chr1474219 4126 3728 658 623 318 199 13133 21369 206 --
NM_030625chr1042055 786 227 219 ------
NM_030627chr533047 2936 230 23451 343 1434 43898 3790 3721 2631
NM_030629chr1611680 11694 ----
NM_030636chr742154 2089 836 490 12055 --1905
NM_030637chr143171 164 105 ------
NM_030647chr785863 5790 4751 4420 2363 2150 1406 629 35836 2060 452 25692 985 --
NM_030648chr4134961 4619 3968 3889 3430 1329 1323 1260 653 518 357 332 256 --15478 11867
NM_030650chr253728 3495 2890 1056 364 11696 32746 1510 1441 13983
NM_030652chr6----1283 --
NM_030660chr1451230 976 502 484 231 --11502 --
NM_030664chr1061990 1552 1528 868 418 293 ------
NM_030674chr1285848 5806 5402 5127 4249 3696 1953 162 14906 24794 2022 15880
NM_030751chr1071702 1602 1510 1355 728 482 243 --11894 11642
NM_030751chr1071702 1602 1510 1355 728 482 243 --11894 11642
NM_030755chr14102807 2390 2384 2378 2167 1157 879 564 292 213 11902 12544 32909 1066 610
NM_030756chr101318 ------
NM_030771chr11164 ------
NM_030780chr821202 161 11511 11465 --
NM_030791chr1441846 658 354 253 1554 21393 639 --
NM_030806chr1168834 7738 6730 5854 3781 3747 3666 3475 3239 2278 2165 1915 1892 1361 395 83 22016 766 15878 --
NM_030809chr1242473 2443 945 931 1667 21688 1015 --
NM_030811chr202370 356 ------
NM_030816chr142741 2279 952 176 52655 1296 922 708 296 23520 1342 --
NM_030820chr621055 300 1117 ----
NM_030877chr201101 ------
NM_030881chr2262322 2117 1852 1554 697 379 ----1892
NM_030885chr342030 1884 912 618 22249 2236 1143 1604
NM_030915chr242314 1553 289 59 2746 442 ----
NM_030918chr144724 4133 1585 551 11298 25236 172 --
NM_030920chr132003 593 556 1744 --11498
NM_030937chr121157 973 ------
NM_030939chr641055 998 823 358 1895 150 --
NM_030940chr931370 544 418 ----11146
NM_030949chr67961 472 355 196 175 112 106 ------
NM_030953chr52349 178 ------
NM_030958chr82421 27 ----1396
NM_030962chr1141437 1188 494 116 ------
NM_030963chr62603 231 ------
NM_030964chr572874 2589 2550 2432 1325 799 45 2926 757 23687 3120 --
NM_030965chr1----1539 --
NM_031216chr1851879 1570 1556 1518 1456 ----1704
NM_031243chr752073 1848 915 435 388 11478 11992 --
NM_031244chr641126 1047 864 194 ------
NM_031262chr92980 828 ------
NM_031263chr931037 885 759 --153 --
NM_031267chr72564 393 ------
NM_031283chr22858 785 1850 ----
NM_031292chr1231194 458 221 --11726 --
NM_031296chr462317 2276 2198 692 584 434 22375 383 ----
NM_031305chr431325 640 568 --21340 234 --
NM_031314chr142688 205 1286 31858 1422 334 --
NM_031369chr42333 176 --1634 --
NM_031370chr42333 176 --1634 --
NM_031407chrX130 ------
NM_031411chr521582 372 --137 --
NM_031417chr1921015 196 1846 ----
NM_031419chr321303 1189 --11392 --
NM_031427chr14125889 5551 4599 4436 2248 2205 2175 2162 1856 977 599 332 1642 ----
NM_031431chr1371769 1656 1514 1471 1206 664 297 21853 1630 11168 --
NM_031435chr1253148 832 261 254 98 --12346 1493
NM_031439chr851884 1601 379 364 241 --1661 --
NM_031442chrX42240 1017 701 254 22548 811 13165 --
NM_031443chr71327 ------
NM_031452chr15183 ------
NM_031453chr1052301 1741 755 650 336 22548 762 1785 --
NM_031463chr163760 352 26 1397 ----
NM_031469chr673834 3747 3598 3060 2594 1317 139 12724 13608 --
NM_031476chr1642734 2719 2590 325 ------
NM_031483chr2093351 3129 2314 2267 1396 994 588 514 326 ------
NM_031492chr111477 ------
NM_031844chr153697 3034 2649 557 250 11633 1960 --
NM_031845chr253644 3211 2462 2257 920 --33358 1454 476 12302
NM_031847chr253644 3211 2462 2257 920 --33358 1454 476 12302
NM_031849chr521582 372 --137 --
NM_031857chr521582 372 --137 --
NM_031858chr1741603 1512 1134 1083 1409 1227 --
NM_031860chr521582 372 --137 --
NM_031862chr1741603 1512 1134 1083 1409 1227 --
NM_031866chr101961 --1935 1882
NM_031892chrX1864 ------
NM_031903chr7--187 ----
NM_031953chr41127 ------
NM_031989chr122310 234 ------
NM_031990chr1921247 1014 1139 ----
NM_031991chr1921247 1014 1139 ----
NM_031992chr72451 216 1166 ----
NM_032012chr9105135 4662 4578 4244 2020 1409 1234 1093 867 587 --34834 4750 4031 21740 1329
NM_032041chr832755 2335 1889 21736 844 ----
NM_032042chr542776 1097 907 471 12540 ----
NM_032047chr331737 315 263 3821 689 509 ----
NM_032088chr541737 680 568 445 ------
NM_032092chr541737 680 568 445 ------
NM_032102chr1132987 1236 570 ----13134
NM_032116chr1395812 5465 5169 4962 4784 1876 1795 1547 1487 --1342 24030 1322
NM_032119chr51252 ------
NM_032132chr11438 --2131 35 --
NM_032144chr221212 693 2658 280 ----
NM_032145chr661888 1646 1407 1352 465 408 31729 593 289 ----
NM_032153chr322368 940 --12321 --
NM_032154chr102915 314 ------
NM_032156chr121104 ------
NM_032160chr1854326 4265 2766 1368 604 --2646 308 --
NM_032165chr12----1248 --
NM_032182chr1061389 1276 1088 297 62 36 ------
NM_032186chr14575 550 327 219 1203 11274 --
NM_032189chr1324276 2034 34966 1970 1765 ----
NM_032199chr1083380 2818 2503 2412 1435 971 700 689 11483 ----
NM_032208chr252895 2731 1007 1000 561 12478 1983 --
NM_032221chr2051837 1809 1638 1437 627 ------
NM_032228chr11102963 2617 2484 2369 2353 2235 768 704 482 454 ------
NM_032229chr1321113 1103 ------
NM_032236chr141083 922 884 336 --11110 --
NM_032239chr421343 366 21259 136 ----
NM_032246chr1541298 1275 1076 362 ----1313
NM_032256chr1241042 1036 1029 826 1332 ----
NM_032281chr1952470 2242 2115 1191 285 ------
NM_032288chr352316 2186 1454 709 139 21894 209 --12173
NM_032291chr121560 283 11926 ----
NM_032312chr2--1262 --1583
NM_032320chr112248 166 --1782 --
NM_032321chr253221 3086 3020 994 801 --22806 871 --
NM_032354chr1761182 982 929 908 820 225 ------
NM_032373chr10165449 5404 5311 5263 5125 4878 4836 3864 2166 1759 1753 1326 1219 498 479 372 13664 --24820 1461
NM_032379chr114843 808 743 323 ------
NM_032403chr541737 680 568 445 ------
NM_032408chr731200 1138 844 ------
NM_032410chr841059 946 781 508 1182 ----
NM_032433chr1931295 1289 1274 ----21556 1360
NM_032434chr241455 1038 340 227 ------
NM_032435chr171923 1636 807 616 425 296 184 ------
NM_032438chr641602 1447 1020 220 --11589 --
NM_032440chr1041797 1158 333 314 1355 ----
NM_032441chrX51143 1092 983 308 132 --1938 --
NM_032446chr543422 1255 226 57 13837 ----
NM_032449chr122239 876 ----12370
NM_032457chr433888 2996 1447 --21501 28 --
NM_032458chrX73263 3057 2908 2809 2668 2377 168 11079 ----
NM_032466chr831536 649 316 ------
NM_032485chr201662 ------
NM_032505chr382441 1858 1793 1775 1052 639 625 102 11800 ----
NM_032507chr61228 ------
NM_032509chr842407 2119 805 49 2206 130 2262 90 --
NM_032510chr1852485 2211 1951 1552 93 3472 367 317 22323 2165 --
NM_032511chr61114 ----1319
NM_032521chr2022606 790 11201 12411 --
NM_032539chrX4727 336 170 86 ------
NM_032547chr421416 1137 ------
NM_032557chr43905 756 322 2401 140 ----
NM_032558chr921229 165 11463 1947 --
NM_032560chr143995 829 47 ----2851 813
NM_032569chr16--21913 1573 11358 --
NM_032574chr2--1246 ----
NM_032576chrY1118 ------
NM_032582chr1731487 585 446 --11300 --
NM_032594chr142962 401 ------
NM_032595chr1711238 ------
NM_032598chr17141 ------
NM_032603chr21149 ------
NM_032622chr411044 1633 1195 183
NM_032631chr192186 128 ------
NM_032632chr1441894 1840 751 117 --1437 --
NM_032646chr17--21696 45 ----
NM_032664chr821474 1358 11549 11432 --
NM_032682chr343443 3071 691 641 22302 726 ----
NM_032689chr191270 ----1119
NM_032737chr1952664 2329 1737 650 396 12638 22481 82 --
NM_032778chr342522 2268 401 314 23131 2398 13300 --
NM_032780chr1121188 920 ------
NM_032781chr11123 1894 --1278
NM_032801chr1141995 1835 1744 979 ------
NM_032804chr1032166 2158 1949 1464 21866 420 11651
NM_032810chr1021279 1045 1598 ----
NM_032813chr132984 951 ------
NM_032828chr1933454 1507 613 1309 ----
NM_032857chr152175 45 1207 ----
NM_032859chr13103932 3496 2837 2823 1160 1128 1072 698 571 408 13761 1155 12698
NM_032864chr13633 502 160