TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4512
miRNA Sequence: CAGGGCCUCACUGUAUCGCCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51436 ------
NM_000020chr12162286 2239 1994 1970 1598 1580 1549 1518 813 694 489 454 418 296 229 213 21836 1632 --1635
NM_000029chr1250 36 ------
NM_000053chr1341454 378 196 156 --11591 --
NM_000068chr1991443 987 591 415 377 333 243 226 145 ------
NM_000080chr172285 164 --2625 211 --
NM_000081chr111492 ------
NM_000084chrX75938 5805 5294 5241 2469 1585 1275 ----1896
NM_000088chr1711152 --1532 --
NM_000092chr233068 2892 629 ------
NM_000110chr11787 ------
NM_000114chr202912 868 --1521 --
NM_000125chr674097 1565 1532 1240 1127 987 352 1399 ----
NM_000138chr1512518 ------
NM_000141chr1011050 ------
NM_000165chr62602 525 ------
NM_000166chrX3594 151 84 ------
NM_000178chr201241 ------
NM_000192chr12--1333 ----
NM_000206chrX2217 35 ------
NM_000208chr1954570 4428 4344 3122 1558 13349 14024 --
NM_000214chr201264 --11627 --
NM_000216chrX33370 241 105 ------
NM_000217chr1262037 1612 1217 778 649 622 13470 24720 3982 --
NM_000238chr71274 1282 288 74 --
NM_000244chr115684 281 186 100 40 1260 ----
NM_000252chrX11172 ------
NM_000255chr61147 ------
NM_000258chr31241 ------
NM_000259chr1535713 5005 4605 --24638 182 12119
NM_000264chr921121 598 1771 1710 --
NM_000266chrX4974 966 314 262 ------
NM_000274chr10155 ------
NM_000276chrX3611 365 336 --21782 776 --
NM_000278chr10122187 2181 2128 2082 1561 1530 804 776 738 702 223 217 1642 ----
NM_000285chr19140 ------
NM_000304chr17----128 --
NM_000319chr121120 ------
NM_000332chr645200 1750 361 31 --36236 5353 4753 --
NM_000335chr361595 724 628 246 199 93 1821 1651 --
NM_000337chr531659 1627 1239 11883 35174 4790 42 14613
NM_000346chr17------1755
NM_000353chr16--186 157 --
NM_000368chr973733 3618 3414 1498 999 899 402 --2991 131 --
NM_000390chrX32360 2187 690 12390 ----
NM_000393chr211388 11436 ----
NM_000399chr102236 38 --148 --
NM_000411chr211819 --1182 --
NM_000425chrX4226 69 50 37 ------
NM_000430chr1723421 257 ------
NM_000439chr51472 ------
NM_000449chr1----160 --
NM_000450chr12185 93 ------
NM_000461chr363251 3160 1207 1061 801 201 13940 13271 --
NM_000486chr12113014 2825 2783 2546 2015 999 714 654 200 61 46 --12795 --
NM_000493chr6----1226 --
NM_000494chr102645 60 ------
NM_000499chr156601 355 338 298 272 22 --1291 --
NM_000503chr82605 62 11811 ----
NM_000523chr221015 833 1155 159 --
NM_000525chr1131317 623 411 21447 278 ----
NM_000533chrX2409 105 1705 --2287 41
NM_000555chrX107817 7593 7046 6586 5808 3157 3143 2127 996 526 15757 ----
NM_000572chr1171 ------
NM_000578chr241483 1295 1157 375 --21801 1385 --
NM_000586chr4--1172 137 --
NM_000599chr293820 3758 3434 3388 3374 3085 2891 1376 400 --13445 --
NM_000609chr1072520 2423 959 926 693 491 99 --12377 --
NM_000611chr1196453 5437 5266 5025 4552 2507 2300 1012 153 11901 46434 6194 2281 2040 --
NM_000615chr1132897 2369 2137 --22157 2057 --
NM_000618chr1266202 5875 5132 4656 2414 201 ------
NM_000618chr1266202 5875 5132 4656 2414 201 ------
NM_000621chr1311189 ------
NM_000633chr18145050 4793 4691 3784 3416 3189 1358 1258 1177 1164 1032 1014 1008 845 --11252 --
NM_000663chr1632795 2346 847 1700 3955 588 279 12192
NM_000665chr71145 ------
NM_000681chr1061300 555 529 512 191 130 ------
NM_000687chr203489 225 48 ------
NM_000719chr1286560 6545 6468 5751 497 421 272 265 --14312 --
NM_000720chr34457 346 177 26 ------
NM_000723chr1781614 1555 638 470 443 359 272 34 2345 332 1176 --
NM_000725chr126637 414 327 213 102 54 1965 ----
NM_000726chr211099 ------
NM_000734chr15825 631 228 222 216 ------
NM_000738chr117961 880 865 839 260 99 88 ------
NM_000780chr81116 ------
NM_000789chr17123 --1244 --
NM_000793chr1434636 3460 3283 1406 24157 4092 --
NM_000801chr201717 ------
NM_000806chr531878 1533 583 11985 ----
NM_000813chr542088 1649 1164 321 --1191 --
NM_000817chr211168 ------
NM_000818chr101187 ------
NM_000827chr552465 874 842 555 35 --1418 --
NM_000831chr1155859 5789 5511 5331 5055 5012 4252 4177 2176 2134 1232 960 885 390 28 1546 55952 4741 4419 3914 166 --
NM_000833chr163592 572 141 ------
NM_000836chr191225 ------
NM_000839chr32368 312 ------
NM_000840chr7----1381 --
NM_000844chr31284 183 ----
NM_000868chrX1784 ------
NM_000870chr521396 1319 ----157
NM_000875chr15105587 5326 5125 4666 2185 1924 1327 940 901 239 --22177 1522 --
NM_000879chr5------190
NM_000883chr72509 491 --3256 248 144 --
NM_000883chr72509 491 --3256 248 144 --
NM_000891chr1743548 2273 1017 59 ------
NM_000901chr412295 ------
NM_000908chr5----1186 --
NM_000918chr173621 614 603 ------
NM_000922chr11------1125
NM_000934chr171230 --1677 --
NM_000941chr77350 294 272 249 241 112 95 ------
NM_000942chr152131 64 --144 --
NM_000944chr4----1359 --
NM_000945chr211524 ------
NM_000948chr6----136 --
NM_000958chr53348 185 178 ----1367
NM_000964chr17141330 1298 1082 1034 998 983 926 874 866 275 256 248 179 173 ------
NM_000965chr321210 351 ------
NM_001001132chr211262 --11331 --
NM_001001323chr1232161 1968 564 ------
NM_001001342chr1031487 1286 930 11114 ----
NM_001001395chr1211939 ----12385
NM_001001481chr822655 1325 --1298 --
NM_001001484chr1012343 ------
NM_001001522chr11131 --1121 --
NM_001001549chr722213 539 ------
NM_001001550chr722213 539 ------
NM_001001555chr722213 539 ------
NM_001001557chr86869 751 645 613 67 49 --11568 --
NM_001001664chr223711 52 ----1210
NM_001001852chr223774 284 217 --1616 --
NM_001001890chr21103465 2933 1359 1344 1083 223 165 106 99 27 13898 ----
NM_001002252chr124312 112 96 62 ------
NM_001002257chr22452 307 13523 22292 664 --
NM_001002259chr12----1126 --
NM_001002762chr10162730 2642 2517 2372 2113 2060 2002 1925 861 822 703 618 438 374 80 28 ------
NM_001002814chr863550 3428 903 688 625 98 --13114 --
NM_001002860chr1424405 643 --12948 1786
NM_001002862chr22122308 2289 2245 1959 1929 1835 404 378 347 110 98 21 11431 ----
NM_001002914chr1731104 1039 799 ------
NM_001003396chr6185 --2229 40 --
NM_001003397chr6185 --2229 40 --
NM_001003407chr1045005 2011 1118 73 13499 11451 --
NM_001003408chr1045005 2011 1118 73 13499 11451 --
NM_001003652chr1868012 6895 3406 3210 2418 1143 12177 12532 17474
NM_001003676chr117847 677 360 290 283 236 136 1651 1216 --
NM_001003682chr161361 1338 1294 408 362 295 1273 ----
NM_001003712chr1222748 1019 ------
NM_001003789chr223932 455 148 ------
NM_001003800chr971408 1121 859 800 743 736 343 ------
NM_001003937chr2--11452 ----
NM_001003940chr1593767 3339 3096 1409 742 729 699 271 209 --23348 189 --
NM_001003942chr1593767 3339 3096 1409 742 729 699 271 209 --23348 189 --
NM_001003943chr1593771 3343 3100 1413 746 733 703 275 213 --23352 193 --
NM_001004065chr91388 11009 13104 --
NM_001004105chr5129 ------
NM_001004127chr133935 909 842 ------
NM_001004360chr2141 ------
NM_001004419chr1221810 624 ------
NM_001004722chr25335 242 229 203 161 ------
NM_001005158chr3195 ------
NM_001005159chr3195 ------
NM_001005209chr22198 56 ------
NM_001005271chr174865 407 165 32 ------
NM_001005273chr174865 407 165 32 ------
NM_001005366chr12170 ------
NM_001005386chr241878 1871 1824 96 ------
NM_001005404chr1781389 1249 1181 609 403 316 308 109 --11189 --
NM_001005417chr14575 209 134 108 --1195 --
NM_001005505chr32523 310 --2486 130 --
NM_001005609chrX73720 3565 3243 1390 1336 290 163 --23576 3184 11218
NM_001005611chrX2449 358 ------
NM_001005743chr142138 118 11282 ----
NM_001005744chr142138 118 11282 ----
NM_001005745chr142138 118 11282 ----
NM_001005746chr211099 ------
NM_001005747chr211099 ------
NM_001005782chr21337 ------
NM_001005910chr31130 --1559 --
NM_001005911chr31130 --1559 --
NM_001006115chr3132671 2163 2032 1999 1018 963 781 762 432 388 348 222 205 ------
NM_001006634chr162562 141 ------
NM_001006665chr12802 611 --1201 --
NM_001006938chrX2129 63 --1567 --
NM_001007023chr1434636 3460 3283 1406 24157 4092 --
NM_001007024chr1753924 3384 3153 1719 349 ------
NM_001007025chr1753924 3384 3153 1719 349 ------
NM_001007156chr1561847 1501 755 552 429 51 --1745 --
NM_001007246chr211171 --11716 --
NM_001007250chr1131 ------
NM_001007271chr105960 819 763 344 39 1141 2976 88 --
NM_001007273chr10155 --171 --
NM_001007279chr223749 587 51 --1106 --
NM_001007466chr654837 3810 1624 401 231 13222 2671 54 --
NM_001007471chr9129 ------
NM_001007553chr111006 1344 ----
NM_001007559chr1811871 ------
NM_001008220chr5153712 3613 3569 3143 2741 916 783 753 734 543 507 486 447 411 254 --2728 501 --
NM_001008222chrX41352 1126 948 243 --2997 959 --
NM_001008225chr7----1182 --
NM_001008239chr1832362 1409 1377 --1461 --
NM_001008407chr791807 1792 1513 1166 551 495 286 251 81 11608 21330 694 --
NM_001008541chr1042141 2120 1436 772 1405 ----
NM_001008541chr1042141 2120 1436 772 1405 ----
NM_001008564chr131825 --1413 --
NM_001008660chr111147 11211 ----
NM_001008701chr19123036 2761 2601 2580 2545 2281 2169 858 831 729 404 62 21949 137 ----
NM_001008860chr15--1635 ----
NM_001008892chr15--1635 ----
NM_001008894chr15--1635 ----
NM_001008938chr11183 ------
NM_001009555chr421734 291 ------
NM_001009566chr14980 590 269 163 ------
NM_001009881chr1----1142 --
NM_001009882chr1----1142 --
NM_001009993chr273657 3146 3076 1654 1637 1558 151 --23833 74 14235
NM_001010854chr14136 --146 --
NM_001010861chr122509 2268 --12614 --
NM_001010888chrX23878 2951 --13461 11055
NM_001010891chr546014 5632 5624 4984 ------
NM_001010917chr10112003 1929 1734 1584 1459 708 636 491 436 360 48 ------
NM_001010922chr121413 179 34148 3869 1661 1348 14002
NM_001011513chr433244 1413 115 ------
NM_001011666chr726133 634 25167 1081 14793 --
NM_001011708chr222143 1110 ------
NM_001011713chr1411523 11473 1651 --
NM_001012329chr162236 1687 1573 973 828 716 --12306 --
NM_001012415chr97703 697 573 281 241 56 37 ------
NM_001012426chr6203373 3176 2922 2903 2841 2132 1360 1296 1230 883 732 675 621 432 407 391 335 304 126 58 ------
NM_001012427chr6203373 3176 2922 2903 2841 2132 1360 1296 1230 883 732 675 621 432 407 391 335 304 126 58 ------
NM_001012642chr15102021 1943 1886 1758 1592 777 630 467 404 319 12157 ----
NM_001012751chr10--11813 ----
NM_001012968chrX2536 526 ------
NM_001012977chrX1915 1425 1478 --
NM_001013437chr18------128
NM_001013635chr122981 233 ------
NM_001013693chr1162546 2470 2462 2232 2007 1951 1876 1155 833 731 426 388 357 313 170 27 1373 ----
NM_001013693chr1162546 2470 2462 2232 2007 1951 1876 1155 833 731 426 388 357 313 170 27 1373 ----
NM_001013843chr15--1350 ----
NM_001014435chr161506 --2541 438 --
NM_001014443chr12170 56 ------
NM_001014794chr11178 ------
NM_001014795chr11178 ------
NM_001014797chr1057529 5353 2803 2669 2203 --46704 2899 2115 1327 --
NM_001014831chr196718 571 515 287 218 78 --1248 --
NM_001014832chr196718 571 515 287 218 78 --1248 --
NM_001014834chr196718 571 515 287 218 78 --1248 --
NM_001014835chr196718 571 515 287 218 78 --1248 --
NM_001014839chr13440 333 197 ------
NM_001014841chr13440 333 197 ------
NM_001015053chr1781470 1448 1434 1283 1026 337 310 145 ------
NM_001015508chr8183 ----1605
NM_001015887chr321282 705 ------
NM_001017368chr1752162 849 711 551 299 ------
NM_001017371chr2--1884 ----
NM_001017395chr3--13399 ----
NM_001017405chr4----1743 --
NM_001017424chr12549 297 --11828 --
NM_001017425chr12549 297 --11828 --
NM_001017523chr1251608 1583 1317 1246 652 --1302 --
NM_001017923chr141256 ------
NM_001017926chr821748 625 ------
NM_001017930chrX--1226 ----
NM_001017973chr5132 ------
NM_001017974chr5132 ------
NM_001017995chr5134087 3984 3871 3372 1355 1244 1020 831 726 571 214 36 27 13482 13263 --
NM_001018003chr85710 613 607 575 550 ----1282
NM_001018050chr22213468 3375 3312 3234 3175 3115 3107 3064 2901 2784 2689 2508 2312 2189 2129 2105 1255 1150 1074 1003 993 --53217 1364 1289 1038 169 --
NM_001018052chr22213468 3375 3312 3234 3175 3115 3107 3064 2901 2784 2689 2508 2312 2189 2129 2105 1255 1150 1074 1003 993 --53217 1364 1289 1038 169 --
NM_001018053chr131462 343 132 --1618 --
NM_001018064chr9--11528 --1363
NM_001018065chr995470 4012 3978 2267 1653 1258 995 665 24 1653 ----
NM_001018066chr995470 4012 3978 2267 1653 1258 995 665 24 1653 ----
NM_001018067chr123997 977 ------
NM_001018068chr123997 977 ------
NM_001018069chr123997 977 ------
NM_001018072chr1251608 1583 1317 1246 652 --1302 --
NM_001018091chr1522622 96 ------
NM_001018108chr1531602 1550 96 11483 21850 1459 --
NM_001018111chr721534 1063 1140 21389 1053 --
NM_001023567chr1521884 346 ------
NM_001023587chr32721 147 ------
NM_001024401chr16132849 2759 2641 2250 1909 1768 958 938 904 677 529 398 41 --11832 --
NM_001024455chrX52603 2239 1051 822 730 --22320 984 --
NM_001024649chr532052 778 127 161 ----
NM_001024660chr311102 --11092 --
NM_001024809chr17141330 1298 1082 1034 998 983 926 874 866 275 256 248 179 173 ------
NM_001024858chr14182942 2925 2682 2671 2620 2551 2298 2217 2094 976 955 837 604 568 338 263 130 122 12184 31965 882 61 --
NM_001024937chr171732 ------
NM_001024948chr111376 ------
NM_001025068chr3----191 --
NM_001025069chr3----191 --
NM_001025076chr1025116 2439 --25020 4831 --
NM_001025077chr1056474 4879 829 473 142 --26378 6189 --
NM_001025079chr353355 2937 2646 599 80 --1657 1312
NM_001025107chr131948 1935 201 --12174 --
NM_001025107chr131948 1935 201 --12174 --
NM_001025108chr222749 30 ------
NM_001025232chr121333 146 ----
NM_001025233chr1232713 1106 455 --1907 --
NM_001025580chrX33164 1431 664 --14112 --
NM_001025603chr1----160 --
NM_001025780chr9------11496
NM_001029859chr1151730 1682 1661 1643 1599 --31822 1758 374 --
NM_001029871chr2051721 1561 658 640 536 129 2514 435 11612
NM_001029883chr272578 2565 2147 1966 1926 432 125 1271 ----
NM_001030007chr1653689 2481 1532 571 300 --23752 757 --
NM_001030055chr1444714 4419 1429 1008 ----12965
NM_001031623chr6134 ----11382
NM_001031677chr51385 --1106 --
NM_001031679chr1242720 1031 675 420 --32389 637 428 --
NM_001031680chr142213 819 681 79 11635 22254 409 1887
NM_001031690chr752937 2203 1185 673 195 --12010 --
NM_001031692chr7--1256 ----
NM_001031695chr2265139 4902 4377 3998 1954 50 --24014 1367 11124
NM_001031716chr21705 11009 ----
NM_001031720chr41159 ------
NM_001031740chr151208 158 145 133 78 ------
NM_001031801chr22197 ------
NM_001031804chr1663905 3817 3543 3460 2799 828 ------
NM_001032288chr201639 --124 --
NM_001032289chrX----2330 154 --
NM_001032296chr1332459 2378 1150 ------
NM_001032380chr1021977 1624 ------
NM_001033044chr11628 ------
NM_001033045chr234353 4003 3544 ------
NM_001033047chr43974 851 90 ------
NM_001033056chr11628 ------
NM_001033081chr141481 1430 691 463 1769 ----
NM_001033082chr141481 1430 691 463 1769 ----
NM_001033117chr3104385 3867 3399 1649 688 598 147 112 97 61 --24599 1418 --
NM_001033507chr141485 1406 1385 30 ------
NM_001033551chr17204051 4024 3457 3422 3389 2951 2934 2677 2650 2501 2489 1344 1021 1004 821 801 675 423 237 146 --63818 3620 1247 1103 1047 549 --
NM_001033557chr21415 ------
NM_001033602chr1342239 1890 1093 91 11758 ----
NM_001033723chr852558 2202 2095 628 30 11049 ----
NM_001034837chr51287 ------
NM_001034838chr51287 ------
NM_001034954chr1031186 899 748 ------
NM_001034955chr1031186 899 748 ------
NM_001034956chr1031186 899 748 ------
NM_001034957chr1031186 899 748 ------
NM_001035235chr51200 ------
NM_001035521chr26264 224 201 124 110 84 ------
NM_001035534chr981296 1174 1144 1138 966 452 144 63 --1909 --
NM_001037132chr711801 21871 905 ----
NM_001037133chr711801 21871 905 ----
NM_001037290chr113945 723 411 ------
NM_001037317chr122509 2268 --12614 --
NM_001037324chr32754 310 ------
NM_001037339chr121643 115 ------
NM_001037340chr121643 115 ------
NM_001037341chr121643 115 ------
NM_001037341chr121643 115 ------
NM_001037582chr41534 ------
NM_001037639chr3135 ------
NM_001037954chr1112442 ----1281
NM_001038493chr251223 327 237 220 23 --1605 --
NM_001038640chr151912 ------
NM_001038702chr532781 2510 960 ------
NM_001038707chr131722 1619 604 ------
NM_001038707chr131722 1619 604 ------
NM_001039140chr203356 124 28 ------
NM_001039350chr741258 677 311 32 ------
NM_001039465chr14128 ------
NM_001039479chr1462285 2086 1986 1763 412 275 ------
NM_001039538chr2164 --1337 --
NM_001039577chr184415 4215 3979 3274 2770 1263 1242 873 33505 3156 95 22796 76 --
NM_001039583chr222479 98 ------
NM_001039584chr222479 98 ------
NM_001039590chrX--13695 --148
NM_001039591chrX--13695 --148
NM_001039670chr123593 237 173 1201 131 1628
NM_001039690chr16182197 1921 940 814 730 704 691 616 587 532 412 403 376 370 364 341 229 104 1954 2698 503 2738 462
NM_001039762chr1011639 --1145 --
NM_001039802chr121061 153 --11188 --
NM_001039840chrX14573 ----14777
NM_001039888chr1--1715 ----
NM_001039905chr1541203 1011 571 178 --11263 --
NM_001039916chr121390 --1101 --
NM_001039917chr121390 --1101 --
NM_001039918chr121390 --1101 --
NM_001039919chr121390 --1101 --
NM_001039920chr121390 --1101 --
NM_001039937chr131998 --22751 605 --
NM_001040118chr11178 125 ----
NM_001040144chr16182197 1921 940 814 730 704 691 616 587 532 412 403 376 370 364 341 229 104 1954 2698 503 2738 462
NM_001040146chr16182197 1921 940 814 730 704 691 616 587 532 412 403 376 370 364 341 229 104 1954 2698 503 2738 462
NM_001040151chr1163494 2775 1820 1720 704 99 ------
NM_001040152chr753218 3129 1836 253 38 ----11653
NM_001040153chr131686 ------
NM_001040157chr41602 --1403 --
NM_001040172chr521396 1319 ----157
NM_001040173chr521396 1319 ----157
NM_001040202chr421020 929 ------
NM_001040272chr91746 ----21685 625
NM_001040284chr1624385 1553 ------
NM_001040427chr16----140 --
NM_001040429chr13----12732 --
NM_001040439chr1681441 1165 1046 538 446 403 320 293 1327 11190 --
NM_001040446chr542263 150 131 96 --12063 --
NM_001040451chr51470 ------
NM_001040452chr51470 ------
NM_001040619chr12295 214 --21181 609 --
NM_001042403chr1211033 ------
NM_001042404chr111893 ------
NM_001042413chr921261 112 --22966 1583 --
NM_001042428chr16165 --1183 --
NM_001042430chr143532 74 65 ------
NM_001042472chr204229 185 168 158 1592 ----
NM_001042476chr1641983 1866 1821 384 --22104 1734 --
NM_001042494chr1542833 2352 1299 44 ------
NM_001042495chr1542833 2352 1299 44 ------
NM_001042496chr1542833 2352 1299 44 ------
NM_001042497chr1542833 2352 1299 44 ------
NM_001042506chrX1915 1425 1478 --
NM_001042510chr8--1634 ----
NM_001042511chr8--1634 ----
NM_001042533chr342965 2738 2333 1290 1353 ----
NM_001042539chr1621121 1011 --1762 --
NM_001042555chr121706 13110 ----
NM_001042599chr277718 6335 5249 5217 5092 2524 2336 --11487 --
NM_001042601chr322920 696 1788 ----
NM_001042603chr1221495 114 --13885 --
NM_001042632chr20112331 1945 966 949 825 570 531 519 441 181 100 --42342 1804 463 313 1600
NM_001042633chr20112331 1945 966 949 825 570 531 519 441 181 100 --42342 1804 463 313 1600
NM_001042681chr142074 2037 2026 741 --22344 2000 --
NM_001042682chr142074 2037 2026 741 --22344 2000 --
NM_001042682chr142074 2037 2026 741 --22344 2000 --
NM_001043318chr14131630 1460 1348 1337 1301 1261 1234 1117 1019 918 611 498 247 --2629 424 --
NM_001043351chr121806 448 ------
NM_001044385chr243930 3282 896 713 ------
NM_001077628chr12217 147 ------
NM_001092chr1782102 1938 1897 1886 1733 1602 1572 431 11674 31705 561 387 --
NM_001095chr1281920 1692 1585 1488 1246 621 60 28 --31717 1474 364 --
NM_001100108chr178035 6457 2480 2194 2031 1677 374 57029 3160 2419 1072 578 38301 2886 1414 --
NM_001106chr3199676 7999 7397 6906 3788 3659 3566 3433 3412 3073 2865 2826 2789 2237 2197 1946 1100 870 841 --27801 3262 12430
NM_001109977chr41173 1717 ----
NM_001111chr131948 1935 201 --12174 --
NM_001113490chrX22311 1319 --1801 --
NM_001116chr1642341 932 821 744 --12769 --
NM_001117chr1831006 600 440 22226 2117 ----
NM_001121chr1011506 --1294 --
NM_001122679chr51436 ------
NM_001128chr1653689 2481 1532 571 300 --23752 757 --
NM_001148chr421939 638 ------
NM_001160chr1232379 870 563 ------
NM_001172chr141501 ------
NM_001173chr1444714 4419 1429 1008 ----12965
NM_001177chr1222152 2060 --11896 --
NM_001191chr2041371 1178 1113 133 1296 ----
NM_001200chr201916 ------
NM_001204chr277033 6335 5983 5315 3073 2669 1992 1727 26930 6570 --
NM_001218chr1552358 1869 1785 126 65 --12390 --
NM_001222chr1061609 1409 369 334 63 41 21648 792 ----
NM_001237chr4------11021
NM_001237chr4------11021
NM_001241chr211507 ----1743
NM_001241chr211507 ----1743
NM_001253chr61259 ------
NM_001256chr1722487 201 --1823 --
NM_001257chr162609 114 ------
NM_001259chr736300 5496 1048 11682 34891 136 109 --
NM_001275chr143399 49 43 --170 --
NM_001290chr4135 --1215 --
NM_001292chr152999 888 --1844 --
NM_001300chr10----1161 --
NM_001304chr1711093 --13809 --
NM_001310chr12----11087 --
NM_001315chr631928 709 453 --151 --
NM_001331chr1152668 2587 2487 961 315 --12776 --
NM_001343chr5--151 11075 --
NM_001358chr41101 ------
NM_001364chr1153884 3642 3569 3040 2962 --33487 2930 2895 --
NM_001379chr191118 ------
NM_001390chr1833088 2678 642 11331 21212 1077 --
NM_001391chr181791 ------
NM_001396chr212696 383 1837 1955 --
NM_001397chr1132566 2483 2327 1988 1920 1649 1074 974 686 273 267 159 104 --12147 --
NM_001399chrX73720 3565 3243 1390 1336 290 163 --23576 3184 11218
NM_001402chr611538 --11796 --
NM_001406chr1731222 682 265 1606 1619 --
NM_001407chr351673 553 465 350 152 ------
NM_001408chr151433 1065 541 147 31 --11087 --
NM_001412chrX23164 3141 ------
NM_001416chr17----1189 --
NM_001419chr19113563 3275 3107 1907 1712 880 622 565 547 534 499 13213 14110 --
NM_001420chr19123119 2806 2740 2734 2689 2576 1125 1112 746 406 127 84 ------
NM_001421chrX2198 134 1337 ----
NM_001429chr221282 ------
NM_001430chr221407 156 --11435 --
NM_001431chr61973 ------
NM_001451chr1641337 1002 949 341 ------
NM_001453chr611517 ------
NM_001458chr76662 642 625 568 251 147 ------
NM_001460chr153005 2649 167 147 94 1191 23296 1167 --
NM_001489chr91210 --160 --
NM_001495chr861238 1197 882 820 809 778 ----1265
NM_001497chr9102621 2577 2515 2373 2337 2309 1703 1024 954 112 ------
NM_001518chr71743 --21082 1003 --
NM_001521chr26264 224 201 124 110 84 ------
NM_001584chr1111213 ------
NM_001587chrX3611 365 336 --21782 776 --
NM_001654chrX1454 ------
NM_001659chr1272431 2275 1888 1656 1649 996 104 ------
NM_001663chr1421902 1756 --1538 --
NM_001664chr32195 79 1901 ----
NM_001665chr113364 188 164 ----1500
NM_001668chr111483 --1475 --
NM_001670chr226608 517 291 258 205 23 ------
NM_001681chr121514 --1278 --
NM_001682chr1221875 278 ------
NM_001690chr3--12422 --12058
NM_001699chr1941566 1181 392 149 ------
NM_001701chr911353 ------
NM_001707chr7130 1571 ----
NM_001709chr1142697 2643 2470 780 ------
NM_001743chr21470 ------
NM_001746chr532052 778 127 161 ----
NM_001754chr21103465 2933 1359 1344 1083 223 165 106 99 27 13898 ----
NM_001755chr16----1804 --
NM_001773chr131021 256 114 1514 11406 --
NM_001777chr353355 2937 2646 599 80 --1657 1312
NM_001782chr9171 ------
NM_001789chr321694 703 1301 ----
NM_001791chr121061 153 --11188 --
NM_001797chr16198 125 ----
NM_001805chr14131 ------
NM_001810chr2010742 710 680 630 593 573 235 163 144 133 ------
NM_001839chr11640 ------
NM_001845chr1321180 435 --11234 --
NM_001852chr1153 --1620 --
NM_001858chr62912 369 --15115 --
NM_001901chr61919 ------
NM_001907chr16--1238 148 --
NM_001923chr112517 509 --199 --
NM_001927chr23713 294 258 ------
NM_001933chr1431269 1197 1004 --1184 --
NM_001936chr741258 677 311 32 ------
NM_001946chr122340 40 ------
NM_001949chr652813 1173 1151 236 205 11978 ----
NM_001951chr81179 ------
NM_001956chr11105 ------
NM_001957chr4----22287 672 --
NM_001962chr52504 226 ------
NM_001967chr3----1420 --
NM_001969chr1422723 321 12499 2440 421 13472
NM_001970chr175589 554 218 80 56 192 ----
NM_001978chr86851 755 720 651 245 214 --1403 --
NM_001981chr12875 232 ------
NM_001995chr4164 ------
NM_001999chr521321 26 ------
NM_002006chr445256 4151 3867 926 --15247 --
NM_002013chr14154 ------
NM_002014chr121635 ------
NM_002025chrX108667 7702 7316 6958 6240 6074 6012 3053 1669 348 --38511 8388 1785 --
NM_002037chr61150 --126 --
NM_002048chr9--1377 ----
NM_002061chr111550 ------
NM_002062chr631049 422 30 --1312 --
NM_002063chrX1357 ------
NM_002065chr11628 ------
NM_002069chr71195 1235 ----
NM_002070chr36923 915 812 797 339 187 ----1826
NM_002074chr131573 1364 1144 11203 ----
NM_002077chr951865 1829 388 219 145 --11508 --
NM_002085chr191138 ------
NM_002086chr1741973 1967 1910 1768 ------
NM_002087chr17165 ------
NM_002092chr413678 ------
NM_002105chr116880 871 798 269 228 32 --2668 55 --
NM_002111chr493662 2815 1461 1344 1317 1282 838 681 641 --32965 277 227 --
NM_002126chr1733654 3282 412 --23259 1180 --
NM_002130chr531650 610 246 ------
NM_002137chr71578 ------
NM_002145chr17122 ------
NM_002168chr15156 --1104 --
NM_002193chr231283 594 533 ------
NM_002201chr15--1103 ----
NM_002204chr1791287 1226 1193 1094 1032 553 435 348 303 ------
NM_002205chr122734 260 --1834 --
NM_002221chr1112796 2703 2457 2433 2363 2244 2032 929 834 608 363 --22864 706 --
NM_002225chr15142 --2404 94 --
NM_002230chr1741044 706 270 197 --3428 337 75 --
NM_002241chr162860 2623 2412 1014 882 280 ------
NM_002247chr1011818 --1642 --
NM_002249chr11413 ------
NM_002254chr232326 2101 1878 --22272 827 --
NM_002264chr333148 970 177 14946 24550 982 --
NM_002265chr171427 ------
NM_002267chr13190 ------
NM_002268chr31533 --1444 --
NM_002270chr531503 507 40 --24364 1100 --
NM_002271chr1312253 ------
NM_002274chr171240 ----187
NM_002285chr222749 30 ------
NM_002309chr22133034 2978 2816 2674 2430 2424 2411 2354 2119 682 650 370 86 12992 52112 922 912 844 620 --
NM_002313chr1045005 2011 1118 73 13499 11451 --
NM_002334chr1131796 259 82 --21707 1482 --
NM_002345chr121163 ------
NM_002351chrX----1464 --
NM_002356chr611819 ------
NM_002359chr17124172 4112 3531 3299 3261 3248 3153 1534 591 570 484 408 --22680 515 --
NM_002374chr2164 --1337 --
NM_002375chr381981 1613 923 677 361 284 212 136 --32191 2056 1700 --
NM_002376chr141158 ------
NM_002383chr163944 834 361 --1585 --
NM_002399chr15--182 ----
NM_002401chr17102196 1796 1773 1754 852 790 658 543 509 287 11709 ----
NM_002402chr7----189 --
NM_002403chr16277 265 158 55 47 30 ------
NM_002406chr54855 784 368 24 --1684 --
NM_002430chr2222155 1761 --41640 1592 859 34 --
NM_002448chr42676 281 ------
NM_002449chr51243 ------
NM_002465chr122210 28 ------
NM_002473chr2281233 898 862 525 327 273 249 243 --2550 381 --
NM_002480chr1211283 ------
NM_002481chr1127850 7145 6873 5895 5770 5388 1986 1738 1371 955 668 281 16286 13073 --
NM_002499chr1542411 2367 2083 682 --1841 --
NM_002501chr1993332 3281 2994 926 861 787 606 376 211 --1548 --
NM_002505chr6--11246 11321 --
NM_002507chr1781940 1812 1462 1309 600 382 145 97 ------
NM_002508chr11107 1370 ----
NM_002509chr205786 78 71 40 34 ------
NM_002519chr1111327 --11069 --
NM_002522chr1793066 2891 1464 1205 962 920 820 708 585 --31474 1096 358 --
NM_002524chr12831 64 ------
NM_002537chr154780 774 704 370 ------
NM_002547chrX63705 1431 1270 1263 832 654 --23216 1669 --
NM_002553chr7--1100 ----
NM_002572chr112347 159 ------
NM_002581chr944444 4435 3746 530 --14360 --
NM_002586chr6134 ------
NM_002594chr2012482 ------
NM_002595chr1211749 11309 ----
NM_002599chr112898 90 2250 98 ----
NM_002600chr121643 115 ------
NM_002601chr21174 1338 ----
NM_002605chr152820 82 ------
NM_002608chr22172 ------
NM_002613chr16204273 3943 3646 2006 1818 1793 1714 1631 1409 1311 1179 933 601 577 567 559 452 428 394 248 --11690 --
NM_002628chr311085 ------
NM_002634chr172685 263 2869 648 ----
NM_002636chr62182 154 --1383 --
NM_002648chr631121 1089 155 1205 ----
NM_002650chr221109 ------
NM_002653chr58903 821 783 744 376 332 323 80 --1790 --
NM_002655chr814254 2706 354 13737 --
NM_002657chr2042441 334 282 35 --2506 444 1164
NM_002658chr103357 223 175 --1106 --
NM_002660chr2031066 254 95 ------
NM_002687chr14--1856 ----
NM_002698chr1962867 2572 1102 394 271 261 --11925 --
NM_002706chr2----1147 --
NM_002707chr22329 151 ------
NM_002709chr21781 ------
NM_002713chr11248 --41013 880 328 260 --
NM_002717chr8186 ------
NM_002718chr352457 927 829 617 178 ------
NM_002719chr142504 30 --1843 --
NM_002736chr71512 ------
NM_002737chr17125857 4548 2554 2375 2307 2264 2254 2015 1146 481 118 94 1257 45816 2659 2069 1525 --
NM_002741chr19----161 --
NM_002745chr2233206 1760 80 1400 24370 2846 --
NM_002746chr161160 --1185 --
NM_002753chr4--1645 ----
NM_002758chr171167 ------
NM_002763chr1----1230 --
NM_002773chr164435 130 69 55 ------
NM_002779chr104535 481 110 55 ------
NM_002809chr171235 --143 --
NM_002815chr17121 ------
NM_002819chr1951292 1149 543 230 26 --1198 --
NM_002821chr65706 298 151 102 94 ------
NM_002823chr21110 --1225 --
NM_002830chr21318 ------
NM_002834chr1222968 1464 --11103 --
NM_002837chr1224531 1274 ------
NM_002840chr141157 1149 555 223 ------
NM_002841chr31556 --164 --
NM_002844chr6----1988 --
NM_002845chr181121 ------
NM_002847chr721080 110 ----11380
NM_002849chr121929 ------
NM_002850chr1941104 940 76 22 ------
NM_002855chr11143372 3312 3227 3040 2811 2635 2492 2356 2338 1301 988 872 609 266 1415 ----
NM_002858chr1--1348 ----
NM_002859chr1251521 1439 1239 564 195 --11494 11677
NM_002868chr12101963 1918 1657 1554 922 841 736 718 601 488 12207 ----
NM_002869chr112742 649 ------
NM_002886chr354973 4923 1020 222 189 --15139 --
NM_002896chr11199 ------
NM_002906chr11----163 --
NM_002911chr1951336 1295 515 412 252 ------
NM_002918chr1951027 411 349 291 139 1885 ----
NM_002928chr13509 304 263 ------
NM_002942chr3147 ------
NM_002950chr3127 --2142 120 --
NM_002953chr12802 611 --1201 --
NM_002959chr154144 3203 2906 429 204 --13679 --
NM_002998chr811478 11933 11596 --
NM_003003chr171257 ------
NM_003011chr921191 343 --11325 --
NM_003013chr4130 ------
NM_003016chr1711785 2626 602 ----
NM_003028chr9183765 3741 3316 3232 3140 3069 3001 2523 2494 2444 1492 1212 1061 823 797 469 178 59 --23201 2401 --
NM_003030chr32207 108 ------
NM_003034chr1236243 3201 103 --17170 --
NM_003035chr1184 ------
NM_003045chr13134050 3766 3653 3641 3565 1707 1553 1446 1022 770 542 189 169 --44016 3591 3306 360 --
NM_003047chr191322 1212 1157 918 408 302 248 132 100 --1424 --
NM_003072chr192397 177 ----163
NM_003074chr362272 1738 749 740 651 184 --1299 --
NM_003076chr1261653 1340 1220 447 413 50 11290 ----
NM_003077chr173606 245 60 ------
NM_003079chr1731046 891 195 ------
NM_003081chr201388 1229 1404 --
NM_003106chr31979 ------
NM_003108chr2116656 6450 6308 6175 2760 2666 2626 2579 1975 1911 1340 --21636 1149 --
NM_003111chr2--1884 ----
NM_003112chr712494 ----13017
NM_003128chr222255 1022 ------
NM_003131chr662122 2037 858 839 465 391 --1343 --
NM_003137chr631416 221 210 --11491 11935
NM_003139chr111184 ------
NM_003140chrY------1125
NM_003142chr2188 ------
NM_003155chr822007 916 ------
NM_003156chr1131067 902 163 ------
NM_003161chr1711245 ----12202
NM_003162chr21288 ------
NM_003178chr3--11465 11753 --
NM_003179chrX51260 1018 407 223 56 ------
NM_003183chr23703 594 165 ------
NM_003185chr202239 185 ------
NM_003186chr11131 --1121 --
NM_003189chr143205 3099 496 93 --11135 --
NM_003199chr1823814 3654 --13647 --
NM_003200chr1972099 1918 1738 1557 1526 299 198 --21775 1474 --
NM_003204chr1751599 1480 680 461 227 ------
NM_003214chr6111382 1372 1117 924 572 517 482 451 131 115 108 --21232 410 --
NM_003215chr421242 1114 ------
NM_003216chr2293162 3126 2894 2814 2354 1228 829 764 667 13255 11208 --
NM_003234chr322450 2373 --21693 558 1608
NM_003236chr232695 2560 147 12774 --12990
NM_003238chr1------1214
NM_003239chr142176 98 ------
NM_003247chr6174 ------
NM_003255chr1762166 936 832 455 428 419 --32315 788 197 --
NM_003257chr151383 ------
NM_003262chr354249 4106 3609 683 149 ------
NM_003268chr1183 ------
NM_003269chr62528 420 ------
NM_003270chrX1378 11127 ----
NM_003281chr1145078 4515 4266 4086 3601 3296 2191 1755 1093 892 855 825 680 554 21606 975 11040 --
NM_003292chr112102 --11738 11667
NM_003300chr141506 --178 --
NM_003317chr141567 ------
NM_003319chr21755 ------
NM_003320chr11144201 3983 3740 3709 3631 3566 3495 3431 1302 763 747 545 507 119 --23790 96 11500
NM_003336chrX1403 ------
NM_003342chr1722986 2514 ------
NM_003349chr201639 --124 --
NM_003352chr21337 ------
NM_003373chr1031554 522 411 --11611 --
NM_003374chr51606 --1196 --
NM_003375chr10--149 ----
NM_003379chr621021 207 ------
NM_003382chr771641 939 716 665 499 121 35 ------
NM_003387chr2--1508 ----
NM_003388chr792083 1839 1474 1354 1323 601 481 353 309 --12000 1830
NM_003400chr21118 ------
NM_003410chrX138 ------
NM_003411chrY135 11327 11820 --
NM_003412chr332630 1171 323 --12012 --
NM_003456chr16165 --1183 --
NM_003458chr3153516 3425 3329 3261 3058 3029 2878 2451 1299 1226 1118 566 509 167 75 --23404 3193 12892
NM_003459chr25466 278 251 98 40 ------
NM_003463chr61135 ------
NM_003470chr1661719 1552 1532 1282 526 404 --11498 --
NM_003472chr621484 1144 ------
NM_003482chr1262599 2202 1718 478 464 213 1160 ----
NM_003483chr1212386 ------
NM_003485chr143857 350 35 ------
NM_003498chr16102332 2298 1892 1739 873 476 345 246 222 25 ------
NM_003509chr6----150 --
NM_003511chr6136 ------
NM_003512chr6----149 --
NM_003520chr6----153 --
NM_003521chr6----150 --
NM_003522chr6----134 --
NM_003525chr6----141 --
NM_003527chr6----132 --
NM_003529chr6----137 --
NM_003532chr6----136 --
NM_003536chr6----137 --
NM_003542chr6----163 --
NM_003558chr9------1592
NM_003559chr1763534 3145 2848 2840 760 483 13396 33461 1397 968 --
NM_003576chr1332459 2378 1150 ------
NM_003583chr1222687 418 13227 22554 393 12947
NM_003590chr212782 --22705 950 --
NM_003607chr133946 3686 687 --13670 1768
NM_003618chr211188 1989 ----
NM_003620chr171149 ------
NM_003626chr11------1997
NM_003629chr183124 3064 2901 2716 1393 1198 400 173 12771 22845 1061 --
NM_003632chr174706 563 232 100 --1285 --
NM_003644chr17176135 6051 5928 5759 4954 4793 4718 4497 4017 2253 1048 761 408 292 184 64 28 --31743 978 350 --
NM_003670chr31953 ------
NM_003671chr942920 2909 1166 345 ------
NM_003677chr12----168 --
NM_003688chrX2309 71 ------
NM_003692chr9------190
NM_003704chr43619 435 279 ------
NM_003713chr131212 338 153 --1691 1569
NM_003714chr532561 566 346 --12086 --
NM_003743chr21412 --21608 210 --
NM_003744chr142138 118 11282 ----
NM_003749chr132547 303 1555 ----
NM_003758chr1511171 --11081 --
NM_003758chr1511171 --11081 --
NM_003768chr121848 543 1116 ----
NM_003773chr3150 ------
NM_003774chr1232281 539 327 --1600 --
NM_003780chr14575 209 134 108 --1195 --
NM_003787chr18------1559
NM_003791chr162220 166 ------
NM_003800chr6--12086 2762 309 --
NM_003822chr122512 505 ------
NM_003829chr9170 ------
NM_003861chr1442687 2535 2380 2359 --2534 279 --
NM_003873chr102909 384 ------
NM_003888chr1531221 101 67 --1393 --
NM_003902chr11553 ------
NM_003907chr32324 247 ------
NM_003913chr633871 3337 885 ------
NM_003916chrX--11055 ----
NM_003924chr44659 601 83 53 ------
NM_003932chr22----11528 --
NM_003947chr331018 341 284 --11063 --
NM_003949chr1771959 1832 1763 1564 1524 1439 779 153 3481 447 308 --
NM_003953chr172338 2135 1994 1903 1871 473 382 ------
NM_003955chr1741109 459 135 48 --21505 451 --
NM_003966chr5127139 4750 4744 2958 2572 2469 1785 1400 1121 683 427 49 ------
NM_003969chr193346 315 121 ------
NM_003977chr11----198 --
NM_003981chr151685 1189 ----
NM_003983chr1681426 1409 1356 1017 796 433 75 26 13753 ----
NM_003987chr10122187 2181 2128 2082 1561 1530 804 776 738 702 223 217 1642 ----
NM_003988chr10122264 2258 2205 2159 1638 1607 881 853 815 779 300 294 1719 ----
NM_003989chr10122123 2117 2064 2018 1497 1466 740 712 674 638 159 153 1578 ----
NM_003990chr10122123 2117 2064 2018 1497 1466 740 712 674 638 159 153 1578 ----
NM_004050chr1442539 797 738 673 1953 ----
NM_004055chr1191817 1481 858 744 600 387 175 96 23 1619 2661 293 --
NM_004059chr93392 355 23 ------
NM_004077chr123470 233 79 ------
NM_004085chrX----1592 --
NM_004087chr321516 1325 ------
NM_004090chr17102921 2909 2828 1088 1055 530 351 332 275 31 --1639 --
NM_004093chr133523 300 184 ------
NM_004094chr1412987 ------
NM_004095chr8248 37 ----178
NM_004098chr102804 222 ------
NM_004100chr632479 2076 1761 181 ----
NM_004111chr111220 ------
NM_004112chr1781618 1367 1220 631 571 520 238 119 11600 11239 --
NM_004114chrX125 ------
NM_004116chr2192 --1477 --
NM_004118chr202219 34 162 ----
NM_004134chr51441 --1455 --
NM_004172chr52597 569 --41982 1943 816 740 11801
NM_004186chr37951 894 795 778 743 721 233 ------
NM_004199chr5132 ------
NM_004200chr11163283 3263 2787 2734 2004 674 590 542 528 489 455 319 210 153 41 35 --12816 --
NM_004225chr811045 ------
NM_004227chr772446 2388 1251 830 248 176 156 --11236 --
NM_004228chr19168 ------
NM_004232chr18--1703 ----
NM_004247chr17185 1281 ----
NM_004263chr21294 11510 11401 11165
NM_004286chr22102728 2470 2422 2392 1903 1111 841 758 372 263 --11815 --
NM_004293chr912744 --12998 --
NM_004301chr3--1154 ----
NM_004302chr1252775 2538 2252 2234 78 11876 ----
NM_004309chr1761097 871 358 320 266 195 --3987 961 104 --
NM_004311chr1052717 2424 2167 2024 49 --1799 --
NM_004321chr2163586 3532 3195 3152 3054 2796 2509 2263 1395 1377 816 810 623 595 143 32 13244 23559 2291 --
NM_004326chr11931 --151 --
NM_004343chr192439 32 ------
NM_004350chr142213 819 681 79 11635 22254 409 1887
NM_004380chr1662014 1927 1721 1693 1654 912 ------
NM_004385chr51702 ------
NM_004393chr361839 1678 700 362 279 163 --12083 --
NM_004395chr56662 612 578 567 496 124 ----1628
NM_004396chr171277 ------
NM_004397chr1164207 2983 2763 1215 932 31 ------
NM_004399chr121209 --2932 703 --
NM_004417chr51101 --123 --
NM_004420chr11112359 2317 2159 2049 1866 831 476 281 274 181 41 --12001 --
NM_004421chr15728 626 333 294 49 ------
NM_004423chr392585 2486 980 864 755 738 622 613 179 ------
NM_004427chr18937 431 387 375 171 161 111 79 ------
NM_004428chr11679 124 ----
NM_004429chrX51248 984 307 224 23 11041 ----
NM_004430chr832035 1094 820 ------
NM_004432chr91702 ------
NM_004436chr1160 ------
NM_004437chr183594 3493 3141 2804 2760 2404 981 733 --12352 --
NM_004440chr631633 106 57 ------
NM_004442chr161412 1401 1320 1175 475 65 ------
NM_004443chr35732 519 247 152 130 193 ----
NM_004449chr2121271 1048 ------
NM_004451chr113664 262 146 --1206 --
NM_004454chr32461 394 11779 ----
NM_004459chr1721609 670 ------
NM_004463chrX--167 ----
NM_004472chr51180 ------
NM_004474chr14340 203 140 29 2877 183 1761 --
NM_004475chr1751105 871 408 343 41 ------
NM_004481chr142467 2288 756 227 --12148 --
NM_004491chr19144192 3760 3506 3402 3170 2789 1633 1488 561 526 363 110 63 36 ----14343
NM_004494chr141249 1009 202 189 ------
NM_004496chr14----1506 --
NM_004500chr1411520 ------
NM_004501chr163742 2708 2691 2685 688 439 ------
NM_004503chr12----2268 250 --
NM_004504chr232233 1953 959 1677 ----
NM_004514chr172346 89 21031 142 32574 967 512 --
NM_004516chr1931013 969 957 1203 ----
NM_004517chr11178 ------
NM_004521chr10--1261 ----
NM_004529chr91959 ------
NM_004537chr122419 219 ------
NM_004539chr18----149 --
NM_004554chr1491563 1434 616 562 519 421 361 180 173 --1641 --
NM_004555chr162495 75 1124 1406 --
NM_004575chr4----11471 --
NM_004579chr113154 108 75 --2102 58 --
NM_004580chr1521726 358 ------
NM_004583chr172636 503 ------
NM_004586chrX33907 3668 1079 --13588 --
NM_004588chr11103970 3539 2857 2821 1620 1488 625 435 220 114 --21025 827 --
NM_004593chr31914 --1894 --
NM_004598chr521255 838 ------
NM_004602chr2011019 --21218 433 --
NM_004612chr923553 188 --11169 --
NM_004626chr11----1247 --
NM_004630chr112937 211 ------
NM_004635chr361037 1005 397 279 192 80 1310 166 --
NM_004637chr31502 --158 --
NM_004642chr121135 ------
NM_004650chrX1596 ------
NM_004651chrX----1349 --
NM_004654chrY--1221 ----
NM_004655chr171146 ------
NM_004656chr3121138 1080 1055 838 495 489 481 419 282 171 58 46 3811 787 460 2426 122 --
NM_004660chrY2924 912 ------
NM_004687chr1741971 1951 698 494 1217 1180 --
NM_004703chr1722468 751 ------
NM_004711chr22133510 3445 2861 2801 2718 2564 1432 1289 1278 1103 870 738 124 1859 22420 731 --
NM_004716chr115798 739 594 306 132 --131 --
NM_004717chr711308 --1477 --
NM_004723chr13417 380 347 ------
NM_004725chr1021215 377 ------
NM_004726chrX21551 1056 ------
NM_004730chr521745 1628 ------
NM_004734chr1312466 --22371 486 --
NM_004737chr22272 66 --1984 --
NM_004748chr1521037 866 ------
NM_004758chr179874 813 781 300 289 255 197 81 68 --1246 --
NM_004763chr212816 791 764 735 708 455 428 399 372 343 316 287 ------
NM_004772chr52257 250 --11291 --
NM_004774chr1712694 ------
NM_004776chr2072829 2781 2390 1029 403 357 346 --33054 2096 997 --
NM_004783chr163604 112 82 ------
NM_004798chr2042761 1200 856 537 13582 ----
NM_004801chr2------1627
NM_004807chr2132333 1998 1667 855 830 748 729 678 634 562 514 68 26 ------
NM_004808chr1012621 ----12824
NM_004818chr121158 --188 --
NM_004821chr51260 --186 --
NM_004822chr17103982 2700 1564 1504 1414 1042 822 390 357 241 1688 13353 --
NM_004834chr21677 ------
NM_004839chr152186 21 ------
NM_004842chr621783 1153 --1319 --
NM_004845chrX53563 1505 672 399 320 11323 21571 1380 --
NM_004860chr173504 68 59 ------
NM_004863chr1484966 3336 1087 585 413 382 360 57 25301 3247 ----
NM_004869chr1811632 ------
NM_004871chr1753924 3384 3153 1719 349 ------
NM_004884chr156707 698 445 384 95 42 21722 178 ----
NM_004898chr412407 ------
NM_004904chr726133 634 25167 1081 14793 --
NM_004924chr193884 371 360 --1152 --
NM_004925chr9140 ------
NM_004926chr14----11504 199
NM_004932chr5----11613 --
NM_004936chr93999 731 198 ----1475
NM_004943chr1991204 980 919 893 883 877 855 766 149 --21182 831 --
NM_004952chr14923 737 230 222 ------
NM_004955chr61137 --2583 152 --
NM_004956chr733279 3025 814 1292 ----
NM_004959chr931249 1181 324 1548 ----
NM_004964chr12384 142 ------
NM_004973chr621585 628 ------
NM_004976chr11215026 4553 4482 4287 4081 4047 4025 3998 3867 3448 2060 1836 1732 1664 1627 1479 1448 1068 396 281 115 --1563 14370
NM_004978chr141647 1562 1096 392 ------
NM_004979chrX3321 242 29 --1469 --
NM_004981chr221175 ------
NM_004985chr1234092 3220 1160 --11007 13512
NM_004992chrX217588 7086 6710 6475 6383 6049 5971 5795 5740 5367 3169 3045 2961 2869 2839 2637 1631 1600 1432 262 79 --36413 5208 1425 --
NM_004992chrX217588 7086 6710 6475 6383 6049 5971 5795 5740 5367 3169 3045 2961 2869 2839 2637 1631 1600 1432 262 79 --36413 5208 1425 --
NM_004995chr1441039 309 234 206 --1422 --
NM_004998chr152347 113 ------
NM_004999chr61956 ------
NM_005004chr10126 ------
NM_005010chr711801 21871 905 ----
NM_005020chr72382 158 ------
NM_005025chr31187 ------
NM_005027chr197386 332 295 123 117 102 40 1241 ----
NM_005045chr71925 ------
NM_005056chr1231739 358 177 --14129 --
NM_005066chr1--1704 ----
NM_005078chr153496 79 51 --11519 11784
NM_005080chr221826 --1780 --
NM_005094chr9170 --1231 --
NM_005105chr131499 865 827 ------
NM_005110chr51698 ------
NM_005119chr141107 1079 209 196 ------
NM_005131chr18170 ------
NM_005135chr1542833 2352 1299 44 ------
NM_005137chr22122364 2295 2169 2081 1923 1857 859 792 711 684 611 82 --12221 --
NM_005148chr17130 1455 ----
NM_005153chr16185 ------
NM_005154chr152464 40 ------
NM_005155chr65654 574 509 205 56 --1662 --
NM_005156chr954771 4551 4281 3569 1302 --13366 --
NM_005161chr1151779 1600 1584 47 37 1198 ----
NM_005171chr12----1841 --
NM_005182chr161506 --2541 438 --
NM_005184chr193981 326 252 --1427 --
NM_005187chr1652059 2008 1574 324 61 ------
NM_005188chr11137687 7006 6608 6206 5657 5249 5220 3170 2967 2356 2331 2144 2105 --26722 908 11398
NM_005197chr1464582 4288 4143 4110 805 418 11927 14170 --
NM_005201chr31358 ------
NM_005202chr141419 776 289 119 --1242 --
NM_005207chr2233547 3195 1363 --22318 1010 --
NM_005219chr561142 595 419 323 211 76 ----11503
NM_005225chr205899 815 790 426 400 21211 383 ----
NM_005235chr277718 6335 5249 5217 5092 2524 2336 --11487 --
NM_005238chr111248 --1268 11111
NM_005239chr2152030 1610 1542 702 35 1135 ----
NM_005241chr3151 ------
NM_005252chr141284 ------
NM_005276chr1281758 1463 1405 1396 1370 1180 481 146 --21746 1617 --
NM_005276chr1281758 1463 1405 1396 1370 1180 481 146 --21746 1617 --
NM_005277chr4----1539 --
NM_005279chr2147 ------
NM_005311chr722213 539 ------
NM_005321chr6----150 --
NM_005324chr171318 1767 11926 --
NM_005326chr16----140 --
NM_005329chr161518 --22015 733 --
NM_005334chrX51632 1387 494 394 67 --1553 --
NM_005336chr262254 2072 840 299 177 128 22211 792 11722 --
NM_005359chr1885916 5906 5490 5150 5111 3968 1974 21 25244 4837 ----
NM_005392chr961633 1597 729 291 243 105 ----11551
NM_005397chr721534 1063 1140 21389 1053 --
NM_005398chr1021067 387 ------
NM_005399chr163080 1444 882 834 723 403 ------
NM_005402chr721659 238 11708 ----
NM_005415chr21227 ------
NM_005417chr2081955 1921 1904 1408 1398 1392 439 97 --51825 1666 1338 556 133 --
NM_005424chr1127 ------
NM_005433chr1821942 283 ------
NM_005436chr1012795 --12601 --
NM_005456chr112701 605 --1644 --
NM_005458chr961728 1572 1517 916 500 84 ------
NM_005461chr2041264 553 533 271 ------
NM_005474chr1781470 1448 1434 1283 1026 337 310 145 ------
NM_005475chr1272624 2146 1321 1072 170 158 21 12465 32983 1246 981 --
NM_005497chr1776132 4924 3828 1705 1163 1062 91 ------
NM_005502chr923070 216 ------
NM_005503chr154920 438 429 53 --11035 --
NM_005505chr127834 826 371 320 298 249 32 ------
NM_005507chr112323 200 ------
NM_005515chr73174 108 67 ------
NM_005520chr51273 --1692 --
NM_005530chr1531504 1301 127 ------
NM_005573chr5--1136 ----
NM_005575chr5158 ------
NM_005578chr321017 211 ------
NM_005596chr946188 4701 4365 662 --12006 1775
NM_005599chr11404 ------
NM_005602chr3145 154 --1102
NM_005604chr652049 1021 70 59 52 ------
NM_005605chr81311 ------
NM_005610chr11887 ------
NM_005618chr6197 --1155 --
NM_005626chr1----1179 --
NM_005632chr1661087 917 727 696 203 151 ------
NM_005637chr1811871 ------
NM_005639chr12181 ------
NM_005650chr223981 975 906 11252 ----
NM_005653chr122158 57 ------
NM_005662chr8--171 ----
NM_005665chr111378 --13619 --
NM_005668chr513062 2987 205 14345 --
NM_005685chr7----1139 --
NM_005715chr652511 2505 1964 702 200 32413 2061 1135 --12450
NM_005722chr241878 1871 1824 96 ------
NM_005736chr1091597 1447 1292 1194 1072 417 205 161 147 --21319 580 --
NM_005737chr251867 608 575 352 318 ------
NM_005740chr22135 --2182 80 --
NM_005746chr732192 735 221 2775 526 ----
NM_005748chr1223253 3165 --13408 --
NM_005775chr85710 613 607 575 550 ----1282
NM_005786chr18162 ------
NM_005789chr172785 184 --1574 --
NM_005802chr91255 ------
NM_005813chr21287 11838 ----
NM_005819chr122414 525 12494 ----
NM_005822chr611790 ------
NM_005826chr1--147 ----
NM_005840chrX127355 6038 5675 5217 4673 2841 2653 2560 1786 1507 1219 63 37295 2709 1361 66046 5543 5526 2991 1293 354 --
NM_005851chr113338 152 70 ------
NM_005852chr174865 407 165 32 ------
NM_005853chr16151 ------
NM_005862chr3153 ------
NM_005866chr92764 50 --2786 321 --
NM_005876chr25697 227 134 72 23 ----1314
NM_005877chr2251931 1804 756 748 612 --11907 --
NM_005882chr4----1743 --
NM_005884chr196718 571 515 287 218 78 --1248 --
NM_005895chr1283923 3699 3650 2796 2704 1198 1163 1104 --43956 1029 229 44 --
NM_005898chr1113149 1536 12434 --
NM_005901chr1868012 6895 3406 3210 2418 1143 12177 12532 17474
NM_005909chr532799 1668 758 ------
NM_005916chr7129 ------
NM_005920chr1103714 3703 3137 2801 2713 1550 1525 1121 334 265 --1345 --
NM_005933chr1162598 2215 1162 459 375 232 12453 168 --
NM_005934chr19172292 2281 2173 2143 2094 2074 1964 1890 1766 1671 935 714 298 232 58 38 22 1859 1455 --
NM_005938chrX31055 950 248 1348 ----
NM_005941chr822813 151 --2890 251 --
NM_005943chr651484 1380 614 533 395 --1638 --
NM_005955chr174995 4280 3924 3766 1466 667 636 13352 33949 3902 1698 2731 679
NM_005957chr1153723 3622 3554 3451 3351 3116 1823 1518 1412 1318 1253 776 720 694 490 --31652 836 164 --
NM_005962chr1042141 2120 1436 772 1405 ----
NM_005962chr1042141 2120 1436 772 1405 ----
NM_005967chr122614 179 ------
NM_005969chr1171137 1010 816 357 340 139 119 --11036 --
NM_005984chr223470 463 94 1454 ----
NM_005990chr552569 894 500 47 38 ------
NM_006007chr923657 3074 ------
NM_006011chr1593917 3114 2761 1456 1165 798 636 549 441 11690 ----
NM_006015chr11910 ------
NM_006030chr32523 310 --2486 130 --
NM_006034chr11112333 2300 2019 1925 1744 1580 1566 994 511 141 22 12073 12096 --
NM_006035chr1451193 1006 500 296 73 ----1439
NM_006036chr22939 288 1467 ----
NM_006037chr294145 3579 3352 3102 2997 1869 1274 164 100 --13139 --
NM_006038chr2071659 1359 647 495 443 399 99 ------
NM_006039chr1781044 884 857 815 751 332 254 52 ------
NM_006043chr164763 275 32 22 ------
NM_006047chr203965 948 538 ----21423 1303
NM_006048chr12506 124 1970 ----
NM_006051chr52220 74 1261 132 --
NM_006091chr1521624 1104 ------
NM_006094chr842119 825 712 613 ------
NM_006095chr424452 3841 1714 126 --
NM_006099chr17845 835 763 751 743 663 95 ----1630
NM_006106chr11--1205 ----
NM_006133chr11132322 1953 1924 1836 1780 1586 932 882 730 716 616 48 28 ------
NM_006135chr1----1570 11211
NM_006136chr7----1232 --
NM_006139chr222588 105 ------
NM_006141chr1632723 301 235 ------
NM_006148chr1722676 521 1495 22252 1931 --
NM_006153chr31211 ------
NM_006158chr8----11618 --
NM_006161chr53233 195 60 ------
NM_006176chr112669 162 ------
NM_006180chr9--11528 --1363
NM_006194chr14------11010
NM_006195chr911253 1323 ----
NM_006203chr514837 --15127 --
NM_006206chr4--12589 ----
NM_006224chr1782337 2320 2314 1923 1580 930 710 607 ------
NM_006237chr133888 863 755 --12290 --
NM_006243chr11760 ------
NM_006251chr512209 --1322 --
NM_006252chr135733 5595 934 11092 --12513
NM_006256chr1----11967 --
NM_006258chr1021176 229 ------
NM_006268chr112942 286 --1189 11127
NM_006275chr2012030 --11641 1162
NM_006277chr21132 ------
NM_006279chr17869 773 246 225 201 106 29 --1124 --
NM_006293chr154917 332 106 39 2991 348 1215 --
NM_006301chr123531 445 125 ------
NM_006302chr2147 ------
NM_006306chrX64734 4195 3691 2206 293 98 --34707 4550 597 25837 984
NM_006312chr123202 60 37 ------
NM_006313chr12----11743 --
NM_006320chr4130 --11105 --
NM_006324chr161221 ------
NM_006328chr111134 1217 ----
NM_006329chr14----2657 274 --
NM_006330chr81586 ------
NM_006336chr961358 1328 1115 974 603 81 --1423 --
NM_006338chr12154 117 ------
NM_006347chr1----126 --
NM_006352chr111761 ------
NM_006367chr111050 ------
NM_006369chr12389 168 --2158 149 --
NM_006371chr354659 3799 3400 3321 1490 15028 ----
NM_006375chrX11696 ----1180
NM_006379chr731620 1490 198 ------
NM_006380chr1734120 3582 2728 13801 ----
NM_006389chr1141090 1057 1025 91 ----1253
NM_006416chr61735 ------
NM_006420chr20----11179 12484
NM_006421chr81252 ------
NM_006434chr1031186 899 748 ------
NM_006454chr4143036 2939 2840 2433 2380 2264 2094 1928 925 757 588 477 223 95 12786 1550 --
NM_006455chr173965 926 916 ------
NM_006457chr433244 1413 115 ------
NM_006459chr1031808 1454 747 11544 1451 --
NM_006465chr1562122 1868 645 584 504 149 --2347 161 --
NM_006478chr22--157 ----
NM_006482chr1222687 418 13227 22554 393 12947
NM_006517chrX52102 2045 392 256 211 21900 1837 1913 --
NM_006519chr6123 ------
NM_006521chrX51346 913 477 139 65 --1182 --
NM_006532chr1991666 1586 1576 1427 1285 716 464 178 148 1555 2736 297 --
NM_006539chr162427 85 ------
NM_006540chr82137 131 ------
NM_006546chr17206378 5451 5382 5358 5103 5052 4746 4693 4161 2361 2132 2092 2074 2003 1954 1893 1513 1413 283 75 15393 ----
NM_006548chr311514 --1156 --
NM_006557chr921268 1094 --21470 1300 --
NM_006561chr1025116 2439 --25020 4831 --
NM_006572chr171152 --12980 --
NM_006587chr431654 258 52 ------
NM_006593chr2------1711
NM_006601chr12------1263
NM_006609chr222335 1937 --12584 12074
NM_006621chr141874 1689 573 181 --11297 --
NM_006625chr11262 ------
NM_006625chr11262 ------
NM_006625chr11262 ------
NM_006628chr1564364 3944 1396 1330 968 479 1519 ----
NM_006640chr1761839 1683 1188 427 371 275 --31823 353 62 --
NM_006650chr5153712 3613 3569 3143 2741 916 783 753 734 543 507 486 447 411 254 --2728 501 --
NM_006654chr121706 13110 ----
NM_006662chr162121 58 ------
NM_006670chr6----1474 --
NM_006686chr9127 ------
NM_006690chr2072267 2159 2068 1684 1506 783 266 1107 21810 47 --
NM_006698chr20----1245 --
NM_006699chr122603 371 ------
NM_006708chr61873 ------
NM_006713chr51262 ------
NM_006717chr922530 2383 ------
NM_006720chr1045005 2011 1118 73 13499 11451 --
NM_006726chr421029 419 ------
NM_006729chrX64961 4039 3870 3653 3558 2215 ------
NM_006734chr611449 ------
NM_006738chr15103440 3234 1752 1535 1431 1380 973 847 472 188 1247 43547 1402 1180 139 --
NM_006742chr16101913 1892 1857 1563 1533 1419 1291 704 307 91 11546 11628 --
NM_006749chr841116 883 143 106 ----11144
NM_006750chr1657670 7343 6819 1150 209 ------
NM_006763chr151996 1881 1787 1467 558 --1537 --
NM_006769chr11643 ------
NM_006772chr6--1502 --11421
NM_006775chr642437 352 324 261 ------
NM_006788chr182161 81 --1736 --
NM_006805chr511700 --1652 --
NM_006807chr172955 264 ------
NM_006815chr121895 --1235 --
NM_006819chr112349 102 ------
NM_006828chr61180 ------
NM_006833chr71133 ------
NM_006852chr172475 218 --22107 204 --
NM_006854chr72598 134 --11980 --
NM_006856chr121844 1806 2262 24 --
NM_006861chr1221729 56 --21557 633 --
NM_006874chr43911 820 814 ------
NM_006884chr32207 108 ------
NM_006888chr1462964 2296 2175 1008 546 187 --1349 --
NM_006896chr741052 722 319 282 ------
NM_006901chr151107 ------
NM_006902chr121337 181 --13062 --
NM_006906chr115234 227 79 66 54 --1680 --
NM_006914chr921527 180 --1580 --
NM_006920chr221953 535 ------
NM_006924chr1713436 ------
NM_006925chr14128 ------
NM_006939chr1421149 819 ------
NM_006940chr1211182 --11473 --
NM_006941chr223913 183 79 ----3885 821 367
NM_006943chr2093289 3257 3231 2656 1068 1051 521 503 70 ------
NM_006950chrX4959 912 802 50 1177 ----
NM_006981chr932592 2079 153 ------
NM_006987chr1731251 1224 77 ------
NM_006990chr132479 1951 891 --22531 201 --
NM_006999chr531786 805 793 --1591 --
NM_007010chr172679 648 ------
NM_007011chr1596303 5928 4593 4522 2428 2145 939 904 640 14248 12498 --
NM_007013chr8--1293 1781 --
NM_007014chr1651632 1350 510 109 93 --21186 167 --
NM_007024chr35560 387 200 125 104 --1233 --
NM_007033chr162062 1867 1582 1434 599 333 ------
NM_007034chr11738 ------
NM_007039chr1421493 231 ------
NM_007042chr351902 1052 889 721 260 1794 ----
NM_007050chr20207436 7354 6709 6614 6415 5209 2820 2590 2534 1914 1800 1245 1000 631 559 368 247 207 154 135 --45802 5230 444 277 --
NM_007064chr311102 --11092 --
NM_007067chr17----11511 --
NM_007081chr223932 455 148 ------
NM_007084chr134547 355 200 101 ------
NM_007087chr16----1790 --
NM_007112chr1149 ------
NM_007118chr51722 ----1584
NM_007122chr15584 572 528 233 27 --1144 --
NM_007146chr1722116 2037 12235 ----
NM_007158chr111006 1344 ----
NM_007159chr3----1424 --
NM_007162chr65469 462 444 413 397 --1228 --
NM_007166chr111147 11211 ----
NM_007170chr11125 --1186 1705
NM_007174chr1271603 1569 1552 972 682 621 124 11507 1181 --
NM_007182chr32258 191 1221 1108 --
NM_007185chr17373 272 264 240 212 95 71 --1312 --
NM_007189chr731454 580 319 ------
NM_007192chr143785 242 171 ------
NM_007200chr15103440 3234 1752 1535 1431 1380 973 847 472 188 1247 43547 1402 1180 139 --
NM_007203chr91388 11009 13104 --
NM_007212chr132075 650 482 ------
NM_007220chrX64907 3503 1847 1525 542 313 --24357 521 --
NM_007221chr12391 328 ------
NM_007222chr821748 625 ------
NM_007238chr2084810 4715 3900 1430 1168 303 274 88 ------
NM_007245chr163825 292 116 ------
NM_007249chr1337511 6186 522 --28079 6801 18834
NM_007260chr19620 587 551 291 242 190 163 152 130 1177 ----
NM_007275chr3156 ------
NM_007282chr31979 ------
NM_007286chr572100 1894 1866 1420 824 485 49 --11381 1528
NM_007331chr482456 2201 2154 925 886 846 494 441 --11037 --
NM_007346chr20131 --2325 90 --
NM_007350chr1213395 12903 1836 --
NM_007353chr7142924 2309 2260 2118 2014 1880 1861 1178 900 884 728 524 398 86 ------
NM_007358chr111969 ------
NM_007359chr1721186 603 ----1180
NM_007363chrX1891 ------
NM_007375chr122651 1973 ------
NM_012081chr523590 189 ------
NM_012084chrX2432 411 ------
NM_012095chr1032668 1327 558 ------
NM_012102chr142074 2037 2026 741 --22344 2000 --
NM_012104chr1143032 2814 1011 991 11320 ----
NM_012104chr1143032 2814 1011 991 11320 ----
NM_012105chr212771 627 --1657 1262
NM_012120chr612092 --22631 2452 1201
NM_012137chr132868 1905 563 ------
NM_012141chr131998 --22751 605 --
NM_012156chr2041368 776 479 66 11195 ----
NM_012158chr1321461 1378 ------
NM_012175chr11----1128 --
NM_012193chr1175201 5190 4945 2174 2047 1551 1283 14762 1293 --
NM_012199chr164009 1771 1429 1052 1044 247 ------
NM_012214chr216338 --14194 --
NM_012216chrX131 ------
NM_012218chr19162912 2906 2866 2662 2594 2464 2282 2221 1018 932 756 749 648 551 100 92 --12729 --
NM_012224chr41483 ------
NM_012229chr103914 409 70 ------
NM_012233chr241087 737 237 100 --189 --
NM_012236chr13728 710 250 1244 ----
NM_012244chr1451356 406 358 216 66 --11286 --
NM_012247chr10----1893 --
NM_012262chr124007 3699 13643 --11220
NM_012264chr22161690 1637 1575 1532 1480 861 770 663 624 599 550 531 439 313 186 173 ------
NM_012264chr22161690 1637 1575 1532 1480 861 770 663 624 599 550 531 439 313 186 173 ------
NM_012281chr71220 ------
NM_012288chr694965 4708 3777 2301 2164 1282 961 488 66 11348 43724 1904 860 478 --
NM_012296chr11163922 3443 3149 3002 2987 2883 2794 2516 2456 2442 866 829 562 346 208 50 ------
NM_012297chr4----1299 --
NM_012300chr542099 1702 820 185 --11695 --
NM_012301chr721502 120 ------
NM_012302chr11369 ------
NM_012304chr582484 2168 1862 1691 864 342 310 135 --21998 554 --
NM_012306chr12133263 3111 2958 2841 2601 2282 1074 893 866 705 654 555 263 23502 400 32810 2494 1435 --
NM_012308chr1192438 1849 1008 976 966 411 336 295 87 11718 1685 --
NM_012316chr1135486 4362 4102 3801 3679 3659 1308 1296 1081 971 694 408 196 --35196 4149 805 --
NM_012325chr2021556 561 ------
NM_012330chr101257 ------
NM_012333chr11649 1633 ----
NM_012334chr523965 3784 ----11425
NM_012342chr10----145 --
NM_012346chr197995 984 919 897 182 29 21 ------
NM_012347chr642717 1940 560 463 --12800 --
NM_012384chr2062107 982 433 409 286 207 --32193 2039 849 --
NM_012398chr19132584 1867 1141 959 916 877 825 726 643 444 184 159 83 --22505 2129 --
NM_012402chr113508 492 180 --1925 --
NM_012407chr222479 98 ------
NM_012410chr161151 1385 1446 --
NM_012417chr171568 ------
NM_012421chr11331 ------
NM_012425chr1041983 1674 275 26 --1104 --
NM_012428chr15----1283 --
NM_012448chr1721813 942 ------
NM_012460chr14------1237
NM_012465chr1022440 951 --12271 --
NM_012475chr12170 56 ------
NM_012479chr752040 1761 783 432 337 --1533 --
NM_013229chr1232379 870 563 ------
NM_013230chrY--11434 ----
NM_013231chr141479 1708 ----
NM_013233chr21966 ------
NM_013246chr111116 --2833 210 --
NM_013247chr24385 141 110 25 ------
NM_013252chr762657 2469 501 266 224 108 --2474 396 --
NM_013255chr768635 5755 5665 1470 1404 1348 15892 ----
NM_013261chr413668 ------
NM_013269chr1221737 551 ------
NM_013283chr51734 ------
NM_013305chr184649 578 289 95 --1363 --
NM_013323chr1721150 933 ------
NM_013336chr371878 1868 1817 1617 1574 1567 650 --11651 --
NM_013341chr222143 1110 ------
NM_013348chr1941234 1044 112 70 ------
NM_013354chr811403 1214 ----
NM_013363chr31158 ------
NM_013374chr333138 1991 1948 ------
NM_013381chr1222158 1936 ------
NM_013392chr22388 305 --121 --
NM_013400chr741016 240 152 44 --2922 727 --
NM_013402chr1162702 2500 2437 2124 2101 829 ----12391
NM_013423chrX11001 1268 ----
NM_013427chrX11001 1268 ----
NM_013433chr1941909 1307 380 255 1265 21488 531 --
NM_013438chr9150 --1534 --
NM_013444chrX152 ------
NM_013446chr72360 97 ------
NM_013449chr1241980 818 687 499 12170 22902 222 --
NM_013450chr2----1187 --
NM_013958chr81166 ------
NM_013959chr81166 ------
NM_013961chr81166 ------
NM_013962chr81166 ------
NM_013989chr1434636 3460 3283 1406 24157 4092 --
NM_013995chrX------12156
NM_014000chr1031554 522 411 --11611 --
NM_014010chr91592 ------
NM_014023chr1031861 1090 220 --11049 --
NM_014030chr1721059 788 ----11155
NM_014057chr91372 ------
NM_014066chr8----2306 113 --
NM_014071chr201119 ------
NM_014079chr371045 931 760 328 282 212 148 --1240 --
NM_014089chr131825 --1413 --
NM_014110chr11248 --41013 880 328 260 --
NM_014112chr821608 485 ------
NM_014117chr161714 ------
NM_014142chr10147 ------
NM_014153chr161169 ------
NM_014155chr1147438 4847 2460 2319 --25501 2946 --
NM_014159chr3172 ------
NM_014181chr242790 1173 1031 621 --12482 --
NM_014216chr1441405 1171 1049 664 --11428 --
NM_014217chr12549 297 --11828 --
NM_014231chr1271870 1851 1801 1470 647 500 488 ------
NM_014232chr1721478 396 1556 1533 --
NM_014232chr1721478 396 1556 1533 --
NM_014233chr1741695 1603 522 217 --1358 --
NM_014245chr32222 129 ------
NM_014253chrX12005 ------
NM_014267chr11----1110 --
NM_014275chr55909 849 766 737 233 --1779 1163
NM_014283chr111436 ------
NM_014284chr13440 333 197 ------
NM_014286chr9132768 2687 2637 2556 2530 2425 2319 2236 1281 739 422 150 143 12591 13467 --
NM_014288chr11221 ------
NM_014292chr22101589 1488 1387 1202 683 608 571 486 369 36 21603 1545 11299 --
NM_014293chr2293907 3573 1044 1011 892 833 409 94 22 --11067 --
NM_014294chr8------11098
NM_014299chr1991996 1769 1408 816 613 564 546 281 224 --1575 --
NM_014309chr2265129 4892 4367 3988 1944 40 --24004 1357 11114
NM_014316chr1641983 1866 1821 384 --22104 1734 --
NM_014323chr221255 ------
NM_014325chr1222222 1415 176 ----
NM_014331chr437224 2343 2246 25797 5184 15631 --
NM_014333chr1122388 1924 21015 40 ----
NM_014338chr223920 755 73 1410 1677 --
NM_014345chr61794 ------
NM_014361chr111364 ------
NM_014368chr991823 1776 1763 616 594 384 349 159 153 ------
NM_014372chr1--1575 ----
NM_014374chr741016 240 152 44 --2922 727 --
NM_014393chr8172 --11737 --
NM_014399chr72953 266 ------
NM_014405chr17142197 2175 2127 2055 1884 1681 1671 1550 668 607 449 380 299 47 --21789 417 --
NM_014408chr1155 ------
NM_014423chr533775 1308 173 --11181 --
NM_014452chr62987 962 --2981 404 --
NM_014458chr11926 ------
NM_014462chr8126 ------
NM_014491chr71309 ------
NM_014494chr1632064 2043 690 --11691 --
NM_014496chrX----1241 --
NM_014507chr223941 894 335 11085 31078 1024 289 --
NM_014515chr12----1163 --
NM_014517chr321296 519 ------
NM_014548chr151382 ------
NM_014554chr1232140 671 533 --1129 1377
NM_014571chr182873 1946 1142 1077 687 622 607 137 --32831 2800 774 --
NM_014575chr31144 ------
NM_014584chr1421632 389 ------
NM_014591chr1021320 1044 ----1511
NM_014592chr51287 ------
NM_014614chr221398 75 --2368 29 --
NM_014615chr1642723 2310 299 142 ------
NM_014616chr322639 706 --1890 12809
NM_014621chr2--193 ----
NM_014630chr1553939 3905 2531 1425 510 --31038 917 85 --
NM_014634chr22183423 3297 3287 3194 3069 2903 2802 2687 2371 1352 1184 1170 993 624 613 410 270 247 --13476 --
NM_014636chr983516 3124 1440 1043 761 749 369 267 --2868 586 11091
NM_014646chr18142486 2093 2084 2054 1026 885 840 807 613 571 444 230 167 67 12445 ----
NM_014653chr1231546 1532 164 1550 32142 374 51 --
NM_014661chr10153821 3331 3316 3058 2959 2473 1307 1148 1006 784 658 624 424 237 72 32842 958 579 ----
NM_014665chr8163621 3525 3508 3486 3044 2754 2714 1230 720 414 358 296 290 242 222 60 23207 999 185 --
NM_014667chr331738 1620 190 --11647 --
NM_014670chr2----1294 --
NM_014671chr7----21218 102 --
NM_014686chr1962186 2014 1858 690 371 238 --11848 --
NM_014690chr752937 2203 1185 673 195 --12010 --
NM_014693chr32754 310 ------
NM_014694chr92482 431 1643 ----
NM_014705chr72731 419 ------
NM_014713chr2179 ------
NM_014715chr111718 ------
NM_014717chr19154 ------
NM_014720chr10134 ------
NM_014723chr20183042 2880 2873 2848 2483 2408 2321 2310 2294 2271 2191 2076 2041 1011 1003 454 375 296 --22736 2384 --
NM_014726chr1781377 1230 936 530 424 281 206 183 ------
NM_014730chr1284529 3456 1961 1760 1630 1268 996 686 13706 ----
NM_014730chr1284529 3456 1961 1760 1630 1268 996 686 13706 ----
NM_014731chr2061544 1317 1233 1185 602 351 ------
NM_014737chr2033545 2886 1650 ------
NM_014739chr623777 1510 --13335 --
NM_014747chr1134860 4651 4618 4483 2097 2057 1935 1366 922 648 546 491 387 --25053 910 --
NM_014751chr8--11484 ----
NM_014755chr243200 1665 1218 473 ------
NM_014756chr11183 ------
NM_014759chr871634 1553 1443 1026 513 343 165 --11492 --
NM_014761chr161145 ------
NM_014762chr161613 869 692 619 592 430 --32510 2299 525 --
NM_014767chr1052858 2831 2645 1473 287 --1581 --
NM_014770chr1231088 361 287 ------
NM_014771chr164684 376 256 111 2790 301 --1747
NM_014772chr18143397 3335 3200 2924 2880 1320 1016 1001 633 556 263 257 89 43 --21334 1314 --
NM_014774chr152890 2590 1224 1210 601 --1431 --
NM_014776chr1222794 665 12277 --13168
NM_014779chr32303 118 ------
NM_014795chr22544 221 ------
NM_014798chr17101874 1868 1737 1348 1180 750 591 568 508 191 --31728 1305 277 --
NM_014810chr132341 271 50 13050 11483 --
NM_014812chr111893 ------
NM_014819chr51801 1737 ----
NM_014820chr311319 ------
NM_014826chr133946 3686 687 --13670 1768
NM_014830chr1263251 3063 2445 1312 788 419 23506 3176 11203 --
NM_014836chr1021977 1624 ------
NM_014839chr11614 ------
NM_014840chr1272978 2757 2736 1121 750 217 178 12403 1646 --
NM_014849chr171090 927 908 877 411 298 190 --1368 --
NM_014850chr3104385 3867 3399 1649 688 598 147 112 97 61 --24599 1418 --
NM_014858chr13865 738 358 --31049 836 458 --
NM_014871chr122501 27 ------
NM_014872chr931782 514 106 --31873 1718 454 --
NM_014873chr123012 1172 ------
NM_014877chr1747240 7022 6944 6614 --15561 17512
NM_014891chr721068 469 ------
NM_014892chr6--1451 ----
NM_014893chrY1425 --12164 --
NM_014897chr173982 902 357 ------
NM_014901chr591990 1906 1648 1454 1418 531 281 95 64 ------
NM_014906chr1723135 1508 ------
NM_014909chr14133728 3555 3425 3270 3174 1554 1190 1068 985 771 630 427 24 12865 32799 2412 622 1717
NM_014912chr1022878 2788 --12867 --
NM_014917chr11132 ------
NM_014920chr622351 1222 --2820 509 --
NM_014921chr19123036 2761 2601 2580 2545 2281 2169 858 831 729 404 62 21949 137 ----
NM_014923chr1311621 ------
NM_014924chr1452140 528 357 330 316 ------
NM_014926chr31851 ------
NM_014931chr196626 611 571 468 455 163 ------
NM_014932chr31495 1485 ----
NM_014934chr1343289 2720 1203 675 12907 ----
NM_014939chr1811052 --1357 --
NM_014944chr14980 590 269 163 ------
NM_014945chr53593 413 286 --1687 --
NM_014946chr211239 --1207 --
NM_014947chr122555 765 --12543 --
NM_014952chr1551744 1708 1550 145 100 1312 31795 569 371 --
NM_014964chr1762169 1953 1934 1683 352 185 1585 31827 254 232 --
NM_014974chr1031668 1250 602 ------
NM_014978chr104667 642 328 115 --1490 --
NM_014982chr1435231 5212 3683 ------
NM_014988chr422109 842 --1121 --
NM_014989chr621284 537 ------
NM_014990chr1431101 906 27 --1245 --
NM_014991chr432093 2077 814 --1443 --
NM_014997chr742289 2153 1865 1097 ----1113
NM_014999chr121561 ------
NM_015000chr1243066 2841 296 188 ------
NM_015008chr3--13399 ----
NM_015015chr191734 --2741 349 --
NM_015020chr1653343 1272 1013 483 384 ------
NM_015024chr8198 --1942 --
NM_015026chr1223661 183 ------
NM_015032chr131701 ------
NM_015033chr993117 3074 1298 721 537 414 315 161 69 --1854 13235
NM_015039chr194107 3342 3129 1649 429 423 384 345 306 ------
NM_015042chr1583687 3354 3236 3172 1010 930 686 42 --33925 3267 2682 --
NM_015044chr1662691 2580 1062 768 742 735 12709 1121 1726
NM_015045chr101469 --1826 --
NM_015051chr962956 2668 1022 986 782 229 ------
NM_015052chr711360 ------
NM_015053chr172232 1719 1693 591 387 56 46 --1652 --
NM_015061chr93649 626 343 ------
NM_015064chr1232892 961 664 ------
NM_015068chr721313 688 ----1505
NM_015070chr1311485 ------
NM_015074chr154715 1992 1647 522 372 14633 ----
NM_015075chrX101866 1607 1443 883 702 478 315 170 136 76 1641 1285 --
NM_015076chr654402 3911 3521 3065 45 ------
NM_015077chr17174312 4000 3849 3598 3478 3377 1894 1505 1289 1224 791 530 474 439 433 122 105 --21532 235 --
NM_015082chr552229 2042 971 762 663 ------
NM_015086chr1281305 1271 1190 608 575 567 446 287 ------
NM_015092chr1624019 3480 --13181 --
NM_015093chr61510 --11716 --
NM_015094chr22194267 3896 3789 3309 3262 3076 3030 2995 2896 1693 1680 1626 1563 1400 786 747 377 235 110 --33932 3706 3054 13879
NM_015103chr34986 855 314 249 ------
NM_015107chrX52334 1878 1797 849 565 1918 ----
NM_015113chr1762144 1767 1701 1668 1536 250 --11487 --
NM_015129chrX31730 645 100 --1290 --
NM_015132chr721727 766 ------
NM_015133chr1681441 1165 1046 538 446 403 320 293 1327 11190 --
NM_015139chr1132 ------
NM_015144chr163897 319 310 --23065 1524 --
NM_015153chr61625 ------
NM_015155chr1072470 2280 2210 822 450 319 112 --12964 --
NM_015156chr1453472 1508 1079 442 363 ------
NM_015158chr92798 719 ------
NM_015173chr41465 ----149
NM_015185chrX52616 2228 2172 2109 951 --12311 --
NM_015191chr1132727 2294 233 --1824 --
NM_015199chr31919 --12743 11154
NM_015200chr4148 ------
NM_015205chr13134098 4008 3904 3891 3782 3657 1563 1468 1330 1125 458 427 177 1210 44593 4080 1895 278 --
NM_015213chr111295 ------
NM_015233chr1342239 1890 1093 91 11758 ----
NM_015236chr41295 ------
NM_015238chr51732 1156 ----
NM_015242chr11178 125 ----
NM_015245chr6102339 2112 2022 1809 1069 1000 761 500 105 54 --12306 --
NM_015250chr94430 267 226 34 ------
NM_015252chr21619 ------
NM_015254chr8132614 2534 2518 2499 2439 2324 2048 1199 893 819 589 576 568 2956 325 12055 --
NM_015269chr1----1142 --
NM_015271chr411371 ------
NM_015272chr1621841 1772 ------
NM_015275chr12--11467 --1176
NM_015282chr292539 2434 2350 870 688 555 450 191 104 ------
NM_015284chr162098 1881 851 757 258 95 --31866 1611 1532 --
NM_015288chr5112457 2350 1170 1021 843 682 613 557 441 238 50 --23278 27 --
NM_015292chr126491 290 211 196 148 135 ------
NM_015299chr14163736 3710 3695 3685 3488 3318 3241 3149 3140 3092 2964 2892 2776 2640 745 148 --42784 1578 708 454 --
NM_015305chr14151807 1445 1386 1262 1248 1197 741 688 671 657 534 409 237 187 162 ------
NM_015310chr867547 7077 7046 5844 2353 775 25982 5496 ----
NM_015313chr1134484 1176 641 ------
NM_015316chr1421029 394 --21174 164 11183
NM_015317chr232752 2533 2473 ------
NM_015321chr19334758 4641 4602 4387 4370 4328 4219 4094 4084 4077 3997 3918 3758 3729 3649 3630 3518 3495 3457 3181 3095 3074 1955 1831 1747 1656 1408 1231 1162 848 759 720 355 ------
NM_015326chr132334 1948 1007 ------
NM_015328chr72416 329 ------
NM_015332chr7123422 3394 2762 2504 2343 2304 1424 1379 1342 1203 1177 664 --32771 1170 141 --
NM_015335chr1212599 --11732 --
NM_015343chr171329 ------
NM_015346chr1421499 106 ------
NM_015349chr631101 347 245 ----12799
NM_015354chr9--1322 ----
NM_015365chrX33164 1431 664 --14112 --
NM_015385chr1031186 899 748 ------
NM_015397chr9----193 --
NM_015401chr127931 443 433 393 359 271 239 ------
NM_015435chr821351 1077 ------
NM_015443chr174462 451 378 262 1994 ----
NM_015446chr111267 --1633 --
NM_015447chr93314 286 86 ------
NM_015455chr534031 1354 892 ------
NM_015457chr114971 965 182 51 --11088 --
NM_015460chr32214 109 ------
NM_015461chr181517 1263 ----
NM_015463chr21296 ----172
NM_015465chr5------1532
NM_015466chr3123 --1171 --
NM_015475chr2----1929 --
NM_015481chr1221071 1056 ------
NM_015497chr151806 --2971 924 --
NM_015503chr166583 534 514 503 227 219 ------
NM_015520chr31458 ------
NM_015526chr1951404 1377 1254 1074 145 --21263 1026 --
NM_015531chr111125 ------
NM_015534chr1--1169 ----
NM_015535chr243456 1382 994 290 ------
NM_015537chr981038 914 877 861 843 824 279 164 --1732 --
NM_015541chr32986 915 --21146 459 --
NM_015542chr101985 --2216 31 --
NM_015548chr6--1127 124 --
NM_015550chr712645 12756 ----
NM_015553chr673838 3617 3580 3536 3391 3136 1558 1274 ----
NM_015555chr6134 ----11382
NM_015557chr1153546 3466 3405 3264 3097 2882 2625 2456 2272 2215 1350 984 957 804 171 --31340 1087 765 --
NM_015568chr20104299 4224 3954 3816 3457 2970 1572 1240 223 110 ----13304
NM_015575chr243130 981 851 146 --1577 --
NM_015576chr312064 ------
NM_015578chr192192 51 ------
NM_015584chr1741101 1080 363 269 ------
NM_015609chr182833 2794 2560 2479 2090 796 766 691 ------
NM_015635chr91187 --11425 --
NM_015640chr123997 977 ------
NM_015642chr32266 246 1240 ----
NM_015651chr9132099 2024 1948 1604 1575 761 701 652 312 206 160 63 27 ------
NM_015658chr12302 75 --1363 --
NM_015670chr171450 ------
NM_015676chr141383 ------
NM_015684chr141208 ------
NM_015686chrX92500 1840 1729 1675 969 778 586 488 360 --12138 --
NM_015695chr671650 669 660 279 218 187 150 --1313 --
NM_015711chr191141 ------
NM_015716chr171732 ------
NM_015726chr111170 1210 --178
NM_015840chr131948 1935 201 --12174 --
NM_015841chr131948 1935 201 --12174 --
NM_015850chr881687 963 873 621 601 594 132 70 12301 ----
NM_015878chr811648 --11867 --
NM_015885chr111122 ------
NM_015888chr123027 290 --13247 --
NM_015892chr1092215 2209 2159 1865 1590 817 402 334 31 --1594 --
NM_015898chr1992461 1941 1809 1682 688 520 363 235 228 11827 1376 --
NM_015902chr81166 ------
NM_015906chr134052 1399 869 ------
NM_015949chr73334 301 100 ----1261
NM_015955chr2185 ------
NM_015964chr16255 49 ------
NM_015980chr531181 515 227 ------
NM_015989chr12126 ------
NM_015995chr15245429 5196 5041 5019 4775 4747 4738 4553 3966 3618 3525 3467 2217 2093 1800 1681 1530 1514 1382 1345 1295 649 577 53 14912 14298 14270
NM_016009chr164724 4216 3950 3070 1915 134 ------
NM_016018chr822639 864 12021 ----
NM_016032chrX41352 1126 948 243 --2997 959 --
NM_016035chr92415 153 ------
NM_016040chr122470 2419 ------
NM_016061chr221072 475 --11358 --
NM_016063chr6----1558 --
NM_016076chr11107 ------
NM_016083chr633545 3340 3128 --13153 --
NM_016090chr11----145 --
NM_016096chr8--1634 ----
NM_016131chr21707 ------
NM_016140chr16255 49 ------
NM_016152chr321210 351 ------
NM_016162chr122798 305 ------
NM_016201chr32680 280 1239 ----
NM_016205chr41201 ------
NM_016213chr15167 ------
NM_016219chr96542 452 439 432 123 76 --1112 --
NM_016221chr5----186 --
NM_016227chr111436 ------
NM_016231chr1721547 1115 ------
NM_016235chr1641355 1038 562 286 ------
NM_016252chr21924 --1858 --
NM_016257chr173047 2855 2687 1238 463 411 372 --1196 12301
NM_016260chr237182 6132 5291 --25216 663 --
NM_016270chr191192 1330 ----
NM_016272chr2252103 741 722 533 160 --1524 --
NM_016275chr33711 131 78 ------
NM_016284chr161695 ------
NM_016287chr1----1396 --
NM_016289chr212334 ------
NM_016300chr3145 ------
NM_016308chr112089 ------
NM_016312chr12----161 --
NM_016322chr913009 --23060 2590 --
NM_016328chr7----1139 --
NM_016329chr3195 ------
NM_016351chr7165 ------
NM_016352chr731117 213 125 ----11133
NM_016357chr12--125 11027 --
NM_016364chr10155 --171 --
NM_016374chr121025 639 --21598 247 --
NM_016374chr121025 639 --21598 247 --
NM_016376chr1711157 1620 --11042
NM_016377chr621783 1153 --1319 --
NM_016410chr91450 ------
NM_016418chr2293752 3673 3382 3245 1192 1167 1132 1098 44 --13450 --
NM_016424chr1711492 --11762 --
NM_016436chr2011048 ------
NM_016441chr22450 146 --1477 --
NM_016457chr192197 145 ------
NM_016467chr22236 133 ------
NM_016505chr1----1699 1284
NM_016507chr1722116 2079 --1371 --
NM_016513chr622351 1222 --2820 509 --
NM_016519chr41161 ------
NM_016522chr1131586 1297 1088 ------
NM_016529chr1321008 371 1127 1971 --
NM_016530chr15140 13813 ----
NM_016531chr421530 47 ------
NM_016532chr176943 863 808 352 153 82 ------
NM_016553chr197995 984 919 897 182 29 21 ------
NM_016559chr321216 211 ------
NM_016563chr1581212 1158 524 494 431 397 382 27 1357 1196 --
NM_016578chr111230 ------
NM_016596chr127931 443 433 393 359 271 239 ------
NM_016603chr5----1172 --
NM_016604chr52248 75 --194 --
NM_016605chr582192 1945 1872 1741 1732 897 792 244 --11804 22014 978
NM_016618chr21123 ------
NM_016620chr1----1353 --
NM_016621chr1194367 4252 3865 3648 3408 3247 3001 1160 801 11627 34287 3923 3494 --
NM_016626chr1811685 ------
NM_016628chr101623 ------
NM_016639chr163349 150 144 1452 ----
NM_016734chr9101989 1884 1678 1568 1369 662 650 577 423 163 11471 11843 --
NM_016824chr1011506 --1294 --
NM_016827chr32230 57 --1690 --
NM_016829chr33519 285 112 --1745 --
NM_016830chr123232 213 163 ------
NM_016937chrX2803 357 174 ----
NM_016938chr111304 1345 1379 --
NM_016952chr1184003 3744 2893 2816 1047 368 273 60 --23664 1493 --
NM_017412chr811344 --1976 --
NM_017413chrX81807 1732 1626 624 349 292 131 81 --12021 --
NM_017415chr563482 3445 1313 1163 777 498 1937 33880 3703 3548 --
NM_017420chr1411003 ------
NM_017423chr431854 1805 490 ------
NM_017432chr195408 359 145 45 21 ------
NM_017436chr226680 539 251 147 96 81 --1672 --
NM_017437chr1422405 230 1333 1767 --
NM_017449chr161412 1401 1320 1175 475 65 ------
NM_017452chr2011019 --21218 433 --
NM_017453chr2011019 --21218 433 --
NM_017454chr2011019 --21218 433 --
NM_017455chr15----1283 --
NM_017457chr19168 ------
NM_017459chr16277 265 158 55 47 30 ------
NM_017514chrX3857 183 156 2683 614 ----
NM_017548chr3--1130 1823 --
NM_017550chr195946 903 787 102 58 ------
NM_017563chr365761 4926 4807 4418 893 699 --12389 --
NM_017575chr1771496 1401 1177 1034 585 522 338 ------
NM_017582chr131709 1159 649 ------
NM_017586chr9131963 1689 1643 1365 1267 711 673 637 607 343 102 63 42 --21846 741 --
NM_017590chr22122537 2407 2392 2089 912 724 460 386 329 246 205 62 --2664 136 --
NM_017592chr19102421 2291 2070 1036 1001 843 722 678 648 167 1448 2685 259 --
NM_017596chr1204535 4470 4394 4215 3502 3254 3095 3070 3064 2964 2946 1628 1416 1348 1079 883 723 336 259 215 11828 44200 3161 1852 901 --
NM_017610chr151122 ------
NM_017622chr175520 195 103 42 26 1162 1119 --
NM_017623chr292297 1966 674 497 285 235 187 138 122 ------
NM_017626chr1071568 1480 1355 1210 609 252 28 --1415 --
NM_017628chr454304 4291 1785 757 32 --24599 3927 23955 1198
NM_017633chr6----23703 3042 --
NM_017635chr113535 354 255 ------
NM_017637chr977870 7784 6057 5832 3155 2595 1416 16512 18847 11317
NM_017640chr61683 1309 1768 --
NM_017643chr1711985 --12197 --
NM_017644chr345037 747 719 231 14081 ----
NM_017651chr631567 1366 189 ------
NM_017658chr142795 126 1642 ----
NM_017666chrX3664 574 230 ------
NM_017668chr163696 610 573 ------
NM_017670chr113695 305 294 190 1842 --
NM_017679chr172617 503 174 1656 --
NM_017686chr1------1975
NM_017709chr143550 1233 404 52 ------
NM_017712chr19116267 6193 6178 5971 5427 5245 5144 1166 1085 464 269 16314 ----
NM_017714chr201174 ------
NM_017719chr32616 464 --1401 --
NM_017724chr32683 655 142 1314 --
NM_017730chr33625 213 73 ----1612
NM_017736chr1622163 266 144 ----
NM_017737chr1185 ------
NM_017739chr14509 459 448 409 ------
NM_017747chr5--1368 ----
NM_017749chr112388 181 --3890 717 645 --
NM_017772chr671535 1337 709 555 334 296 217 ------
NM_017778chr8----11216 --
NM_017787chr10112174 2052 1984 1798 1115 1100 1030 831 815 476 448 12892 1656 22210 922
NM_017799chr1441721 1682 1394 732 ------
NM_017824chr1012297 --21054 763 --
NM_017848chrX53537 3230 1693 654 66 ----2337 236
NM_017851chr1551165 985 971 880 368 ------
NM_017887chr1176 ------
NM_017893chr1071201 429 412 376 368 209 155 --1953 --
NM_017907chr111193 ------
NM_017919chr955746 4699 4283 2177 574 --24677 198 --
NM_017921chr1772280 2228 2043 1643 1432 523 33 --22034 1708 --
NM_017929chr2231203 396 252 ----11355
NM_017966chr1131320 375 186 --2201 135 11004
NM_018008chr31250 ------
NM_018027chr102556 211 ------
NM_018031chr31419 ------
NM_018045chr142288 385 367 353 --12488 1618
NM_018047chr5125 ------
NM_018052chr163347 185 24 ------
NM_018054chr162562 141 ------
NM_018061chr111539 --1542 --
NM_018064chr6159 ------
NM_018071chr142674 654 --1850 --
NM_018085chr1127468 7453 7270 7029 6645 2449 2344 2200 571 160 119 70 22526 2429 ----
NM_018086chr211785 ------
NM_018113chr122373 57 ------
NM_018116chr12481 426 ------
NM_018121chr102801 688 --22553 2066 --
NM_018133chr312085 ------
NM_018154chr194372 199 71 49 --1145 --
NM_018155chr341254 1025 395 172 ------
NM_018157chr1232544 2521 286 11069 ----
NM_018171chr12----1680 --
NM_018181chr1821818 1483 ------
NM_018184chr3188 11497 ----
NM_018191chr131421 ----11471
NM_018205chr1082164 1849 1549 525 514 175 72 47 --32222 2209 421 --
NM_018207chr131504 1196 1153 21437 499 ----
NM_018208chr151136 1127 1006 888 792 --5896 771 395 347 215 --
NM_018239chr1082164 1849 1549 525 514 175 72 47 --32222 2209 421 --
NM_018243chr432925 2640 281 23544 3130 33277 1222 1018 --
NM_018247chr613014 --1645 --
NM_018254chr111713 1696 21673 360 11496
NM_018263chr2----12391 12406
NM_018287chr10----2412 166 --
NM_018293chr3--2328 97 1932 --
NM_018299chr822655 1325 --1298 --
NM_018313chr321983 638 --12422 12082
NM_018354chr20149 --188 --
NM_018362chr11--12450 1244 --
NM_018364chr123653 548 23927 1147 11219 --
NM_018375chr14----2402 238 --
NM_018381chr191322 ------
NM_018383chr231766 192 27 ------
NM_018400chr1163494 2775 1820 1720 704 99 ------
NM_018403chr353892 3663 3065 2598 637 1571 1679 13283
NM_018424chr91219 --21213 492 --
NM_018440chr835766 5249 504 --22593 131 16683
NM_018462chr33151 143 62 --1309 --
NM_018469chr1721060 426 ------
NM_018557chr211088 --11540 --
NM_018566chr154533 3540 3440 467 360 --153 13884
NM_018569chr431280 1221 227 ------
NM_018584chr1----1193 --
NM_018602chr15188 ------
NM_018622chr3135 ------
NM_018640chr1211939 ----12385
NM_018644chr1181422 860 577 528 412 352 226 46 ----1764
NM_018660chr831158 122 34 --11944 --
NM_018667chr16162877 2479 2449 2416 2338 2257 2063 2052 1993 1935 1868 1801 1106 1092 598 195 12172 32356 2222 769 --
NM_018674chr24541 499 237 84 1477 1172 --
NM_018689chr1562589 2102 1685 1655 878 802 1458 1625 --
NM_018699chr41277 --1333 --
NM_018700chr511350 ------
NM_018717chr422904 173 --1662 --
NM_018718chr74781 527 330 127 --1567 1225
NM_018837chr201111 ------
NM_018841chr163516 3153 2721 1313 1264 272 --23603 1454 --
NM_018945chr653267 117 72 42 27 --1257 1965
NM_018948chr11985 --1503 --
NM_018951chr72498 390 --168 --
NM_018952chr173189 134 40 --184 --
NM_018953chr124820 557 242 125 1728 1736 --
NM_018970chr712804 ------
NM_018979chr1241974 1946 991 442 12014 ----
NM_018994chr11393 ------
NM_018999chr1044544 977 966 114 13050 1541 --
NM_019009chr1182450 2297 2280 1882 1817 1703 962 717 --42304 2023 810 678 --
NM_019041chr631669 806 198 ------
NM_019044chr294478 3704 3070 2900 1762 1503 1237 1157 561 13138 13483 --
NM_019045chrX1362 ------
NM_019053chr1011032 ------
NM_019074chr156830 786 713 651 346 281 ------
NM_019084chr1011901 ------
NM_019087chr52588 23 --135 --
NM_019106chr2243408 3286 2156 101 12459 11011 --
NM_019114chr922099 2006 --12409 --
NM_019116chr16113455 3205 3054 3032 2956 2864 2773 1070 866 795 63 --13044 --
NM_019555chr32415 31 11807 ----
NM_019557chr12834 652 --1763 2661 313
NM_019593chr2022080 2018 --22327 801 --
NM_019595chr21132 ------
NM_019610chr111889 ------
NM_019845chr22754 129 --1308 --
NM_019849chr191203 ------
NM_019850chr25593 546 304 131 72 --1577 --
NM_019854chr124731 265 179 160 ------
NM_019857chrX31390 517 44 11464 ----
NM_019885chr282954 2175 2056 1129 738 662 264 165 --2714 633 --
NM_019903chr1011506 --1294 --
NM_020039chr1281920 1692 1585 1488 1246 621 60 28 --31717 1474 364 --
NM_020122chr245957 5647 5043 735 --25074 254 --
NM_020134chr281187 914 866 792 444 423 253 118 --1908 --
NM_020142chr12177 --1408 --
NM_020150chr1031846 1670 635 ------
NM_020159chr4----1585 --
NM_020182chr2043559 1032 469 114 --22839 758 --
NM_020184chr281946 1453 1442 804 788 424 272 53 --31514 877 848 --
NM_020198chr1741454 1237 1056 191 ------
NM_020205chr123417 961 --12499 12810
NM_020239chr131722 1619 604 ------
NM_020240chr532781 2510 960 ------
NM_020248chr162236 1687 1573 973 828 716 --12306 --
NM_020310chr17142541 2248 1900 1853 1714 874 834 728 597 515 399 124 94 22 --1440 --
NM_020336chr2033787 2715 698 --12912 --
NM_020338chr10122701 2623 2458 2342 1391 783 759 477 465 457 261 244 ------
NM_020341chr20189 ------
NM_020342chr222471 1775 ------
NM_020346chr11----11556 --
NM_020348chr1032608 2378 89 ------
NM_020362chr1182 ------
NM_020382chr1221179 580 1204 11036 --
NM_020390chr323727 1685 ------
NM_020408chr62674 324 ------
NM_020423chr11198 ------
NM_020429chr7103096 2633 2611 2500 2327 2267 2113 648 434 315 --22753 92 --
NM_020439chr13634 310 187 ------
NM_020440chr152954 2916 1206 709 189 --12125 --
NM_020443chr1126952 5565 5071 2678 2614 2444 2402 2337 1632 1334 1280 96 --16915 --
NM_020447chr153155 40 23 11653 22230 2005 --
NM_020452chr181543 1474 1367 849 758 657 210 89 1382 1177 --
NM_020474chr1811802 --1718 --
NM_020526chr191777 1689 727 685 630 560 532 188 101 --11130 --
NM_020530chr225824 668 352 343 228 ------
NM_020645chr111550 ------
NM_020647chr82697 220 --12131 --
NM_020649chr17192 ------
NM_020659chr194554 439 183 95 ------
NM_020673chr2097409 6626 6546 6481 6464 5647 5356 4987 44 16255 ----
NM_020686chr1632795 2346 847 1700 3955 588 279 12192
NM_020689chr2081655 1146 573 509 417 124 81 24 --1152 --
NM_020699chr195137 4973 4736 4547 4157 3729 3427 1869 1795 21861 697 2827 294 --
NM_020708chr20112338 1991 1587 967 905 694 636 435 383 323 25 --11889 --
NM_020713chr20263083 3051 2856 2843 2823 2739 2636 2575 2564 2553 2489 2436 2185 1184 1008 956 912 893 848 800 687 613 553 383 321 164 --2674 351 --
NM_020718chr1635402 5266 5250 --26110 845 1766
NM_020728chr743028 2995 2221 312 --11275 --
NM_020739chr1521037 866 ------
NM_020742chrX31891 443 321 --12233 --
NM_020747chr51275 ------
NM_020748chr171295 11614 11862 --
NM_020750chr631050 385 31 --31016 153 75 --
NM_020752chr1012100 1906 ----
NM_020761chr1771928 1420 1324 1318 1282 474 145 --1766 --
NM_020766chrX43441 1671 839 231 --1952 --
NM_020770chr171027 947 815 509 368 40 33 1481 ----
NM_020772chr1732537 2202 2026 38146 5925 1563 25415 2864 --
NM_020773chr462233 1867 1720 838 695 527 1137 ----
NM_020774chr1814612 --15699 11052
NM_020778chr15214758 4687 4538 4016 3506 3217 1601 1384 1337 1224 1161 1147 1017 862 754 742 709 619 584 435 311 --43750 1357 276 143 14107
NM_020792chr31312 --12325 --
NM_020795chr1751998 1850 1539 202 33 --1642 --
NM_020796chr52134 107 --13018 --
NM_020801chr511859 --12581 --
NM_020807chr16141610 1573 1554 1437 1306 1193 1154 645 508 439 421 102 60 51 ------
NM_020809chr1121605 240 ------
NM_020810chr1422775 1346 ------
NM_020820chr2071528 1457 1355 505 287 199 76 ------
NM_020825chr1673606 3549 1208 1067 589 414 253 --11527 --
NM_020830chr222184 387 ------
NM_020832chr11188 --1597 --
NM_020841chr1222748 1019 ------
NM_020845chr12122224 2168 1956 1944 1799 1697 937 578 380 329 118 68 --22201 1825 --
NM_020850chr16102737 2575 2464 2312 2074 826 734 128 31 21 11244 11041 --
NM_020854chr18----11224 --
NM_020856chr1921380 67 ------
NM_020859chr432884 756 355 --13205 --
NM_020860chr4----1782 --
NM_020861chr61421 --1106 --
NM_020868chr2141 ------
NM_020871chrX22302 2045 --12141 --
NM_020886chr1131110 469 21 ------
NM_020888chr161457 745 657 434 304 137 1246 11683 --
NM_020899chr1731978 1659 125 1750 ----
NM_020917chr1943588 573 510 446 ------
NM_020920chr14159 1311 ----
NM_020927chr1631891 616 309 ------
NM_020939chr661356 1242 1171 497 96 65 1264 1945 --
NM_020943chr2------1171
NM_020952chr9129 ------
NM_020956chr19244722 4554 4469 4353 3716 3582 3262 3159 3113 1547 1501 1371 1269 1244 1221 1082 1061 812 739 639 525 266 193 138 ------
NM_020958chr141317 ------
NM_020962chr1562259 2189 868 553 371 321 --21968 487 --
NM_020967chr2031188 476 320 --21105 865 --
NM_020974chr112493 408 --1444 --
NM_020975chr104755 549 458 71 11573 ----
NM_020977chr421939 638 ------
NM_021020chr883328 3192 2824 2545 683 289 152 53 --52782 2582 2461 791 213 --
NM_021035chr2041205 1174 1049 941 1929 11272 --
NM_021064chr62444 56 --1586 --
NM_021072chr522422 2116 ------
NM_021079chr17133087 2924 2877 2848 2686 2667 2521 2207 2165 2070 2035 805 602 --42933 2800 2482 895 --
NM_021090chr22114978 4822 4579 4516 4285 1480 1218 1051 288 80 53 ------
NM_021106chr97765 617 252 228 193 163 147 ------
NM_021120chrX52537 2407 2194 1206 1144 --42932 2271 1119 1103 --
NM_021133chr141120 510 496 76 ------
NM_021155chr1942528 1831 1082 475 ------
NM_021183chrX22375 173 ------
NM_021198chr291445 1311 1021 925 597 515 318 252 199 --31304 932 75 --
NM_021202chr2062167 2122 2014 1243 1138 623 --22096 869 22461 947
NM_021216chr1941308 1122 1088 473 --21148 989 --
NM_021238chr1211780 ------
NM_021239chr142585 138 ------
NM_021249chr1411134 --11582 --
NM_021253chr6--1910 ----
NM_021260chr1461162 1085 532 485 413 164 --175 --
NM_021267chr1971414 969 939 434 373 325 292 ----1398
NM_021269chr191110 ------
NM_021627chr321065 139 ------
NM_021643chr211497 ------
NM_021648chr662374 2110 2068 1700 240 195 12499 11942 --
NM_021705chr6--11246 11321 --
NM_021723chr7165 ------
NM_021728chr14--1157 ----
NM_021729chr111307 ------
NM_021785chrX1143 1136 ----
NM_021813chr674891 4230 3894 1841 1759 1316 297 --11456 --
NM_021814chr63622 438 206 ------
NM_021911chr542088 1649 1164 321 --1191 --
NM_021913chr1941566 1181 392 149 ------
NM_021943chr651881 1870 1449 762 429 11410 ----
NM_021946chrX51427 1103 351 340 265 ------
NM_021959chr62927 306 141 ----
NM_021960chr132339 1094 626 ------
NM_021961chr11106664 5907 5130 2901 2396 2275 1438 1405 1075 831 --16651 --
NM_021962chr1782102 1938 1897 1886 1733 1602 1572 431 11674 31705 561 387 --
NM_021963chrX1483 --1548 --
NM_021964chr326452 6132 36483 4048 1644 12269 --
NM_021967chr541254 1121 996 910 ------
NM_021977chr62754 699 --22519 650 --
NM_021988chr201639 --124 --
NM_021991chr173747 321 226 --2131 40 --
NM_022044chr22188 ------
NM_022048chr1554674 1638 1452 565 216 --2206 29 --
NM_022060chr144917 891 369 333 --3980 494 203 --
NM_022062chr1121500 585 1113 41259 607 392 59 --
NM_022064chr3--2162 62 ----
NM_022130chr5----2406 180 --
NM_022140chr521785 260 11586 11543 --
NM_022143chr721365 1214 ------
NM_022157chr1124 ------
NM_022166chr16125789 4885 4750 4376 2521 2157 1688 1328 1173 767 643 509 15130 24480 100 --
NM_022169chr1161378 1185 1163 452 354 170 --1345 --
NM_022170chr731450 664 592 --11338 --
NM_022334chr212816 791 764 735 708 455 428 399 372 343 316 287 ------
NM_022336chr252339 2092 842 156 56 --21726 689 --
NM_022340chr383667 2658 2403 2353 2334 744 333 29 ------
NM_022343chr951143 973 917 867 852 ------
NM_022346chr421196 876 ------
NM_022369chr155505 378 243 174 78 --1117 --
NM_022374chr21446 ------
NM_022442chr201639 --124 --
NM_022444chr7--174 ----
NM_022459chr1385567 5220 4274 2015 1658 1308 502 460 14975 14204 --
NM_022461chr3155 ------
NM_022469chr132681 929 248 ------
NM_022491chr1242259 1399 534 527 --1998 1499
NM_022497chr373012 2838 1429 773 742 337 271 2386 255 1792 12664
NM_022553chr61184 --1116 --
NM_022574chr772038 1875 1614 554 452 324 80 ----11895
NM_022648chr2154197 4033 3830 3781 3519 3260 3121 2936 1845 1839 1801 1477 1241 1035 282 --44420 3837 3320 768 --
NM_022652chr122340 40 ------
NM_022658chr1211122 ------
NM_022716chr121181 25 --12906 --
NM_022719chr22113697 3335 3113 2392 840 739 553 360 198 95 89 --23682 1348 --
NM_022742chr7161 ------
NM_022744chr166952 528 385 373 246 161 --1125 --
NM_022748chr782219 1967 1142 918 580 183 115 75 22657 2525 22044 545 --
NM_022750chr72506 60 --124 --
NM_022755chr951911 1712 1611 929 631 --21676 963 --
NM_022758chr652522 2019 1983 111 44 ------
NM_022763chr322700 2144 ------
NM_022781chr932999 2795 2653 1755 ----
NM_022823chr22356 127 ------
NM_022824chr521302 484 --1361 --
NM_022828chr521550 359 ------
NM_022832chr422539 665 --22480 797 --
NM_022833chr981296 1174 1144 1138 966 452 144 63 --1909 --
NM_022842chr3133208 3177 2990 2771 2751 2730 2574 2386 1145 1095 454 384 277 ----11036
NM_022843chr1311014 ------
NM_022845chr16----1758 --
NM_022893chr212888 --1661 --
NM_022898chr1454189 3567 2999 720 117 14371 --13996
NM_022970chr1011050 ------
NM_022978chr541254 1121 996 910 ------
NM_023008chr196728 719 690 664 604 31 --1643 --
NM_023033chr121536 ------
NM_023034chr81536 1586 ----
NM_023039chr5147 ------
NM_023067chr34916 383 336 112 ------
NM_023068chr2041506 1127 569 369 ------
NM_023076chr1632685 2421 336 ------
NM_023079chr1721747 275 ------
NM_023105chr881687 963 873 621 601 594 132 70 12301 ----
NM_023106chr881687 963 873 621 601 594 132 70 12301 ----
NM_023110chr881687 963 873 621 601 594 132 70 12301 ----
NM_023111chr881687 963 873 621 601 594 132 70 12301 ----
NM_023112chr14112921 2708 1983 655 621 477 437 309 225 145 70 --32929 1815 258 --
NM_023925chr12----1126 --
NM_023929chr8--1292 ----
NM_024003chrX4226 69 50 37 ------
NM_024007chr512800 --199 --
NM_024015chr1781107 800 468 387 381 208 99 85 ------
NM_024019chr41198 ----133
NM_024046chr391226 1196 1137 1056 829 455 424 406 372 --2437 364 1391
NM_024052chr1742025 2008 1198 534 --12863 1391
NM_024107chr175864 739 297 247 76 1796 1802 --
NM_024294chr652522 2019 1983 111 44 ------
NM_024295chr81825 1306 ----
NM_024297chr172586 66 ------
NM_024306chr167964 772 484 218 152 122 39 ------
NM_024320chr172196 178 ------
NM_024329chr181230 1104 625 543 426 305 257 236 21370 319 ----
NM_024348chr91238 1261 ----
NM_024408chr143016 1290 1091 1016 12956 ----
NM_024416chr91372 ------
NM_024421chr181875 ------
NM_024525chr11459 --191 --
NM_024529chr1----1328 --
NM_024551chr1242431 756 272 141 12379 11626 1835
NM_024551chr1242431 756 272 141 12379 11626 1835
NM_024554chr151664 1476 1216 1092 326 ------
NM_024556chr111369 ----147
NM_024558chr141205 ----129
NM_024567chr8169 ------
NM_024569chr172415 2212 2071 1980 1948 550 459 ------
NM_024590chr4----21576 479 --
NM_024595chr13903 892 132 ------
NM_024598chr1641135 1076 103 29 ------
NM_024607chr843217 2759 555 112 --1450 --
NM_024612chr17--1284 1406 --
NM_024613chr82727 160 ------
NM_024643chr143504 46 37 ------
NM_024652chr152496 357 --3808 477 400 --
NM_024665chr324720 3488 --11699 --
NM_024674chr132812 1209 1099 --1764 --
NM_024689chrX51461 1319 409 239 179 ------
NM_024698chr1181268 1236 1223 1078 1028 997 442 315 ------
NM_024704chr203246 203 132 ------
NM_024705chr1351123 1066 754 266 29 --1200 --
NM_024742chr16101882 1625 1585 1337 1209 708 578 443 166 144 ------
NM_024751chr41159 ------
NM_024755chr15--1350 ----
NM_024757chr941118 348 212 98 ------
NM_024779chr1231147 1001 120 1492 1158 --
NM_024785chr21176 --21145 349 11311
NM_024786chr51152 --170 --
NM_024798chr1582711 2345 2118 2025 1115 902 144 78 --11994 --
NM_024811chr1141904 708 443 273 --11345 --
NM_024817chr15115678 1896 1890 1774 1588 1454 1145 1077 853 678 91 15938 ----
NM_024830chr562119 2073 1683 1410 692 307 --1632 --
NM_024834chr1021829 1269 ------
NM_024837chr151731 11466 ----
NM_024845chr1691610 1485 1312 1282 1256 640 282 142 28 11141 21577 233 --
NM_024874chr161272 1187 930 358 221 31 ------
NM_024887chr14802 716 533 182 1423 1777 --
NM_024893chr201294 1907 ----
NM_024899chr181508 ------
NM_024911chr12712 109 ------
NM_024915chr882834 1966 1085 795 285 279 234 153 --1572 --
NM_024939chr1651279 1249 1031 669 336 ------
NM_024946chr1631368 1153 264 --11199 --
NM_024947chr357902 3106 2288 1918 68 --12322 --
NM_024953chr1221924 414 --1699 --
NM_024954chr106631 235 202 94 48 29 ------
NM_024969chr21644 --1691 --
NM_024971chr9129 ------
NM_024989chr277683 7417 6947 6838 6378 6310 2769 --11558 --
NM_024991chr1031186 899 748 ------
NM_024993chr22589 567 --11229 --
NM_025054chr832829 2791 193 --23544 2931 --
NM_025058chr18703 694 659 229 172 119 43 34 ------
NM_025126chr12--1576 ----
NM_025141chr151460 ------
NM_025146chr332093 784 56 1276 ----
NM_025158chr51470 ------
NM_025160chr112755 ----12611
NM_025179chr1104556 4137 4048 3782 3277 1624 1533 1525 1052 93 --11918 --
NM_025182chr91775 ------
NM_025191chr12957 796 --1422 --
NM_025222chr362579 1010 797 644 296 126 ------
NM_025224chr2062283 2061 1799 1530 795 388 1261 ----
NM_025235chr1021539 107 --1745 --
NM_025236chr64765 285 216 41 --1304 --
NM_025237chr1751063 1055 483 173 42 --1146 --
NM_025244chr21204 ------
NM_025248chr17133056 3005 2975 2886 2768 1263 1174 1165 1136 737 676 537 140 --22983 770 --
NM_025251chr851157 1122 945 370 129 ------
NM_030576chr17112661 2584 2159 2153 1860 1626 1037 841 282 144 37 ------
NM_030594chr151976 ------
NM_030625chr1012063 --11627 12007
NM_030627chr5130 ------
NM_030630chr172124 45 ------
NM_030647chr715774 15398 11015 --
NM_030648chr444977 4690 2160 1659 --24390 1483 --
NM_030650chr223696 3544 ------
NM_030651chr62517 267 --150 --
NM_030653chr121209 --2932 703 --
NM_030664chr1012343 ------
NM_030665chr1731157 1033 91 ------
NM_030674chr1244891 4875 942 583 --11737 --
NM_030761chr152597 2244 603 203 129 21721 382 22679 1087 --
NM_030762chr1221443 280 --21972 539 --
NM_030766chr1231006 424 275 ----1156
NM_030796chr751650 892 659 52 41 ------
NM_030802chr175149 107 92 67 55 --1328 --
NM_030809chr1242336 2295 1959 841 --22212 1548 --
NM_030820chr621065 175 ------
NM_030884chr381981 1613 923 677 361 284 212 136 --32191 2056 1700 --
NM_030913chr14712 524 516 136 --1665 --
NM_030914chr92971 67 --1286 --
NM_030915chr242325 1602 942 721 --1227 --
NM_030918chr1115043 4994 4500 4454 4394 4271 4002 3774 1618 601 468 23854 613 1130 --
NM_030920chr111420 12011 ----
NM_030922chr15--1635 ----
NM_030935chr73291 116 43 ------
NM_030937chr141379 1179 943 238 2469 120 ----
NM_030938chr172290 266 ------
NM_030953chr54617 531 303 194 11013 ----
NM_030962chr111322 ------
NM_030981chr1141226 471 300 230 --1876 --
NM_030984chr7122 ------
NM_031216chr18----1155 11833
NM_031231chr204686 545 128 26 --1510 --
NM_031232chr204686 545 128 26 --1510 --
NM_031243chr71578 ------
NM_031268chr16204273 3943 3646 2006 1818 1793 1714 1631 1409 1311 1179 933 601 577 567 559 452 428 394 248 --11690 --
NM_031309chr8132372 2357 2252 2198 1853 1726 842 774 685 160 128 98 33 11794 11811 --
NM_031314chr1411520 ------
NM_031371chr121025 639 --21598 247 --
NM_031371chr121025 639 --21598 247 --
NM_031417chr1962761 2498 1125 293 229 131 --32425 620 31 --
NM_031435chr121640 ------
NM_031439chr81348 --11424 --
NM_031442chrX11295 12180 ----
NM_031444chr22102116 1777 1684 877 790 717 691 538 460 57 11902 2666 28 --
NM_031445chr253337 2603 2335 574 198 --1785 --
NM_031461chr821706 359 1623 ----
NM_031476chr1662642 2548 2480 1993 971 628 1658 2729 422 --
NM_031478chr164645 142 91 57 ------
NM_031483chr2023596 96 12262 ----
NM_031844chr163742 2708 2691 2685 688 439 ------
NM_031845chr2164 --1337 --
NM_031847chr2164 --1337 --
NM_031890chr2262522 2207 1077 631 519 329 --1550 --
NM_031899chr371405 198 185 148 117 45 23 --1540 --
NM_031938chr113945 723 411 ------
NM_031990chr1951292 1149 543 230 26 --1198 --
NM_031991chr1951292 1149 543 230 26 --1198 --
NM_031992chr731450 664 592 --11338 --
NM_032012chr964730 4372 4355 3929 1368 71 1134 14739 --
NM_032017chr1111921 1793 1329 1314 1306 774 498 455 417 339 78 --1759 --
NM_032042chr532574 2215 799 1351 1991 --
NM_032050chr221255 ------
NM_032051chr221222 ------
NM_032102chr111583 --1766 --
NM_032109chr541178 354 186 111 --161 --
NM_032124chr1821115 1094 1859 ----
NM_032127chr11160 ------
NM_032132chr12404 155 ------
NM_032144chr21594 ------
NM_032147chr1211033 ------
NM_032156chr12----1126 --
NM_032174chr131137 440 72 11312 1999 --
NM_032182chr10--11448 ----
NM_032186chr1----1353 --
NM_032193chr1191771 1538 1301 738 471 460 387 179 144 ------
NM_032195chr211211 ------
NM_032199chr102268 136 12756 ----
NM_032207chr1971209 1155 967 809 794 470 279 ------
NM_032217chr4------1453
NM_032221chr2011457 ------
NM_032233chr141740 ------
NM_032242chr3173269 3263 3232 3029 2966 2711 2569 2375 1253 1060 786 541 472 349 299 166 131 11242 32649 2276 663 --
NM_032246chr1511208 ------
NM_032268chr1682244 2123 2069 1163 1148 488 427 65 --1737 12414
NM_032271chr1631303 413 283 --1121 --
NM_032281chr19123119 2806 2740 2734 2689 2576 1125 1112 746 406 127 84 ------
NM_032283chr181771 1748 1598 1335 700 377 361 334 1207 ----
NM_032294chr1731731 411 59 --1613 --
NM_032298chr19135 1128 ----
NM_032316chr342447 2311 731 30 ----12030
NM_032325chr113364 194 49 ------
NM_032327chr101405 ------
NM_032345chr12148 ------
NM_032352chr141219 ------
NM_032373chr10--22311 902 ----
NM_032413chr151137 ------
NM_032421chr792083 1839 1474 1354 1323 601 481 353 309 --12000 1830
NM_032440chr1022314 214 12332 12254 --
NM_032457chr4----1149 --
NM_032486chr1682518 2398 2201 1956 1653 913 647 305 ----1158
NM_032501chr2051205 1136 979 183 21 --1321 --
NM_032509chr832267 1833 1669 ------
NM_032510chr1832037 532 222 ------
NM_032512chrX51035 802 56 49 30 1913 ----
NM_032514chr202440 277 --2318 52 --
NM_032523chr22493 167 ------
NM_032538chr6112604 2576 2394 2205 2100 2017 1048 508 374 313 186 --42403 1974 1847 1836 1180
NM_032552chr971520 1456 1376 468 391 83 43 --31411 678 364 --
NM_032560chr141375 ------
NM_032569chr1681470 1247 736 730 676 553 544 509 --2503 308 11280
NM_032575chr16191837 1726 1687 1629 1614 1492 1482 1412 1395 1277 824 761 753 656 620 553 451 414 259 --31699 1501 1429 11735
NM_032580chr171518 ------
NM_032581chr741420 1284 403 128 ------
NM_032582chr172752 119 --1663 --
NM_032590chr122242 35 ------
NM_032595chr1761177 619 613 462 369 176 ------
NM_032663chr1251475 613 393 173 134 --21542 1533 --
NM_032682chr352576 1197 1157 851 653 --31167 881 536 --
NM_032711chr17124172 4112 3531 3299 3261 3248 3153 1534 591 570 484 408 --22680 515 --
NM_032777chr841353 456 263 64 ------
NM_032778chr342965 2738 2333 1290 1353 ----
NM_032781chr115234 227 79 66 54 --1680 --
NM_032786chr125588 498 428 192 56 1458 ----
NM_032827chr251082 831 269 55 38 --1865 --
NM_032828chr1933646 1445 429 ----181
NM_032829chr1251068 958 920 345 193 ------
NM_032840chr1251149 1076 313 140 99 --1796 --
NM_032871chr1161298 737 711 224 138 32 31771 641 409 ----
NM_032873chr111636 --22959 31 --
NM_032875chr171555 ------
NM_032883chr202858 28 --180 --
NM_032884chr1154 ------
NM_032892chr151236 ------
NM_032961chr41175 ------
NM_032975chr1833088 2678 642 11331 21212 1077 --
NM_032978chr181791 ------
NM_032979chr181791 ------
NM_032980chr1833088 2678 642 11331 21212 1077 --
NM_032981chr181791 ------
NM_032995chr261058 685 514 401 308 22 --1575 --
NM_032999chr71743 --21082 1003 --
NM_033000chr71743 --21082 1003 --
NM_033001chr71743 --21082 1003 --
NM_033014chr91372 ------
NM_033016chr22172 ------
NM_033020chr134052 1399 869 ------
NM_033025chr196919 840 719 634 392 177 ------
NM_033036chr117687 666 416 367 352 265 30 ------
NM_033055chr11842 ------
NM_033083chr311378 --1127 13207
NM_033103chr19--156 128 --
NM_033118chr205810 762 669 270 137 ------
NM_033121chr122212 164 175 21747 1187 --
NM_033127chr1123 3622 553 462 ----
NM_033129chr2091815 1798 1617 1311 1294 821 288 268 53 --1491 1633
NM_033132chr131527 --1434 --
NM_033133chr1793330 3251 3146 2325 1352 1138 967 534 462 1706 ----
NM_033136chr541282 1218 231 121 11289 11652 --
NM_033137chr541282 1218 231 121 11289 11652 --
NM_033143chr474463 4370 3994 1560 1007 347 99 ------
NM_033158chr3150 ------
NM_033163chr10144 ------
NM_033181chr633545 3340 3128 --13153 --
NM_033201chr163461 210 78 --1273 --
NM_033222chr911365 ------
NM_033224chr757542 6137 1204 432 25 --25734 519 --
NM_033225chr832143 912 509 ------
NM_033246chr153274 112 94 ------
NM_033255chr13126 ------
NM_033290chrX53749 2695 2461 1038 303 12606 ----
NM_033309chr1661010 980 900 391 269 244 --1378 --
NM_033315chr1792069 2027 1978 1455 865 613 474 339 118 --1531 --
NM_033326chr1132071 1863 517 ------
NM_033331chr942920 2909 1166 345 ------
NM_033334chr91210 --160 --
NM_033360chr1234213 3341 1281 --22807 1128 13633
NM_033375chr1751373 1320 1299 1218 432 --11264 --
NM_033387chr9112523 2503 2434 1945 1873 978 911 456 444 160 150 2892 481 ----
NM_033389chr17104443 4226 4098 3402 1582 1429 958 804 611 486 --13380 --
NM_033425chr1112442 ----1281
NM_033429chr1562223 829 769 566 290 232 ------
NM_033449chr581934 1809 1776 1635 1486 793 683 548 --21702 396 --
NM_033480chr642717 1940 560 463 --12800 --
NM_033481chr642717 1940 560 463 --12800 --
NM_033503chr1593767 3339 3096 1409 742 729 699 271 209 --23348 189 --
NM_033512chr872423 1868 827 689 295 289 64 12674 ----
NM_033518chrX123 --1277 --
NM_033631chr183889 3652 2904 2779 2763 2696 1051 206 13512 ----
NM_033642chrX125 ------
NM_033644chr542099 1702 820 185 --11695 --
NM_033645chr542099 1702 820 185 --11695 --
NM_052818chr1321903 1658 ------
NM_052840chr1551547 1496 1429 1108 626 ------
NM_052845chr1282699 2646 1312 1284 1132 599 108 78 --32993 1038 442 --
NM_052854chr112588 124 ------
NM_052879chr121485 13297 ----
NM_052880chr223942 339 157 1189 11213 --
NM_052885chr1233839 912 445 11575 ----
NM_052896chr152539 1582 903 748 79 --22201 154 --
NM_052897chr122258 236 ------
NM_052899chr55782 336 97 64 45 ------
NM_052900chr8--11480 ----
NM_052905chr221283 380 --1500 --
NM_052906chr22254924 4872 4844 4655 4604 3750 3634 3547 3467 3312 3259 1927 1834 1695 1688 1524 1421 1299 1197 984 961 833 530 104 49 --14865 13995
NM_052911chr181981 ------
NM_052927chr531426 467 350 ------
NM_052934chr121962 1781 --2576 254 --
NM_052968chr112533 54 --1114 --
NM_052978chr142290 238 --11371 1280
NM_052996chr1641731 1482 99 52 ------
NM_053002chr32790 246 --1955 --
NM_053016chr937326 6904 6223 1471 27187 6265 --
NM_053023chr1172166 1292 1049 755 701 670 517 ------
NM_053024chr311407 ------
NM_053025chr32630 410 ------
NM_053026chr32630 410 ------
NM_053027chr32630 410 ------
NM_053028chr32630 410 ------
NM_053031chr32630 410 ------
NM_053032chr32630 410 ------
NM_053064chr1422142 1164 ----12499
NM_053067chr9150 ------
NM_053279chr882708 1848 923 404 357 206 171 133 --1804 --
NM_054013chr55909 849 766 737 233 --1779 1163
NM_054025chr1181422 860 577 528 412 352 226 46 ----1764
NM_054033chr21221 --1606 --
NM_054035chr174621 567 357 59 2782 612 ----
NM_057169chr1222794 665 12277 --13168
NM_057170chr1222794 665 12277 --13168
NM_057175chr411837 --1945 --
NM_057178chr1752162 849 711 551 299 ------
NM_057749chr8----1918 --
NM_058004chr221109 ------
NM_058170chr11208 ------
NM_058172chr4------11720
NM_058175chr215833 702 642 595 556 ----1240
NM_058240chr142584 33 --1147 --
NM_058241chr2------1643
NM_058241chr2------1643
NM_058243chr192143 116 --1307 --
NM_078474chr151460 ------
NM_078476chr641409 1184 219 184 --31531 683 465 --
NM_080415chr173908 632 32 --2602 64 --
NM_080422chr18196 ------
NM_080423chr18196 ------
NM_080491chr11163922 3443 3149 3002 2987 2883 2794 2516 2456 2442 866 829 562 346 208 50 ------
NM_080596chr6----136 --
NM_080599chr101985 --2216 31 --
NM_080604chr65597 586 521 490 163 1623 ----
NM_080607chr208857 810 747 687 371 282 227 137 --1756 --
NM_080654chr111174 ------
NM_080669chr17124027 3848 3828 3616 3443 1825 1582 1253 1179 1018 655 217 11107 1316 --
NM_080670chr53751 675 286 --173 --
NM_080672chr201354 ------
NM_080679chr65815 608 211 204 40 ------
NM_080680chr65815 608 211 204 40 ------
NM_080681chr65815 608 211 204 40 ------
NM_080717chr12--1333 ----
NM_080725chr2011494 1221 21675 158 --
NM_080730chr123593 237 173 1201 131 1628
NM_080731chr123593 237 173 1201 131 1628
NM_080737chrX124 11048 1422 --
NM_080738chr111260 --1344 1656
NM_080792chr2062249 1663 1575 695 165 140 --1115 11735
NM_080872chr823247 908 1209 ----
NM_080881chr56662 612 578 567 496 124 ----1628
NM_080927chr332917 348 47 --1672 --
NM_100264chr101623 ------
NM_100486chr101623 ------
NM_101395chr2142324 1364 1051 414 --1560 --
NM_130385chr1132557 2304 77 --32894 2702 2450 --
NM_130436chr212696 383 1837 1955 --
NM_130437chr2142283 1323 1010 373 --1519 --
NM_130438chr2142233 1273 960 323 --1469 --
NM_130439chr1042141 2120 1436 772 1405 ----
NM_130439chr1042141 2120 1436 772 1405 ----
NM_130440chr141157 1149 555 223 ------
NM_130466chr1271824 1236 758 645 540 464 73 11835 ----
NM_130468chr15189 --1674 --
NM_130766chr176943 863 808 352 153 82 ------
NM_130781chr51385 --1106 --
NM_130795chr97765 617 252 228 193 163 147 ------
NM_130797chr741258 677 311 32 ------
NM_130799chr115684 281 186 100 40 1260 ----
NM_130800chr115684 281 186 100 40 1260 ----
NM_130801chr115684 281 186 100 40 1260 ----
NM_130802chr115684 281 186 100 40 1260 ----
NM_130803chr115684 281 186 100 40 1260 ----
NM_130804chr115684 281 186 100 40 1260 ----
NM_130808chr31177 ------
NM_130811chr201388 1229 1404 --
NM_130846chr121929 ------
NM_130848chr571315 819 776 758 676 606 92 --11926 --
NM_133170chr20207436 7354 6709 6614 6415 5209 2820 2590 2534 1914 1800 1245 1000 631 559 368 247 207 154 135 --45802 5230 444 277 --
NM_133171chr203882 859 47 ------
NM_133172chr52220 74 1261 132 --
NM_133173chr52220 74 1261 132 --
NM_133174chr52220 74 1261 132 --
NM_133263chr5----149 --
NM_133265chrX22311 1319 --1801 --
NM_133266chr112337 103 --167 --
NM_133328chr196706 574 303 173 166 134 ------
NM_133369chr57375 327 262 228 147 112 77 1928 ----
NM_133378chr21755 ------
NM_133379chr2197 ------
NM_133432chr21755 ------
NM_133437chr21755 ------
NM_133468chr711563 1528 ----
NM_133476chr121390 --1101 --
NM_133486chrX183 ------
NM_133498chr191114 --194 --
NM_133499chrX41029 982 872 120 1247 ----
NM_133625chr341281 1262 1227 1177 2455 291 ----
NM_133633chr2251133 786 489 360 329 --1893 --
NM_133634chr2171444 681 668 559 496 485 134 11726 ----
NM_133635chr2171091 591 328 315 206 143 132 11373 ----
NM_133639chr152318 71 1264 ----
NM_133642chr22272 66 --1984 --
NM_133647chr1542833 2352 1299 44 ------
NM_134325chr151497 1316 628 514 487 --1111 --
NM_134427chr97765 617 252 228 193 163 147 ------
NM_138288chr1411918 --1198 --
NM_138300chr161307 1151 486 275 83 76 ------
NM_138338chr22213468 3375 3312 3234 3175 3115 3107 3064 2901 2784 2689 2508 2312 2189 2129 2105 1255 1150 1074 1003 993 --53217 1364 1289 1038 169 --
NM_138340chr181119 ------
NM_138370chr21663 ------
NM_138385chr451314 1170 1127 1033 245 1324 ----
NM_138391chr12391 228 ------
NM_138415chr2261199 727 587 527 186 156 178 1301 --
NM_138423chr1521827 937 ------
NM_138426chr7----11962 --
NM_138440chr162140 35 --1597 --
NM_138457chr6203373 3176 2922 2903 2841 2132 1360 1296 1230 883 732 675 621 432 407 391 335 304 126 58 ------
NM_138473chr1265133 4547 3713 3561 1932 1607 13992 ----
NM_138479chr131464 821 303 --21392 374 --
NM_138558chr11248 --41013 880 328 260 --
NM_138576chr1454189 3567 2999 720 117 14371 --13996
NM_138578chr2041371 1178 1113 133 1296 ----
NM_138633chr621783 1153 --1319 --
NM_138717chr65654 574 509 205 56 --1662 --
NM_138731chr1423606 356 11607 ----
NM_138735chr2------1627
NM_138768chr115893 808 652 566 112 ------
NM_138774chr191821 1582 ----
NM_138795chr171564 1434 1423 1120 647 433 120 --21456 1244 --
NM_138802chr23208 81 48 ----1232
NM_138927chr2121033 95 ------
NM_138961chr11174 ------
NM_138967chr1572509 2343 2060 1874 1604 907 563 22171 782 32219 1981 1540 11656
NM_138971chr1143032 2814 1011 991 11320 ----
NM_138971chr1143032 2814 1011 991 11320 ----
NM_138972chr1143032 2814 1011 991 11320 ----
NM_138972chr1143032 2814 1011 991 11320 ----
NM_138973chr1143032 2814 1011 991 11320 ----
NM_138973chr1143032 2814 1011 991 11320 ----
NM_138980chr4--1514 ----
NM_138981chr4--1645 ----
NM_138982chr4--1514 ----
NM_138991chr212771 627 --1657 1262
NM_138992chr214968 824 755 209 --1854 1459
NM_139012chr631928 709 453 --151 --
NM_139014chr632008 789 533 --1131 --
NM_139071chr1261653 1340 1220 447 413 50 11290 ----
NM_139072chr22640 614 ------
NM_139135chr11910 ------
NM_139168chr511332 --1360 --
NM_139169chr101182 ------
NM_139175chr7------152
NM_139181chr11178 125 ----
NM_139207chr1221462 893 ------
NM_139246chr93936 855 384 2923 593 21442 29 --
NM_139273chr111226 1182 ----
NM_139283chr124890 882 724 235 ------
NM_139321chr2073934 3747 3649 2806 2611 1084 235 ------
NM_144488chr97765 617 252 228 193 163 147 ------
NM_144489chr97765 617 252 228 193 163 147 ------
NM_144568chr143431 265 83 --1156 --
NM_144571chr425370 298 --1950 25241 4837
NM_144578chr1434951 4248 491 ------
NM_144579chr2162894 2860 2598 2467 2188 2035 1825 1068 1061 863 757 643 615 576 435 117 1236 22382 1969 --
NM_144580chr12286 228 ------
NM_144586chr21425 1509 ----
NM_144590chr1012762 22392 1909 ----
NM_144595chr131686 ------
NM_144599chr1544483 2108 331 170 --185 12156
NM_144636chr32690 673 --160 --
NM_144671chr12141856 1360 761 750 726 712 682 622 517 482 318 209 184 64 --3429 155 124 --
NM_144691chr192541 126 --167 --
NM_144712chr21177 --1309 --
NM_144767chr15103440 3234 1752 1535 1431 1380 973 847 472 188 1247 43547 1402 1180 139 --
NM_144963chr821998 1663 ------
NM_144967chrX1959 ------
NM_144973chr121958 --24683 1334 --
NM_144979chr41537 ------
NM_144982chr12----1223 --
NM_145005chr91834 ------
NM_145008chr113738 200 55 --1552 --
NM_145055chr1832362 1409 1377 --1461 --
NM_145058chr122101 30 ------
NM_145074chr24385 141 110 25 ------
NM_145113chr1411428 ------
NM_145117chr1142197 1120 1012 686 12618 ----
NM_145176chr623213 517 ----1203
NM_145185chr1981706 1626 1620 792 656 492 443 52 ------
NM_145204chr152486 33 ------
NM_145206chr1042848 2259 492 96 ------
NM_145234chrX----1697 --
NM_145239chr165190 171 131 91 56 ------
NM_145259chr246617 5679 1037 729 --11961 --
NM_145284chrX42519 2025 928 348 1999 ----
NM_145296chr197701 680 305 234 195 27 21 ------
NM_145307chr1034400 533 500 --11656 --
NM_145313chr1061322 1301 1226 516 207 86 11068 ----
NM_145320chr712645 12756 ----
NM_145321chr712645 12756 ----
NM_145322chr712645 12756 ----
NM_145349chr17101575 1565 1541 814 782 411 243 215 135 38 --2759 149 --
NM_145686chr21677 ------
NM_145687chr21677 ------
NM_145725chr141506 --178 --
NM_145726chr141506 --178 --
NM_145727chr6----4537 383 195 41 --
NM_145733chr2221197 1075 1248 ----
NM_145739chr22493 167 ------
NM_145798chr172662 128 --126 --
NM_145799chrX73061 2352 2323 1976 1217 338 40 --11071 --
NM_145800chrX140 ------
NM_145804chr1151035 937 444 226 51 --41057 1011 335 79 --
NM_145808chr7----12721 --
NM_145861chr111260 --1344 1656
NM_145891chr1621259 56 --11558 --
NM_145892chr1621259 56 --11558 --
NM_145893chr1621381 178 --11680 --
NM_146388chr1951134 1050 921 882 192 ------
NM_147150chr91388 11009 13104 --
NM_147157chr92764 50 --2786 321 --
NM_147161chr141074 1038 227 132 ------
NM_147192chr171305 1056 415 398 191 120 73 11094 1273 --
NM_147202chr962352 2330 2113 1743 1715 447 2932 668 --12541
NM_147223chr22595 145 --21791 393 --
NM_147233chr21412 --21608 210 --
NM_147686chr6147 --1124 --
NM_148174chr811648 --11867 --
NM_148894chr41899 ------
NM_148898chr71309 ------
NM_148899chr71309 ------
NM_148921chr1762169 1953 1934 1683 352 185 1585 31827 254 232 --
NM_152222chr1161298 737 711 224 138 32 31771 641 409 ----
NM_152233chr1411134 --11582 --
NM_152236chr22--157 ----
NM_152244chr1721150 933 ------
NM_152247chr223728 672 23 --3901 780 698 --
NM_152253chr22134114 4058 3946 3777 3409 3313 2902 1669 1188 1171 992 601 49 12686 74287 4166 4084 2968 2836 1723 1557 --
NM_152263chr145806 5345 287 62 ------
NM_152265chr111130 11093 ----
NM_152280chr153395 3247 2962 1411 1312 ------
NM_152283chr51170 ------
NM_152296chr192275 46 ------
NM_152300chr172679 648 ------
NM_152310chr10--1259 2229 33 --
NM_152341chr1681471 1356 1349 1269 1107 1055 937 392 --11086 --
NM_152344chr171110 ------
NM_152345chr1771056 1034 994 937 816 303 194 ------
NM_152346chr1771033 1009 975 908 804 175 136 1862 ----
NM_152380chr141175 480 272 42 ------
NM_152387chr22311 179 1374 ----
NM_152388chr243930 3282 896 713 ------
NM_152417chr8------188
NM_152424chrX93632 3351 3122 3055 3010 2962 1322 1265 753 --12879 --
NM_152437chr1232049 225 218 ------
NM_152440chr121417 1822 ----
NM_152442chr1241370 1061 458 26 ------
NM_152446chr142158 113 1812 1331 --
NM_152449chr1561339 1324 429 390 154 24 1167 11626 --
NM_152455chr15131 ------
NM_152470chr18133667 3145 2857 2606 1450 1298 1268 1262 968 900 329 275 44 12659 ----
NM_152529chr234353 4003 3544 ------
NM_152538chr321282 705 ------
NM_152545chr42262 63 ------
NM_152556chr752374 2311 903 719 34 ------
NM_152557chr751383 1304 1158 603 440 ------
NM_152607chr11147 ------
NM_152622chr513012 ------
NM_152629chr921261 112 --22966 1583 --
NM_152636chr11----22265 112 --
NM_152640chr12----135 --
NM_152716chr1131434 1252 511 ------
NM_152724chr1041983 1674 275 26 --1104 --
NM_152733chr6216318 6301 6147 6134 6049 5814 5622 5472 5398 5114 5052 4908 4887 4696 4614 2489 2045 1753 1713 380 320 12173 75962 5953 5867 5392 5241 4444 1968 --
NM_152739chr721096 186 1130 ----
NM_152753chr641769 487 453 350 1251 ----
NM_152756chr51516 --12936 --
NM_152758chr823041 1011 ------
NM_152769chr197887 876 728 636 232 79 31 --1107 --
NM_152774chr712012 --1875 --
NM_152787chrX42746 965 439 328 --13905 --
NM_152830chr17123 --1244 --
NM_152838chr203965 948 538 ----21423 1303
NM_152857chr621005 222 1682 ----
NM_152858chr621005 222 1682 ----
NM_152860chr1261454 1308 619 277 113 54 --1230 --
NM_152868chr221175 ------
NM_152890chr121147 451 ------
NM_152924chr1596303 5928 4593 4522 2428 2145 939 904 640 14248 12498 --
NM_152989chr1211182 --11473 --
NM_152994chr21148 ------
NM_153006chr171354 1294 2440 26 --
NM_153029chr16103917 3854 3501 3474 3417 3280 3024 1397 836 778 13610 ----
NM_153038chr22672 83 ------
NM_153042chr61469 ------
NM_153047chr61150 --126 --
NM_153048chr61150 --126 --
NM_153050chr22114978 4822 4579 4516 4285 1480 1218 1051 288 80 53 ------
NM_153051chr22114978 4822 4579 4516 4285 1480 1218 1051 288 80 53 ------
NM_153182chr342965 2738 2333 1290 1353 ----
NM_153183chrX31181 1066 222 ------
NM_153186chr92798 719 ------
NM_153188chr531503 507 40 --24364 1100 --
NM_153234chr52273 83 12443 2112 74 --
NM_153252chrX142 ------
NM_153260chr1521318 164 ------
NM_153262chr112709 ------
NM_153267chr91167 ------
NM_153273chr3132671 2163 2032 1999 1018 963 781 762 432 388 348 222 205 ------
NM_153321chr17----128 --
NM_153322chr17----128 --
NM_153334chr226694 595 589 489 212 193 --1147 --
NM_153362chr6--1346 ----
NM_153367chr10123890 3863 3458 3443 2695 1348 992 941 808 311 137 115 ------
NM_153450chr112770 335 --1662 --
NM_153453chr6155 ------
NM_153487chr6144603 4449 4289 3801 3734 3260 3145 1895 1849 1791 1712 1276 1179 967 13104 34502 352 182 --
NM_153499chr1272734 2657 2637 2023 2003 621 33 ------
NM_153500chr1272734 2657 2637 2023 2003 621 33 ------
NM_153607chr5--1835 ----
NM_153619chr1531242 771 402 ------
NM_153620chr711643 1629 ----
NM_153634chr12--11202 ----
NM_153649chr121806 448 ------
NM_153693chr12----2268 250 --
NM_153715chr72498 390 --168 --
NM_153718chr197995 984 919 897 182 29 21 ------
NM_153719chr197995 984 919 897 182 29 21 ------
NM_153756chr191942 1886 1435 1325 767 612 488 285 104 --11959 --
NM_153757chr4188 ------
NM_153827chr171732 ------
NM_153832chr14632 588 225 80 ------
NM_170606chr71400 1461 1480 --
NM_170610chr6----138 --
NM_170662chr31500 ------
NM_170663chr171732 ------
NM_170665chr1254349 4282 2912 1568 971 --24113 2799 --
NM_170674chr15--182 ----
NM_170677chr15--182 ----
NM_170679chr511248 ------
NM_170696chr1531221 101 67 --1393 --
NM_170697chr1531221 101 67 --1393 --
NM_170706chr194107 3342 3129 1649 429 423 384 345 306 ------
NM_170712chr32258 191 1221 1108 --
NM_170713chr32258 191 1221 1108 --
NM_170714chr32258 191 1221 1108 --
NM_170720chr1941234 1044 112 70 ------
NM_170731chr1142697 2643 2470 780 ------
NM_170732chr1142697 2643 2470 780 ------
NM_170733chr1142697 2643 2470 780 ------
NM_170734chr1142697 2643 2470 780 ------
NM_170735chr1142697 2643 2470 780 ------
NM_170739chr111277 ------
NM_170750chrX1587 ------
NM_170769chr64765 285 216 41 --1304 --
NM_170774chr2033545 2886 1650 ------
NM_170782chr11413 ------
NM_171998chrX31671 958 285 ------
NM_172016chr6--1910 ----
NM_172057chr71274 1282 288 74 --
NM_172058chr82605 62 11811 ----
NM_172059chr82605 62 11811 ----
NM_172060chr82605 62 11811 ----
NM_172070chr232084 1420 718 --12283 --
NM_172071chr127365 6406 12817 ----
NM_172103chr632479 2076 1761 181 ----
NM_172105chr632479 2076 1761 181 ----
NM_172127chr4------1161
NM_172128chr4------1117
NM_172169chr1061609 1409 369 334 63 41 21648 792 ----
NM_172170chr1061609 1409 369 334 63 41 21648 792 ----
NM_172171chr1061609 1409 369 334 63 41 21648 792 ----
NM_172173chr1061609 1409 369 334 63 41 21648 792 ----
NM_172206chr1731731 411 59 --1613 --
NM_172225chr171305 1056 415 398 191 120 73 11094 1273 --
NM_172226chr1272734 2657 2637 2023 2003 621 33 ------
NM_172315chr15--182 ----
NM_172316chr15--182 ----
NM_172337chr14--1157 ----
NM_172375chr142895 818 ------
NM_173054chr71925 ------
NM_173074chr2184 ------
NM_173078chrX1375 ------
NM_173082chr631402 1341 146 ------
NM_173156chr13644 217 31 --2667 657 --
NM_173163chr162489 69 1118 1400 --
NM_173165chr161370 --1152 --
NM_173191chr1021320 1044 ----1511
NM_173192chr1021320 1044 ----1511
NM_173193chr1021320 1044 ----1511
NM_173194chr1021320 1044 ----1511
NM_173195chr1021320 1044 ----1511
NM_173198chr932592 2079 153 ------
NM_173199chr91485 ------
NM_173200chr932592 2079 153 ------
NM_173201chr162290 266 ------
NM_173359chr321953 761 ------
NM_173454chr152820 82 ------
NM_173468chr432254 1229 395 ------
NM_173469chr151212 --1442 --
NM_173470chrX3674 501 138 --12635 --
NM_173475chr1631672 1559 1238 1141 ----
NM_173476chr16162020 1839 1771 1659 1618 1585 1551 1508 878 834 593 441 370 312 255 42 ------
NM_173477chr1761953 1622 1583 601 376 286 --31913 234 71 --
NM_173491chr531369 135 109 --1174 --
NM_173507chr1185 ------
NM_173511chr221180 162 ------
NM_173536chr434342 3143 1042 --1144 --
NM_173543chr34646 222 178 57 ------
NM_173546chr32147 94 --1265 --
NM_173570chr31362 --42152 495 306 231 --
NM_173584chr113261 124 76 --151 --
NM_173595chr12115235 5200 4614 4123 3721 3578 2085 1977 1362 826 643 --24144 210 --
NM_173602chr1233268 2816 2507 --23509 2301 13277
NM_173642chr1178593 8143 8054 6695 6610 6310 6146 3584 3437 3054 2459 2406 2262 2206 1401 643 334 17025 13099 --
NM_173653chr331169 1162 334 --1343 11283
NM_173664chr541448 1310 515 330 ------
NM_173683chr811524 ----11608
NM_173809chr1031487 1286 930 11114 ----
NM_173822chr212135 --11475 --
NM_173828chr55353 335 310 286 269 --1342 --
NM_173832chr8133286 2836 2577 2443 1082 872 852 801 596 460 372 244 27 ------
NM_173851chr822684 1595 --11294 --
NM_174909chr5----1668 --
NM_174911chr85718 706 570 122 102 13356 ----
NM_174934chr1183487 3065 2889 1096 725 501 461 332 --13478 --
NM_174937chr10--1625 ----
NM_174963chr17869 773 246 225 201 106 29 --1124 --
NM_174964chr17869 773 246 225 201 106 29 --1124 --
NM_174965chr19888 792 586 265 244 220 125 48 27 --1143 --
NM_174966chr17869 773 246 225 201 106 29 --1124 --
NM_174967chr19888 792 586 265 244 220 125 48 27 --1143 --
NM_174968chr17869 773 246 225 201 106 29 --1124 --
NM_174969chr17869 773 246 225 201 106 29 --1124 --
NM_174970chr19888 792 586 265 244 220 125 48 27 --1143 --
NM_174971chr17869 773 246 225 201 106 29 --1124 --
NM_175061chr721757 1681 ------
NM_175566chr111364 ------
NM_175610chr151383 ------
NM_175624chr1246551 5808 2829 522 --12585 --
NM_175625chr1246551 5808 2829 522 --12585 --
NM_175630chr23769 572 30 1332 ----
NM_175709chr2242465 742 338 185 ------
NM_175733chr112667 143 --11553 --
NM_175736chr12175832 5822 5638 5345 5175 4810 4742 3019 2860 1799 1067 887 795 570 533 381 177 26739 1044 32175 1208 470 --
NM_175768chr61121 --146 --
NM_175847chr1951292 1149 543 230 26 --1198 --
NM_175852chr1112811 2752 2567 2539 2209 2058 1923 484 365 68 52 --32365 464 185 --
NM_175854chr132952 821 ------
NM_175859chrX31390 517 44 11464 ----
NM_175884chr71267 --151 --
NM_175898chr1571243 606 526 451 428 357 210 ------
NM_175900chr1651394 1109 657 377 115 --2491 38 --
NM_175907chr182833 486 ----1872
NM_175920chr5158 ------
NM_175931chr1652059 2008 1574 324 61 ------
NM_176792chr106951 878 514 366 281 196 --11259 --
NM_176823chr153469 3050 1090 536 314 13819 1241 --
NM_176863chr172785 184 --1574 --
NM_177398chr141485 1406 1385 30 ------
NM_177399chr141485 1406 1385 30 ------
NM_177414chr131212 338 153 --1691 1569
NM_177441chr175864 739 297 247 76 1796 1802 --
NM_177524chr7----189 --
NM_177525chr7----189 --
NM_177539chr13892 711 110 --1133 --
NM_177925chr1252933 2648 2401 576 398 --145 --
NM_177968chr2--1260 ----
NM_177969chr2----1147 --
NM_177972chr11144201 3983 3740 3709 3631 3566 3495 3431 1302 763 747 545 507 119 --23790 96 11500
NM_177974chr1521827 937 ------
NM_177977chr1771959 1832 1763 1564 1524 1439 779 153 3481 447 308 --
NM_177983chr22329 151 ------
NM_177989chr3--1154 ----
NM_177990chr20189 ------
NM_177996chr2041368 776 479 66 11195 ----
NM_177999chr9113584 3281 3006 2970 2572 2545 2362 1074 1051 991 920 21460 454 31470 379 219 --
NM_178010chr1211182 --11473 --
NM_178026chr203510 391 173 ------
NM_178037chr1232892 961 664 ------
NM_178038chr1232892 961 664 ------
NM_178042chr3--1154 ----
NM_178120chr251045 494 149 59 42 --1427 --
NM_178126chr172343 144 --12147 --
NM_178151chrX107817 7593 7046 6586 5808 3157 3143 2127 996 526 15757 ----
NM_178152chrX107817 7593 7046 6586 5808 3157 3143 2127 996 526 15757 ----
NM_178153chrX107817 7593 7046 6586 5808 3157 3143 2127 996 526 15757 ----
NM_178426chr111583 --1575 --
NM_178427chr111483 --1475 --
NM_178439chr2--1102 --1145
NM_178441chr1461162 1085 532 485 413 164 --175 --
NM_178470chrX178 ------
NM_178496chr311333 --1156 --
NM_178539chr1211546 1413 ----
NM_178554chr392279 1346 1257 1238 1035 890 848 221 120 --2934 867 --
NM_178568chr17111684 1581 1540 1432 1368 1196 599 484 424 377 340 11469 ----
NM_178585chr432093 2077 814 --1443 --
NM_178586chr142504 30 --1843 --
NM_178812chr8--11492 ----
NM_178818chr16102290 1763 1746 1737 1684 1628 1587 742 537 22 --1566 --
NM_178830chr194535 256 136 64 1125 ----
NM_178832chr1011534 --1120 --
NM_178835chr43656 599 283 --1584 --
NM_178860chr174863 223 211 71 --1796 --
NM_178863chr164335 149 108 87 ------
NM_178864chr111485 --1130 --
NM_181077chr1531882 346 185 ------
NM_181093chr11198 ------
NM_181332chrX31891 443 321 --12233 --
NM_181336chr661315 1019 980 896 307 78 11045 ----
NM_181349chr7103096 2633 2611 2500 2327 2267 2113 648 434 315 --22753 92 --
NM_181351chr1132897 2369 2137 --22157 2057 --
NM_181458chr221105 33 ------
NM_181459chr21871 ------
NM_181460chr21918 ------
NM_181486chr12--1333 ----
NM_181491chr9153115 2991 2594 2265 2235 2139 1276 1193 1106 706 602 526 409 189 181 --2771 287 --
NM_181492chr223919 913 844 11190 ----
NM_181504chr523014 49 --1324 --
NM_181509chr202440 277 --2318 52 --
NM_181521chr16167071 6544 6527 6518 6465 6409 6368 5523 5318 4803 2266 1884 1862 487 236 184 24611 2506 15347 --
NM_181523chr523014 49 --1324 --
NM_181524chr523014 49 --1324 --
NM_181528chr20140 ------
NM_181575chr21112 ------
NM_181670chr121120 ------
NM_181671chr171879 ------
NM_181712chr111764 --12018 --
NM_181762chrX1403 ------
NM_181777chrX1403 ------
NM_181809chr1163675 3646 3557 3398 3315 3300 2636 2485 1619 1404 1144 689 384 148 109 51 12742 12894 --
NM_181828chr2293752 3673 3382 3245 1192 1167 1132 1098 44 --13450 --
NM_181829chr2293752 3673 3382 3245 1192 1167 1132 1098 44 --13450 --
NM_181830chr2293752 3673 3382 3245 1192 1167 1132 1098 44 --13450 --
NM_181832chr2293767 3688 3397 3260 1207 1182 1147 1113 59 --13465 --
NM_181836chr5------22575 672
NM_181861chr1232379 870 563 ------
NM_181868chr1232379 870 563 ------
NM_181869chr1232464 955 648 ------
NM_181874chr31355 1154 126 --
NM_181882chr191131 ------
NM_181897chr352457 927 829 617 178 ------
NM_182314chrX11696 ----1180
NM_182481chr211457 ------
NM_182482chr211457 ------
NM_182503chr655311 5289 4563 4413 525 24167 4152 24512 1105 14541
NM_182526chr14122998 2978 2903 2471 2067 1196 724 609 600 580 370 268 12241 42266 2055 988 319 --
NM_182551chr22452 307 13523 22292 664 --
NM_182553chr113422 378 82 --1474 --
NM_182557chr1131915 1803 1773 --11595 --
NM_182565chr173677 503 183 --2631 486 --
NM_182580chr152136 2107 1861 1679 419 --2660 429 --
NM_182607chrX11691 ------
NM_182641chr1721609 670 ------
NM_182643chr842119 825 712 613 ------
NM_182645chr6155 ------
NM_182664chr152230 788 782 776 138 ----1103
NM_182685chr11679 124 ----
NM_182700chr761772 567 478 282 212 58 ------
NM_182705chr1742492 2200 895 33 1994 32520 2399 756 --
NM_182728chr1451356 406 358 216 66 --11286 --
NM_182757chr622227 892 --13339 --
NM_182758chr1533819 2828 2452 ----11111
NM_182760chr32331 288 --1306 --
NM_182763chr132328 1083 615 ------
NM_182764chr203882 859 47 ------
NM_182767chr1212049 159 ----
NM_182776chr7129 ------
NM_182779chr15728 626 333 294 49 ------
NM_182796chr51734 ------
NM_182811chr2031066 254 95 ------
NM_182830chr14----1512 --
NM_182847chr24541 499 237 84 1477 1172 --
NM_182848chr13----21506 76 --
NM_182895chr226694 595 589 489 212 193 --1147 --
NM_182898chr726133 634 25167 1081 14793 --
NM_182899chr726133 634 25167 1081 14793 --
NM_182911chr21204 ------
NM_182918chr2121271 1048 ------
NM_182925chr55553 173 166 70 42 ------
NM_182936chr142584 33 --1147 --
NM_182964chr1142197 1120 1012 686 12618 ----
NM_182970chr20154246 4147 3928 3868 3611 3511 3448 3295 2985 2714 1150 503 150 101 70 1626 34221 3916 3583 --
NM_182972chr122255 2244 ------
NM_182975chr111171 ------
NM_183002chr142584 33 --1147 --
NM_183004chr1422723 321 12499 2440 421 13472
NM_183234chr1521726 358 ------
NM_183235chr1521726 358 ------
NM_183236chr1521726 358 ------
NM_183237chr32284 191 ------
NM_183243chr72509 491 --3256 248 144 --
NM_183243chr72509 491 --3256 248 144 --
NM_183244chr201354 ------
NM_183246chr201354 ------
NM_183376chr1522383 514 --1878 1566
NM_183380chr6--1127 124 --
NM_183381chr31979 ------
NM_183383chr31979 ------
NM_183384chr31979 ------
NM_183397chr20105034 4939 4124 3175 1654 1392 527 498 312 96 ------
NM_183415chr1271824 1236 758 645 540 464 73 11835 ----
NM_183419chr821351 1077 ------
NM_194071chr7114875 4302 3852 3498 3363 2077 1828 1716 1008 570 364 --25202 848 14009
NM_194271chr12--1576 ----
NM_194272chr152289 268 --1438 --
NM_194277chrX----1308 --
NM_194278chr14131630 1460 1348 1337 1301 1261 1234 1117 1019 918 611 498 247 --2629 424 --
NM_194282chr412792 --11238 --
NM_194285chr1122497 2178 12649 1862 --
NM_194286chr12135820 5726 3925 2425 2321 1718 941 784 535 379 219 208 31 2964 565 1515 12337
NM_194291chr812626 ------
NM_194301chr142929 734 --173 --
NM_194313chr991622 1590 1212 734 187 162 116 55 32 --183 21752 630
NM_194314chr135675 4148 3469 ------
NM_194317chr232552 2375 2040 11727 1331 --
NM_194328chr932999 2795 2653 1755 ----
NM_194329chr932999 2795 2653 1755 ----
NM_194330chr932999 2795 2653 1755 ----
NM_194332chr932999 2795 2653 1755 ----
NM_197939chr172898 817 --2223 127 --
NM_197955chr151137 ------
NM_197956chr931805 79 67 186 21626 579 --
NM_198040chr18937 431 387 375 171 161 111 79 ------
NM_198043chr101405 ------
NM_198044chr101405 ------
NM_198045chr101405 ------
NM_198046chr101405 ------
NM_198053chr15825 631 228 222 216 ------
NM_198056chr361595 724 628 246 199 93 1821 1651 --
NM_198066chr1422955 2349 --1735 --
NM_198074chr12457 414 --1497 --
NM_198081chr621913 192 1279 12456 --
NM_198123chr8--11480 ----
NM_198124chr8--11480 ----
NM_198186chr91592 ------
NM_198187chr91592 ------
NM_198188chr92331 65 ------
NM_198213chr121627 --1519 --
NM_198215chr10----1531 --
NM_198225chr1021977 1624 ------
NM_198243chr151249 ------
NM_198279chrX2929 511 1420 ----
NM_198281chr422326 1294 --11239 --
NM_198291chr2081955 1921 1904 1408 1398 1392 439 97 --51825 1666 1338 556 133 --
NM_198324chr123470 233 79 ------
NM_198399chr3----191 --
NM_198404chr131817 ------
NM_198440chr22132499 2480 2436 2150 2120 2026 595 569 538 301 289 212 87 11622 ----
NM_198513chr821717 229 ------
NM_198549chr133096 2886 2481 ------
NM_198560chr3173770 3649 3558 3428 3372 3106 3069 2935 2913 2859 2532 897 819 639 614 349 300 --42926 675 261 187 --
NM_198568chr62859 167 ------
NM_198581chr257020 6274 6144 2482 1638 16680 ----
NM_198686chr14102456 1692 664 384 302 290 192 112 43 21 --22475 1621 12343
NM_198715chr126000 1657 1997 14685 --
NM_198793chr363351 2933 2642 1675 595 76 --1653 1308
NM_198850chr19273 39 --1216 --
NM_198859chr365068 4290 4165 3814 3474 1112 --15055 --
NM_198880chr33625 213 73 ----1612
NM_198889chr4------1453
NM_198896chr112742 649 ------
NM_198900chr12175832 5822 5638 5345 5175 4810 4742 3019 2860 1799 1067 887 795 570 533 381 177 26739 1044 32175 1208 470 --
NM_198956chr761772 567 478 282 212 58 ------
NM_198963chr22418 103 ------
NM_198968chr1343289 2720 1203 675 12907 ----
NM_198993chr1781711 1668 1637 1570 652 494 261 76 --31237 537 477 --
NM_199000chr712263 ------
NM_199078chr292297 1966 674 497 285 235 187 138 122 ------
NM_199141chr196857 760 707 652 333 192 --1754 --
NM_199144chr201639 --124 --
NM_199160chr991764 1717 1704 557 535 325 290 100 94 ------
NM_199168chr103603 525 493 197 11173 --
NM_199169chr2043559 1032 469 114 --22839 758 --
NM_199170chr2043559 1032 469 114 --22839 758 --
NM_199171chr2043559 1032 469 114 --22839 758 --
NM_199188chr121485 13297 ----
NM_199190chr121485 13297 ----
NM_199203chr201639 --124 --
NM_199245chr1272276 2257 2207 1876 1611 906 894 --134 --
NM_199324chr413102 --1553 --
NM_199330chr152186 21 ------
NM_199331chr152186 21 ------
NM_199332chr152186 21 ------
NM_199334chr171160 ------
NM_199351chr1181 --2544 440 --
NM_199413chr151685 1189 ----
NM_199424chr1651632 1350 510 109 93 --21186 167 --
NM_199436chr211239 --1207 --
NM_199478chrX2409 105 1705 --2287 41
NM_201269chr1----1353 --
NM_201280chr61662 ------
NM_201432chr17176135 6051 5928 5759 4954 4793 4718 4497 4017 2253 1048 761 408 292 184 64 28 --31743 978 350 --
NM_201433chr17176135 6051 5928 5759 4954 4793 4718 4497 4017 2253 1048 761 408 292 184 64 28 --31743 978 350 --
NM_201434chr172636 503 ------
NM_201521chr63380 268 78 ------
NM_201522chr63380 268 78 ------
NM_201523chr63380 268 78 ------
NM_201542chr1174 ------
NM_201567chr321694 703 1301 ----
NM_201568chr13644 217 31 --2667 657 --
NM_201569chr13644 217 31 --2667 657 --
NM_201575chr161151 1385 1446 --
NM_201591chr4----1539 --
NM_201592chr4----1539 --
NM_201630chr12154 117 ------
NM_201999chr43911 820 814 ------
NM_203290chr6------1183
NM_203301chr14--150 ----
NM_203304chr191268 ------
NM_203329chr1196453 5437 5266 5025 4552 2507 2300 1012 153 11901 46434 6194 2281 2040 --
NM_203330chr1196453 5437 5266 5025 4552 2507 2300 1012 153 11901 46434 6194 2281 2040 --
NM_203331chr1196453 5437 5266 5025 4552 2507 2300 1012 153 11901 46434 6194 2281 2040 --
NM_203342chr183594 3493 3141 2804 2760 2404 981 733 --12352 --
NM_203343chr183594 3493 3141 2804 2760 2404 981 733 --12352 --
NM_203346chr262254 2072 840 299 177 128 22211 792 11722 --
NM_203351chr17102196 1796 1773 1754 852 790 658 543 509 287 11709 ----
NM_203364chr11135 ----1262
NM_203394chr12196 12324 ----
NM_203406chr51506 --22126 1163 --
NM_203446chr211103 ------
NM_203504chr4----1299 --
NM_203505chr4----1299 --
NM_203506chr1741973 1967 1910 1768 ------
NM_205768chr111761 ------
NM_205836chr5----1102 1484
NM_205853chr31150 --1135 --
NM_205860chr122512 505 ------
NM_205861chr14802 716 533 182 1423 1777 --
NM_206819chr122220 38 ------
NM_206820chr122220 38 ------
NM_206821chr122220 38 ------
NM_206853chr624032 542 ------
NM_206854chr635293 1803 643 ------
NM_206855chr636258 1608 278 ------
NM_206876chr21781 ------
NM_206907chr512209 --1322 --
NM_206909chr867547 7077 7046 5844 2353 775 25982 5496 ----
NM_206914chr1241510 882 205 68 ------
NM_206925chr1552358 1869 1785 126 65 --12390 --
NM_206944chr9129 ------
NM_206945chr9129 ------
NM_206946chr9129 ------
NM_206947chr9129 ------
NM_207005chr15584 572 528 233 27 --1144 --
NM_207012chr1032668 1327 558 ------
NM_207042chr1160 ------
NM_207043chr13905 583 224 1164 ----
NM_207044chr13905 583 224 1164 ----
NM_207045chr1160 ------
NM_207046chr1160 ------
NM_207047chr13905 583 224 1164 ----
NM_207119chr1082164 1849 1549 525 514 175 72 47 --32222 2209 421 --
NM_207303chr1024201 72 --23786 1396 --
NM_207343chr111393 ------
NM_207397chr13786 686 343 ------
NM_207406chr466383 5983 5126 1834 1792 34 11951 ----
NM_207429chr1151807 681 370 297 147 12332 ----
NM_207481chr231286 902 181 ------
NM_207577chr113985 196 122 1528 ----
NM_207647chr942070 332 119 46 ------
NM_212551chr1176 1304 1254 --
NM_213606chr10----2767 364 --
NM_213662chr1722258 1705 12169 12266 --