TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4513
miRNA Sequence: AGACUGACGGCUGGAGGCCCAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000267chr1743196 3150 2890 2466 22624 742 1415 --
NM_000448chr1153061 2591 1046 746 633 1225 ----
NM_000489chrX73282 2875 2431 2355 2138 700 186 1726 ----
NM_000555chrX95938 5572 5552 5374 5029 2195 1393 1172 920 ------
NM_000618chr1286189 2468 2323 2117 1499 1490 1274 286 26622 2446 1480 --
NM_000618chr1286189 2468 2323 2117 1499 1490 1274 286 26622 2446 1480 --
NM_000813chr535112 4496 1480 ----1338
NM_001001323chr1252445 1283 1255 815 601 --12985 --
NM_001003674chr18107015 5405 4954 2436 2171 1871 1568 1183 1165 87 15872 14833 --
NM_001003675chr18107015 5405 4954 2436 2171 1871 1568 1183 1165 87 15872 14833 --
NM_001003712chr1263745 3503 2717 2659 1286 1212 --13843 --
NM_001005474chr341557 1219 1061 430 1465 --144
NM_001009899chr355744 4974 1017 797 117 1125 15145 --
NM_001009959chr221603 170 12012 1270 1627
NM_001010853chr633216 2988 333 12387 --12849
NM_001010888chrX54307 4174 3078 3072 195 23926 1718 ----
NM_001011537chr342169 1774 623 444 ----11644
NM_001011666chr756150 5917 2048 309 105 --14141 --
NM_001014380chr1365199 4258 2150 1820 1409 1317 15154 ----
NM_001018067chr155206 4791 4367 3579 1763 11598 1199 --
NM_001018068chr155206 4791 4367 3579 1763 11598 1199 --
NM_001018069chr155206 4791 4367 3579 1763 11598 1199 --
NM_001024956chr1175651 5097 4377 1728 1658 1328 1132 24269 3923 ----
NM_001030055chr1454374 4272 4123 1240 447 14254 23605 1774 --
NM_001031732chr453635 3492 2516 1073 548 12671 12909 --
NM_001033025chr131159 545 243 1466 1381 11473
NM_001039590chrX53716 3419 1289 815 675 21611 1125 ----
NM_001039591chrX53716 3419 1289 815 675 21611 1125 ----
NM_001040440chr52443 23 1101 --1482
NM_001040458chr541788 550 351 156 ----11257
NM_001040653chr342634 847 742 50 2959 797 1962 12135
NM_001040712chr953620 3566 1291 779 748 1976 1983 21200 980
NM_001042355chr1654004 3963 1140 544 338 ----11973
NM_001042412chr1654004 3963 1140 544 338 ----11973
NM_001042492chr1743196 3150 2890 2466 22624 742 1415 --
NM_001042599chr277694 6953 4820 3057 2948 2142 1329 ----13087
NM_001042604chr384013 3737 3724 3447 2971 1547 986 900 2818 366 --13370
NM_001042749chrX42023 1467 1375 252 11475 11364 --
NM_001042750chrX42023 1467 1375 252 11475 11364 --
NM_001042751chrX42023 1467 1375 252 11475 11364 --
NM_001106chr3118862 8539 8130 8051 6618 6016 2263 1699 1504 1266 195 11895 --18081
NM_001173chr1454374 4272 4123 1240 447 14254 23605 1774 --
NM_001186chr2152554 2018 1218 1201 723 22937 2872 ----
NM_001204chr297181 6221 5376 5296 3107 2026 1956 339 221 27482 5162 1627 --
NM_001419chr1984814 4716 4389 3340 3216 964 525 69 ------
NM_001439chr131159 545 243 1466 1381 11473
NM_001682chr1252159 997 969 529 315 --12699 --
NM_001701chr91561 ----21188 532
NM_001830chrX63502 3490 2585 1352 1263 616 22490 1252 11033 --
NM_002025chrX68865 8249 7173 6746 3504 2548 27404 204 ----
NM_002126chr1764084 1145 1076 561 468 435 ------
NM_002158chr223699 1372 23005 2777 --12345
NM_002210chr263532 2347 1288 1201 961 842 32550 1431 317 ----
NM_002270chr584579 4099 3893 2202 1319 1214 297 46 13754 ----
NM_002336chr1213276 34562 4280 458 --11750
NM_002655chr844502 4036 3265 831 23393 188 21554 907 --
NM_002656chr6--1938 --2741 66
NM_002839chr953620 3566 1291 779 748 1976 1983 21200 980
NM_003262chr364195 4085 1965 1877 896 147 11280 23727 1329 --
NM_003298chr366103 4573 2053 1864 1858 681 24629 3840 ----
NM_003342chr1773165 2971 2830 2387 971 861 417 ------
NM_003392chr364191 3761 3318 3307 2882 884 ------
NM_003566chr1232468 2413 527 --1817 22357 2353
NM_003822chr12911 900 12180 13128 13076
NM_003983chr1643952 2878 2870 514 ----23374 3012
NM_004124chr1473512 3434 2336 2330 1022 821 646 21329 570 ----
NM_004171chr1176187 5995 3430 3424 1175 260 157 1962 18544 17884
NM_004338chr18107015 5405 4954 2436 2171 1871 1568 1183 1165 87 15872 14833 --
NM_004586chrX43694 1361 1263 363 --1812 11811
NM_004726chrX75381 4759 4358 2242 1505 730 290 --24752 2295 14538
NM_004745chr865004 4860 2612 2145 1249 1060 ----12715
NM_004859chr1792840 2653 2308 2240 1935 1885 858 475 67 ------
NM_004904chr756150 5917 2048 309 105 --14141 --
NM_004992chrX48277 6855 1965 1059 22771 2219 36118 3118 2745 --
NM_004992chrX48277 6855 1965 1059 22771 2219 36118 3118 2745 --
NM_005065chr1445370 5072 4686 1419 13478 --11680
NM_005156chr965309 4966 3316 2149 1421 1367 24231 3602 ----
NM_005188chr11108293 7874 7282 6587 5953 3194 2077 1746 1134 231 21589 1548 45468 2406 1551 956 --
NM_005235chr277694 6953 4820 3057 2948 2142 1329 ----13087
NM_005504chr1265105 4923 4331 4082 1669 908 15919 ----
NM_005739chr1541915 1600 1541 517 32047 1972 183 ----
NM_005843chr241679 1257 183 50 2755 239 1758 --
NM_005909chr564299 3288 837 696 546 165 33600 2684 1158 24119 578 --
NM_005941chr843751 1497 242 217 13205 23461 1058 12729
NM_006047chr2032464 1324 344 --21084 800 1797
NM_006186chr22303 291 ----11101
NM_006203chr554712 2198 1754 1033 143 11027 24055 1091 --
NM_006252chr177377 6538 6249 5221 2382 2051 1549 145 ----
NM_006420chr2043265 2268 2112 947 ----1492
NM_006544chr1445187 4955 1474 437 --2963 32 --
NM_006559chr121239 340 2859 29 --11020
NM_006599chr16108144 6541 5757 5483 2656 2373 2251 2237 666 514 46562 5507 408 333 ----
NM_006603chrX42023 1467 1375 252 11475 11364 --
NM_006718chr6--1938 --2741 66
NM_006750chr1658127 6075 3227 2800 873 1889 27362 1740 --
NM_006873chr243354 2994 2313 1200 ----13051
NM_006918chr1175651 5097 4377 1728 1658 1328 1132 24269 3923 ----
NM_007054chr553885 3586 3075 1578 160 1779 ----
NM_007249chr1387217 6955 3705 3029 2388 2272 1507 946 38534 7521 2873 25889 1285 --
NM_012081chr553750 3699 2493 2279 279 --13075 12713
NM_012234chr363123 3031 2455 1159 631 461 --13550 --
NM_012330chr101472 21168 418 --21172 640
NM_014005chr542208 778 573 238 ----22066 176
NM_014021chr133156 2975 1116 ----184
NM_014155chr1132872 1068 293 25808 2004 --14941
NM_014319chr1231577 1372 204 1219 11312 --
NM_014331chr466834 1211 971 787 745 577 ----21831 120
NM_014423chr575348 5160 4611 3424 1830 1611 581 11685 1167 --
NM_014445chr332008 1566 321 42288 1669 715 269 --1759
NM_014585chr21223 1321 21084 367 1307
NM_014616chr353440 3088 2878 2142 288 11101 12571 --
NM_014636chr944278 4080 3555 2741 22770 1229 21555 187 --
NM_014906chr1734042 1264 334 2345 311 12910 --
NM_014942chr632583 1795 248 32248 726 714 1619 --
NM_014951chr1051914 1694 934 614 587 1577 12574 --
NM_015020chr1653563 3440 2727 581 140 23658 2464 --13662
NM_015071chr576370 4312 2443 2264 1931 1750 1274 15597 12141 15630
NM_015074chr174974 4357 3781 1863 1205 930 211 13426 --13239
NM_015090chr176073 5770 5456 5263 5104 4413 1871 15698 43888 2222 1671 632 --
NM_015092chr1664701 4385 3478 1292 730 93 11286 13664 --
NM_015247chr1654004 3963 1140 544 338 ----11973
NM_015271chr444237 3065 2906 1582 31736 1511 1359 --1824
NM_015310chr897806 7520 6996 5181 1259 1191 808 308 147 --16219 --
NM_015458chr864277 3336 3261 2032 1599 73 13274 ----
NM_015640chr155206 4791 4367 3579 1763 11598 1199 --
NM_015886chr8145667 5365 5335 4946 4818 4035 3991 2177 1655 1556 1430 1258 699 680 13861 ----
NM_016083chr653746 2905 1198 863 145 13808 --11449
NM_016271chr1842131 861 808 688 31697 1560 115 ----
NM_016591chr5295 49 1248 --1252
NM_017637chr9127031 6542 6423 5907 5836 3678 2829 2788 1969 1777 944 69 59482 7175 6221 3399 1033 26224 1359 --
NM_017650chr746029 5526 1727 518 11027 --24883 1089
NM_017658chr1474480 3755 3113 1696 1498 1060 771 --11461 --
NM_017741chr432536 2499 446 194 --21827 64
NM_018084chr232856 609 56 ----13207
NM_018225chr975107 5074 5026 4864 4561 3510 2101 2968 119 33944 3742 3602 --
NM_018263chr252584 2549 904 538 107 1847 --12205
NM_018302chr432294 2225 2209 12461 --1611
NM_018440chr868216 7646 5929 5546 283 158 23036 107 28725 725 18414
NM_018452chr6_random63672 3434 1463 1328 1056 753 23079 1095 ----
NM_018638chr12105570 5089 4084 3916 3850 3677 1809 1381 986 781 23670 1404 1249 --
NM_018696chr182802 85 2687 252 --1733
NM_018999chr1021062 303 11382 14858 11309
NM_019001chr384013 3737 3724 3447 2971 1547 986 900 2818 366 --13370
NM_019063chr23606 524 151 12019 --12151
NM_019891chr131321 417 364 ----1826
NM_020122chr285172 4769 4466 4298 1862 1764 1219 1014 ----45355 4563 4137 644
NM_020336chr2043772 2471 656 491 23863 315 11363 12883
NM_020390chr374912 3110 1445 779 659 610 140 13812 21957 247 1515
NM_020711chr221603 170 12012 1270 1627
NM_020718chr1666347 6227 5169 2436 2405 1250 --11132 --
NM_020727chr2143783 2819 297 259 23759 648 23309 725 --
NM_020772chr17138236 8217 7653 7052 6675 6668 2741 1956 1830 1704 1380 713 282 ------
NM_020774chr1834228 1482 1027 31716 1010 357 --14723
NM_020841chr1263745 3503 2717 2659 1286 1212 --13843 --
NM_020871chrX2694 555 32219 1951 1940 2752 245 --
NM_020975chr1022055 110 ----11968
NM_021911chr535112 4496 1480 ----1338
NM_021961chr1146923 5386 1275 1082 36084 4676 1800 27376 4850 --
NM_021964chr316466 1913 1733 1170
NM_022048chr1576151 5788 5277 5209 4608 2302 1891 ------
NM_023929chr81913 22389 235 --1239
NM_024639chr632890 1957 836 --1388 12508
NM_024770chr245578 2291 1099 286 22652 1077 --14883
NM_024817chr1585321 5288 5025 4948 4142 3973 2292 894 1123 25544 201 --
NM_024947chr379605 7976 7079 6234 5923 637 580 23563 1641 1681 --
NM_024989chr2128129 7346 6388 6175 5933 5156 2110 1577 1544 1402 790 514 15033 ----
NM_025160chr183199 3187 2975 2927 2749 1232 422 45 --23432 982 --
NM_031419chr341557 1219 1061 430 1465 --144
NM_031427chr1431203 339 247 34691 693 254 ----
NM_032116chr1365199 4258 2150 1820 1409 1317 15154 ----
NM_032228chr1132367 742 615 ----13507
NM_032288chr342169 1774 623 444 ----11644
NM_032321chr262878 2803 1239 799 777 195 22757 209 ----
NM_032373chr1065661 5447 5245 2272 1250 1029 1261 1149 --
NM_032682chr372802 2781 2771 2720 2705 2608 2294 ------
NM_032838chr193851 252 227 11107 --11035
NM_032968chrX63638 3364 3248 3113 515 498 1151 ----
NM_032969chrX63638 3364 3248 3113 515 498 1151 ----
NM_032973chrY63630 3359 3243 3108 515 498 1151 ----
NM_033181chr653746 2905 1198 863 145 13808 --11449
NM_033224chr777065 6954 6915 5572 5559 3146 1163 12702 15149 --
NM_052879chr1273837 3307 1544 1098 719 638 575 ------
NM_052885chr1254947 3971 1552 450 348 --1871 1808
NM_052907chr1243692 2986 1655 552 ----1302
NM_053016chr977062 6898 6699 6537 2279 1745 511 ------
NM_080867chr1434397 1703 1138 34965 3287 3191 14127 --
NM_130391chr953620 3566 1291 779 748 1976 1983 21200 980
NM_130392chr953620 3566 1291 779 748 1976 1983 21200 980
NM_130393chr953620 3566 1291 779 748 1976 1983 21200 980
NM_130809chr563120 2890 2605 2273 1036 900 --1425 --
NM_133370chr453635 3492 2516 1073 548 12671 12909 --
NM_138270chrX73282 2875 2431 2355 2138 700 186 1726 ----
NM_138713chr16108144 6541 5757 5483 2656 2373 2251 2237 666 514 46562 5507 408 333 ----
NM_138714chr16108144 6541 5757 5483 2656 2373 2251 2237 666 514 46562 5507 408 333 ----
NM_144578chr1444735 1854 1191 532 33811 3628 624 13631 11904
NM_152549chr52443 23 1101 --1482
NM_152838chr2032464 1324 344 --21084 800 1797
NM_153188chr584579 4099 3893 2202 1319 1214 297 46 13754 ----
NM_172071chr186415 6200 4547 2572 2550 1485 1333 42 ------
NM_173171chr22303 291 ----11101
NM_173172chr22611 599 ----11409
NM_173173chr22303 291 ----11101
NM_173214chr16108144 6541 5757 5483 2656 2373 2251 2237 666 514 46562 5507 408 333 ----
NM_173582chr1175766 5692 5533 5008 4612 423 409 24195 770 ----
NM_173808chr163699 1773 1165 1096 816 396 1307 ----
NM_178140chr541932 1884 1814 27 --21945 881 32451 917 913
NM_178151chrX95938 5572 5552 5374 5029 2195 1393 1172 920 ------
NM_178152chrX95938 5572 5552 5374 5029 2195 1393 1172 920 ------
NM_178153chrX95938 5572 5552 5374 5029 2195 1393 1172 920 ------
NM_181481chr18107015 5405 4954 2436 2171 1871 1568 1183 1165 87 15872 14833 --
NM_181482chr18107015 5405 4954 2436 2171 1871 1568 1183 1165 87 15872 14833 --
NM_181483chr18107015 5405 4954 2436 2171 1871 1568 1183 1165 87 15872 14833 --
NM_181521chr1656184 6146 2576 433 95 35031 759 51 1386 15230
NM_181705chr544682 3624 585 411 14259 ----
NM_181780chr331377 369 127 --2484 452 1806
NM_181836chr572529 2010 969 912 905 503 465 ------
NM_182765chr10--12262 1738 32378 2266 870
NM_182898chr756150 5917 2048 309 105 --14141 --
NM_182899chr756150 5917 2048 309 105 --14141 --
NM_194314chr165586 5413 4319 4092 1411 336 --21856 1848 --
NM_198128chr1842131 861 808 688 31697 1560 115 ----
NM_198581chr277329 7251 7040 5791 2230 1343 48 ------
NM_198990chr742450 2419 1152 176 13304 11136 --
NM_199188chr1273837 3307 1544 1098 719 638 575 ------
NM_199190chr1273837 3307 1544 1098 719 638 575 ------
NM_199421chr1434397 1703 1138 34965 3287 3191 14127 --
NM_205860chr12911 900 12180 13128 13076
NM_206853chr653351 830 165 102 60 33469 1123 1085 ----
NM_206854chr664612 3741 2091 1426 1363 1321 14730 ----
NM_206855chr685577 4706 2391 2328 2286 714 197 58 15695 ----
NM_206866chr2152554 2018 1218 1201 723 22937 2872 ----
NM_206909chr897806 7520 6996 5181 1259 1191 808 308 147 --16219 --
NM_207303chr1053978 3506 2588 738 554 13377 1209 --
NM_207406chr465363 4825 4568 1845 953 725 14535 --1683
NM_213589chr285541 5500 5081 4255 2180 2083 1628 1385 ------