TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-451a
miRNA Sequence: AAACCGUUACCAUUACUGAGUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000297chr42259 169 ----2786 564
NM_001001396chr144329 4190 3245 2920 13577 --13591
NM_001001481chr832925 2317 335 --21203 767 13319
NM_001001556chr1531059 288 197 --31234 146 110 --
NM_001001928chr2255113 3170 2582 1159 257 --28347 1452 15885
NM_001013717chr521221 27 ----21380 492
NM_001046chr552729 582 210 99 34 ----11008
NM_001049chr142191 99 ----22377 2168
NM_001099678chr356339 2307 900 282 237 1545 --24375 51
NM_001148chr4------22029 662
NM_001684chr144046 3907 2962 2637 13294 --13308
NM_002044chr1531059 288 197 --31234 146 110 --
NM_002092chr463739 1999 1551 667 610 502 --3478 360 288 --
NM_002356chr621788 484 --11054 1954
NM_005036chr2255113 3170 2582 1159 257 --28347 1452 15885
NM_006139chr222805 1861 --12700 11890
NM_014155chr1136034 5426 66 --37028 4806 2636 --
NM_014331chr447419 6818 6780 380 15204 16691 23124 1827
NM_015886chr845636 3898 1772 778 11653 25318 5243 --
NM_015906chr133304 687 668 14717 23980 599 11334
NM_017447chr2123314 2811 --13020 1573
NM_017519chr6------21123 1096
NM_017658chr1421122 925 24659 733 24385 576 --
NM_017801chr3----22440 285 22238 588
NM_017813chr875423 3854 1380 1268 1050 1035 753 195 --145
NM_018299chr832925 2317 335 --21203 767 13319
NM_018362chr1121557 162 13858 --13608
NM_018440chr878494 5350 2831 1395 1282 1256 120 --15852 --
NM_020732chr6------21123 1096
NM_020977chr4------22029 662
NM_021163chr741284 669 540 101 ----12946
NM_022459chr1375789 5616 4920 4514 3856 1503 236 16169 ----
NM_030816chr143297 2546 2403 587 ----22361 810
NM_033020chr133304 687 668 14717 23980 599 11334
NM_144571chr456778 5678 4478 2635 581 --26279 348 --
NM_175863chr6------21123 1096
NM_182493chr16------35417 2059 130
NM_198273chr532899 2185 613 --11055 12604
NM_207303chr1033103 1512 1141 ----22660 798