TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-452-3p
miRNA Sequence: CUCAUCUGCAAAGAAGUAAGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000337chr576292 5507 4913 4358 2293 1858 1774 26478 654 22235 1549 14117
NM_000902chr31404 12706 --32195 1095 869
NM_001003652chr1898233 6752 6014 5666 3392 2996 2760 375 177 11805 25733 1918 --
NM_001004419chr1274001 3829 2973 1380 1078 668 76 53155 1848 1614 965 749 ----
NM_001009899chr3105805 5721 5639 5569 4751 4490 4034 1134 471 156 11349 12210 --
NM_001010867chr1146641 5580 5564 5426 5335 5279 4418 2166 1914 1829 1318 1211 567 527 24798 2002 35385 5238 257 1990
NM_001014797chr10107896 7844 6979 6803 6711 6344 5313 5208 1404 918 47552 6964 6760 124 --27359 652
NM_001018065chr955625 4520 1749 1134 597 42301 2144 1874 267 13697 24754 2228
NM_001018066chr955625 4520 1749 1134 597 42301 2144 1874 267 13697 24754 2228
NM_001024647chr12127627 7530 7265 5273 5139 2571 2266 1875 1406 1128 706 211 ------
NM_001024956chr1155305 3887 2160 571 222 24440 303 12343 13986
NM_001040152chr794901 4874 4271 3736 2025 727 579 449 49 23977 518 --21862 778
NM_001042533chr363159 3091 2860 998 886 140 42062 1103 562 82 22452 506 --
NM_001186chr2153262 3054 2835 1293 529 11077 --22924 2323
NM_001364chr1171291 1258 696 508 308 280 240 1250 1823 --
NM_001759chr1254777 4353 1833 1306 1000 15279 24086 668 1810
NM_001918chr1119103 8879 7977 7601 7087 6689 6362 6000 2843 1485 344 58008 7640 6918 2898 1296 ----
NM_002006chr465729 5641 3762 3523 2277 355 --21413 709 --
NM_002025chrX98802 7340 7077 6836 6593 3681 3576 3155 528 58578 6120 3326 2510 2293 37270 1689 495 --
NM_002310chr536331 1212 910 46258 6166 464 114 --24488 428
NM_002698chr1943002 1955 1943 1858 31881 898 537 1851 32561 2185 2051
NM_003342chr1752851 2523 2180 2133 795 12294 22634 199 1448
NM_003799chr1863909 3314 2770 1039 1033 516 --13821 1170
NM_004171chr1198927 8119 7944 7839 7518 3663 1868 1652 1573 27532 6273 12128 38725 7750 1309
NM_004232chr1843742 2648 836 491 12757 --11488
NM_004612chr994524 4416 3589 3279 2985 1480 1216 981 280 --24607 2946 --
NM_004745chr886421 6281 5826 5203 4972 4504 2527 258 25285 4496 25632 2625 12105
NM_005359chr18106264 5979 5882 4150 2220 1621 1561 1234 721 583 16103 12038 --
NM_005759chr253882 3584 1640 755 641 23840 1519 44725 3712 1631 522 --
NM_005901chr1898233 6752 6014 5666 3392 2996 2760 375 177 11805 25733 1918 --
NM_006080chr72811 228 12484 22929 2814 1220
NM_006729chrX64222 4086 3965 2246 1563 1209 35473 831 133 21547 1377 --
NM_006738chr1564483 4148 3619 2938 647 399 12835 31261 290 159 21759 1544
NM_006918chr1155305 3887 2160 571 222 24440 303 12343 13986
NM_007200chr1564483 4148 3619 2938 647 399 12835 31261 290 159 21759 1544
NM_007249chr1399184 8742 7013 5906 3513 2630 2543 1492 1437 2978 389 27105 3571 1515
NM_007287chr31404 12706 --32195 1095 869
NM_007288chr31404 12706 --32195 1095 869
NM_007289chr31404 12706 --32195 1095 869
NM_012072chr20124298 3989 3684 3614 2974 1717 1649 1240 1027 835 719 372 53500 3286 2788 1780 424 ----
NM_012294chr753544 2921 2721 2622 877 33664 700 248 --2653 591
NM_013269chr1263928 3756 2900 1307 1005 595 53082 1775 1541 892 676 11811 --
NM_013309chr1522051 607 --11889 1202
NM_014021chr182292 1060 926 903 877 606 244 104 --13281 --
NM_014155chr1196849 6813 5835 5706 5110 2033 1436 859 232 34950 4784 933 26656 603 15561
NM_014331chr456778 5736 685 396 378 16726 17576 26477 1085
NM_014721chr696768 6142 5900 5105 2871 2534 1860 825 286 26016 5916 21208 176 --
NM_014747chr1125704 5305 5074 4567 4364 3876 3847 2270 2235 2001 1613 769 24089 3938 25270 4205 --
NM_014840chr1272914 1247 1225 1211 940 894 345 12462 22930 1140 22867 963
NM_015074chr144917 3894 3532 1829 ----34468 3484 1627
NM_015156chr1443239 2760 1497 939 23330 1215 --23436 2544
NM_015226chr1663209 2372 2209 1388 1211 1057 --22919 244 23104 468
NM_016206chr358006 7527 6320 3095 2317 35958 5919 336 --16940
NM_017709chr193965 3131 3122 3102 2908 1445 1401 1102 78 24110 2861 13079 --
NM_017847chr142122 2079 2060 450 1230 --12070
NM_017902chr10105343 5294 4290 3954 3943 3910 2291 1445 451 142 34821 4110 1222 24282 32 12265
NM_018440chr8127844 7607 7405 6523 6190 5783 5754 2676 2620 2163 732 118 26694 1862 --1218
NM_018557chr21561 --1622 11407
NM_018566chr174256 3800 3435 1298 679 246 184 14369 11712 14948
NM_020338chr1063576 3056 2619 2589 2289 810 12775 33408 1103 352 13623
NM_020443chr1116619 6395 6268 6117 5699 2160 2104 2063 1765 673 266 54362 1809 1375 612 135 15969 --
NM_020466chr643997 3519 1251 249 43970 1389 975 759 --13949
NM_020673chr2067571 5222 5171 2078 704 608 56980 6806 6641 5059 2577 15271 23043 1922
NM_020956chr19174235 4084 3809 3766 3670 3607 3441 2966 1814 1736 1658 1090 907 626 518 460 405 41869 1791 1713 1635 24608 3776 --
NM_021061chr893839 3604 3377 3191 3157 3008 2995 2869 1622 33393 3118 1372 11671 --
NM_021961chr11117386 7013 6426 6358 5803 5112 2779 2030 1532 938 259 26253 289 15303 --
NM_022048chr1595853 5303 3867 2407 2138 1092 794 504 134 --25196 4787 25339 4378
NM_022456chr12127627 7530 7265 5273 5139 2571 2266 1875 1406 1128 706 211 ------
NM_022491chr1252759 2302 872 510 167 23222 2231 33167 2480 714 22697 2449
NM_024511chr442542 2233 1291 1109 --22790 2324 22926 1300
NM_024947chr3149100 9015 8639 8237 7441 7322 7011 6371 3707 2584 2135 1806 1512 302 39030 3750 943 ----
NM_030780chr821136 1111 2514 324 --11576
NM_030806chr1199115 9026 8142 7805 7338 7137 6775 6759 3522 3370 3198 3087 1567 935 813 684 507 349 322 22122 464 18575 1692
NM_032012chr984967 4141 3476 1662 800 777 378 245 --24721 3299 15143
NM_032105chr1127837 6988 6748 6200 5705 3192 2762 2185 653 624 548 49 47999 1305 1218 91 ----
NM_032778chr363159 3091 2860 998 886 140 42062 1103 562 82 22452 506 --
NM_032859chr1342708 1393 1265 323 13393 13691 1313
NM_032873chr11114559 4520 4372 4196 3866 3844 3772 3206 1719 1477 147 14249 11341 24012 3611
NM_080872chr873868 3687 3500 3332 3220 898 301 23262 1409 --11493
NM_133334chr4135920 5496 5156 4680 4380 2450 1802 1520 1369 1355 1256 760 34 42382 2180 2047 1122 14916 15964
NM_133478chr251661 1649 960 574 359 3231 205 132 1223 2782 120
NM_144599chr15135438 4669 4556 4204 3613 3582 3505 1767 897 851 631 326 123 11792 1927 --
NM_144767chr1564483 4148 3619 2938 647 399 12835 31261 290 159 21759 1544
NM_145259chr2106995 6786 5719 5494 5106 4782 4315 2719 1426 430 46744 6710 5439 383 ----
NM_145284chrX52411 2157 1948 934 826 ----12275
NM_152261chr1231632 429 320 ----12510
NM_152375chr172600 2436 1883 956 495 266 170 31617 506 122 1515 --
NM_152409chr552551 2265 483 307 168 ----13229
NM_152734chr6125274 5042 4463 4258 3690 3455 1401 1123 1071 937 412 195 21654 1288 13856 --
NM_153182chr363159 3091 2860 998 886 140 42062 1103 562 82 22452 506 --
NM_153332chr822754 2099 22200 384 22821 128 21197 59
NM_153607chr552815 1170 830 511 488 1684 12176 12351
NM_153810chr1065138 3303 3188 1234 696 690 14887 14708 15000
NM_170665chr1294446 4326 4042 3638 2901 1556 1426 1367 1240 1254 13029 --
NM_173642chr1148993 8650 8623 8248 7849 6479 6285 5693 3639 3547 2424 1682 1179 986 11213 17874 16499
NM_175623chr12127627 7530 7265 5273 5139 2571 2266 1875 1406 1128 706 211 ------
NM_175624chr12137722 7625 7360 5368 5234 2666 2361 1970 1501 1223 801 306 23 ------
NM_175625chr12137722 7625 7360 5368 5234 2666 2361 1970 1501 1223 801 306 23 ------
NM_182493chr1695311 5244 5045 4957 3635 1266 990 420 65 34792 1000 156 12152 --
NM_198281chr452994 2234 1362 875 486 --12168 22770 2595
NM_199050chr2163408 973 585 216 94 86 12905 --22492 843
NM_206866chr2153262 3054 2835 1293 529 11077 --22924 2323
NM_207297chr351365 1197 513 264 22 22804 607 --13079
NM_212558chr994118 4042 3771 3669 3232 785 675 533 348 13937 ----