TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-452-5p
miRNA Sequence: AACUGUUUGCAGAGGAAACUGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX93442 3157 3022 2453 2388 2241 1023 518 247 --22307 499 --
NM_000084chrX106485 6104 5512 5308 2732 2369 2238 1591 1187 967 16399 14654 1740
NM_000092chr283848 3504 3481 1313 870 589 452 427 1353 13672 --
NM_000104chr262119 1961 1073 664 464 415 12815 32803 2192 892 2926 354
NM_000192chr1231420 1401 1218 ----21137 80
NM_000216chrX43663 1527 1006 198 12703 14043 1183
NM_000217chr1254547 1644 1543 964 65 15047 24047 460 --
NM_000259chr15126112 5878 5661 5322 5077 4507 4500 4172 3938 1796 1536 418 ----23982 590
NM_000264chr942794 2230 2150 125 --43233 3154 3034 2464 --
NM_000267chr1722839 2201 11235 43350 3146 3056 2805 1460
NM_000332chr6157207 6849 6729 6340 5838 5630 5247 4902 4793 4658 4593 4518 2291 491 306 15810 16611 12128
NM_000337chr5135778 5526 5437 4785 4703 4574 2562 2503 2452 2231 1271 824 487 25361 1246 65962 5416 5009 4885 4482 1597 15476
NM_000368chr9114524 3350 3250 1188 1180 823 640 577 556 159 49 --33162 3004 1591 13514
NM_000376chr1272925 2830 2125 2012 628 618 340 --23050 913 --
NM_000390chrX52343 1217 1010 118 96 --13262 21101 842
NM_000393chr262124 1615 1465 612 439 227 ----1627
NM_000430chr1793118 2738 2434 2349 1209 974 719 313 306 --13613 --
NM_000489chrX53206 3124 2949 655 155 1273 22188 97 --
NM_000555chrX157427 7392 7244 7154 7130 6835 6780 6445 5957 2794 2788 1193 1074 750 643 12397 36383 5862 1385 37527 7275 1119
NM_000599chr2144241 3585 3380 3326 3053 1744 1637 1583 1425 1220 733 715 360 260 33629 1542 581 ----
NM_000618chr12105943 5777 5126 4758 4160 4094 4035 1169 1148 541 14249 1688 2949 875
NM_000618chr12105943 5777 5126 4758 4160 4094 4035 1169 1148 541 14249 1688 2949 875
NM_000633chr1884853 3775 3605 2063 1245 862 173 146 11130 33655 3618 271 151
NM_000719chr12136177 6095 4373 4276 2589 2555 2466 2042 1861 1477 1356 343 105 --25610 902 --
NM_000813chr5125468 5102 4852 4794 4226 4094 3971 3399 1042 701 561 243 24614 3667 25253 1677 14507
NM_000831chr1156322 5349 5273 4222 3959 2525 2151 2126 1727 1567 1361 860 661 603 352 --15137 --
NM_000860chr421105 42 ----21517 1087
NM_000872chr1071195 1127 609 496 455 365 98 1210 2523 248 11205
NM_000875chr15196081 6058 5675 5332 4933 4845 4809 4623 4489 4480 2815 2580 2365 1869 1792 1544 909 198 145 11075 11089 130
NM_000891chr1772960 2722 2515 1345 1337 864 26 --167 --
NM_000899chr1284327 3192 1493 1215 767 173 75 49 --34239 3292 529 --
NM_000912chr863580 3089 2884 2660 956 269 22437 791 1699 13403
NM_000950chrX53256 2267 1234 767 560 --21290 710 13524
NM_000959chr1103724 3658 3640 3460 1484 925 801 615 555 166 12870 12953 --
NM_000961chr20103947 3864 3753 3590 3558 3194 2593 1557 625 466 ------
NM_001001419chr584964 4676 4456 3491 1261 867 760 95 13684 13298 --
NM_001001420chr584964 4676 4456 3491 1261 867 760 95 13684 13298 --
NM_001001664chr293611 3599 3402 3026 2863 2596 1427 1285 115 --23169 1434 --
NM_001001890chr21103703 3524 3132 3091 3009 2884 1355 1120 709 302 --14313 --
NM_001001928chr22127723 7716 7585 7544 6784 6429 6175 6165 2634 1010 484 122 22660 1290 15883 --
NM_001001974chr1062084 1946 1681 1659 693 306 1589 21534 772 --
NM_001002843chr153855 222 51 11139 11011 1919
NM_001002860chr1493773 3140 1827 1138 1096 791 670 498 251 --2819 458 --
NM_001002919chr24200 161 119 66 --2547 460 1518
NM_001003652chr18188687 8167 7847 7102 6758 6404 5260 5242 2701 2684 2490 1891 1840 920 801 772 520 113 1293 46967 5954 2576 639 --
NM_001003674chr18126800 6072 5500 5249 4454 2461 2187 1478 1468 983 797 264 15671 34585 2701 214 --
NM_001003675chr18126800 6072 5500 5249 4454 2461 2187 1478 1468 983 797 264 15671 34585 2701 214 --
NM_001003679chr191964 1734 1722 1450 900 693 416 170 52 11363 11620 --
NM_001003712chr1233015 2603 420 1313 13179 11427
NM_001004313chr1782096 1901 1417 1282 492 458 339 105 --21763 541 11973
NM_001004317chr672901 2757 1762 1626 1593 1067 137 172 12915 186
NM_001004419chr1283971 2947 1678 1488 1238 841 768 721 23071 479 44142 3629 1439 1008 --
NM_001005404chr1774246 3970 3384 2736 1665 356 267 --34138 3274 3121 --
NM_001005473chr5136482 6243 6189 6149 4620 4442 4106 2529 1957 1661 1427 881 621 --11222 25280 1866
NM_001005609chrX113153 3065 2969 2884 2795 2638 2393 930 863 232 202 --13321 1953
NM_001006657chr292936 2912 2637 2196 1298 1262 1105 1071 692 --33115 2950 834 12045
NM_001007094chr10133960 3884 3629 3542 3492 3384 3037 2816 1310 1069 763 695 461 33667 3106 2979 ----
NM_001007097chr9134771 3762 3743 3702 3564 1927 1800 1424 772 450 428 231 21 --34802 3419 1498 --
NM_001008239chr1893856 3756 2844 2838 2498 2329 708 519 512 ------
NM_001008405chr731582 1252 503 --1175 2576 549
NM_001008408chr7144985 4936 4783 2458 2336 2130 2100 2038 1597 1529 1495 1321 814 590 ------
NM_001008495chr862217 1671 1430 529 285 56 11555 1454 12134
NM_001008738chr5112784 2576 1175 602 596 502 462 348 341 56 37 --22540 377 --
NM_001009554chr4104714 4468 4408 4144 3915 3699 1476 984 756 225 --14420 11604
NM_001009554chr4104714 4468 4408 4144 3915 3699 1476 984 756 225 --14420 11604
NM_001009899chr3126229 6197 5921 5675 4767 4454 2430 2323 1945 1245 998 451 14887 3945 793 516 --
NM_001009909chr1173913 3012 2915 1487 1431 837 816 1230 23605 1245 13270
NM_001010861chr172451 2356 2101 2093 1780 1106 832 32755 1967 420 ----
NM_001010891chr5106924 5977 5739 5672 5536 4784 2517 1872 1625 1057 16626 35943 4952 4875 --
NM_001010984chr162559 2418 1623 314 182 143 12138 12338 12581
NM_001010986chrX52053 741 493 487 371 22268 298 22425 981 1471
NM_001011513chr453903 1459 1132 474 109 12896 12810 23744 457
NM_001011666chr7146312 6143 6073 5159 4428 4403 4364 4300 4033 1689 1351 1271 1194 392 44626 4106 2325 1903 --1824
NM_001012420chr1562870 2421 1977 1043 788 564 11799 32756 2657 158 --
NM_001012755chrX94694 4545 4463 4198 3357 1959 1609 682 308 ------
NM_001013031chr10103302 3068 3052 2737 2637 2611 2314 1396 640 517 12525 ----
NM_001013620chr12138465 8367 5937 5579 3311 3198 2504 2483 1909 1202 1050 974 545 21753 1426 28179 2925 --
NM_001014797chr10227470 7326 7247 6554 6411 6341 6277 5822 5805 3217 2995 2831 2715 2560 2466 2375 2008 1563 1344 1195 265 90 15154 1353 35789 5750 5004
NM_001015877chrX52724 2298 1001 275 267 --12499 1913
NM_001017535chr1272925 2830 2125 2012 628 618 340 --23050 913 --
NM_001018067chr165156 4121 1798 1134 1106 328 13438 45249 5049 3989 1388 --
NM_001018068chr165156 4121 1798 1134 1106 328 13438 45249 5049 3989 1388 --
NM_001018069chr165156 4121 1798 1134 1106 328 13438 45249 5049 3989 1388 --
NM_001018089chr15103773 3282 2992 2489 1500 1208 972 452 294 46 --33433 2525 37 12935
NM_001024647chr1287563 6970 5694 2468 2453 2194 1997 1328 --11556 1345
NM_001024649chr582848 2523 2412 1188 1032 698 619 296 21901 169 12801 --
NM_001024948chr163306 3264 795 641 375 283 ----21117 474
NM_001025076chr1085711 5084 2146 1870 1755 1598 518 358 --36148 3867 470 --
NM_001025077chr1067069 6442 2956 1876 1716 944 --47506 5225 4631 1828 --
NM_001025079chr363456 3417 1558 1205 875 176 1273 23302 645 --
NM_001025233chr1282394 2025 1866 1010 674 639 357 219 --12579 12249
NM_001025266chr3114873 4504 4303 3900 3733 3552 2988 1473 1042 1013 131 11480 54659 1297 1195 1186 196 --
NM_001025580chrX54142 2910 1548 1244 970 --13281 13039
NM_001029863chr673079 2898 2604 1038 296 175 166 --1716 --
NM_001030055chr1453687 1407 760 221 21 --13945 14389
NM_001031679chr12113256 3236 2567 2186 1263 1149 1110 348 318 218 145 --13487 --
NM_001031695chr22135185 5013 4450 3993 3422 1990 1818 1584 1083 661 574 443 398 --23750 717 14261
NM_001031732chr493320 3063 2720 2659 2274 1347 1208 243 208 --11227 --
NM_001031804chr1683895 3697 3539 3413 3111 2888 2724 752 23586 2713 44199 3492 1352 1126 --
NM_001032999chr20105154 5018 4954 4574 4430 4371 4192 4045 2060 1548 --1739 --
NM_001033087chr2083155 2645 2588 2476 2376 2099 2048 470 21136 456 1403 --
NM_001034954chr10113221 2887 2477 1115 882 816 697 618 572 181 121 ----11056
NM_001034955chr10113221 2887 2477 1115 882 816 697 618 572 181 121 ----11056
NM_001034956chr10113221 2887 2477 1115 882 816 697 618 572 181 121 ----11056
NM_001034957chr10113221 2887 2477 1115 882 816 697 618 572 181 121 ----11056
NM_001035511chr131602 1352 59 135 3786 228 158 11376
NM_001035512chr131709 1459 166 1142 3893 335 265 11483
NM_001035513chr131709 1459 166 1142 3893 335 265 11483
NM_001037164chr741472 767 701 61 21634 568 11932 --
NM_001037165chr7188513 7574 6398 5639 3423 3176 1947 1548 1495 1452 1290 1258 1107 946 625 393 340 98 --15992 --
NM_001037317chr172451 2356 2101 2093 1780 1106 832 32755 1967 420 ----
NM_001039538chr221280 71 1164 1597 11313
NM_001039547chr3167707 6856 6313 6132 5915 5664 5103 2799 1799 1584 1430 1111 720 353 279 155 16759 45141 2714 2573 1144 --
NM_001039569chr231121 1096 461 1508 13273 23330 785
NM_001039585chr193981 3915 3897 3717 1182 1058 872 812 423 23127 272 13210 --
NM_001039590chrX92955 1450 1374 1197 849 803 713 468 439 ----23658 2994
NM_001039591chrX92955 1450 1374 1197 849 803 713 468 439 ----23658 2994
NM_001039618chr11165799 5136 4466 3778 3708 3633 2123 1936 1516 949 714 632 493 443 266 210 --45207 823 625 614 22280 2177
NM_001039693chr2104085 3913 3590 3405 3243 2587 1432 767 433 76 --11174 1239
NM_001039709chr20105154 5018 4954 4574 4430 4371 4192 4045 2060 1548 --1739 --
NM_001039937chr1363912 3884 3754 2878 1277 787 23414 2992 23696 2530 11258
NM_001040284chr16115840 5406 4745 4563 4463 4306 3658 1151 593 541 56 1336 12307 22346 373
NM_001040429chr1352825 2542 920 462 425 --32998 1228 846 12571
NM_001040441chr1105454 5350 5193 4948 4942 4586 4082 775 693 148 24990 4966 14427 --
NM_001040665chr784201 3731 3334 1951 1690 1391 693 521 13390 13962 --
NM_001042413chr9113793 3430 3298 2766 2741 1564 1535 1306 1204 830 372 23217 2652 13397 --
NM_001042492chr1722839 2201 11235 43350 3146 3056 2805 1460
NM_001042494chr1583799 3781 3687 3548 3239 1327 422 254 12473 1810 --
NM_001042495chr1583799 3781 3687 3548 3239 1327 422 254 12473 1810 --
NM_001042496chr1583799 3781 3687 3548 3239 1327 422 254 12473 1810 --
NM_001042497chr1583799 3781 3687 3548 3239 1327 422 254 12473 1810 --
NM_001042533chr373116 2448 2109 1180 1121 738 185 --2652 630 --
NM_001042599chr2147045 6674 6264 6087 5463 5386 5125 2748 2713 2325 2219 545 379 252 37211 1827 1254 1959 17660
NM_001042601chr392987 2820 2607 2274 2259 2117 1298 969 953 --12657 --
NM_001042603chr1254613 4150 3750 3684 607 15258 24520 1659 --
NM_001042604chr394216 4184 3896 3311 1958 1816 1805 1439 676 11700 23960 3245 --
NM_001042683chr61673 197 41591 660 568 328 1252
NM_001044385chr293860 3449 3375 3189 2731 1622 1562 1078 809 --31110 333 273 --
NM_001044387chr1923329 1455 32982 2539 545 33820 1262 849 24082 1286
NM_001044388chr1923329 1455 32982 2539 545 33820 1262 849 24082 1286
NM_001071775chr1351776 1582 1467 626 101 11265 2607 303 11597
NM_001083621chr1144200 3796 3745 3623 3497 3482 3264 3126 3119 3090 1650 317 223 144 --23487 720 --
NM_001099678chr3176167 5708 5422 4996 4719 4039 4007 2224 1832 1528 1220 1162 938 472 299 276 64 34596 4350 1348 66049 5613 4560 4312 2241 1270 --
NM_001100108chr1108271 7809 7776 5781 5673 5344 2905 2820 1409 255 27354 1739 --1887
NM_001106chr3209496 9265 9259 8803 7902 7379 6965 6369 6201 3408 2780 2603 2437 2424 2312 1574 1024 670 551 230 --29726 1755 --
NM_001121chr1021781 267 ----21936 1692
NM_001167chrX106624 6143 6046 5665 5602 5438 4507 4440 4334 1559 25126 1473 15531 --
NM_001173chr1453687 1407 760 221 21 --13945 14389
NM_001177chr121143 1332 161 11713
NM_001186chr21113281 3077 2780 2255 1232 1118 1071 793 608 476 328 --12175 --
NM_001204chr2146830 6521 5458 5269 5007 2397 1785 1559 659 637 517 385 369 140 16994 11025 --
NM_001206chr992760 2537 2488 2069 1263 1257 852 687 65 23118 1137 1663 --
NM_001259chr7156172 6003 5937 5864 5611 5400 5362 5170 4665 2021 1775 1759 1591 1038 813 1648 23974 572 1633
NM_001304chr1783832 3095 3055 1376 668 626 480 403 33756 3553 543 12968 --
NM_001329chr1041645 1061 279 61 --21600 52 1527
NM_001369chr571075 534 509 499 471 317 87 --11371 1323
NM_001396chr2152498 2014 1083 968 671 --42630 2363 2033 911 11902
NM_001399chrX113153 3065 2969 2884 2795 2638 2393 930 863 232 202 --13321 1953
NM_001432chr443845 2787 621 35 --23685 2705 13527
NM_001448chrX81823 1764 1557 593 574 436 422 237 ----1486
NM_001497chr962750 1938 1074 950 740 340 12555 --1713
NM_001616chr232930 1250 1003 13275 33337 1058 747 12321
NM_001690chr371675 1647 1631 939 805 406 337 ----1974
NM_001730chr1371564 1484 1408 476 340 234 148 1432 --11192
NM_001730chr1371564 1484 1408 476 340 234 148 1432 --11192
NM_001746chr582848 2523 2412 1188 1032 698 619 296 21901 169 12801 --
NM_001754chr21103703 3524 3132 3091 3009 2884 1355 1120 709 302 --14313 --
NM_001777chr363456 3417 1558 1205 875 176 1273 23302 645 --
NM_001858chr6114667 3816 3763 3735 3589 3467 1528 1450 1425 817 554 --11245 --
NM_001918chr1158033 8023 7811 7644 7598 7578 7554 6803 6322 2792 2098 1531 1284 1115 610 11195 59321 7003 6796 6702 6448 1630
NM_001938chr121410 1315 1592 31201 285 61 --
NM_001969chr1463708 2962 2665 1523 1455 578 129 33643 3215 2980 --
NM_001992chr551654 1459 876 644 468 ----12199
NM_002006chr475621 4997 4971 4541 4438 2041 1967 --24988 498 24744 1598
NM_002025chrX138723 8479 8084 7215 7074 3172 2480 1741 1682 806 344 276 146 --37276 7005 6422 11272
NM_002033chr11103657 3198 1554 1372 1146 1054 933 883 792 296 23869 3183 ----
NM_002040chr2182879 2184 894 602 485 308 259 251 1577 43145 2191 986 358 13198
NM_002092chr4114984 4015 3674 3307 1042 953 805 667 514 477 345 --34174 437 359 13740
NM_002137chr742179 1645 71 39 --32332 912 254 12117
NM_002214chr7105661 5417 3703 3602 1968 1828 1701 533 486 462 --11263 --
NM_002270chr555526 4019 3687 1773 586 --45270 4907 4884 1974 2440 313
NM_002293chr152440 2014 950 923 819 1428 --12763
NM_002310chr595934 4727 4103 2422 2305 2023 1744 1325 1140 --36174 2389 621 14852
NM_002336chr12114573 4435 4074 3534 3347 3323 2017 1243 561 320 194 13214 25089 1830 --
NM_002374chr221280 71 1164 1597 11313
NM_002451chr942913 2720 1116 970 33602 3566 1070 --1897
NM_002481chr1157798 7252 6963 6012 5659 5589 5402 5318 3088 2373 1203 1102 524 465 214 17972 15616 15957
NM_002519chr1161166 532 382 298 174 155 125 ----
NM_002581chr995630 4822 4461 4235 4086 4017 3464 1757 1138 32236 1437 1326 2923 586 15423
NM_002595chr1231484 1405 568 21358 499 11257 --
NM_002655chr8135178 5118 4919 4803 3786 3586 1683 1187 1170 1001 698 347 143 45239 3434 2025 776 --189
NM_002716chr1173546 3251 2753 2670 2375 1072 687 1878 --21103 768
NM_002736chr742218 1804 1410 159 --1676 1146
NM_002740chr352600 1122 839 777 538 --12259 11968
NM_002760chrY95352 5079 5067 4622 4607 1386 329 255 212 25489 4479 24863 4165 --
NM_002822chr1261789 1430 1296 659 536 121 --1518 --
NM_002834chr1293958 3522 3104 2697 1377 1088 98 72 32 --1294 --
NM_002837chr1294126 3886 3823 3704 3506 1801 1698 727 515 --21560 1081 1559
NM_002874chr952225 2141 2048 1701 470 ----1272
NM_002886chr3104445 3679 3317 3293 3215 2035 2019 1750 1720 1603 14990 ----
NM_002892chr1451675 518 380 206 28 --21381 1338 11060
NM_002927chr12104 23 ----132
NM_002959chr184449 3705 3498 3453 3342 515 465 447 ----14192
NM_003001chr131709 1459 166 1142 3893 335 265 11483
NM_003010chr1752422 1698 1580 1573 681 --22191 1619 1859
NM_003034chr12157669 7159 6812 6373 6198 6171 6124 5961 5742 2536 2110 1570 921 303 115 37190 6234 1740 26160 1883 --
NM_003045chr1374781 4429 3751 3715 3518 1439 206 23144 515 43849 1962 474 273 1842
NM_003099chr15106407 6097 5835 5824 5191 4723 2057 1966 436 203 --24394 2343 11947
NM_003108chr2136933 6749 6650 6433 6292 6061 5904 5840 4719 1785 1609 1489 882 --27070 5172 27252 6493
NM_003112chr773175 2846 2602 539 429 202 183 12948 23182 500 1565
NM_003137chr662062 1945 679 632 556 253 21958 694 1728 --
NM_003161chr1763608 2491 2287 1164 540 91 1295 --1199
NM_003199chr1874448 3949 3874 2052 979 603 180 --24363 1665 2730 261
NM_003221chr683754 3156 3146 3058 2992 1386 1186 52 11312 --12976
NM_003246chr1571671 817 628 622 610 347 183 --12029 --
NM_003298chr3126056 5506 5386 5336 5030 4563 4536 3905 1881 1814 1536 217 45006 1446 968 346 35172 4395 1587 14669
NM_003326chr172553 2384 1744 1024 890 285 129 12738 --1361
NM_003392chr3103841 3500 3369 3252 3223 3114 2739 1360 1085 649 21206 898 43482 2987 1155 1005 --
NM_003404chr2041593 753 328 158 --12008 11946
NM_003411chrY61274 645 600 204 113 42 --11398 --
NM_003421chr10133960 3884 3629 3542 3492 3384 3037 2816 1310 1069 763 695 461 33667 3106 2979 ----
NM_003439chr783468 3293 3021 2865 2833 453 340 147 11289 11144 --
NM_003474chr1071578 1558 1503 946 626 33 25 12254 1381 --
NM_003478chr11113270 2625 2556 2323 2126 1085 810 758 647 509 451 21119 543 ----
NM_003566chr1263096 2643 1342 1285 289 119 12655 --12668
NM_003590chr284025 3933 3581 3532 3153 2480 771 278 13423 12883 --
NM_003607chr1144393 3704 2877 2795 2766 2731 2703 1602 1596 1220 380 338 296 197 1119 ----
NM_003622chr1282365 1902 1687 985 740 534 144 137 1330 ----
NM_003663chr363219 2516 2425 955 824 114 1412 23021 1326 --
NM_003759chr484140 3952 2667 571 443 328 308 128 32819 1616 1199 13257 --
NM_003822chr192987 2924 2333 2258 630 592 324 314 72 --22345 984 --
NM_003895chr2142019 1439 802 422 21682 1664 31696 272 21 1236
NM_003913chr684312 3777 3376 2806 1612 1068 503 62 13988 32711 1354 1174 --
NM_003939chr10113372 3177 2962 2731 2641 1573 1564 1002 845 547 389 191 13521 --
NM_003966chr577604 5470 3034 3013 2061 532 379 16602 27811 6987 --
NM_003994chr1284327 3192 1493 1215 767 173 75 49 --34239 3292 529 --
NM_004096chr1081997 1419 262 219 106 87 77 29 --1280 --
NM_004124chr1483548 3451 2506 2389 1146 394 378 344 --1708 --
NM_004161chr271522 1375 1255 1123 503 381 182 --1391 --
NM_004170chr93709 553 528 --21458 1268 11629
NM_004171chr11148805 8050 7936 7723 6350 6125 2979 2903 2857 1956 1880 1675 1195 1154 27425 1810 42280 1619 590 351 --
NM_004172chr521509 545 1454 32055 257 137 1338
NM_004227chr7103056 2790 2723 2592 2453 2167 1231 941 892 474 22336 588 11168 --
NM_004232chr1853135 2725 2559 2434 1259 --43376 3053 2996 434 --
NM_004293chr963656 3390 2740 2657 2570 257 --2764 153 191
NM_004337chr872138 1662 1651 663 205 55 31 --22099 735 1322
NM_004338chr18126800 6072 5500 5249 4454 2461 2187 1478 1468 983 797 264 15671 34585 2701 214 --
NM_004412chr1075955 2038 1779 1570 1310 1251 1239 21379 819 25799 1614 15769
NM_004432chr922177 1849 ----2607 514
NM_004464chr484312 4141 3519 3309 2977 1613 1083 925 ----11641
NM_004501chr153208 2980 2937 2552 372 ----13858
NM_004586chrX95430 4792 4678 3485 1187 1031 631 604 379 1592 45082 4012 574 468 11142
NM_004598chr562764 2741 2196 2019 831 317 13289 33205 2575 2311 --
NM_004663chr1511125 --21601 1159 11109
NM_004685chr1332155 1851 125 2928 115 --12996
NM_004703chr1772462 2242 2221 854 440 302 166 2424 63 1174 --
NM_004709chrX71826 1808 1501 1492 1350 1264 666 11702 --1676
NM_004726chrX85182 4676 3663 2253 1827 1557 1480 24 15479 34747 1408 800 34240 4013 1171
NM_004745chr886148 5506 4969 4472 1837 1264 1006 401 16188 26793 807 --
NM_004772chr531526 1442 153 ----11457
NM_004774chr1752582 1022 826 90 25 12079 1306 11184
NM_004834chr283324 2088 1291 1272 1126 480 449 362 22328 835 --23272 2933
NM_004842chr621208 1198 21344 1222 ----
NM_004857chr1484542 4409 4372 3788 3569 1095 995 509 13118 --34748 4573 3518
NM_004859chr1752176 1105 378 217 85 22003 966 22680 2368 --
NM_004866chr5103991 3959 3835 3648 2009 1549 1108 430 176 100 23687 3162 34667 4606 1459 --
NM_004898chr472905 2831 2193 1860 908 229 96 1500 22563 434 --
NM_004904chr7146312 6143 6073 5159 4428 4403 4364 4300 4033 1689 1351 1271 1194 392 44626 4106 2325 1903 --1824
NM_004929chr841426 1257 1224 524 --21061 1039 --
NM_004956chr7134182 4058 3637 3609 3601 3389 2839 1851 1537 1265 1239 1207 1001 13629 24296 1171 --
NM_004985chr1274008 3971 3829 3745 3023 3000 158 --14540 13711
NM_004992chrX207598 7304 6743 6602 6516 6402 6319 6249 5681 5218 3351 2888 2328 2126 1866 1083 1017 877 377 363 --37345 5468 496 --
NM_004992chrX207598 7304 6743 6602 6516 6402 6319 6249 5681 5218 3351 2888 2328 2126 1866 1083 1017 877 377 363 --37345 5468 496 --
NM_004999chr684121 3819 3350 3339 1742 852 786 116 23567 635 13308 --
NM_005023chr561420 1083 990 976 592 470 ------
NM_005036chr22127723 7716 7585 7544 6784 6429 6175 6165 2634 1010 484 122 22660 1290 15883 --
NM_005044chrX134047 3874 3830 3803 3598 3586 3141 3126 1527 1318 146 72 29 --33385 1302 1160 12998
NM_005056chr1264857 4394 3994 3928 851 157 15502 24764 1903 --
NM_005065chr1464296 4087 3742 3329 3304 456 --22075 1775 11253
NM_005093chr20105154 5018 4954 4574 4430 4371 4192 4045 2060 1548 --1739 --
NM_005116chr2074214 3684 3377 2965 1415 1273 125 24547 3643 34295 1540 550 --
NM_005121chr1783661 3615 2648 2570 2541 2345 1271 1051 1638 11159 --
NM_005135chr1583799 3781 3687 3548 3239 1327 422 254 12473 1810 --
NM_005156chr9165151 4896 4833 4510 4357 4052 3950 3759 3607 3358 2067 2030 1652 1214 561 71 15130 ----
NM_005188chr11228147 7911 7722 7478 7301 6752 6668 6421 6341 6234 6219 5845 5265 5213 5035 3048 2692 1628 1215 1109 697 284 18110 33319 2134 941 45915 2015 1477 1115
NM_005235chr2147045 6674 6264 6087 5463 5386 5125 2748 2713 2325 2219 545 379 252 37211 1827 1254 1959 17660
NM_005339chr494186 3512 3235 3173 3083 2999 591 294 231 21626 697 --1826
NM_005359chr1895332 4245 4207 3986 1740 1568 1540 874 153 --26512 5167 21590 758
NM_005385chr372628 2493 1895 1871 1777 113 71 ----11687
NM_005433chr18102563 2369 1733 1716 991 930 571 276 246 225 --1499 --
NM_005436chr10134015 3778 3550 3077 2836 2680 1574 1224 896 618 501 429 288 ------
NM_005497chr17116023 5460 4880 3967 2374 2163 1631 1175 288 260 47 11536 24796 4067 --
NM_005504chr12106140 4240 4183 4033 2411 2379 1843 1226 832 30 ----1316
NM_005542chr761791 1677 1657 1531 497 458 --11587 11846
NM_005596chr966163 5681 380 136 98 27 56144 5126 4858 2254 826 55398 4451 2113 1668 757 13974
NM_005668chr5124427 3995 3947 3188 3075 2941 1518 1489 1406 1101 273 65 --21841 425 --
NM_005738chr741472 767 701 61 21634 568 11932 --
NM_005739chr1521679 1625 12102 12040 31994 1854 106
NM_005746chr742441 2011 420 316 --22275 1713 12067
NM_005748chr12113397 2721 2488 2469 2249 2212 1322 936 509 400 131 ------
NM_005759chr284677 4373 3904 3648 3333 3068 1006 36 1982 24514 3181 11534
NM_005779chr583286 2910 2513 2479 1077 462 313 131 1996 150 22321 220
NM_005813chr2--11654 31806 1056 616 32581 1664 979
NM_005828chr17114360 3958 3715 3702 3258 1907 848 763 627 375 312 11341 --23437 1634
NM_005840chrX157588 7508 7179 6953 6692 6347 5761 5511 5487 5089 3035 1667 1369 808 429 16105 17249 --
NM_005843chr241898 1719 1382 713 11664 41620 1501 1229 769 2410 309
NM_005868chr762461 1949 1800 1757 694 286 11938 12287 1786
NM_005901chr18188687 8167 7847 7102 6758 6404 5260 5242 2701 2684 2490 1891 1840 920 801 772 520 113 1293 46967 5954 2576 639 --
NM_005903chr584964 4676 4456 3491 1261 867 760 95 13684 13298 --
NM_005941chr8103908 3828 3741 3405 3367 3192 1203 1135 925 528 11594 33264 1424 1102 23772 939
NM_005955chr1115137 5020 4424 4025 1865 1805 1671 1561 1545 725 622 --35264 4595 4456 --
NM_005966chr23852 520 107 1214 --11784
NM_006011chr1594309 3751 1677 1546 1499 730 632 540 95 --21419 129 --
NM_006047chr2042412 2338 384 334 11030 33154 2961 553 --
NM_006095chr484197 4070 3680 2889 1510 1163 281 235 11339 33351 2796 1124 --
NM_006122chr1592590 2299 1814 1736 1716 516 346 323 196 1531 12685 --
NM_006154chr1562603 2319 1987 1888 1826 679 12246 1307 2849 150
NM_006158chr831766 1722 1567 --1353 21844 411
NM_006166chr1292320 1767 1029 1020 1001 641 553 545 61 --21910 312 --
NM_006203chr5135074 4162 3636 3519 1900 1467 1376 918 575 523 427 259 217 --11593 14366
NM_006251chr562694 2379 1256 1199 468 441 1460 1516 12497
NM_006252chr1187554 7329 7100 6561 6096 5752 5495 2953 2656 2253 2169 2018 1902 1692 1300 875 835 626 36202 5479 540 44680 4659 1817 846 --
NM_006256chr192797 2685 1962 1938 1052 706 550 284 54 --2692 216 --
NM_006258chr1081458 1420 1221 1009 564 210 175 38 ----11407
NM_006282chr20154617 4097 3829 3528 3221 3054 1766 1742 1502 1478 1017 584 395 261 160 --1446 --
NM_006300chr1951591 1554 633 560 361 1229 11943 12369
NM_006306chrX125478 5438 5386 5323 5283 4086 3901 3673 3640 1241 233 152 15725 1825 15513
NM_006364chr1441198 1151 322 275 1405 --1951
NM_006371chr3144985 4945 4517 4303 3940 1964 1877 1835 1687 1534 1427 1361 1236 949 --35266 4629 4366 --
NM_006379chr72483 470 --31725 1638 694 11921
NM_006380chr1754237 4195 4146 3163 3155 13655 11034 11142
NM_006393chr10104462 4311 2780 1778 1285 1212 1016 561 504 174 --1490 --
NM_006434chr10113221 2887 2477 1115 882 816 697 618 572 181 121 ----11056
NM_006457chr453903 1459 1132 474 109 12896 12810 23744 457
NM_006504chr1042437 2426 431 411 --32509 1045 368 1963
NM_006534chr2083334 3040 2903 2821 2311 2229 771 233 32661 680 664 --12099
NM_006544chr14135770 5525 4661 4610 4579 4373 4347 2197 1947 1279 881 711 142 14182 15906 14859
NM_006561chr1085711 5084 2146 1870 1755 1598 518 358 --36148 3867 470 --
NM_006575chr1431220 457 169 --1239 11298
NM_006599chr1698270 7304 5462 3032 2990 2140 1052 624 221 --15093 11097
NM_006609chr272843 2660 2651 2422 1923 1101 770 1817 32181 1118 886 --
NM_006620chr694894 4886 4282 4031 3944 3699 1695 1400 42 1703 --1285
NM_006626chr961899 1026 980 905 438 154 22215 296 22111 247 --
NM_006628chr1563890 3344 3050 2837 417 180 32901 542 124 43933 3535 1475 234 --
NM_006667chrX4940 833 323 55 --11113 1888
NM_006750chr16107924 7020 6289 5643 5281 3034 2527 1251 1163 955 16503 ----
NM_006873chr263438 3132 2604 1424 1106 1071 --22980 433 --
NM_006885chr1694117 3995 3944 3778 3642 2799 1706 284 72 --23194 406 1891
NM_006902chr192763 2651 2443 2064 1333 312 277 177 149 --1756 --
NM_006915chrX62268 1027 862 776 574 277 12485 11628 --
NM_006922chr242196 826 638 180 12267 2922 143 22168 463
NM_006924chr1744393 3616 2949 204 --12859 24303 3521
NM_006955chr1093304 3192 2546 2344 1356 1340 1118 401 285 1141 13247 --
NM_006956chr751640 826 649 444 403 11514 21866 504 --
NM_006981chr962891 2778 2472 2113 394 113 ----21161 1125
NM_007007chr1273617 1937 802 750 380 126 73 11884 139 --
NM_007011chr15126390 5323 5045 4618 4602 4376 4294 2245 1798 1512 517 366 --46157 4968 4928 2194 --
NM_007038chr21145592 5571 5080 4839 4732 4248 4101 3717 1978 1746 1398 663 186 68 --12246 --
NM_007043chr1271731 1701 747 479 450 371 361 12068 22025 1520 --
NM_007050chr20187931 7245 7228 5848 5678 5617 5456 5383 3167 3161 2971 2900 2223 1871 1227 1112 675 253 --22992 2147 --
NM_007137chrX105197 4630 4478 4428 4157 3407 1551 967 484 87 24754 3371 41967 1721 1379 1294 13390
NM_007146chr1772829 2342 2208 2174 823 319 244 1872 12693 --
NM_007175chr893660 3588 3264 2907 2516 1115 780 482 37 --33072 2669 205 --
NM_007214chr631364 985 922 11027 --184
NM_007249chr13179316 8977 8727 8594 8407 7738 7663 7595 6519 3093 2978 2112 1992 971 510 485 241 17304 58700 7604 7182 3427 1219 26565 2956
NM_007347chr1592843 2751 2707 2565 2245 2104 917 762 529 12128 --11077
NM_012104chr1173796 3707 3262 623 615 488 196 --23641 2438 12720
NM_012104chr1173796 3707 3262 623 615 488 196 --23641 2438 12720
NM_012120chr632447 2262 594 11947 --33018 2826 2067
NM_012129chr732154 1625 1606 1452 12041 1766
NM_012141chr1363912 3884 3754 2878 1277 787 23414 2992 23696 2530 11258
NM_012158chr1341453 1431 640 204 11703 1269 11617
NM_012164chr9157576 7255 5685 5626 5466 5276 4937 4738 2531 2392 2225 2117 1583 1094 738 16859 47184 6203 5152 1046 11633
NM_012214chr296449 5516 4821 4106 4063 2555 2273 2040 1770 15940 14723 --
NM_012234chr393721 3510 3456 3362 3255 2844 2565 592 574 --23274 1015 13772
NM_012249chr273444 3091 2570 2254 2168 1299 303 13318 21171 97 1181
NM_012252chr7155155 5136 5051 4549 4468 4459 3796 3711 3682 3467 2101 1502 935 303 278 14773 1370 11933
NM_012262chr154761 4237 3769 1643 131 190 44475 4166 4116 3455 2646 137
NM_012288chr695058 4445 4284 4036 3602 2132 927 871 112 25362 1716 11985 --
NM_012290chr261604 1098 515 509 261 227 --11103 11589
NM_012294chr7113878 3074 2843 2507 1548 1310 1141 1079 788 466 378 --12776 1728
NM_012297chr432363 1699 978 --42056 1964 564 381 --
NM_012309chr11134440 4188 3761 3589 1977 1633 1330 1308 1277 1258 1041 862 743 11215 44842 3465 1696 1120 --
NM_012334chr5134784 4396 3919 3667 3433 2994 2945 1496 869 861 496 286 202 --34379 4067 3074 --
NM_012382chr574320 4238 3598 3158 1573 978 312 34455 3685 2783 11659 --
NM_012420chr1071741 1421 824 492 432 229 117 --21826 695 --
NM_012464chr442826 2434 982 286 --1307 22338 405
NM_012465chr1082752 2584 2568 2499 2119 1119 556 22 --21206 94 --
NM_013231chr1464108 3720 3675 3047 1100 488 --43892 3769 3728 206 --
NM_013255chr7208573 8269 7989 7733 7157 6073 6064 5868 5796 5635 5504 5365 2913 1822 1737 1596 1311 777 534 34 181 37393 3146 1589 37358 2859 596
NM_013269chr1283898 2874 1605 1415 1165 768 695 648 22998 406 44069 3556 1366 935 --
NM_013302chr16134335 3433 1882 1755 1714 1682 1532 1359 1166 1037 309 241 37 ------
NM_013374chr372905 2895 2685 2609 2592 573 482 1600 32432 1162 732 --
NM_013943chr163218 3184 2953 2595 2227 2004 1930 23111 2427 2372 179
NM_014011chr272598 1837 708 612 359 245 83 21674 878 --157
NM_014021chr143054 2572 300 63 13214 13333 12525
NM_014028chr653091 2128 1250 974 897 --22527 1025 1644
NM_014048chr1674114 3512 3501 1760 1693 671 396 14619 23259 1246 14803
NM_014106chr1562437 2426 2156 2140 1863 179 11123 12321 --
NM_014112chr895351 5048 4645 1467 1246 1145 1080 34 28 --14409 21719 384
NM_014155chr11116299 6034 5556 5252 4859 1984 1912 918 655 492 206 14740 35090 4564 1637 --
NM_014157chr16123961 3653 3504 3348 3230 2712 1452 996 884 565 381 369 ------
NM_014253chrX62347 1900 1714 695 483 246 2903 409 2352 257 11822
NM_014309chr22135175 5003 4440 3983 3412 1980 1808 1574 1073 651 564 433 388 --23740 707 14251
NM_014319chr1241890 1332 779 160 --21727 1240 1642
NM_014331chr4117236 7173 6620 6472 6114 5895 4898 2680 1028 935 51 16355 --12872
NM_014394chr1021033 83 --2964 71 1818
NM_014423chr595649 4466 4270 3947 2011 1736 1059 896 108 24838 3822 11645 --
NM_014586chr21104529 4158 4110 1946 1797 1171 387 301 49 38 --1572 --
NM_014630chr1533791 3685 3056 --23220 565 13571
NM_014702chr642267 2188 326 54 --12402 1786
NM_014721chr667484 6820 4774 2868 1493 26 16177 --24812 937
NM_014729chr861835 1785 837 826 416 396 --1162 --
NM_014730chr12104589 4009 3499 2003 1725 1605 1574 1343 969 23 23507 1297 --14499
NM_014730chr12104589 4009 3499 2003 1725 1605 1574 1343 969 23 23507 1297 --14499
NM_014732chr16155357 5281 4544 4476 4228 4041 2254 1511 1301 975 959 818 793 718 551 15057 35803 5118 908 --
NM_014739chr673975 3809 1576 983 844 807 395 11013 23476 660 21240 164
NM_014755chr274260 3425 2966 2867 2637 1504 62 12810 34296 946 288 --
NM_014766chr7103770 3744 2956 2533 2425 1406 1389 1244 1133 994 ----12964
NM_014810chr163650 3549 3518 1223 1078 468 22714 2677 --1441
NM_014826chr1144393 3704 2877 2795 2766 2731 2703 1602 1596 1220 380 338 296 197 1119 ----
NM_014828chr1472200 2103 1943 932 831 760 724 11892 22262 1759 --
NM_014830chr12113724 3374 3054 2460 2426 1099 752 580 479 153 37 --1279 13850
NM_014844chr14114204 3846 3810 3792 3756 3624 3585 3302 2773 234 211 --11152 1860
NM_014862chr15144151 4056 4041 3632 3609 3276 3070 2701 2581 1178 885 460 390 357 ------
NM_014864chr1114342 4309 3751 3031 1734 1362 690 566 507 293 50 --1873 --
NM_014870chr1144200 3796 3745 3623 3497 3482 3264 3126 3119 3090 1650 317 223 144 --23487 720 --
NM_014873chr174162 4060 3495 1820 1222 1010 794 --34530 4351 577 11094
NM_014877chr1777441 6428 5899 5203 2141 1460 1199 --22374 1622 --
NM_014903chr1262273 2153 855 847 833 283 --12284 --
NM_014904chr1053687 1533 1014 876 351 --1444 12765
NM_014905chr261728 1692 1259 1250 533 176 --31868 402 251 --
NM_014906chr17123908 3816 3792 3735 3627 2588 1600 1590 1324 1178 934 135 ----12797
NM_014923chr1341727 1548 641 337 22307 1931 2646 85 --
NM_014936chr692583 2543 2068 1871 1826 1814 1128 554 68 22211 1748 12872 11934
NM_014946chr272874 2496 1958 697 346 156 86 --22802 653 1410
NM_014953chr13134068 4027 3128 3064 3019 2791 1187 1078 816 734 386 193 146 13555 23749 3638 11239
NM_014962chr2082864 2609 2519 2483 658 421 397 363 --2782 491 12647
NM_014982chr14105408 5320 4493 3376 1472 818 502 428 125 74 1465 11733 11605
NM_014991chr483264 2112 2042 909 809 429 198 155 1266 31155 712 84 --
NM_015020chr16113614 2940 2834 2718 2629 1462 1351 1331 1245 847 565 --13755 --
NM_015025chr272515 1667 818 756 747 313 176 --1111 --
NM_015026chr1294758 4298 4148 4015 3419 1818 858 195 25 --33388 759 533 --
NM_015032chr1382907 2328 2179 1892 1852 986 866 124 21975 335 1640 1397
NM_015035chr20126407 6237 5952 5786 5192 2506 2317 1944 1812 1553 193 146 --35912 400 271 1564
NM_015039chr164341 3906 3291 2825 2746 846 1761 41675 1541 1350 1319 23826 3807
NM_015040chr273159 3011 2797 2662 2271 1066 649 12315 1341 12842
NM_015051chr9103355 2774 2577 2263 2179 1101 748 741 592 111 ----163
NM_015071chr5115716 5641 4820 4721 4598 4138 4084 2552 1695 581 309 --1353 --
NM_015076chr673903 1759 1629 1518 1070 511 388 --23931 3692 --
NM_015087chr1351953 635 539 350 61 --11800 22527 1656
NM_015090chr1115237 5142 4900 4631 4495 4127 2283 2051 1604 824 527 1671 24814 3835 --
NM_015092chr1664289 4280 1863 1484 409 278 24030 496 24495 1246 --
NM_015097chr36866 753 602 493 379 349 12000 --1219
NM_015130chr431375 1045 366 11074 1899 1339
NM_015144chr1693171 2834 2725 1580 1554 1019 733 680 561 --21145 740 --
NM_015156chr1483709 2844 2675 1514 1357 989 961 107 --23280 3127 --
NM_015192chr2052423 879 858 420 305 --41839 836 734 382 --
NM_015199chr341922 1874 647 199 --22128 1209 1826
NM_015200chr452527 453 90 44 38 --2915 692 --
NM_015208chr1863794 3682 3126 3051 2730 1230 --43370 3354 3221 410 --
NM_015250chr942031 1477 710 150 ----1758
NM_015263chr154870 480 149 96 --182 11101
NM_015271chr464285 1593 1311 1231 1212 299 33685 3223 1101 11276 --
NM_015294chr17--1179 21140 913 2198 131
NM_015310chr8147911 7868 6905 6800 6578 6409 5916 5536 3114 1896 1352 1014 589 43 48041 6175 1492 793 58363 8129 5590 2566 110 --
NM_015336chr1262514 2408 2373 2037 1653 894 22278 1023 1822 --
NM_015355chr1761479 1413 662 605 459 101 --11704 11776
NM_015365chrX54142 2910 1548 1244 970 --13281 13039
NM_015375chr1144327 4238 3734 3410 1829 1723 1466 1105 987 561 409 362 335 163 --23697 1744 --
NM_015385chr10113221 2887 2477 1115 882 816 697 618 572 181 121 ----11056
NM_015455chr583575 2509 2495 1350 782 313 297 207 ----23367 1325
NM_015458chr8145281 5071 4364 3613 3604 3354 1748 1127 855 511 358 347 333 258 14480 21157 530 --
NM_015535chr263991 1566 1062 685 315 21 --54023 3299 3200 2910 901 12705
NM_015550chr783388 3189 2811 2602 2325 1186 919 475 ----1758
NM_015553chr674870 4054 3930 3360 1686 1130 467 --31966 1675 568 14324
NM_015569chr183388 1560 1352 1308 1248 1227 979 664 1424 11819 --
NM_015578chr1921878 25 ----21932 273
NM_015635chr9102123 1689 1524 1398 845 447 166 146 131 48 1367 ----
NM_015640chr165156 4121 1798 1134 1106 328 13438 45249 5049 3989 1388 --
NM_015886chr895586 5442 5356 4184 4152 2114 2094 1042 862 1873 --15084
NM_015906chr163511 3147 1783 1540 1175 1149 --21626 984 1923
NM_015912chr872413 700 595 462 441 275 184 ------
NM_016009chr174276 3667 1841 823 279 249 70 13879 --14511
NM_016025chr1651764 1647 1544 700 324 ----1583
NM_016040chr1102756 2443 2234 2192 1925 1001 917 852 523 119 1825 ----
NM_016072chr1252025 1649 918 175 93 21843 823 1167 --
NM_016081chr462241 1398 644 241 134 50 ----1609
NM_016083chr663450 3421 3124 1010 892 256 1952 31588 1465 532 --
NM_016107chr551207 1141 1092 986 35 2961 473 --1221
NM_016132chr1533343 2435 195 23186 137 13316 11239
NM_016206chr3108193 8029 8011 5520 3187 2786 2467 2109 1464 1182 --28275 1167 11624
NM_016217chr673185 2739 2360 1227 1094 453 141 11080 43587 3578 2947 2759 --
NM_016255chr633073 2759 555 23108 2892 2853 103 23277 3227
NM_016260chr2167016 6969 6694 6151 4691 4654 4619 3003 2956 2790 2570 2053 1767 367 260 189 21005 769 47294 7232 6005 2446 15837
NM_016298chr3122988 2960 2932 2923 2890 2575 2104 2050 2041 1214 1004 262 --11148 --
NM_016322chr963212 2901 2632 2432 1150 815 1743 1138 22820 58
NM_016377chr621208 1198 21344 1222 ----
NM_016436chr20102730 2643 2333 1975 1861 1702 1655 722 309 215 --22528 342 --
NM_016472chr1441287 1193 1061 592 11154 1605 --
NM_016507chr1792883 2712 2476 2251 1173 699 517 469 339 ------
NM_016530chr15113406 3257 2769 2657 2632 1560 1463 1219 1194 1036 179 12580 22957 2678 --
NM_016531chr494213 3978 3908 2979 1465 1433 1048 671 444 11556 ----
NM_016620chr16571 512 304 266 101 22 1255 11378 1161
NM_016621chr11134246 4240 4126 4068 3355 2831 1850 1099 928 782 639 568 49 --21373 224 1585
NM_016651chr141444 ----21071 964
NM_016824chr1021781 267 ----21936 1692
NM_016831chr151569 1512 966 154 53 --21539 873 11754
NM_017420chr1473432 2982 2854 877 770 658 225 --13372 --
NM_017447chr2153566 2779 1212 571 154 --1720 24181 675
NM_017489chr82383 32 11084 --21275 851
NM_017563chr386033 4702 4540 4431 4207 2367 950 315 15290 25520 1569 14324
NM_017594chr973177 2680 2150 1293 1038 678 399 42205 1113 731 167 ----
NM_017628chr4125037 4995 4344 4245 4184 3399 2049 1755 1543 1077 891 241 31932 1660 1600 35174 5063 4808 24868 4075
NM_017633chr683893 2937 2744 1394 1122 697 563 47 2583 466 ----
NM_017637chr9109167 7553 7240 6078 3510 3370 2492 1541 1199 260 38649 6393 1457 37151 5849 3465 11901
NM_017650chr7115851 4736 4708 4504 4268 2441 2126 1615 1060 888 526 11460 ----
NM_017658chr1474384 3958 3095 1326 1204 1132 824 ----125
NM_017661chr153855 222 51 11139 11011 1919
NM_017680chr941047 962 945 402 ----1419
NM_017709chr134116 793 424 --42748 1641 1367 1084 12868
NM_017754chr684807 3983 3764 3425 1996 1618 1517 494 24197 694 1502 24576 1272
NM_017762chr1592265 2081 1949 1889 1708 1625 852 740 113 12478 ----
NM_017813chr8125433 4812 4323 3946 3684 2128 1959 1684 1414 1137 606 542 11623 15016 --
NM_017919chr955342 4502 2306 1628 1380 --23584 1993 --
NM_017952chr2104455 4174 4152 3961 3216 2788 1187 939 632 455 --14009 --
NM_018013chr693097 2551 2058 830 812 723 713 217 159 --22875 1237 --
NM_018036chr1493513 3133 3109 2868 1366 956 822 439 412 1694 13663 --
NM_018046chr551554 536 503 206 43 --2683 179 --
NM_018084chr262593 2089 1278 1091 644 147 ----12257
NM_018085chr1177874 7018 6746 6285 5981 5755 5619 5340 5281 3285 2956 1777 1581 1382 674 501 391 27949 888 17057 --
NM_018121chr1073023 2987 1963 1274 270 261 174 12957 1616 12685
NM_018155chr342337 658 533 85 22212 1003 23325 97 1959
NM_018225chr985315 4857 4518 3777 3685 3480 3422 102 --22051 1996 --
NM_018227chr473055 2316 970 862 729 321 197 1681 52488 2397 2383 1198 427 21154 1121
NM_018243chr4104034 3732 3433 3344 3080 1477 1145 1040 504 277 23394 827 ----
NM_018293chr372943 2479 2292 2198 1872 753 740 11110 --137
NM_018323chr431322 1161 441 --21606 423 11827
NM_018339chr951715 1319 1174 546 369 --21521 1471 11257
NM_018340chr16104246 3778 1878 1613 1154 590 490 177 98 61 13174 23996 911 --
NM_018364chr194075 3978 3793 3513 1460 1118 861 668 213 --13083 --
NM_018373chr14126267 6243 5245 4820 4706 2237 2124 2092 1952 847 645 542 14148 12491 15364
NM_018374chr765166 5102 3930 3544 1446 828 13328 23768 3730 --
NM_018429chr53347 242 213 12059 12891 21771 73
NM_018440chr8138655 7141 6922 6847 6187 6000 2656 1732 1591 990 867 385 168 13476 36511 3200 1503 --
NM_018452chr6_random83184 2551 1441 1249 933 473 352 287 1372 23607 3412 1224
NM_018482chr872543 2395 2319 1769 893 318 288 1844 12369 --
NM_018489chr152266 2171 1922 478 81 1908 21618 195 1486
NM_018566chr1114952 4915 4824 4761 4514 4253 3847 1822 1233 879 711 24706 3669 ----
NM_018638chr12105487 4192 3808 1873 1662 1587 1352 1313 535 158 23725 1953 35242 1188 868 --
NM_018844chr751824 1494 1353 1343 745 --1417 2818 791
NM_018947chr7115032 4937 4394 3902 3068 1593 1317 1153 981 721 33 1197 --1645
NM_018970chr7102825 2513 2314 2286 2064 1044 869 789 146 106 12577 12521 1571
NM_019001chr394216 4184 3896 3311 1958 1816 1805 1439 676 11700 23960 3245 --
NM_019035chr451818 1442 650 527 44 22033 843 196 --
NM_019050chr472206 1960 1912 1600 1497 322 300 ------
NM_019072chr5134169 4062 4052 3983 3907 3826 3292 3141 3128 3085 2960 2824 574 1462 ----
NM_019094chr1242769 2704 2630 1420 23295 657 43729 2489 2463 173 --
NM_019555chr391641 1624 1618 1213 643 423 293 74 27 ----11365
NM_019610chr152093 1625 1603 789 766 --22020 1420 --
NM_019859chr1091226 1158 640 527 486 396 129 51 39 1241 2554 279 11236
NM_019860chr1091274 1206 575 534 444 177 99 87 54 1289 2602 327 11284
NM_019903chr1021781 267 ----21936 1692
NM_020133chr6126385 6148 6073 5987 5313 5159 4990 2272 1486 1365 1094 882 --35272 4408 1183 16191
NM_020144chr772111 1573 442 338 219 116 60 ----11497
NM_020337chr462916 2775 1158 1014 796 23 --12757 1160
NM_020390chr354437 4316 4271 1796 1359 13773 74930 4798 4625 3735 3430 1941 696 23452 878
NM_020463chr221416 256 11233 21312 1091 1128
NM_020466chr6124881 3944 3816 3272 3225 1974 1949 1648 763 735 206 145 --1570 --
NM_020673chr20177392 7189 6756 6690 6644 6437 6287 6152 5510 5370 3038 2792 2527 2007 1572 1521 373 --25137 2596 --
NM_020699chr195339 4874 1267 1132 1097 252 143 129 121 --11309 --
NM_020718chr1686551 6509 5184 5075 4648 4473 1217 872 --36071 6043 2527 11935
NM_020727chr2173946 3442 3268 3032 2865 1214 426 22775 605 13653 --
NM_020728chr7133173 3108 3101 2911 2905 2598 2592 1989 1228 975 400 351 125 ----1795
NM_020734chr1273293 2889 2617 2310 1214 1192 198 33002 2513 658 ----
NM_020766chrX134480 3818 3350 3253 2999 1317 1275 1227 958 710 247 157 52 --14336 11201
NM_020772chr1778434 7785 7487 7415 2789 2044 709 15910 26119 5950 16700
NM_020774chr18105321 5302 4705 2505 2025 1840 1809 1021 767 714 44101 2340 1670 478 35804 1422 1101 24432 4269
NM_020778chr15114675 4472 4174 3635 3575 3557 3295 3168 1459 805 52 14945 1243 14936
NM_020779chr292936 2912 2637 2196 1298 1262 1105 1071 692 --33115 2950 834 12045
NM_020813chr1962738 1007 684 567 280 147 --22407 248 32603 2459 2425
NM_020830chr262405 1314 888 865 255 35 31322 1238 98 1350 --
NM_020841chr1233015 2603 420 1313 13179 11427
NM_020844chr897300 7138 2652 2024 1553 1544 1532 543 425 14884 36557 4960 2975 21322 371
NM_020917chr1973679 3444 2907 2545 1225 848 700 22566 324 23100 2761 --
NM_020918chr1063162 3020 2302 1325 900 632 1493 1678 13012
NM_020921chr14123497 1479 1339 1268 1227 831 804 735 679 456 147 45 1592 23347 759 --
NM_020935chr2104235 3770 3579 3248 1828 1314 1145 572 389 115 12853 14265 --
NM_020948chr163319 2641 2567 2472 1153 461 --2482 99 --
NM_020964chr18124798 4608 4079 3554 3231 1628 1286 1157 1071 896 746 497 11730 ----
NM_021033chr13103502 3321 3168 2515 2286 2212 2152 970 646 138 1936 ----
NM_021116chr7137906 7854 6914 6873 6170 5592 3025 2666 2477 1763 925 434 192 17990 43537 2465 1229 1153 --
NM_021191chr1272244 2209 1898 993 617 242 117 ------
NM_021249chr1461092 1060 636 626 214 107 ----1306
NM_021255chr1463991 3854 3539 2968 473 194 --13940 13726
NM_021622chr1062084 1946 1681 1659 693 306 1589 21534 772 --
NM_021629chr374587 4088 1646 936 784 414 289 --43474 3180 1253 1220 --
NM_021638chr474773 4761 4148 3992 3514 1740 1207 1795 24430 4315 --
NM_021647chr4104714 4468 4408 4144 3915 3699 1476 984 756 225 --14420 11604
NM_021813chr6145438 5367 4903 4837 4552 4518 4247 3959 2302 1909 1206 546 387 226 --24540 2199 --
NM_021814chr661639 1259 638 618 433 109 11144 --11701
NM_021911chr5125468 5102 4852 4794 4226 4094 3971 3399 1042 701 561 243 24614 3667 25253 1677 14507
NM_021914chr1482232 1925 1771 1660 1585 923 632 156 169 11602 --
NM_021954chr1383655 2943 2557 2369 1049 1022 616 25 --3895 847 713 --
NM_021961chr11137328 5488 5421 2877 2324 1977 1954 1849 1575 1434 1060 709 355 --14655 16707
NM_021964chr3116100 5576 5419 5384 4766 4238 2513 2293 2064 427 42 --32376 1390 697 21876 1127
NM_022048chr1585777 5557 5009 2436 1290 1250 1124 131 11461 34829 4806 4751 --
NM_022166chr16105197 4471 2472 2153 1786 1127 994 846 162 48 --26254 4439 11227
NM_022351chr893681 3382 3352 3077 2512 1311 941 787 42 --12431 22597 924
NM_022456chr1287563 6970 5694 2468 2453 2194 1997 1328 --11556 1345
NM_022459chr1386027 5988 3977 2173 1585 921 279 154 26359 1865 25686 5143 --
NM_022473chr1594383 4001 3889 3815 3570 2942 1154 1053 201 --53430 2867 1082 604 500 14102
NM_022719chr22123677 3574 3509 3361 3331 3320 3307 3014 2601 1165 785 507 --11314 13826
NM_022802chr1041645 1061 279 61 --21600 52 1527
NM_022828chr551616 1285 1228 1178 251 --1522 1225
NM_022841chr1552578 1040 570 445 279 ----1189
NM_022893chr282988 2375 1259 1150 687 570 364 139 --1545 --
NM_022912chr272890 2412 2141 1982 1943 1880 346 ----12986
NM_023000chr1451675 518 380 206 28 --21381 1338 11060
NM_023001chr1451675 518 380 206 28 --21381 1338 11060
NM_024052chr1772836 1074 951 884 705 618 195 --33160 2890 1132 --
NM_024095chr1271499 1000 985 592 372 293 79 1977 31566 1067 88 --
NM_024341chr1923329 1455 32982 2539 545 33820 1262 849 24082 1286
NM_024345chr9125815 5303 5148 4583 4190 4096 3749 3725 3714 3705 1168 787 31913 1522 942 14536 --
NM_024524chr352874 2790 929 182 160 137 12510 --
NM_024561chr13------21210 1157
NM_024611chr15103773 3282 2992 2489 1500 1208 972 452 294 46 --33433 2525 37 12935
NM_024627chr22124169 3774 3143 3091 3033 1979 1954 1513 1422 1166 727 601 --13223 13243
NM_024665chr3124092 4082 3708 2918 1806 1599 1259 823 412 304 274 245 1456 ----
NM_024761chr994400 3728 1984 1804 1598 1155 911 677 109 --31214 631 129 --
NM_024770chr2166524 6388 6218 6181 6001 5986 5417 5403 5096 5014 4440 2485 2406 2176 1137 547 --16611 15057
NM_024817chr1575964 5775 4735 4386 4187 3680 58 --45142 4059 1499 280 11704
NM_024920chr441303 1228 1082 115 11101 --1167
NM_024947chr3198983 8433 8367 8072 7601 7270 7146 6689 5902 3804 3166 3135 2778 2741 2674 2043 1420 660 27 --49154 8029 7831 1211 --
NM_024949chr485001 4418 4139 3994 3805 1803 1393 1014 13266 34755 4182 1090 --
NM_024989chr2167337 6770 6324 6257 5277 3216 2882 2493 1866 1732 1495 1084 784 570 492 133 12637 1281 11042
NM_024991chr10113221 2887 2477 1115 882 816 697 618 572 181 121 ----11056
NM_025054chr844197 3772 1640 1071 23295 809 1494 34227 4172 1407
NM_025146chr352429 1902 919 857 377 1385 12559 11060
NM_025160chr163908 3695 3053 2715 1481 390 23834 3216 2826 752 --
NM_025179chr1144607 3847 3798 3762 3609 3542 3457 3155 1674 1028 650 521 390 287 --1197 --
NM_030579chr1663429 3033 2773 2623 2424 905 13600 12555 11417
NM_030627chr532757 430 106 21595 1416 34086 1442 1183 1703
NM_030647chr7155764 5583 5498 5452 4409 4350 4302 3992 3970 2050 1549 863 554 126 91 36037 4096 506 24264 1777 --
NM_030648chr4114079 3965 3799 3549 1862 995 633 532 325 317 244 --13706 13583
NM_030650chr273991 3715 3140 1478 1437 559 241 --21021 623 1886
NM_030674chr12125794 5379 5296 5024 4982 4044 2265 2056 1996 1575 150 102 --15191 --
NM_030755chr1442458 2329 2276 45 --22540 210 1747
NM_030806chr1239278 8940 8827 7866 7662 7573 7371 7064 6146 3560 3516 3150 2886 2735 2570 2361 2162 1788 1410 1296 1258 96 45 29259 6123 48640 7874 2083 1912 19102
NM_030918chr1104647 3893 3707 3665 2014 1844 1008 885 567 346 24831 3699 14073 --
NM_031243chr742179 1645 71 39 --32332 912 254 12117
NM_031271chr82337 253 --31371 1154 650 11411
NM_031435chr1283235 2699 2598 1400 1195 1047 573 290 12142 23430 882 13269
NM_031442chrX42899 1167 715 349 12140 1108 12001
NM_031469chr683740 3493 3414 3144 3117 1339 883 451 --13225 13426
NM_031844chr153208 2980 2937 2552 372 ----13858
NM_031845chr221280 71 1164 1597 11313
NM_031847chr221280 71 1164 1597 11313
NM_032105chr1167931 7385 7096 6145 5792 5722 5535 5451 4938 3221 2506 1336 1235 657 598 347 18105 15749 16090
NM_032160chr1874303 3552 3512 3082 2743 2665 994 ------
NM_032186chr16571 512 304 266 101 22 1255 11378 1161
NM_032189chr13115035 4541 4445 4201 4102 4089 3143 1963 1624 1542 745 11445 ----
NM_032199chr1063831 3022 2644 1144 850 396 --22616 835 --
NM_032208chr273235 3107 3085 2822 1326 712 168 --32932 2246 260 --
NM_032373chr10105455 5099 4815 3587 2163 1777 1065 801 405 76 --21943 1009 --
NM_032445chr15122544 2375 2304 2193 2166 2151 1978 1816 1629 824 682 495 11708 2854 63 --
NM_032446chr533181 1388 813 ----32820 1326 663
NM_032457chr473757 3410 3367 2566 1523 1494 443 --23425 2700 11132
NM_032458chrX63054 2628 1331 605 597 330 --12829 11243
NM_032505chr312106 32078 917 79 12661 1271
NM_032622chr431356 42 27 11026 --11274
NM_032632chr1442056 2014 610 212 ----11316
NM_032778chr373116 2448 2109 1180 1121 738 185 --2652 630 --
NM_032826chr7155365 4984 4095 4000 3917 3798 3564 1826 1625 588 383 230 212 200 178 15093 ----
NM_032859chr1393633 3135 1567 1488 1231 1102 861 734 500 --21125 151 --
NM_032869chr852037 471 391 265 66 11447 21602 1538 --
NM_032932chr17156406 6333 6277 5948 5743 5097 4121 4109 4065 2466 2083 2027 1818 745 621 --16469 --
NM_032968chrX83337 3270 2578 1188 779 156 116 110 14123 34135 3879 2754 23905 1334
NM_032969chrX83337 3270 2578 1188 779 156 116 110 14123 34135 3879 2754 23905 1334
NM_032973chrY83332 3265 2577 1188 779 156 116 110 14115 34127 3871 2749 23897 1334
NM_033020chr163511 3147 1783 1540 1175 1149 --21626 984 1923
NM_033030chr241473 1335 1041 309 31398 605 463 --11296
NM_033133chr1793484 3323 2979 1435 1405 784 771 748 528 ----12571
NM_033143chr494643 4472 3850 3640 3308 1414 1256 77 33 --1188 --
NM_033181chr663450 3421 3124 1010 892 256 1952 31588 1465 532 --
NM_033224chr7127800 7349 6372 5992 5767 2017 1902 1075 586 381 233 165 37050 2720 2092 63212 2234 1310 808 770 190 --
NM_033290chrX113394 3202 2957 2942 1367 1165 987 907 867 577 491 138 33570 2829 759 --
NM_033360chr1274129 4092 3950 3866 3144 3121 279 --14661 13832
NM_033389chr17114725 4680 4111 3409 3266 1820 1707 873 855 666 364 --23849 2993 --
NM_033426chr1452404 2307 2084 759 281 --21096 839 1669
NM_033429chr1572917 2600 2530 2328 1994 520 510 --13214 1973
NM_033430chr4123336 3330 3024 2917 2645 1660 1031 982 711 629 620 513 11070 13795 --
NM_033437chr4123336 3330 3024 2917 2645 1660 1031 982 711 629 620 513 11070 13795 --
NM_033505chr2126457 6410 5894 4671 4318 4295 2316 1623 1336 988 786 600 1415 1495 14718
NM_033512chr832189 2104 1995 --13055 23047 642
NM_033637chr10113372 3177 2962 2731 2641 1573 1564 1002 845 547 389 191 13521 --
NM_033656chr21125673 5494 4715 4337 3915 3844 3815 2226 2064 1799 1024 861 23985 241 35968 5192 2163 11211
NM_052879chr1264141 3778 3460 3159 1383 962 11523 12964 23250 1279
NM_052885chr1274046 4022 3956 3725 1937 1319 54 14296 34322 839 263 --
NM_052896chr182186 1658 1651 914 871 665 269 241 1529 --12381
NM_052907chr1293241 2705 1345 1294 1113 234 197 135 60 --33103 1601 1238 --
NM_052910chr1382145 2086 1930 1858 1638 1597 1467 295 ----11701
NM_052932chr1142390 334 109 71 ----1102
NM_052937chr832622 2476 2425 1255 --12381
NM_053016chr986550 6260 5783 5489 2329 1971 1851 1323 26067 1415 46508 5317 2138 956 15469
NM_053043chr7144985 4936 4783 2458 2336 2130 2100 2038 1597 1529 1495 1321 814 590 ------
NM_057175chr472395 1769 1709 925 690 385 325 --1128 --
NM_080546chr962050 1919 1529 589 354 168 --11470 11856
NM_080676chr2083155 2645 2588 2476 2376 2099 2048 470 21136 456 1403 --
NM_080717chr1231420 1401 1218 ----21137 80
NM_080867chr14124386 4280 4208 4155 4034 3973 3930 3580 1743 1249 624 194 34642 4630 1204 11945 --
NM_080872chr8103510 3409 3002 1412 1132 872 611 475 354 22 ------
NM_130435chr1042437 2426 431 411 --32509 1045 368 1963
NM_130436chr2152498 2014 1083 968 671 --42630 2363 2033 911 11902
NM_130438chr2173075 2591 2285 2257 2164 1248 100 --33207 2940 2610 12479
NM_133170chr20187931 7245 7228 5848 5678 5617 5456 5383 3167 3161 2971 2900 2223 1871 1227 1112 675 253 --22992 2147 --
NM_133334chr4116330 5694 5574 4677 4060 3887 2520 1884 1769 817 143 11002 34726 1399 542 --
NM_133370chr493320 3063 2720 2659 2274 1347 1208 243 208 --11227 --
NM_133372chr5112784 2576 1175 602 596 502 462 348 341 56 37 --22540 377 --
NM_133477chr443201 3052 2272 2235 ----12360
NM_133493chr664427 4167 4124 1714 1587 404 --11600 13030
NM_133646chr275613 4329 3752 2081 1678 831 183 45199 3729 1820 1511 24770 3464 32162 1150 83
NM_133647chr1583799 3781 3687 3548 3239 1327 422 254 12473 1810 --
NM_138270chrX53206 3124 2949 655 155 1273 22188 97 --
NM_138423chr15102100 2081 1868 1685 813 428 366 312 304 233 --1323 --
NM_138444chr1394497 4167 4111 3337 3092 1943 1635 1047 802 23406 661 --24664 3933
NM_138459chr683371 3332 2997 2894 2545 1430 1397 274 ------
NM_138468chr286275 6215 6046 5533 4727 1716 718 140 34381 1826 892 14287 1456
NM_138633chr621208 1198 21344 1222 ----
NM_138638chr1482232 1925 1771 1660 1585 923 632 156 169 11602 --
NM_138713chr1698270 7304 5462 3032 2990 2140 1052 624 221 --15093 11097
NM_138714chr1698270 7304 5462 3032 2990 2140 1052 624 221 --15093 11097
NM_138731chr1463404 2774 1141 1131 1094 1014 --23046 99 14033
NM_138809chr5102760 2510 2240 2163 2079 1976 1796 1123 1069 1023 --21770 61 --
NM_138971chr1173796 3707 3262 623 615 488 196 --23641 2438 12720
NM_138971chr1173796 3707 3262 623 615 488 196 --23641 2438 12720
NM_138972chr1173796 3707 3262 623 615 488 196 --23641 2438 12720
NM_138972chr1173796 3707 3262 623 615 488 196 --23641 2438 12720
NM_138973chr1173796 3707 3262 623 615 488 196 --23641 2438 12720
NM_138973chr1173796 3707 3262 623 615 488 196 --23641 2438 12720
NM_139168chr531953 1852 77 --1589 11360
NM_139321chr20104150 3529 2778 2755 2701 1480 989 883 808 617 --13056 --
NM_139323chr2041593 753 328 158 --12008 11946
NM_144571chr4115533 4850 4678 4592 2413 2365 1280 1039 870 787 307 --46824 6687 5017 4742 --
NM_144578chr1454101 3515 1504 1185 270 34627 3592 2011 21311 1029 --
NM_144599chr15105064 4898 4649 4471 4273 3978 3788 3610 316 205 32197 1815 574 24105 1217 --
NM_144664chr1112113 1247 3948 393 256 --
NM_144766chr12104 23 ----132
NM_144775chr1794527 3466 3430 3086 1823 1339 1106 1052 449 --54163 3911 3534 3222 76 --
NM_144949chr272598 1837 708 612 359 245 83 21674 878 --157
NM_144973chr1274657 4650 3937 1909 1513 843 194 35030 3477 78 ----
NM_145055chr1893856 3756 2844 2838 2498 2329 708 519 512 ------
NM_145206chr1083138 2981 2365 2142 1270 438 283 26 --22549 837 --
NM_145259chr2126863 6671 6357 5561 2714 2080 1192 1185 1077 788 617 349 36167 1556 1528 --25218 111
NM_145307chr1084586 3610 1547 1134 1062 1033 970 210 13440 43971 3159 2916 1171 --
NM_145320chr783388 3189 2811 2602 2325 1186 919 475 ----1758
NM_145321chr783388 3189 2811 2602 2325 1186 919 475 ----1758
NM_145322chr783388 3189 2811 2602 2325 1186 919 475 ----1758
NM_145686chr283324 2088 1291 1272 1126 480 449 362 22328 835 --23272 2933
NM_145687chr283324 2088 1291 1272 1126 480 449 362 22328 835 --23272 2933
NM_148571chr1771524 1462 1445 1337 508 423 33 --2838 580 1781
NM_148955chr15106407 6097 5835 5824 5191 4723 2057 1966 436 203 --24394 2343 11947
NM_152233chr1461092 1060 636 626 214 107 ----1306
NM_152352chr1873013 2672 2614 854 549 512 501 2829 227 2370 236 --
NM_152388chr293860 3449 3375 3189 2731 1622 1562 1078 809 --31110 333 273 --
NM_152409chr5113093 2960 2809 2627 2548 2276 1363 969 646 563 304 --12973 --
NM_152433chr1121453 594 11093 1143 1512
NM_152444chr1461127 793 460 376 357 225 11264 11145 --
NM_152622chr592782 2730 2453 1336 1113 1078 621 523 351 ------
NM_152624chr5147289 7081 7039 7024 6445 6372 6157 6100 5813 4703 4674 2311 1548 726 45856 1079 941 374 45380 4693 2774 1570 --
NM_152629chr9113793 3430 3298 2766 2741 1564 1535 1306 1204 830 372 23217 2652 13397 --
NM_152699chr3103651 3534 3474 3325 3300 3136 2868 2283 1489 269 23332 423 13463 --
NM_152734chr6115234 5095 4872 4324 4066 3431 3352 1541 1479 314 25 --21705 521 --
NM_152754chr773595 3365 2796 856 844 404 235 13013 1297 --
NM_152756chr5154120 3578 3081 2918 2716 1665 1325 1319 1254 836 573 433 326 145 100 11049 12853 --
NM_152774chr772707 2568 1949 996 790 414 272 --22248 79 --
NM_152787chrX53796 2454 1470 1305 618 23530 3254 13076 13930
NM_152826chr15106407 6097 5835 5824 5191 4723 2057 1966 436 203 --24394 2343 11947
NM_152835chr142690 2677 2167 51 --12042 11107
NM_152838chr2042412 2338 384 334 11030 33154 2961 553 --
NM_152903chr1362697 2682 2605 2096 2051 1938 1924 12437 12796
NM_152924chr15126390 5323 5045 4618 4602 4376 4294 2245 1798 1512 517 366 --46157 4968 4928 2194 --
NM_152996chr142060 1568 419 340 1715 --11664
NM_152999chr784201 3731 3334 1951 1690 1391 693 521 13390 13962 --
NM_153182chr373116 2448 2109 1180 1121 738 185 --2652 630 --
NM_153188chr555526 4019 3687 1773 586 --45270 4907 4884 1974 2440 313
NM_153207chr1283705 3263 1528 1396 764 524 439 283 --23391 601 23640 3552
NM_153234chr572509 2340 499 401 367 340 216 1584 12801 1578
NM_153262chr152831 1289 984 734 242 11968 32326 1104 21 12753
NM_153332chr862692 2251 1243 788 231 155 1212 --12167
NM_153365chr482185 1769 950 872 784 778 255 69 1579 22305 434 --
NM_153607chr512172 --42585 2567 1240 378 1305
NM_153619chr1573319 2415 2344 1100 992 835 100 23326 2272 22766 2397 1690
NM_153712chr293084 2974 2803 2783 1510 1252 599 484 206 22669 1206 23054 2990 --
NM_153810chr1094704 3814 3745 1702 1679 1231 966 734 441 11323 ----
NM_170665chr12114539 4387 3760 3269 3081 2810 1777 1272 1254 1137 391 13671 1306 14438
NM_170706chr164341 3906 3291 2825 2746 846 1761 41675 1541 1350 1319 23826 3807
NM_172071chr1107111 7060 6917 5742 4583 2385 1588 701 514 467 22152 221 44937 2442 1113 891 37148 2729 520
NM_172240chr122482 419 --21161 384 1876
NM_173198chr962891 2778 2472 2113 394 113 ----21161 1125
NM_173200chr962891 2778 2472 2113 394 113 ----21161 1125
NM_173214chr1698270 7304 5462 3032 2990 2140 1052 624 221 --15093 11097
NM_173468chr4125765 5682 5657 5595 4288 3920 2236 2029 1652 662 558 433 34699 1744 1294 36095 5788 42 11581
NM_173495chrX92472 2352 2291 1768 960 905 327 151 109 1463 1650 --
NM_173510chr2262851 2575 2242 1831 567 397 1483 31813 1148 209 --
NM_173536chr484348 4012 3995 2080 2037 1751 1265 636 24881 123 44965 4743 1960 1033 --
NM_173552chr372082 1687 1596 941 697 524 38 --11763 --
NM_173582chr11176323 6182 5744 5145 4803 4740 3888 2319 2116 1121 991 729 661 553 523 381 44 16153 45654 5482 2444 739 14542
NM_173642chr1188130 7941 7607 7521 7134 6638 6387 6270 6057 3518 3115 2672 2516 1851 1799 1608 1551 1072 38435 8376 309 25652 3012 26850 1175
NM_173694chrX62119 807 559 553 437 54 22334 364 22491 1047 1537
NM_173808chr152791 1517 1261 104 84 1846 11621 23842 202
NM_173829chr545114 4587 1695 354 34500 2387 1911 35960 2394 2011 --
NM_173851chr873865 3846 3130 2970 1482 828 746 11164 33224 3102 386 --
NM_174902chr1161771 1503 720 582 311 288 --11274 1302
NM_174911chr893726 3091 3057 2745 2661 2595 1374 1051 988 --21265 622 --
NM_175061chr751985 1552 1510 59 41 11974 31897 1886 700 --
NM_175623chr1287563 6970 5694 2468 2453 2194 1997 1328 --11556 1345
NM_175624chr1297658 7065 5789 4714 2563 2548 2289 2092 1423 --11651 1440
NM_175625chr1297658 7065 5789 4714 2563 2548 2289 2092 1423 --11651 1440
NM_175736chr12227779 7034 6848 6307 6224 6217 6158 6136 6014 5963 5802 5441 5171 4955 2384 2170 2031 2017 1845 1613 1063 291 37353 6793 6486 27084 6146 16901
NM_175767chr541477 1378 1159 414 41718 1368 133 94 11599 --
NM_175854chr1362235 2084 1008 967 791 106 22786 1108 --1682
NM_175861chr12125472 4932 4869 4229 3842 3737 2073 1833 1608 1355 1167 196 11786 11341 1830
NM_175873chr551142 979 580 353 239 11003 21504 1386 11031
NM_175907chr1852828 1142 1021 713 683 --1417 22523 2037
NM_176081chr1075955 2038 1779 1570 1310 1251 1239 21379 819 25799 1614 15769
NM_176083chr1075955 2038 1779 1570 1310 1251 1239 21379 819 25799 1614 15769
NM_177974chr15102100 2081 1868 1685 813 428 366 312 304 233 --1323 --
NM_178151chrX157427 7392 7244 7154 7130 6835 6780 6445 5957 2794 2788 1193 1074 750 643 12397 36383 5862 1385 37527 7275 1119
NM_178152chrX157427 7392 7244 7154 7130 6835 6780 6445 5957 2794 2788 1193 1074 750 643 12397 36383 5862 1385 37527 7275 1119
NM_178153chrX157427 7392 7244 7154 7130 6835 6780 6445 5957 2794 2788 1193 1074 750 643 12397 36383 5862 1385 37527 7275 1119
NM_178509chr1783979 3238 2874 2821 2708 702 630 86 --177 --
NM_178566chr981726 1668 1493 1244 553 319 149 79 ----1383
NM_178585chr483264 2112 2042 909 809 429 198 155 1266 31155 712 84 --
NM_180989chr1372225 750 732 522 343 114 105 --1644 1148
NM_181443chr2082864 2609 2519 2483 658 421 397 363 --2782 491 12647
NM_181481chr18126800 6072 5500 5249 4454 2461 2187 1478 1468 983 797 264 15671 34585 2701 214 --
NM_181482chr18126800 6072 5500 5249 4454 2461 2187 1478 1468 983 797 264 15671 34585 2701 214 --
NM_181483chr18126800 6072 5500 5249 4454 2461 2187 1478 1468 983 797 264 15671 34585 2701 214 --
NM_181486chr1231420 1401 1218 ----21137 80
NM_181489chr3126486 6335 5808 5345 5213 4612 4258 2447 1696 745 441 22 11689 ----
NM_181504chr584196 3661 3078 2612 1534 766 741 677 --12757 --
NM_181523chr584196 3661 3078 2612 1534 766 741 677 --12757 --
NM_181524chr584196 3661 3078 2612 1534 766 741 677 --12757 --
NM_181659chr2083334 3040 2903 2821 2311 2229 771 233 32661 680 664 --12099
NM_181659chr2083334 3040 2903 2821 2311 2229 771 233 32661 680 664 --12099
NM_181705chr595166 5132 4777 4445 4100 3792 3685 3649 597 1957 35660 4236 667 15300
NM_181836chr542569 2559 2192 745 --11998 21838 637
NM_182485chr443689 2372 1458 414 13222 12976 --
NM_182501chr283030 929 827 645 345 182 175 161 --13099 12577
NM_182503chr6105259 4409 4044 3875 3597 2158 1845 1554 873 660 --33749 3564 190 11778
NM_182646chr443689 2372 1458 414 13222 12976 --
NM_182703chr1531349 1298 920 11146 --2940 519
NM_182848chr1361463 1352 544 449 400 371 --1212 --
NM_182896chr32422 386 ----1570
NM_182898chr7146312 6143 6073 5159 4428 4403 4364 4300 4033 1689 1351 1271 1194 392 44626 4106 2325 1903 --1824
NM_182899chr7146312 6143 6073 5159 4428 4403 4364 4300 4033 1689 1351 1271 1194 392 44626 4106 2325 1903 --1824
NM_183004chr1463708 2962 2665 1523 1455 578 129 33643 3215 2980 --
NM_183238chr12103015 2476 1244 1049 1019 976 810 707 320 145 --42726 521 472 180 --
NM_194071chr795287 5244 5219 4915 4362 4055 1180 296 277 --25495 5124 1733
NM_194247chr264179 3257 2927 1803 661 169 34233 4006 2763 53954 3752 3532 1792 82 --
NM_194291chr842862 2653 883 235 193 --23006 87
NM_194298chr1041637 1438 513 469 ----11592
NM_194314chr193868 3630 1384 1334 1179 995 950 874 121 13855 24610 1510 --
NM_197970chr241473 1335 1041 309 31398 605 463 --11296
NM_198270chrX113434 3087 2876 2775 1291 1238 905 484 268 158 64 --32384 1055 1016 1967
NM_198336chr761703 1589 1569 1443 409 370 --11499 11758
NM_198400chr1562603 2319 1987 1888 1826 679 12246 1307 2849 150
NM_198404chr13--1144 --2746 224
NM_198439chr1121453 594 11093 1143 1512
NM_198465chrX102687 2678 2323 2017 894 879 839 349 278 145 22361 288 --42818 2647 1958 1950
NM_198581chr2126775 6737 5324 4857 4646 4595 1958 1254 941 715 641 512 36022 5852 976 35161 1897 1359 1392
NM_198595chr474773 4761 4148 3992 3514 1740 1207 1795 24430 4315 --
NM_198715chr196175 4936 4536 4447 4200 3858 1517 379 205 24470 1823 14904 --
NM_198793chr363452 3413 1554 1201 871 172 1269 23298 641 --
NM_198794chr1431220 457 169 --1239 11298
NM_198859chr384173 4118 4030 1485 1389 1246 1171 1020 14425 13715 --
NM_198900chr12227779 7034 6848 6307 6224 6217 6158 6136 6014 5963 5802 5441 5171 4955 2384 2170 2031 2017 1845 1613 1063 291 37353 6793 6486 27084 6146 16901
NM_198935chr2073136 2878 2539 1146 926 685 184 12836 12412 12856
NM_199040chr1242769 2704 2630 1420 23295 657 43729 2489 2463 173 --
NM_199188chr1264141 3778 3460 3159 1383 962 11523 12964 23250 1279
NM_199190chr1264141 3778 3460 3159 1383 962 11523 12964 23250 1279
NM_199421chr14124386 4280 4208 4155 4034 3973 3930 3580 1743 1249 624 194 34642 4630 1204 11945 --
NM_199436chr272874 2496 1958 697 346 156 86 --22802 653 1410
NM_199462chr1144327 4238 3734 3410 1829 1723 1466 1105 987 561 409 362 335 163 --23697 1744 --
NM_201269chr16571 512 304 266 101 22 1255 11378 1161
NM_201613chr128870 699 664 345 279 201 107 89 ----1333
NM_203327chr2074214 3684 3377 2965 1415 1273 125 24547 3643 34295 1540 550 --
NM_203390chr831886 1454 1314 --31853 508 399 1143
NM_203446chr2162829 2249 2098 1836 480 446 22492 2474 32506 1082 831 11046
NM_203458chr1102538 2518 2396 1141 1135 656 545 534 412 61 11491 12936 13634
NM_203463chr2103977 3518 1826 1633 1320 641 573 458 331 136 23643 226 ----
NM_203504chr432363 1699 978 --42056 1964 564 381 --
NM_203505chr432363 1699 978 --42056 1964 564 381 --
NM_205848chr1102679 2346 2290 2236 1999 1076 1015 885 81 27 12200 1194 --
NM_205860chr192987 2924 2333 2258 630 592 324 314 72 --22345 984 --
NM_206853chr644133 3768 3586 98 13483 13085 23995 3727
NM_206854chr695394 5029 4847 3343 3321 1359 1276 1140 776 14744 24346 1126 35256 4988 995
NM_206855chr6116359 5994 5812 4308 4286 2324 2241 2105 1741 798 787 15709 25311 2091 36221 5953 1960
NM_206866chr21113281 3077 2780 2255 1232 1118 1071 793 608 476 328 --12175 --
NM_206907chr562694 2379 1256 1199 468 441 1460 1516 12497
NM_206909chr8147911 7868 6905 6800 6578 6409 5916 5536 3114 1896 1352 1014 589 43 48041 6175 1492 793 58363 8129 5590 2566 110 --
NM_207406chr4106005 5741 5347 5200 4046 2028 1496 550 271 139 25156 4484 1570 1662
NM_212460chr741472 767 701 61 21634 568 11932 --