TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4522
miRNA Sequence: UGACUCUGCCUGUAGGCCGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000112chr565226 2152 2028 1959 1819 746 ----23356 189
NM_000259chr1544987 3878 1890 928 --24562 4289 15656
NM_000337chr586144 5767 5588 5112 4513 4310 2121 1963 14008 --11334
NM_000555chrX56448 6246 2035 677 29 --123 --
NM_000618chr1246571 1981 935 759 16238 15781 --
NM_000618chr1246571 1981 935 759 16238 15781 --
NM_000719chr1275439 4818 4519 1160 1096 953 220 35716 5461 5080 14326 16624
NM_000809chr486565 3052 2265 1409 1230 1112 879 526 39072 2992 149 27330 6809 11106
NM_000813chr574181 3916 3591 2093 1781 1117 748 21332 731 14462 11004
NM_001001928chr2298327 6678 6411 3253 2998 1800 1696 1432 1384 16920 11014 28317 2206
NM_001004419chr1222950 1521 --13010 1956
NM_001008239chr1853859 3759 2745 2332 768 11249 11105 --
NM_001008405chr71259 --11745 21283 234
NM_001010867chr1106356 6187 5616 4719 2614 2005 1858 1686 482 289 --55164 5020 707 418 70 12380
NM_001010888chrX74066 3904 3552 1838 1368 504 110 1918 2717 375 1220
NM_001010891chr576455 5685 2374 1540 1408 884 695 --46345 6062 5104 2521 --
NM_001014797chr1077185 6472 6191 5078 2871 2244 1034 --47989 7702 7047 5404 17623
NM_001017395chr373261 3071 2237 1349 884 874 105 33406 1275 58 ----
NM_001018065chr995050 4738 4632 3869 2402 2093 849 650 82 ----11268
NM_001018066chr995050 4738 4632 3869 2402 2093 849 650 82 ----11268
NM_001031732chr443530 3339 3279 3157 33239 2514 308 --1974
NM_001034841chr1633830 646 202 25362 4202 34395 4207 4041 13641
NM_001037165chr7118775 7643 7522 7003 6633 6149 5485 5416 2740 1344 696 16431 48219 5697 1738 993 --
NM_001040284chr1635381 3932 1516 11887 --33839 324 262
NM_001040429chr1313624 ----23275 430
NM_001042413chr912567 --11638 23064 122
NM_001042555chr1264553 1713 1523 1447 1029 253 --14447 --
NM_001106chr388514 8069 7540 3333 2315 2223 2113 1089 16150 26729 1123 19340
NM_001167chrX86627 6275 5668 4483 2176 1877 1647 181 22514 393 --14679
NM_001204chr267633 7323 6576 5089 1628 1409 25485 2271 --1260
NM_001256chr1762765 1993 1869 996 791 416 1305 1358 --
NM_001364chr1174739 1819 1772 1559 1541 1239 1228 11391 ----
NM_001609chr1053024 2870 1253 586 314 --1139 13088
NM_001742chr741801 1624 313 197 1628 --11304
NM_002359chr1783728 3554 2650 1724 799 372 314 278 11565 23969 285 1995
NM_003112chr772727 2367 1293 1278 886 135 90 1680 12098 --
NM_003679chr132385 900 134 11273 12955 1929
NM_003966chr555473 1111 324 224 130 --42956 1871 1818 88 15639
NM_004171chr1158674 6797 3699 2875 2747 26507 6147 38765 1960 1248 21885 808
NM_004586chrX75322 4667 4639 3887 3322 1747 837 1957 ----
NM_004745chr886893 6428 4745 4392 2463 1950 950 754 --21412 165 --
NM_004976chr1195039 4908 4786 4577 3407 651 461 348 300 --11885 25009 3433
NM_004992chrX138540 8051 7359 6236 5987 5941 5890 2415 1823 726 671 157 141 15958 11711 16853
NM_004992chrX138540 8051 7359 6236 5987 5941 5890 2415 1823 726 671 157 141 15958 11711 16853
NM_005036chr2298327 6678 6411 3253 2998 1800 1696 1432 1384 16920 11014 28317 2206
NM_005160chr2265554 4265 1472 1448 122 21 35216 5188 1491 21897 44 --
NM_005188chr1198001 7358 6755 5889 5038 1979 1867 1605 1526 26108 953 27252 6568 --
NM_005665chr164053 3783 3601 1758 1008 942 --12990 --
NM_005668chr584445 4249 3806 3747 3119 1473 781 202 14238 14104 --
NM_005933chr1132095 941 527 --1187 11877
NM_005955chr174156 4108 3430 1173 841 580 529 --25069 1869 13445
NM_006252chr176672 5755 5338 4632 4582 1290 932 25580 2127 ----
NM_006654chr1264553 1713 1523 1447 1029 253 --14447 --
NM_007038chr2185656 5157 4768 3988 3924 1661 818 123 ----13726
NM_007050chr2077629 6740 6463 6300 5157 2269 1259 16525 32488 2213 29 12513
NM_012164chr956078 2842 2395 1879 1394 12996 22229 967 1617
NM_013231chr1443933 3063 410 268 12855 --23883 724
NM_013269chr1222877 1448 --12937 1883
NM_014616chr322266 754 33138 2962 454 --1134
NM_014877chr1787526 7238 7020 5829 5142 4926 4781 3072 35729 2271 622 25927 5434 --
NM_015008chr373261 3071 2237 1349 884 874 105 33406 1275 58 ----
NM_015025chr232251 904 316 --12453 11681
NM_015035chr2076360 5068 4376 2257 1547 1490 1139 15981 34062 1163 279 14732
NM_015071chr545607 5484 1698 1576 11828 24747 4452 11464
NM_015310chr8118229 7480 7032 6453 5677 5528 3184 2593 2545 2232 1343 1697 35863 3039 840 --
NM_015314chr721031 121 --21639 695 1235
NM_015568chr2054324 4122 2864 1425 1371 --1476 32730 1220 552
NM_017563chr354502 4423 4369 2508 1822 11619 35767 4483 1083 15576
NM_017637chr968365 8174 3011 1294 263 252 16421 29041 3566 --
NM_018444chr852273 1839 1468 180 162 ----1172
NM_018844chr71501 11289 11987 21525 476
NM_018999chr1054864 3859 3680 1554 289 13803 34310 1927 1191 11305
NM_020935chr264640 4511 4184 4173 1636 419 1342 --11408
NM_021038chr32692 58 ----22593 289
NM_021148chr772092 1877 1797 855 718 630 271 12036 ----
NM_021911chr574181 3916 3591 2093 1781 1117 748 21332 731 14462 11004
NM_021964chr325214 430 16176 --12476
NM_022340chr363637 2419 1111 724 600 97 --21401 663 11287
NM_022735chr1125 192 --2574 238
NM_024947chr359178 9130 5905 3049 1626 23238 578 38076 7193 2678 --
NM_030806chr199463 9357 7720 7150 5716 5708 3038 2869 1689 21850 1529 11212 --
NM_032160chr1854081 3634 1409 254 73 --13054 11650
NM_032458chrX23211 2914 ----1348
NM_032711chr1783728 3554 2650 1724 799 372 314 278 11565 23969 285 1995
NM_033224chr777377 6977 6611 6439 6142 4878 2639 25870 4913 37804 2558 1280 --
NM_033285chr843363 1372 1365 930 13786 --21206 402
NM_033429chr1561000 951 660 646 639 265 12352 12155 --
NM_052885chr1243509 3199 918 462 ----2868 346
NM_133170chr2077629 6740 6463 6300 5157 2269 1259 16525 32488 2213 29 12513
NM_133370chr443530 3339 3279 3157 33239 2514 308 --1974
NM_138468chr265411 4517 3982 2511 1780 1145 26116 5827 1258 --
NM_138959chr146133 4544 2627 2120 14335 24939 1210 26687 6385
NM_145055chr1853859 3759 2745 2332 768 11249 11105 --
NM_152263chr165290 3921 3689 2157 1360 378 14518 15583 16011
NM_152431chr111394 --1335 1269
NM_152629chr912567 --11638 23064 122
NM_152734chr685311 5206 3517 1849 905 858 616 595 25222 5187 11545 25283 4289
NM_172071chr157024 4784 2218 1581 1420 26086 5851 12121 15793
NM_173468chr425495 2163 2953 370 24612 2408 11772
NM_173808chr154114 3848 2943 1051 703 1416 --14021
NM_173825chr322511 1995 12263 --22085 617
NM_174902chr11--31221 1150 1144 --21156 538
NM_178151chrX56448 6246 2035 677 29 --123 --
NM_178152chrX56448 6246 2035 677 29 --123 --
NM_178153chrX56448 6246 2035 677 29 --123 --
NM_181489chr3136521 5070 4994 4868 4556 2460 2450 2177 2066 1783 985 544 156 24390 2075 --12055
NM_182515chr1935075 2620 2164 14990 46039 5837 5051 1321 --
NM_182757chr673319 2626 2168 813 805 670 391 --32949 2602 2308 --
NM_198484chr3105486 5408 4308 2533 2514 1892 1515 1375 103 79 16164 16063 --
NM_198581chr256071 5327 4701 2890 878 22027 1575 36449 5490 4861 --
NM_206853chr633809 2773 2550 --23026 293 --
NM_206854chr635070 4034 3811 --24287 1554 --
NM_206855chr666035 4999 4776 924 730 555 --25252 2519 --
NM_206909chr8118229 7480 7032 6453 5677 5528 3184 2593 2545 2232 1343 1697 35863 3039 840 --
NM_207292chr32692 58 ----22593 289
NM_207293chr32692 58 ----22593 289
NM_207294chr32692 58 ----22593 289
NM_207295chr32692 58 ----22593 289
NM_207296chr32692 58 ----22593 289
NM_207297chr32717 83 ----22618 314
NM_207406chr4106217 5981 5839 5713 5450 5307 2064 976 81 44 26267 1206 ----