TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4524b-5p
miRNA Sequence: AUAGCAGCAUAAGCCUGUCUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52107 54 1975 --11261
NM_000020chr1242403 2318 1890 187 12173 ----
NM_000021chr1441107 1034 720 292 ------
NM_000037chr842469 1905 726 175 --22311 2207 --
NM_000038chr53775 728 50 11504 1344 --
NM_000044chrX164 ------
NM_000074chrX--184 1760 --
NM_000081chr141850 1365 1160 614 --11629 --
NM_000084chrX94950 2654 1855 1653 1517 677 618 541 251 15647 26505 1657 16038
NM_000088chr1711109 ------
NM_000089chr71243 ------
NM_000090chr22859 174 ------
NM_000092chr264330 4320 4192 3078 1693 1417 13634 23918 1241 --
NM_000104chr22646 94 --12207 --
NM_000108chr751747 1536 1429 1175 275 --21640 1312 --
NM_000109chrX31802 1070 236 --11073 --
NM_000110chr12464 22 ------
NM_000112chr565505 5111 3705 1675 1542 1470 25566 1929 24442 4323 14519
NM_000125chr641708 1337 245 40 --11270 --
NM_000127chr82285 54 ------
NM_000129chr621454 1142 ------
NM_000135chr161753 --1329 --
NM_000138chr15--12620 11938 --
NM_000141chr1021147 529 31443 1198 521 ----
NM_000142chr431433 1378 52 --2231 55 11605
NM_000147chr1132 --1481 --
NM_000151chr1721786 1260 --1461 --
NM_000163chr512088 --12099 --
NM_000165chr6--1476 ----
NM_000168chr75942 856 799 374 77 ------
NM_000176chr543848 2751 868 603 ------
NM_000188chr102480 178 ------
NM_000194chrX1159 ------
NM_000208chr19104531 3851 3657 3620 3444 3135 1777 1583 1286 231 --1581 11203
NM_000212chr1741695 882 869 504 ------
NM_000214chr202537 90 11594 11710 --
NM_000217chr1225171 1648 14725 13516 --
NM_000222chr421342 624 ------
NM_000232chr432677 321 119 23178 2901 ----
NM_000245chr732086 1767 1431 ------
NM_000248chr312964 --1701 --
NM_000252chrX41522 1126 399 388 ------
NM_000259chr1554399 4024 3924 1743 379 21847 584 1639 12367
NM_000264chr923176 352 1495 1356 --
NM_000266chrX1272 ------
NM_000267chr1733154 2653 329 32548 2177 800 21259 1247 --
NM_000276chrX32077 2025 801 --12203 --
NM_000280chr11----1106 --
NM_000289chr122255 87 ------
NM_000291chrX--1272 ----
NM_000297chr411427 1125 ----
NM_000304chr172965 145 --1835 --
NM_000310chr131044 825 182 ----11213
NM_000314chr1052472 2263 1252 1020 474 23078 2926 1959 --
NM_000319chr124866 435 314 278 11085 ----
NM_000321chr1321754 1617 ------
NM_000322chr651627 1588 1362 405 366 --11408 11657
NM_000332chr656326 4864 1234 792 461 ------
NM_000333chr32267 146 ------
NM_000334chr173861 637 261 ------
NM_000335chr321917 1607 ----21418 273
NM_000337chr586199 5448 5250 5022 1834 867 773 692 --11904 --
NM_000362chr2243438 2806 2310 1121 12498 --23516 1079
NM_000368chr944843 4407 3796 3191 24534 3428 24022 4019 --
NM_000376chr1263184 2580 2548 1024 224 37 23059 596 --1322
NM_000378chr1111104 1419 ----
NM_000387chr32678 308 1551 ----
NM_000390chrX23325 2291 13257 12918 --
NM_000399chr101319 ------
NM_000408chr283413 3245 2672 2615 1279 1115 762 274 23047 2159 ----
NM_000411chr2132578 2230 2202 ------
NM_000428chr1462480 2333 2217 2194 1981 268 ------
NM_000430chr1793719 3589 3455 2639 2539 2480 2310 1230 357 ----12314
NM_000437chr11135 1711 1360 --
NM_000449chr11161 ------
NM_000451chrX21592 320 ------
NM_000458chr173876 355 143 ------
NM_000461chr354467 4061 3678 3303 501 ------
NM_000462chr1531741 1396 564 ------
NM_000476chr911443 1100 ----
NM_000489chrX72982 2795 2584 2489 2416 2224 863 12247 --12378
NM_000495chrX3782 406 98 ------
NM_000503chr841649 190 125 33 --11653 --
NM_000522chr7156 1923 ----
NM_000533chrX1224 ------
NM_000555chrX67797 7306 6876 6219 1711 357 26206 1777 11586 --
NM_000565chr132201 1735 176 1679 12135 --
NM_000575chr231001 421 85 ------
NM_000601chr71331 ------
NM_000611chr11106444 5688 5133 4850 4731 2291 1933 1916 1762 1480 26718 962 --11864
NM_000617chr1232241 1431 749 --32179 1857 236 --
NM_000618chr1286352 4949 4920 4602 1410 1377 449 221 26013 72 1366 16061
NM_000618chr1286352 4949 4920 4602 1410 1377 449 221 26013 72 1366 16061
NM_000627chr2--1908 2652 266 --
NM_000633chr1833715 1803 103 --1460 --
NM_000676chr171214 ------
NM_000679chr51150 ------
NM_000681chr101158 --21152 1026 11348
NM_000685chr33828 320 228 ----1832
NM_000685chr33828 320 228 ----1832
NM_000686chrX11000 ------
NM_000687chr201151 1560 133 --
NM_000721chr112283 --12274 --
NM_000724chr1021655 135 ------
NM_000756chr8183 ------
NM_000780chr82793 193 ------
NM_000794chr531019 121 68 ------
NM_000801chr2021054 844 1971 ----
NM_000806chr541725 1360 1253 653 11370 11797 --
NM_000807chr4159 3477 164 85 ----
NM_000809chr446034 2820 1393 539 32179 474 25 17500 28161 6376
NM_000813chr575260 4721 4244 1741 391 161 122 41687 1509 697 169 ----
NM_000814chr1543129 1121 1065 491 11631 12909 --
NM_000817chr23962 425 76 ------
NM_000818chr102191 22 --1210 --
NM_000826chr432447 2349 2251 ------
NM_000827chr531715 754 412 1217 ----
NM_000828chrX41978 1682 600 57 1533 ----
NM_000831chr165243 3972 1645 924 534 179 --14365 --
NM_000833chr1611478 193 11526 --
NM_000840chr7140 ------
NM_000844chr331007 866 160 ------
NM_000859chr511408 ------
NM_000865chr61187 ------
NM_000868chrX11805 --11689 --
NM_000875chr1576938 2303 2249 1613 732 725 672 --21275 564 11876
NM_000891chr1752944 2662 2649 998 566 13240 --21193 393
NM_000899chr1263765 3271 1536 1197 135 24 13982 ----
NM_000901chr41164 --12156 --
NM_000912chr853359 2652 599 316 291 33567 1287 1246 --1872
NM_000919chr51593 ----1457
NM_000922chr113748 292 153 11041 ----
NM_000924chr1221365 1279 1950 11080 --
NM_000926chr1178874 8267 8002 6260 5890 3184 2883 38053 7936 3370 17855 --
NM_000933chr2051205 1172 455 269 74 11153 ----
NM_000937chr172390 332 --156 --
NM_000944chr432081 504 370 11883 ----
NM_000945chr251492 1338 782 771 715 ------
NM_000949chr5----1220 --
NM_000950chrX63035 2919 2754 2693 1445 189 12735 11160 --
NM_000958chr511237 --1302 --
NM_000962chr973080 2368 1937 877 765 722 341 22030 1898 12393 --
NM_000964chr1711361 ------
NM_001001132chr2131195 942 395 ------
NM_001001323chr1252023 830 683 236 193 21120 928 --22726 694
NM_001001331chr32953 181 11662 ----
NM_001001342chr1021081 1030 21354 402 ----
NM_001001344chrX22495 2251 --22254 2164 --
NM_001001394chr22536 494 ------
NM_001001395chr1242788 2089 892 242 ------
NM_001001396chr144476 3903 3891 3800 13603 33894 1725 385 --
NM_001001419chr575130 5057 4435 4195 1043 794 541 15224 13232 14627
NM_001001420chr575130 5057 4435 4195 1043 794 541 15224 13232 14627
NM_001001433chr2043163 2851 328 233 22952 578 ----
NM_001001436chr16--2750 23 ----
NM_001001483chr111320 1360 ----
NM_001001484chr1031994 656 413 ------
NM_001001549chr722484 976 22525 701 2979 182 --
NM_001001550chr722484 976 22525 701 2979 182 --
NM_001001555chr722484 976 22525 701 2979 182 --
NM_001001556chr15----1114 --
NM_001001560chr222738 311 1187 ----
NM_001001664chr224089 98 ------
NM_001001706chr63964 304 168 1230 ----
NM_001001890chr2154220 3106 1473 1448 210 23618 1673 14223 --
NM_001001933chr1--186 ----
NM_001001971chr102525 126 174 21403 564 --
NM_001001974chr1011979 12342 11555 --
NM_001001995chrX61744 1330 1272 1214 286 62 1633 1135 --
NM_001002026chr352501 2432 1633 616 433 ------
NM_001002032chr172726 24 ------
NM_001002243chr22787 251 ------
NM_001002252chr12183 ------
NM_001002257chr253366 3226 2539 1379 163 1797 33333 1367 379 --
NM_001002269chr91446 ------
NM_001002294chr1160 ------
NM_001002295chr101775 ------
NM_001002762chr1052354 1805 810 321 197 12957 ----
NM_001002838chrX31757 659 379 11774 1382 --
NM_001002843chr1531270 296 80 ----11069
NM_001002860chr1444654 3978 3919 3050 13887 24368 709 --
NM_001002909chr1742068 833 625 459 ------
NM_001002914chr1721059 505 --11083 --
NM_001003406chr2273247 3227 3025 2927 2778 2115 1054 ----1572
NM_001003407chr1074768 4646 1906 1705 1247 1008 967 --15023 --
NM_001003408chr1074768 4646 1906 1705 1247 1008 967 --15023 --
NM_001003652chr18117661 5595 3058 2591 2323 1359 817 459 442 395 348 37569 2934 690 26231 1436 --
NM_001003674chr1897008 6996 5472 4345 2358 2203 1310 1178 897 26596 4669 86637 4644 4612 4609 4606 4603 4600 4597 --
NM_001003675chr1897008 6996 5472 4345 2358 2203 1310 1178 897 26596 4669 86637 4644 4612 4609 4606 4603 4600 4597 --
NM_001003688chr41894 21127 1032 ----
NM_001003712chr12--1503 --12517
NM_001003794chr353009 2999 2362 2112 466 12955 ----
NM_001003800chr942894 1235 616 223 13162 11451 --
NM_001003810chr41220 2752 92 ----
NM_001004065chr973791 3495 2943 2911 2876 1392 311 ------
NM_001004304chr1263119 3031 2708 2152 1043 986 --12848 --
NM_001004317chr664162 3567 3313 1677 1406 485 11622 11681 --
NM_001004342chr185685 5223 3980 3882 3716 1822 1797 1736 ------
NM_001004346chr421016 391 31112 892 171 ----
NM_001004360chr241255 316 287 80 --1182 --
NM_001005242chr1221300 324 ----11481
NM_001005266chr15--1674 ----
NM_001005267chr15--1674 ----
NM_001005268chr15--1674 ----
NM_001005269chr15--1674 ----
NM_001005353chr13796 381 313 ----11049
NM_001005353chr13796 381 313 ----11049
NM_001005360chr191582 --1853 --
NM_001005361chr191582 --1853 --
NM_001005362chr191582 --1853 --
NM_001005366chr122240 153 ------
NM_001005375chrY21161 123 ------
NM_001005386chr252227 2008 711 487 239 22413 1626 1315 1437
NM_001005404chr1753885 3736 3184 3125 789 ----12931
NM_001005463chr1051929 1863 773 722 329 22536 736 ----
NM_001005502chr1264478 3177 1794 1666 1164 1154 ------
NM_001005505chr341424 1381 316 251 ------
NM_001005609chrX43729 3222 2984 1319 --2407 79 12744
NM_001005732chr211663 ------
NM_001005733chr211620 ------
NM_001005849chr17----1489 --
NM_001005910chr33585 432 268 1184 ----
NM_001005911chr33585 432 268 1184 ----
NM_001005920chr162940 384 ------
NM_001006115chr352629 2428 2074 1926 870 21045 354 32013 859 856 --
NM_001006600chr541693 1582 746 483 ------
NM_001006610chr16------1141
NM_001006612chrX1436 --1104 --
NM_001006613chrX1436 --1104 --
NM_001006614chrX1436 --1104 --
NM_001006617chr911363 --1934 --
NM_001006619chr911363 --1934 --
NM_001006620chr911363 --1934 --
NM_001006621chr911363 --1934 --
NM_001006623chr232345 387 157 22426 1746 1693 12390
NM_001006634chr162667 557 1290 ----
NM_001006636chr22960 123 ------
NM_001006684chrX149 ------
NM_001006935chrX1136 --179 --
NM_001006936chrX1136 --179 --
NM_001006937chrX1136 --179 --
NM_001006938chrX2749 504 --2561 507 --
NM_001007024chr1754174 3196 2717 510 245 23003 1765 12834 --
NM_001007025chr1754174 3196 2717 510 245 23003 1765 12834 --
NM_001007026chr123355 343 108 ------
NM_001007067chr83740 364 305 ------
NM_001007068chr83740 364 305 ------
NM_001007069chr83740 364 305 ------
NM_001007070chr83740 364 305 ------
NM_001007097chr985046 4343 1076 1015 951 783 109 84 ----13348
NM_001007098chr12354 328 ----1900
NM_001007102chr631596 1438 469 ------
NM_001007156chr1511720 11739 ----
NM_001007226chr173967 207 56 ------
NM_001007227chr173967 207 56 ------
NM_001007228chr173967 207 56 ------
NM_001007229chr173967 207 56 ------
NM_001007230chr173967 207 56 ------
NM_001007246chr2141861 1263 531 517 21934 604 21865 1266 --
NM_001007257chr121062 177 --11237 --
NM_001007278chr1384957 4796 3562 3491 3426 2107 1456 581 25255 3212 ----
NM_001007466chr664955 2073 1667 1641 436 356 1847 ----
NM_001007553chr11330 11204 1792 --
NM_001007559chr182295 134 1495 22051 1367 --
NM_001007794chr11605 ------
NM_001008220chr553898 3811 3534 2859 34 --11518 --
NM_001008239chr1863582 3349 2894 2856 2575 100 12759 11370 11525
NM_001008392chr343462 2930 2612 978 11085 32261 1037 999 --
NM_001008405chr73472 63 27 11701 ----
NM_001008407chr71624 ----2628 324
NM_001008408chr796278 5437 4646 3922 2546 2498 1634 1589 938 ------
NM_001008491chr231900 1810 1646 21626 590 1549 --
NM_001008492chr231900 1810 1646 21626 590 1549 --
NM_001008495chr842257 2234 1753 1656 ------
NM_001008539chr865355 4489 4213 4104 2076 664 --11890 --
NM_001008540chr21318 ------
NM_001008541chr1031890 1461 717 ------
NM_001008541chr1031890 1461 717 ------
NM_001008564chr1312278 ------
NM_001008566chr22194 1119 ----
NM_001008660chr112214 84 1277 ----
NM_001008701chr1942608 1910 430 424 --32007 1913 1040 --
NM_001008711chr82673 152 162 ----
NM_001008738chr522875 1126 1510 22457 2454 --
NM_001008777chr171279 ------
NM_001008783chr61878 1593 ----
NM_001009554chr431007 390 46 --23766 708 24506 712
NM_001009554chr431007 390 46 --23766 708 24506 712
NM_001009566chr151345 1280 1133 911 46 ------
NM_001009567chr101590 ------
NM_001009571chr731664 1132 501 ------
NM_001009598chr1140 ------
NM_001009814chr13----179 --
NM_001009899chr356237 5298 5268 3948 2418 25467 1289 1376 --
NM_001009909chr1143682 3553 501 36 1564 --13509
NM_001009958chr7--1611 ----
NM_001009959chr232622 2565 1722 1646 12475 --
NM_001009993chr264210 3575 1193 1028 794 632 23045 1233 ----
NM_001010861chr122778 2154 12171 12377 --
NM_001010888chrX33776 447 228 ----11757
NM_001010895chr931757 1650 77 12053 --1294
NM_001010908chr101479 ------
NM_001010924chr1031223 1034 481 ------
NM_001010927chr62482 374 ------
NM_001010932chr71331 ------
NM_001010971chr11929 ------
NM_001010986chrX32447 1699 1682 1340 --11572
NM_001010989chr163441 368 22 ------
NM_001010990chr163441 368 22 ------
NM_001011537chr332352 1513 409 ------
NM_001011546chr20154 ------
NM_001011553chr7--1704 ----
NM_001011645chrX164 ------
NM_001011663chr103182 101 88 ------
NM_001011666chr711177 36015 1292 594 --11121
NM_001011713chr1431573 1545 1108 1276 ----
NM_001011724chr131282 1291 1113 --
NM_001011725chr131282 1291 1113 --
NM_001011885chr151105 21514 1127 ----
NM_001012267chr941874 1705 531 77 ------
NM_001012393chr1174605 3461 3455 3161 1718 262 108 ------
NM_001012398chr162994 38 ----11041
NM_001012410chr31448 ------
NM_001012415chr92748 107 ------
NM_001012418chr6104214 4034 3065 2680 2648 1282 1078 170 44 36 --23023 48 --
NM_001012420chr1532914 2692 420 ----127
NM_001012423chr1532914 2692 420 ------
NM_001012426chr643015 2456 1347 571 --1574 12367
NM_001012427chr643015 2456 1347 571 --1574 12367
NM_001012478chr19--1607 ----
NM_001012614chr41528 1699 ----
NM_001012732chr42357 330 ----158
NM_001012751chr1021489 118 11694 ----
NM_001012755chrX31923 718 694 13598 11841 --
NM_001012761chr572465 2390 2262 704 418 260 165 --1599 --
NM_001012968chrX82741 2341 2164 1961 921 693 181 37 ------
NM_001013031chr1073458 3087 2452 1317 878 532 448 --11321 12629
NM_001013415chr451241 1198 619 363 213 1603 ----
NM_001013437chr182305 64 ------
NM_001013438chr31403 ------
NM_001013439chr31249 ------
NM_001013615chr11890 1802 1249 1894
NM_001013629chr1022133 1925 1364 ----
NM_001013699chr121181 ----1374
NM_001013843chr15------1579
NM_001014765chr141628 1532 513 49 125 ----
NM_001014797chr1087457 2985 2082 1431 1316 1230 946 823 16217 37438 6241 975 --
NM_001014812chr151132 --1378 --
NM_001015877chrX43031 2890 2804 321 31152 779 560 ----
NM_001015882chr9188 11078 ----
NM_001015887chr341816 698 654 228 --21599 142 --
NM_001017368chr1751015 771 722 668 486 22189 474 1774 --
NM_001017395chr342653 2597 1156 957 --31064 1061 1058 13588
NM_001017396chr23582 473 158 32173 1332 832 1392 --
NM_001017424chr131526 1493 69 --11343 --
NM_001017425chr131526 1493 69 --11343 --
NM_001017440chr798017 6063 5331 5258 2778 2588 2354 1965 1934 36432 5724 430 ----
NM_001017523chr1211876 1689 ----
NM_001017535chr1263184 2580 2548 1024 224 37 23059 596 --1322
NM_001017916chr1742062 763 713 140 155 1189 1410
NM_001017917chr1742062 763 713 140 155 1189 1410
NM_001017926chr831775 1330 680 21588 1456 ----
NM_001017961chr11151 ------
NM_001017969chr92659 617 ------
NM_001017977chr11369 ------
NM_001017989chr193951 900 36 ------
NM_001017999chr141656 917 422 23 22135 1774 1928 --
NM_001017999chr141656 917 422 23 22135 1774 1928 --
NM_001018000chr141656 917 422 23 22135 1774 1928 --
NM_001018000chr141656 917 422 23 22135 1774 1928 --
NM_001018001chr141656 917 422 23 22135 1774 1928 --
NM_001018038chr92187 78 ------
NM_001018050chr2243243 2143 447 216 ------
NM_001018052chr2243243 2143 447 216 ------
NM_001018054chr11369 1278 ----
NM_001018057chr115886 543 483 263 173 ------
NM_001018064chr951796 1578 751 500 96 21948 1821 ----
NM_001018067chr155053 4682 1920 1196 286 24452 3664 1593 14433
NM_001018068chr155053 4682 1920 1196 286 24452 3664 1593 14433
NM_001018069chr155053 4682 1920 1196 286 24452 3664 1593 14433
NM_001018072chr1211876 1689 ----
NM_001018074chr543848 2751 868 603 ------
NM_001018075chr543848 2751 868 603 ------
NM_001018076chr543848 2751 868 603 ------
NM_001018077chr543848 2751 868 603 ------
NM_001018111chr763799 3486 1395 1164 949 413 --21426 228 --
NM_001018676chr81440 --2160 157 --
NM_001018677chr81440 --2160 157 --
NM_001020658chr13677 232 113 ----1596
NM_001020658chr13677 232 113 ----1596
NM_001020818chr1941717 1608 258 206 --11728 --
NM_001020819chr1941717 1608 258 206 --11728 --
NM_001020820chr1941717 1608 258 206 --11728 --
NM_001020821chr1941717 1608 258 206 --11728 --
NM_001020825chr521323 226 ------
NM_001023560chr61875 --1791 --
NM_001023567chr1562358 2306 2079 544 420 25 1410 ----
NM_001023587chr341104 1036 204 118 ------
NM_001024071chr142800 209 ------
NM_001024094chr543848 2751 868 603 ------
NM_001024226chr1------11030
NM_001024227chr1------11030
NM_001024228chr1------11030
NM_001024401chr1632899 2273 389 12090 ----
NM_001024455chrX72671 2243 2190 2170 1920 1896 60 --21745 490 --
NM_001024463chr152863 777 1453 ----
NM_001024593chr10--158 ----
NM_001024649chr532923 957 920 ------
NM_001024668chr122742 208 196 ----
NM_001024808chr1241115 1024 296 184 --1300 --
NM_001024809chr1711361 ------
NM_001024934chr61262 1662 ----
NM_001024935chr61262 1662 ----
NM_001024936chr61262 1662 ----
NM_001024947chr5182 1862 ----
NM_001024948chr142946 2621 2149 1345 12656 ----
NM_001024956chr1125750 5638 34597 3840 145 15881 --
NM_001024959chr32698 149 ------
NM_001024960chr32698 149 ------
NM_001025068chr321621 1271 ----1530
NM_001025069chr321621 1271 ----1530
NM_001025076chr1096025 5870 5468 4326 3803 2432 2273 2109 1242 15861 ----
NM_001025077chr1077383 7228 6826 5684 5161 4948 2600 17219 ----
NM_001025079chr354076 3348 2573 755 742 11674 24017 3712 --
NM_001025201chr2--1636 1460 --
NM_001025203chr21129 ------
NM_001025204chr21129 ------
NM_001025233chr1232355 1030 445 --1257 --
NM_001025248chr151919 11290 ----
NM_001025249chr151919 11290 ----
NM_001025266chr364790 4760 4596 3651 1385 83 ----23068 1205
NM_001025366chr621639 488 11468 --1284
NM_001025366chr621639 488 11468 --1284
NM_001025367chr621639 488 11468 --1284
NM_001025367chr621639 488 11468 --1284
NM_001025368chr621639 488 11468 --1284
NM_001025368chr621639 488 11468 --1284
NM_001025369chr621655 504 11484 --1300
NM_001025369chr621655 504 11484 --1300
NM_001025370chr621639 488 11468 --1284
NM_001025370chr621639 488 11468 --1284
NM_001025580chrX53755 3555 3462 1678 566 ----12731
NM_001025595chr411234 1168 ----
NM_001025603chr11161 ------
NM_001025616chr42607 519 11211 11878 --
NM_001025777chr2--21628 90 ----
NM_001029858chr652920 2768 2125 543 323 23101 722 1317 --
NM_001029863chr643110 2760 985 73 12797 ----
NM_001029875chr522662 216 12255 ----
NM_001029883chr243033 2223 1983 1045 1155 ----
NM_001030007chr1683983 3832 3553 3433 2988 2631 1424 207 32916 151 124 12856 --
NM_001030055chr1411214 31489 1037 748 31554 245 242 23533 1843
NM_001031685chr13771 693 367 146 ----
NM_001031690chr792622 2563 2542 2492 2002 970 803 501 395 22656 1903 ----
NM_001031695chr2265376 5126 4980 3598 2072 1099 15152 11523 22077 1662
NM_001031700chr432091 432 317 ------
NM_001031702chr33891 823 778 ------
NM_001031717chr31257 --1772 176
NM_001031732chr443559 3211 741 584 --1421 --
NM_001031746chr1021376 1008 2497 284 ----
NM_001031804chr1661723 1502 902 304 237 73 ----13433
NM_001031812chr52532 49 1928 11669 --
NM_001031848chr18--1319 ----
NM_001032221chr941661 1577 482 282 --21236 1233 --
NM_001032280chr62110 98 11661 5119 116 113 104 101 --
NM_001032282chr821103 331 11009 ----
NM_001032283chr122804 725 1413 ----
NM_001032284chr122804 725 1413 ----
NM_001032288chr2021339 488 --21228 1225 1351
NM_001032293chr17159 1554 ----
NM_001032296chr1352876 2517 2440 1064 887 --32637 2443 2290 --
NM_001032367chr151442 ------
NM_001032999chr2054536 3242 1004 539 31 35331 3434 986 25054 4089 --
NM_001033025chr121116 325 ------
NM_001033044chr121638 22 21282 723 ----
NM_001033047chr422675 35 1595 --12209
NM_001033056chr121638 22 21282 723 ----
NM_001033057chr321367 352 ------
NM_001033059chr61603 1699 ----
NM_001033081chr121540 1425 --21703 1497 --
NM_001033082chr121540 1425 --21703 1497 --
NM_001033087chr2043105 2041 815 787 13151 ----
NM_001033112chr51161 ------
NM_001033117chr384878 4519 4430 4245 4167 3509 1507 747 12975 11557 --
NM_001033506chr11197 ------
NM_001033518chr722787 2422 --172 --
NM_001033519chr722787 2422 --172 --
NM_001033520chr722787 2422 --172 --
NM_001033551chr1753549 3093 2965 2851 553 --23333 1291 1754
NM_001033557chr21131 1569 ----
NM_001033566chr174984 814 661 72 ------
NM_001033568chr174984 814 661 72 ------
NM_001033578chr83397 284 183 12316 1543 --
NM_001033677chr121391 --2282 279 --
NM_001033723chr852546 2534 2306 2219 197 ------
NM_001033756chr621573 422 11402 --1218
NM_001033756chr621573 422 11402 --1218
NM_001033925chr1021879 337 ------
NM_001034833chr51292 ------
NM_001034845chr41199 31442 1202 277 ----
NM_001034852chr1441761 423 396 262 ------
NM_001034954chr1043045 1205 609 339 2847 553 2968 464 --
NM_001034955chr1043045 1205 609 339 2847 553 2968 464 --
NM_001034956chr1043045 1205 609 339 2847 553 2968 464 --
NM_001034957chr1043045 1205 609 339 2847 553 2968 464 --
NM_001035003chr431340 551 346 ------
NM_001035004chr431340 551 346 ------
NM_001035005chr183603 243 235 ------
NM_001035267chr121288 ------
NM_001035511chr151465 1344 693 475 323 --11608 --
NM_001035512chr151572 1451 800 582 430 --11715 --
NM_001035513chr151572 1451 800 582 430 --11715 --
NM_001035521chr21512 1754 ----
NM_001037132chr74627 528 274 110 1558 ----
NM_001037133chr74627 528 274 110 1558 ----
NM_001037164chr751938 1817 1770 1407 1374 ------
NM_001037172chr331216 910 78 ------
NM_001037317chr122778 2154 12171 12377 --
NM_001037332chr552492 1674 748 672 330 ------
NM_001037333chr552492 1674 748 672 330 ------
NM_001037334chr183712 476 384 --1501 1868
NM_001037494chr12--197 ----
NM_001037495chr12--197 ----
NM_001037535chrX31132 528 189 ------
NM_001037536chrX31132 528 189 ------
NM_001037540chrX31132 528 189 ------
NM_001037553chr2194935 4477 3832 3777 3208 1921 1029 427 304 1957 14706 14550
NM_001037637chr5----151 --
NM_001037954chr1152502 2289 710 570 51 12510 2837 327 --
NM_001038493chr221064 32 ------
NM_001038702chr561949 1919 1715 830 462 327 22617 2303 1529 --
NM_001038707chr152064 2040 844 702 463 1577 ----
NM_001038707chr152064 2040 844 702 463 1577 ----
NM_001039465chr141514 175 1490 --
NM_001039479chr1422375 1806 3878 582 383 31682 1508 259 --
NM_001039538chr253673 3594 3547 977 355 22929 1251 ----
NM_001039577chr183880 1179 1161 1143 695 380 249 139 ------
NM_001039585chr174241 3738 3682 3395 2962 1616 212 --23779 216 --
NM_001039590chrX73243 3107 2589 2469 1412 934 506 1267 13111 13787
NM_001039591chrX73243 3107 2589 2469 1412 934 506 1267 13111 13787
NM_001039618chr1154703 4690 1469 1367 327 35394 4978 3720 21617 1395 --
NM_001039671chr19----6209 39 36 33 30 27 --
NM_001039672chr19----6209 39 36 33 30 27 --
NM_001039673chr19----6209 39 36 33 30 27 --
NM_001039690chr1621825 1511 1570 ----
NM_001039709chr2054536 3242 1004 539 31 35331 3434 986 25054 4089 --
NM_001039711chr121118 728 ------
NM_001039712chr121118 728 ------
NM_001039716chr12288 43 ------
NM_001039802chr12976 364 ------
NM_001039840chrX86017 5391 4577 4250 2428 1766 1306 711 1702 ----
NM_001039916chr121294 ------
NM_001039917chr121294 ------
NM_001039918chr121294 ------
NM_001039919chr121294 ------
NM_001039920chr121294 ------
NM_001039937chr1321227 1016 21665 336 23809 900 --
NM_001040001chr621987 1911 21722 771 ----
NM_001040057chr731404 507 180 11298 ----
NM_001040092chr8--1370 --1363
NM_001040100chr3146 11008 ----
NM_001040101chr43473 362 137 1130 ----
NM_001040113chr161910 ------
NM_001040134chr1921429 584 ------
NM_001040135chr73732 613 103 --2808 258 --
NM_001040142chr211500 1240 12157 --
NM_001040143chr211500 1240 12157 --
NM_001040144chr1621825 1511 1570 ----
NM_001040146chr1621825 1511 1570 ----
NM_001040152chr774925 4768 4431 3711 3659 1516 173 25106 1761 25122 3616 --
NM_001040153chr132971 779 ------
NM_001040159chr41462 --11087 --
NM_001040167chr72806 304 1388 21173 172 --
NM_001040181chr34812 463 427 321 ------
NM_001040182chr34812 463 427 321 ------
NM_001040183chr34812 463 427 321 ------
NM_001040199chr34812 463 427 321 ------
NM_001040200chr34812 463 427 321 ------
NM_001040214chr61638 1339 ----
NM_001040260chr45891 829 240 79 31 --11015 --
NM_001040261chr45891 829 240 79 31 --11015 --
NM_001040284chr1644841 1428 730 230 44327 2324 2023 1558 --14269
NM_001040402chr4113153 3006 1006 897 434 265 191 138 92 71 34 42890 2648 2352 825 ----
NM_001040424chr2142668 2361 915 775 ------
NM_001040429chr1373608 3295 2764 2525 2427 320 111 1167 ----
NM_001040441chr124062 193 --13929 --
NM_001040450chr1532289 1868 923 --12397 --
NM_001040453chr1532289 1868 923 --12397 --
NM_001040455chr112975 248 ------
NM_001040458chr561340 1302 1172 1156 81 28 --1154 --
NM_001040653chr321936 1740 22628 2455 --1898
NM_001040694chr1151059 938 914 358 159 ----1854
NM_001040697chr112226 96 ------
NM_001040708chr8--1901 ----
NM_001040712chr942657 2335 881 666 1529 --1886
NM_001040875chr822398 1929 ------
NM_001042355chr1624176 3982 53813 3727 1470 1361 517 15370 --
NM_001042357chr1041499 580 203 93 --1597 --
NM_001042358chr1041499 580 203 93 --1597 --
NM_001042360chr1041499 580 203 93 --1597 --
NM_001042363chr1041499 580 203 93 --1597 --
NM_001042383chr332943 981 230 1680 13185 --
NM_001042388chr182821 644 ------
NM_001042389chr1041499 580 203 93 --1597 --
NM_001042390chr1041499 580 203 93 --1597 --
NM_001042392chr1041499 580 203 93 --1597 --
NM_001042395chr1041499 580 203 93 --1597 --
NM_001042412chr1624176 3982 53813 3727 1470 1361 517 15370 --
NM_001042413chr963454 552 436 279 188 45 ----12940
NM_001042414chr13169 ------
NM_001042424chr4--32309 1142 870 ----
NM_001042425chr62110 98 11661 5119 116 113 104 101 --
NM_001042481chr14143 1773 12437 --
NM_001042486chr2021347 88 ------
NM_001042492chr1733154 2653 329 32548 2177 800 21259 1247 --
NM_001042493chr621498 384 ----1307
NM_001042494chr1563132 3059 2962 2399 852 530 13337 ----
NM_001042495chr1563132 3059 2962 2399 852 530 13337 ----
NM_001042496chr1563132 3059 2962 2399 852 530 13337 ----
NM_001042497chr1563132 3059 2962 2399 852 530 13337 ----
NM_001042506chrX1466 ------
NM_001042510chr851993 1351 540 141 77 ------
NM_001042511chr851993 1351 540 141 77 ------
NM_001042517chr131980 1952 ----
NM_001042533chr341134 957 551 134 22946 2578 ----
NM_001042537chrX51995 1664 964 888 259 --1463 12286
NM_001042555chr1264727 4026 1289 1061 1015 606 24089 376 ----
NM_001042599chr267269 6650 6298 5135 5065 1308 12771 25962 4880 16654
NM_001042601chr343081 864 706 400 23155 1139 2377 260 --
NM_001042603chr12105149 3870 3797 2038 1247 1040 993 530 469 95 14539 --13998
NM_001042604chr384263 4231 3996 3548 3168 1519 562 159 11396 ----
NM_001042669chr42607 519 11211 11878 --
NM_001042681chr122513 2047 ------
NM_001042682chr122513 2047 ------
NM_001042682chr122513 2047 ------
NM_001042683chr621422 593 ------
NM_001042724chr19--1693 ----
NM_001042749chrX1391 11672 1250 --
NM_001042750chrX1391 11672 1250 --
NM_001042751chrX1391 11672 1250 --
NM_001043318chr14103962 3758 3724 3477 1188 1121 1104 1031 777 769 --1396 --
NM_001043351chr152170 2065 588 114 23 --2876 26 --
NM_001044305chr631320 508 259 --11220 --
NM_001044385chr2113814 2996 2930 2716 1255 1210 1171 1015 946 605 166 --33201 2819 1424 --
NM_001044722chr52532 49 1928 11669 --
NM_001044723chr52532 49 1928 11669 --
NM_001046chr542997 526 259 149 12904 12262 --
NM_001049chr1412498 11840 ----
NM_001071775chr1331570 330 245 ------
NM_001079874chr131499 264 113 11603 ----
NM_001083620chr432445 2347 2249 ------
NM_001095chr1231610 1336 343 --1677 --
NM_001100108chr187824 6710 5162 2323 2018 1081 480 333 48267 8105 6505 3333 2523 494 --
NM_001106chr3129656 9351 8022 7817 7786 7246 6644 3686 3322 2441 836 442 39639 8648 7443 49355 6954 1286 115 --
NM_001109977chr42220 79 ------
NM_001113490chrX33215 2963 427 22511 270 ----
NM_001116chr1632592 2575 68 ----12484
NM_001117chr1842489 571 467 331 --12207 --
NM_001119chr421279 994 --11229 11041
NM_001121chr1021619 311 11803 ----
NM_001122631chr11--2617 264 ----
NM_001122679chr52107 54 1975 --11261
NM_001124chr111468 ------
NM_001126chr12229 222 ------
NM_001128chr1683983 3832 3553 3433 2988 2631 1424 207 32916 151 124 12856 --
NM_001143chrY146 ------
NM_001148chr41288 1678 ----
NM_001149chr1031035 1007 114 --21266 943 1284
NM_001153chr2173 ------
NM_001157chr10------1234
NM_001167chrX66709 6554 2614 1209 213 105 1757 ----
NM_001173chr1411214 31489 1037 748 31554 245 242 23533 1843
NM_001186chr2182786 2061 1224 946 884 638 285 85 --12638 --
NM_001197chr22169 1144 275 72 --
NM_001198chr612351 ------
NM_001201chr41287 23310 2696 ----
NM_001204chr267517 6023 2911 2635 2286 246 --11257 --
NM_001206chr9--12177 ----
NM_001207chr5----151 --
NM_001211chr151119 1363 ----
NM_001219chr721664 89 --1547 --
NM_001222chr1051773 1232 650 599 193 ------
NM_001227chr1031355 1123 252 ------
NM_001233chr72646 95 ------
NM_001235chr11----1644 --
NM_001238chr19----1492 --
NM_001241chr261907 634 450 381 230 195 177 --2980 862
NM_001241chr261907 634 450 381 230 195 177 --2980 862
NM_001256chr171369 12953 12667 1188
NM_001257chr1621327 995 ------
NM_001259chr7166378 6354 5468 4918 4467 2384 2340 2240 1819 1397 1387 1186 1150 838 642 97 14908 26381 119 1273
NM_001260chr131236 ------
NM_001261chr94887 792 387 47 --1802 --
NM_001265chr132817 64 --1821 --
NM_001270chr511115 ------
NM_001271chr1543243 3049 2235 1097 1969 3416 116 113 1480
NM_001274chr11----145 --
NM_001278chr102973 465 11138 2997 45 --
NM_001284chr52389 170 ------
NM_001290chr41744 ------
NM_001293chr111410 --1413 --
NM_001298chr211291 ------
NM_001304chr1733641 3019 1411 21231 127 1808 11416
NM_001310chr1252565 2438 1946 727 694 13072 --1965
NM_001315chr642216 700 689 469 --1301 1657
NM_001316chr203348 322 140 --1352 --
NM_001328chr41528 1699 ----
NM_001329chr1031459 657 228 1445 1537 --
NM_001331chr1132867 2625 271 22389 764 22178 706 --
NM_001332chr511080 ------
NM_001343chr51655 ------
NM_001351chr321131 35 ------
NM_001356chrX----11780 --
NM_001364chr11--24579 878 ----
NM_001386chr82669 340 12146 ----
NM_001387chr533113 2057 724 13189 22060 1956 --
NM_001390chr1823250 927 22830 2417 2378 375 23523 3210
NM_001392chr182231 55 ------
NM_001395chrX3975 372 205 --2727 704 --
NM_001396chr2122266 81 ----11778
NM_001399chrX43729 3222 2984 1319 --2407 79 12744
NM_001402chr642011 1731 519 482 ----1587
NM_001406chr1721593 1546 11270 1135 --
NM_001407chr331591 1082 1070 ------
NM_001408chr121627 420 ------
NM_001418chr11----144 --
NM_001418chr11----144 --
NM_001419chr1923305 1571 11129 33464 3254 752 --
NM_001420chr1962952 2562 2184 2127 1927 246 ------
NM_001429chr22--11073 ----
NM_001431chr62398 379 ------
NM_001432chr443584 2519 1344 601 1172 ----
NM_001438chr143242 2353 782 532 --12705 1536
NM_001439chr121116 325 ------
NM_001440chr862514 997 741 728 117 93 11813 21973 744 --
NM_001448chrX21756 508 ------
NM_001449chrX1420 ------
NM_001453chr621720 1674 ------
NM_001457chr341276 126 50 41 --1345 --
NM_001458chr71713 ------
NM_001463chr21781 --2784 290 --
NM_001483chr72948 905 --1110 --
NM_001493chrX2572 25 ------
NM_001497chr93799 71 50 22601 325 --1401
NM_001498chr621226 854 --1869 --
NM_001508chr2--1930 --1944
NM_001518chr741095 789 763 59 ------
NM_001521chr21512 1754 ----
NM_001543chr564347 3631 3436 2983 1225 247 14858 13100 --
NM_001546chr631201 1075 248 ------
NM_001570chr331262 1176 118 ----11180
NM_001587chrX32077 2025 801 --12203 --
NM_001604chr11----1106 --
NM_001610chr113798 648 69 ------
NM_001614chr172652 174 --1520 --
NM_001614chr172652 174 --1520 --
NM_001616chr273410 2601 1134 798 445 374 151 --22604 509 2611 54
NM_001618chr1190 ------
NM_001621chr722762 986 --1796 1990
NM_001621chr722762 986 --1796 1990
NM_001634chr61603 1699 ----
NM_001650chr1812587 12606 13051 --
NM_001655chr1131686 650 319 ----1226
NM_001656chr52473 412 11672 11485 --
NM_001658chr1------11030
NM_001659chr1222121 335 ----12410
NM_001660chr31679 1726 1166 --
NM_001663chr1432313 2026 860 --1268 --
NM_001664chr32131 49 ------
NM_001665chr111394 ------
NM_001668chr14852 816 799 144 ------
NM_001682chr1231079 544 397 2834 642 --22440 408
NM_001683chr32953 181 11662 ----
NM_001684chr164193 3620 3608 3517 1605 1531 13320 33611 1442 102 --
NM_001690chr352304 2017 1917 1690 883 ------
NM_001693chr81915 1171 1496 --
NM_001701chr911041 11218 --11433
NM_001702chr8148 ------
NM_001707chr7173 --1320 1597
NM_001709chr1162649 2327 941 816 503 306 12423 ----
NM_001716chr1121170 27 ----1400
NM_001723chr62872 843 1139 ----
NM_001730chr1331496 1390 539 ----11213
NM_001730chr1331496 1390 539 ----11213
NM_001731chr122677 241 ------
NM_001742chr73738 698 171 11666 ----
NM_001746chr532923 957 920 ------
NM_001748chr12770 438 1955 ----
NM_001753chr731543 1189 1144 ----182
NM_001754chr2154220 3106 1473 1448 210 23618 1673 14223 --
NM_001755chr1622058 2008 1561 ----
NM_001759chr1284838 4445 3960 3755 1213 848 748 563 11163 21771 626 11700
NM_001769chr122301 134 ------
NM_001773chr131417 1261 502 ------
NM_001777chr354076 3348 2573 755 742 11674 24017 3712 --
NM_001788chr7--1704 ----
NM_001791chr12976 364 ------
NM_001797chr161765 1542 ----
NM_001798chr1221102 384 ------
NM_001800chr192391 99 ------
NM_001802chr161831 ------
NM_001821chr184686 4009 3798 1915 1457 877 408 25 44890 3268 3070 322 21168 400 --
NM_001822chr2--1636 1460 --
NM_001829chr42952 358 --1978 --
NM_001830chrX53875 3467 597 246 240 --21550 453 --
NM_001834chr5163 --195 --
NM_001839chr11693 1505 ----
NM_001845chr132551 420 --11327 11374
NM_001851chr6--1628 ----
NM_001854chr121174 407 11149 ----
NM_001858chr653857 1623 826 229 91 34016 2071 436 ----
NM_001859chr913534 33197 1437 1286 ----
NM_001863chr19--1113 ----
NM_001874chr1264478 3177 1794 1666 1164 1154 ------
NM_001875chr221071 327 ------
NM_001881chr10--1386 ----
NM_001893chr17155 1388 ----
NM_001895chr201121 --1340 --
NM_001896chr161295 ------
NM_001901chr61338 ------
NM_001903chr51612 2773 79 1591 --
NM_001904chr341034 723 361 281 ------
NM_001915chr1742062 763 713 140 155 1189 1410
NM_001920chr12--2776 58 ----
NM_001921chr42357 330 ----158
NM_001933chr143946 511 110 ----11208
NM_001935chr2--1814 --1259
NM_001938chr121474 134 ------
NM_001940chr123355 343 108 ------
NM_001945chr531386 1270 38 ------
NM_001946chr122351 76 ------
NM_001948chr151919 11290 ----
NM_001949chr642755 2494 693 382 1457 12498 --
NM_001951chr8125 ------
NM_001967chr3138 ----1522
NM_001968chr41698 ------
NM_001969chr1473616 3508 2844 2584 1034 661 150 ------
NM_001991chr1722088 70 1691 1839 --
NM_001995chr451275 511 401 372 354 157 ----
NM_001999chr52360 330 ----1370
NM_002006chr473631 1393 1119 754 591 514 217 --45647 5606 1060 220 15074
NM_002009chr1521872 649 1671 1377 --
NM_002014chr123627 456 64 ------
NM_002015chr1343244 2869 2608 594 22278 606 1223 --
NM_002017chr1111079 --1958 --
NM_002023chr121077 443 1183 ----
NM_002024chrX31891 1875 1608 11793 ----
NM_002025chrX46977 6320 2569 1536 28516 3105 13183 --
NM_002026chr22988 946 --1839 --
NM_002027chr81440 --2160 157 --
NM_002031chr61593 ------
NM_002035chr1863953 2923 2703 1164 945 615 23605 3455 1618 157
NM_002037chr6182 ------
NM_002040chr2152819 2657 2600 418 404 --1742 --
NM_002044chr15----1114 --
NM_002051chr101775 ------
NM_002052chr831232 1195 975 21459 1150 ----
NM_002054chr2142 ------
NM_002056chr21708 1849 1896 --
NM_002065chr121638 22 21282 723 ----
NM_002072chr9----1876 --
NM_002074chr131743 1281 1161 ------
NM_002076chr1243257 2927 2594 2523 ----12097
NM_002077chr922103 721 --1368 1250
NM_002080chr1621017 52 1704 1935 --
NM_002092chr4105058 5025 4831 3805 3777 3620 3143 1619 1426 105 11919 13068 --
NM_002103chr19170 ------
NM_002107chr13503 488 67 ------
NM_002111chr4113856 3457 3204 2713 1169 1076 1023 379 366 322 299 --23298 1396 23376 1400
NM_002126chr1754149 3138 629 595 543 14057 --14125
NM_002136chr12----1113 --
NM_002137chr762419 1711 843 726 592 479 ------
NM_002138chr41220 2752 92 ----
NM_002139chrX--1125 ----
NM_002140chr91179 ------
NM_002141chr72563 230 ------
NM_002145chr17--1106 ----
NM_002146chr1731455 1179 168 11083 ----
NM_002148chr21147 ------
NM_002156chr21178 1322 ----
NM_002158chr222960 1500 22329 315 1168 --
NM_002181chr22535 33 1646 ----
NM_002188chr51569 ------
NM_002193chr2------11880
NM_002196chr201339 ------
NM_002196chr201339 ------
NM_002202chr51398 ------
NM_002203chr53778 518 56 --11072 --
NM_002207chr33494 298 117 ------
NM_002210chr233427 1015 908 23516 106 ----
NM_002211chr102464 435 2718 356 ----
NM_002214chr754716 3851 2191 319 114 ----34783 1462 178
NM_002221chr152918 2123 1983 596 367 11897 1390 1285
NM_002222chr321323 148 --1482 --
NM_002223chr1263731 3078 1572 1411 989 206 32716 1547 327 13734 13448
NM_002226chr141749 --1219 --
NM_002227chr121145 390 ------
NM_002235chr1221692 166 11398 1434 --
NM_002239chr2----1821 --
NM_002240chr21--1611 ----
NM_002241chr152100 1970 1129 560 396 ------
NM_002242chr241961 1569 1291 254 1208 ----
NM_002264chr384519 4033 1966 1949 1541 1512 1241 811 11679 ----
NM_002265chr171432 --1193 --
NM_002267chr1331712 817 763 --12465 --
NM_002268chr331659 448 132 11298 1135 --
NM_002270chr574336 3501 1978 1827 1601 1361 1125 15353 --15557
NM_002274chr17135 ------
NM_002293chr152680 2610 2202 2155 107 --32573 230 110 --
NM_002298chr1321510 603 ------
NM_002309chr2252713 2608 2335 2193 1941 --1118 1810
NM_002310chr595633 5326 4934 4408 2572 2346 1646 1156 51 14195 36383 1903 60 16530
NM_002313chr1074768 4646 1906 1705 1247 1008 967 --15023 --
NM_002334chr1161885 1688 1317 710 680 151 ------
NM_002336chr12104791 4458 4326 3375 1563 1365 1342 893 609 207 31696 1493 773 11587 --
NM_002349chr2--1166 ----
NM_002350chr831212 924 493 ------
NM_002356chr652494 2483 2235 2061 1152 22505 211 ----
NM_002359chr17124045 3935 3843 3648 3385 3315 3186 1510 1335 1294 966 893 14210 13163 --
NM_002360chr742620 2506 1696 411 --22623 1007 --
NM_002373chr1531326 844 554 165 21342 1296 --
NM_002374chr253673 3594 3547 977 355 22929 1251 ----
NM_002375chr342216 1994 1914 1860 --1750 --
NM_002376chr14--1421 ----
NM_002380chr81380 ------
NM_002381chr22753 77 196 ----
NM_002384chr181965 ------
NM_002397chr522030 1602 1885 22086 399 --
NM_002398chr22956 560 ------
NM_002399chr1521280 1265 --11353 --
NM_002401chr1752130 1583 992 675 76 --31816 59 56 --
NM_002402chr721006 787 ------
NM_002430chr2272414 2014 1903 1010 980 734 415 189 2944 373 --
NM_002436chrX185 ------
NM_002438chr101590 ------
NM_002442chr1231449 396 168 ------
NM_002444chrX11256 11442 11290 --
NM_002445chr84375 292 179 33 ------
NM_002460chr643526 3377 2581 1242 13609 ----
NM_002472chr17--192 ----
NM_002473chr2241241 463 187 101 ------
NM_002478chr111482 ------
NM_002480chr1211211 1953 --1248
NM_002481chr1116550 6493 6357 5326 5205 3194 3155 3135 2010 1406 308 11949 32461 1631 1628 --
NM_002489chr72299 26 ------
NM_002494chr4149 ------
NM_002499chr1542071 1876 764 637 1227 22379 1879 31730 835 598
NM_002500chr241195 909 881 95 ------
NM_002501chr1944096 1319 1017 627 ------
NM_002515chr1441823 1536 368 95 11315 ----
NM_002518chr221083 336 1821 ----
NM_002519chr111145 ------
NM_002524chr14395 241 126 96 ------
NM_002527chr12--1195 ----
NM_002538chr53582 387 128 ------
NM_002539chr2180 ----2250 22
NM_002545chr1174605 3461 3455 3161 1718 262 108 ------
NM_002546chr8123 ------
NM_002567chr124745 721 598 155 ------
NM_002576chr1121101 1091 ------
NM_002577chr364022 3517 2969 562 454 399 ------
NM_002579chr1921429 584 ------
NM_002581chr995530 5346 5204 4857 3722 1276 852 671 78 1487 24005 840 --
NM_002588chr52632 236 ------
NM_002594chr2012424 --2717 408 --
NM_002595chr1231848 1575 432 ----1323
NM_002597chr11319 ------
NM_002610chr242403 2033 396 346 1965 ----
NM_002612chr72688 55 ------
NM_002613chr1694893 4590 4204 3678 2089 1203 978 628 398 24317 1615 44885 4340 1725 1722 1909
NM_002618chr2----1128 --
NM_002628chr311123 --1991 --
NM_002645chr112367 221 --1458 --
NM_002655chr864982 3953 3821 3371 1958 667 34838 4339 3229 14034 25226 4446
NM_002656chr61877 --1271 --
NM_002657chr2073436 3269 3226 1467 1068 448 39 --1629 --
NM_002670chr341257 1211 345 262 ----11215
NM_002673chr34565 439 159 24 --1443 --
NM_002698chr191649 ------
NM_002699chr12317 87 ------
NM_002709chr243076 2486 362 200 13432 ----
NM_002710chr121794 11085 ----
NM_002714chr6166 1236 ----
NM_002715chr521101 955 ------
NM_002716chr1133581 3077 1464 1938 --1653
NM_002717chr81198 ------
NM_002730chr1931375 518 190 1431 11066 --
NM_002731chr121146 387 ------
NM_002732chr93480 322 186 ------
NM_002734chr1731971 1512 139 1550 1229 --
NM_002737chr1796387 6331 5103 5007 4499 2199 2041 1804 734 --15106 --
NM_002738chr1621137 429 ------
NM_002742chr142704 125 ----1118
NM_002745chr2264203 4068 3531 1687 1386 274 31605 1174 356 ----
NM_002747chr1821871 96 --11840 --
NM_002752chr51413 ------
NM_002753chr42744 351 ------
NM_002755chr152800 321 ------
NM_002756chr173974 235 130 --1307 1262
NM_002761chr16--1114 ----
NM_002763chr1--1433 ----
NM_002811chr16--1377 2205 67 --
NM_002813chr1221471 983 --1488 --
NM_002814chrX1277 1150 ----
NM_002816chr17157 ------
NM_002819chr191575 11276 ----
NM_002821chr61809 ------
NM_002823chr21599 ------
NM_002827chr2041761 1755 1229 569 ------
NM_002830chr22340 71 ------
NM_002833chr1541219 1211 278 230 ------
NM_002834chr12104034 3850 3092 2771 1492 1411 899 868 814 694 --22505 1386 --
NM_002835chr72242 233 ------
NM_002839chr942657 2335 881 666 1529 --1886
NM_002840chr131433 1234 591 1497 ----
NM_002843chr1133395 3388 1326 --11329 12329
NM_002844chr6275 65 ------
NM_002848chr1231308 1218 832 ------
NM_002849chr1211032 1832 --2435 362
NM_002855chr1153467 3392 3380 2487 450 43172 2978 776 629 23449 3383 --
NM_002858chr1--1189 ----
NM_002859chr1211154 ------
NM_002867chr15546 514 132 98 64 --1136 --
NM_002868chr122845 185 12449 ----
NM_002874chr942365 935 614 499 ----12249
NM_002880chr31318 --1111 1115
NM_002886chr354231 4139 3282 1113 1064 43880 3830 748 704 ----
NM_002892chr1431198 487 388 1103 ----
NM_002893chrX1301 ------
NM_002897chr25751 635 509 209 161 ------
NM_002901chr112369 45 1410 164 --
NM_002906chr1112122 ------
NM_002912chr61111 ------
NM_002938chr411999 ------
NM_002941chr31223 1456 ----
NM_002942chr331059 301 28 ------
NM_002948chr31369 182 ----
NM_002951chr201250 ------
NM_002959chr183924 3480 1477 1368 1032 1018 433 120 ----1991
NM_002968chr163996 450 319 ----1809
NM_002970chrX175 ------
NM_002971chr311134 ------
NM_002972chr22124 ------
NM_002973chr121228 ------
NM_002994chr43452 259 237 --1247 1316
NM_002998chr842169 2115 776 325 ------
NM_002999chr2031930 1414 1201 1775 ----
NM_003001chr151572 1451 800 582 430 --11715 --
NM_003010chr1731949 1738 541 ------
NM_003011chr921277 321 ------
NM_003013chr43560 195 102 ------
NM_003016chr1741674 252 203 118 ----11640
NM_003017chr63956 436 124 ------
NM_003020chr15137 1178 ----
NM_003026chr951355 1261 1201 255 73 ------
NM_003028chr973789 3154 2908 2792 1078 151 87 13831 1787 12589
NM_003030chr32456 71 11941 ----
NM_003031chr16------1141
NM_003042chr32428 387 ------
NM_003043chr323871 38 --1824 --
NM_003046chr865355 4489 4213 4104 2076 664 --11890 --
NM_003047chr171436 1362 1119 1044 929 912 228 1482 21425 63 --
NM_003051chr131864 621 568 11623 --11868
NM_003069chrX2574 182 ------
NM_003071chr321964 1852 1778 ----
NM_003074chr332075 744 412 ------
NM_003076chr123597 161 112 ------
NM_003077chr174563 259 163 105 --1307 --
NM_003081chr2031011 885 320 --1447 --
NM_003091chr20195 ------
NM_003099chr1564751 2072 1294 1159 784 337 25234 4929 1523 11215
NM_003101chr13493 268 67 11603 ----
NM_003106chr3--1765 ----
NM_003107chr622292 1787 --1879 --
NM_003108chr276236 5660 4908 4737 1668 515 448 16769 11261 --
NM_003110chr17--11102 ----
NM_003112chr712894 --12696 --
NM_003128chr252786 1139 884 599 318 11072 ----
NM_003131chr63685 516 233 ------
NM_003137chr621817 1495 ------
NM_003139chr11--1327 ----
NM_003144chr642160 743 524 316 1652 21562 560 --
NM_003150chr1732237 1605 141 --12269 --
NM_003155chr811861 --12404 --
NM_003156chr1131195 322 271 --2234 231 --
NM_003161chr1773328 2714 2209 1132 1054 806 314 ------
NM_003162chr231087 190 31 2942 109 ----
NM_003165chr951760 1676 581 381 51 --21335 1332 --
NM_003174chr101244 --1268 --
NM_003178chr342054 865 238 101 1606 11459 --
NM_003179chrX21292 123 ------
NM_003185chr2021311 1193 1934 ----
NM_003188chr61609 --1332 --
NM_003189chr112523 13154 148 --
NM_003194chr62235 221 ------
NM_003199chr1854977 3941 3579 1322 889 ----14935
NM_003202chr52529 50 1310 1750 --
NM_003204chr1731803 1578 272 ----11275
NM_003206chr61420 ------
NM_003211chr1231396 1192 560 176 ----
NM_003216chr2223288 124 22985 2785 22145 730 --
NM_003220chr62110 98 11661 5119 116 113 104 101 --
NM_003221chr633626 3507 1367 --14146 --
NM_003244chr181129 1114 ----
NM_003246chr1521271 516 ------
NM_003257chr15--11360 ----
NM_003262chr364949 4855 3733 3435 1345 330 --13736 --
NM_003263chr4145 ------
NM_003269chr621110 241 1981 11170 --
NM_003270chrX61036 450 401 357 237 76 ------
NM_003272chr12741 200 ------
NM_003275chr921227 1106 ----1974
NM_003281chr184902 3495 3455 1857 1733 1557 808 533 --23618 1766 --
NM_003286chr2011041 ------
NM_003298chr376187 5823 5040 5012 2348 1359 1144 35546 1278 138 25667 1795 14176
NM_003304chr341579 1088 251 194 ------
NM_003309chr651791 533 342 211 51 11524 ----
NM_003314chr52395 47 --155 --
NM_003319chr22874 192 ------
NM_003336chrX1118 ------
NM_003337chr5------1406
NM_003338chr10--1699 1731 --
NM_003339chr511233 ------
NM_003340chr44993 885 451 87 ------
NM_003341chr34624 279 168 52 ----1594
NM_003342chr1773154 2784 2276 2265 2225 1328 932 ------
NM_003344chr751421 1102 637 503 463 21457 1383 ----
NM_003345chr163528 448 84 ------
NM_003347chr2262337 2210 2147 1845 863 759 ------
NM_003349chr2021339 488 --21228 1225 1351
NM_003359chr42524 72 21240 838 ----
NM_003360chr4156 ------
NM_003369chr1132128 2113 1125 12486 ----
NM_003371chr93715 519 463 ------
NM_003373chr1031632 479 85 11406 1546 11213
NM_003374chr5--1106 ----
NM_003375chr101339 ------
NM_003376chr621639 488 11468 --1284
NM_003376chr621639 488 11468 --1284
NM_003385chr2--2335 186 1838 --
NM_003387chr252877 2694 973 366 39 --2242 49 1442
NM_003390chr114938 285 271 166 ------
NM_003392chr352819 1610 1275 860 138 --2755 530 --
NM_003399chrX3337 329 98 21026 22 --1728
NM_003400chr22741 685 ------
NM_003403chr141567 1191 ----
NM_003404chr2021385 548 11677 ----
NM_003405chr222799 190 ------
NM_003406chr82641 619 --1622 --
NM_003410chrX33029 2731 553 ------
NM_003411chrY31814 1514 220 1402 ----
NM_003412chr332311 1166 1056 --22531 2027 --
NM_003413chrX41802 1747 649 437 122 ----
NM_003418chr31523 ------
NM_003423chr1931053 1018 445 ------
NM_003439chr742800 1360 1084 484 23254 3017 --11283
NM_003442chr11--1561 ----
NM_003453chr13----156 --
NM_003457chr17159 1554 ----
NM_003458chr333577 276 221 11394 11566 --
NM_003463chr6--11022 ----
NM_003467chr21318 ------
NM_003468chr273968 3318 3154 1544 1300 453 101 ----1984
NM_003469chr2--190 1170 --
NM_003470chr162710 142 1458 1114 --
NM_003471chr351762 823 673 148 105 ------
NM_003472chr631283 296 170 1129 ----
NM_003473chr1011052 136 1423 --
NM_003478chr1173013 2992 1244 750 657 330 215 12286 1412 --
NM_003482chr1261991 1903 1881 909 706 374 --12092 --
NM_003483chr1242665 2201 972 238 12312 ----
NM_003489chr2142973 2634 2391 2268 31033 528 411 ----
NM_003490chr2221047 36 ------
NM_003528chr151641 1207 298 262 46 ------
NM_003557chr131494 1429 138 ------
NM_003558chr92259 214 ------
NM_003563chr173967 207 56 ------
NM_003566chr1233452 2220 410 --12524 --
NM_003567chr11280 ------
NM_003574chr1885668 4540 4421 4324 3901 2288 365 23 53557 753 598 489 401 24197 369 --
NM_003575chr741453 1152 1115 639 --1207 --
NM_003576chr1352876 2517 2440 1064 887 --32637 2443 2290 --
NM_003583chr1293623 3577 2734 2631 2467 1126 830 732 701 23895 878 13777 --
NM_003590chr233031 753 384 1767 23550 3296 --
NM_003592chr71381 ------
NM_003595chr22194 1119 ----
NM_003607chr164255 3897 3296 2838 1694 253 13224 11697 11656
NM_003613chr151671 1511 --1627
NM_003615chr353666 3132 2664 229 95 12836 ----
NM_003620chr173933 809 203 ----1834
NM_003622chr1242637 2229 1806 120 ------
NM_003624chr193919 488 391 --133 1529
NM_003629chr173131 3039 2960 2268 1301 456 404 --23350 3042 11143
NM_003630chr62672 585 ------
NM_003632chr173777 592 241 --1311 --
NM_003633chr582555 2523 2323 2057 1842 1010 771 141 --2448 445 1647
NM_003636chr151764 1673 1574 494 69 1414 ----
NM_003637chr121449 484 --1159 --
NM_003644chr17136576 6507 5900 5531 4828 4645 4634 4531 4477 2188 1081 746 32 16284 11324 15066
NM_003651chr121167 ------
NM_003654chr11--1750 ----
NM_003659chr23833 311 298 --1289 --
NM_003663chr312341 --1389 --
NM_003664chr5164 1199 ----
NM_003670chr3121 21034 547 21221 464 --
NM_003671chr973124 2790 2276 547 339 235 105 1533 12381 11143
NM_003672chr141205 698 426 27 11970 ----
NM_003673chr172413 91 --179 --
NM_003677chr1242071 1832 1599 316 ----11837
NM_003684chr141011 888 851 712 180 1891 --
NM_003687chr531102 1063 930 11198 ----
NM_003690chr23606 505 473 ------
NM_003692chr92919 645 ------
NM_003702chr85686 300 220 147 95 ------
NM_003704chr42587 484 ------
NM_003705chr21190 --1575 --
NM_003709chr22337 303 ------
NM_003710chr151442 ------
NM_003713chr141532 1135 61 24 143 1305 --
NM_003714chr542792 2320 2216 2204 23021 1195 ----
NM_003716chr33284 64 24 ------
NM_003718chr71186 ------
NM_003722chr342678 2656 2092 984 ------
NM_003728chr41509 ------
NM_003735chr52632 236 ------
NM_003736chr52632 236 ------
NM_003743chr212100 ------
NM_003746chr12--197 ----
NM_003749chr1362270 2183 582 224 149 89 22112 1883 12353 --
NM_003750chr10--1389 1957 --
NM_003758chr15----2259 216 11243
NM_003758chr15----2259 216 11243
NM_003763chr2043163 2851 328 233 22952 578 ----
NM_003768chr131482 1257 165 --11398 --
NM_003769chr122272 49 ------
NM_003774chr1272682 2601 2455 2371 2153 2056 422 1975 1183 --
NM_003778chr3198 ----1611
NM_003783chr11283 145 ----
NM_003787chr1821474 358 --1436 --
NM_003794chr351089 1073 969 413 336 --1845 --
NM_003795chr61226 ------
NM_003797chr11170 ------
NM_003798chr91192 ------
NM_003800chr631840 460 56 ------
NM_003822chr152971 1229 970 839 831 12759 ----
NM_003831chr1821793 1514 ------
NM_003861chr1422430 139 22859 469 ----
NM_003870chr1522081 1954 21828 703 --11332
NM_003872chr242784 1991 1964 246 ------
NM_003873chr1041847 599 514 69 1691 ----
NM_003877chr121978 --1981 --
NM_003878chr8268 55 ------
NM_003885chr1762170 1733 1700 1007 659 587 12456 22102 1667 --
NM_003887chr23879 411 202 22122 1916 ----
NM_003895chr2132082 1923 1700 22013 1585 11604 --
NM_003902chr11704 --1707 --
NM_003908chr2041321 1092 957 165 ------
NM_003913chr662625 1563 1073 795 379 286 --12741 --
NM_003916chrX11506 1120 --11313
NM_003927chr181947 1692 ----
NM_003930chr732385 341 128 --1227 1479
NM_003931chr61262 1662 ----
NM_003941chr741698 1569 625 205 --11701 --
NM_003943chr41126 ------
NM_003947chr32347 230 --11332 --
NM_003951chrX1361 ------
NM_003953chr132528 1851 252 ------
NM_003958chr673922 3882 3142 2442 482 178 90 1661 33825 3045 2445 --
NM_003968chr31634 ------
NM_003971chr17--1131 ----
NM_003980chr621265 72 11111 --11076
NM_003983chr16124461 4063 4034 3489 1535 1337 1069 926 849 741 671 383 23591 839 14037 13422
NM_003988chr1041932 924 867 447 12274 154 --
NM_003994chr1263765 3271 1536 1197 135 24 13982 ----
NM_003998chr42599 254 --2279 276 --
NM_004006chrX31802 1070 236 --11073 --
NM_004007chrX31802 1070 236 --11073 --
NM_004009chrX31802 1070 236 --11073 --
NM_004010chrX31802 1070 236 --11073 --
NM_004011chrX31802 1070 236 --11073 --
NM_004012chrX31802 1070 236 --11073 --
NM_004013chrX31802 1070 236 --11073 --
NM_004014chrX31802 1070 236 --11073 --
NM_004015chrX31802 1070 236 --11073 --
NM_004016chrX31716 984 150 --1987 --
NM_004017chrX31802 1070 236 --11073 --
NM_004018chrX31716 984 150 --1987 --
NM_004020chrX31802 1070 236 --11073 --
NM_004021chrX31716 984 150 --1987 --
NM_004022chrX31716 984 150 --1987 --
NM_004023chrX31716 984 150 --1987 --
NM_004027chr2----128 --
NM_004028chr1812587 12606 13051 --
NM_004036chr23691 676 170 1635 ----
NM_004050chr1452166 2061 817 677 456 --1784 21941 444
NM_004055chr1141678 1393 901 297 1256 2694 691 --
NM_004067chr711420 1400 ----
NM_004075chr12--1492 ----
NM_004080chr72530 430 ------
NM_004081chrY21161 123 ------
NM_004085chrX154 ------
NM_004087chr31630 --21853 1850 --
NM_004090chr1732657 2116 722 --1942 --
NM_004093chr1342054 767 512 247 1660 31132 915 770 --
NM_004097chr22263 38 --146 --
NM_004100chr61248 ----12293
NM_004103chr82249 69 --1252 --
NM_004104chr172769 686 --1139 --
NM_004112chr1741647 1538 642 90 ----1178
NM_004114chrX21011 54 ------
NM_004116chr23432 426 152 --139 --
NM_004124chr1453519 3039 2842 620 94 ----12665
NM_004130chr32187 89 1492 198 --
NM_004133chr852038 972 662 469 169 --21980 116 --
NM_004136chr1532567 2339 1107 1208 1978 1868
NM_004157chr33829 723 114 1569 2865 348 --
NM_004161chr231078 451 256 --11419 --
NM_004162chr331247 979 954 ------
NM_004169chr17186 --1325 --
NM_004170chr941849 1789 1670 289 21363 635 --11853
NM_004171chr11129160 6909 6366 6244 3658 3100 2985 2397 1973 1485 638 125 --1248 --
NM_004177chr1121492 1359 11846 121 --
NM_004181chr41107 1349 ----
NM_004185chr1----1102 --
NM_004200chr111732 ------
NM_004205chr11------1488
NM_004227chr723014 2096 32372 993 927 2208 115 --
NM_004228chr191148 ------
NM_004232chr1843561 3182 3041 400 --1309 11303
NM_004235chr92655 545 ------
NM_004238chr2131 ------
NM_004241chr101228 ------
NM_004255chr15142 ------
NM_004263chr221797 1313 11525 11393 --
NM_004272chr511993 1492 ----
NM_004274chr1432109 781 251 12855 --12916
NM_004276chr121391 --2282 279 --
NM_004279chr742079 1982 728 528 11709 ----
NM_004281chr102209 104 ------
NM_004293chr953820 3647 3403 1009 233 11040 ----
NM_004294chr13--1587 ----
NM_004304chr21341 ------
NM_004305chr21433 --1372 --
NM_004309chr174459 389 272 223 ------
NM_004311chr1032509 113 70 --52702 1182 1113 972 525 --
NM_004319chr11570 22758 1048 32220 1065 24 --
NM_004323chr942310 2240 875 274 --195 --
NM_004326chr13489 127 61 ------
NM_004327chr2232181 2001 1941 11620 1423 --
NM_004329chr101559 --11286 1135
NM_004330chr1551121 945 166 104 55 1244 ----
NM_004338chr1897008 6996 5472 4345 2358 2203 1310 1178 897 26596 4669 86637 4644 4612 4609 4606 4603 4600 4597 --
NM_004342chr722136 936 22021 541 ----
NM_004346chr411401 ------
NM_004349chr831234 381 294 1373 ----
NM_004352chr162574 517 ------
NM_004354chr41723 1618 ----
NM_004356chr112165 112 ------
NM_004364chr19--11018 ----
NM_004370chr662125 1843 1729 1468 758 27 --11697 --
NM_004379chr221194 671 127 ----
NM_004380chr1642185 1639 977 637 ------
NM_004384chr52532 49 1928 11669 --
NM_004385chr51458 ------
NM_004388chr1----182 --
NM_004389chr21756 ------
NM_004392chr1342631 1788 778 519 --1267 --
NM_004393chr34915 744 662 507 1563 ----
NM_004395chr51252 1803 ----
NM_004397chr1153543 2960 1659 1071 242 14264 13958 11636
NM_004404chr231900 1810 1646 21626 590 1549 --
NM_004405chr21258 ------
NM_004408chr92488 56 ------
NM_004411chr72587 258 --1590 --
NM_004412chr1075925 5491 5098 5036 4426 3756 2244 25293 1862 25663 1138 --
NM_004414chr2121092 132 ------
NM_004415chr62667 161 --123 --
NM_004416chr121735 1977 ----
NM_004420chr1142279 1533 608 143 1315 ----
NM_004423chr332127 830 533 ----12302
NM_004424chr161145 ------
NM_004426chr123635 595 162 ------
NM_004427chr1--1950 ----
NM_004429chrX31456 1080 594 --11083 11185
NM_004430chr821743 1693 --2758 52 --
NM_004432chr941896 1484 880 160 --1454 --
NM_004438chr242802 1179 835 143 ------
NM_004440chr641449 627 576 465 1644 181 --
NM_004441chr3--11296 1150 --
NM_004449chr2121423 536 ------
NM_004454chr332038 1489 568 ------
NM_004457chr22505 27 ------
NM_004458chrX51932 1763 1007 681 85 12577 --11981
NM_004459chr1721992 1531 --21579 569 --
NM_004464chr464301 3573 3224 1304 1008 510 ------
NM_004469chrX262 49 1366 ----
NM_004481chr132578 796 563 --12044 --
NM_004484chrX----1280 --
NM_004487chr3----1931 --
NM_004491chr1984291 3440 3150 3026 3008 1256 874 296 23702 548 13883 --
NM_004492chr15138 ------
NM_004496chr142533 171 --1536 --
NM_004498chr151286 ------
NM_004500chr1421271 363 --11492 --
NM_004501chr164066 2612 2581 1640 1457 312 21471 986 --1652
NM_004504chr23782 590 443 12848 12962 --
NM_004505chr1722022 115 11975 ----
NM_004515chr12287 59 ------
NM_004525chr231460 1147 284 2313 297 --11523
NM_004529chr921231 888 11237 ----
NM_004535chr2021625 1164 ------
NM_004540chr211190 ------
NM_004543chr2178 1337 ----
NM_004571chr2162997 2777 2244 1300 684 548 1912 23001 417 --
NM_004575chr441624 1457 620 290 ------
NM_004578chr11846 ------
NM_004582chr11421 193 ----
NM_004586chrX105123 4735 4495 4241 4035 3592 3403 2140 636 136 --3750 139 127 --
NM_004588chr1143987 3156 818 640 ------
NM_004593chr32683 158 1261 ----
NM_004596chr19----1180 --
NM_004598chr51109 13132 ----
NM_004602chr2021393 1172 11113 ----
NM_004607chr5177 ------
NM_004612chr954409 3978 3103 1049 311 13442 ----
NM_004613chr2021569 665 125 ----
NM_004615chrX3764 719 701 ------
NM_004616chr12151 ------
NM_004620chr112496 153 ------
NM_004622chr232022 1884 728 --11941 198
NM_004631chr11369 1278 ----
NM_004639chr6194 ------
NM_004643chr142318 226 1169 1277 --
NM_004645chr171753 ------
NM_004654chrY11373 1270 ----
NM_004656chr33943 908 500 ------
NM_004660chrY1864 11901 11712 --
NM_004663chr1511521 ------
NM_004673chr131549 1513 988 11058 ----
NM_004687chr1762012 1911 1732 1478 1465 745 2825 687 ----
NM_004690chr61739 ------
NM_004694chr171782 ------
NM_004697chr921070 50 ------
NM_004703chr171277 11802 12580 --
NM_004709chrX31736 1389 42 1126 ----
NM_004725chr1031494 1446 428 ----2531 415
NM_004726chrX95315 4916 4790 4757 4691 3609 898 689 272 15587 ----
NM_004730chr541749 1462 363 294 ------
NM_004734chr1332328 1147 839 --2858 855 1317
NM_004735chr21153 ------
NM_004736chr131800 835 578 1821 1839 --
NM_004737chr2241281 1274 883 58 ------
NM_004738chr2042083 1740 687 462 --1813 1783
NM_004739chr111654 ------
NM_004742chr3--2534 425 ----
NM_004744chr413670 23779 1209 ----
NM_004745chr846351 4783 2553 2113 34995 2279 1133 34801 2556 1316 --
NM_004747chr1021499 477 11167 ----
NM_004748chr1521501 920 12749 1136 --
NM_004751chr151322 1425 2132 23 --
NM_004755chr141294 11092 ----
NM_004759chr14573 424 295 39 ----1577
NM_004760chr72705 420 1969 12017 12202
NM_004762chr173480 143 78 ------
NM_004768chr12251 137 ------
NM_004772chr5--21504 1321 ----
NM_004776chr2043001 2461 977 266 --2965 962 12841
NM_004779chr5------1378
NM_004781chr141230 91 67 26 1599 ----
NM_004781chr141230 91 67 26 1599 ----
NM_004788chr113450 388 344 --12446 22500 1971
NM_004792chr2--2191 60 ----
NM_004796chr1442163 1867 255 97 ------
NM_004798chr2023029 165 13186 12649 13293
NM_004801chr221476 266 --11550 --
NM_004808chr1052412 2277 1046 882 362 ------
NM_004814chr12449 113 ------
NM_004817chr91258 ------
NM_004831chr1911046 --1197 --
NM_004834chr222972 238 13266 12774 --
NM_004835chr33828 320 228 ----1832
NM_004835chr33828 320 228 ----1832
NM_004836chr21191 1838 1246 --
NM_004840chrX42343 1893 1763 199 ------
NM_004841chr11302 --195 --
NM_004845chrX73669 3413 3385 3000 794 377 363 31364 259 134 ----
NM_004849chr61449 --1117 --
NM_004856chr15----1438 --
NM_004859chr1722537 850 23028 2932 22373 1226 --
NM_004863chr1454522 3971 3897 835 377 2578 196 ----
NM_004871chr1754174 3196 2717 510 245 23003 1765 12834 --
NM_004874chr8130 ------
NM_004879chr112627 383 ------
NM_004884chr152437 373 ------
NM_004887chr531072 407 263 ------
NM_004897chr101884 ------
NM_004898chr432733 2670 1904 12648 32864 1969 804 --
NM_004902chr201126 ------
NM_004904chr711177 36015 1292 594 --11121
NM_004905chr12653 220 --2890 117 --
NM_004906chr6--1629 --1238
NM_004911chr71489 ------
NM_004929chr8125 ------
NM_004938chr911260 ------
NM_004945chr191582 --1853 --
NM_004949chr1842078 1959 823 676 ------
NM_004956chr773724 1390 1112 1061 952 742 568 33403 3066 1310 23323 1115 --
NM_004965chr211562 ------
NM_004966chr101904 ------
NM_004968chr7188 --1275 --
NM_004973chr641663 1390 1324 1279 ------
NM_004976chr1143314 1361 248 159 --11280 --
NM_004985chr1243089 2776 562 123 21165 715 ----
NM_004992chrX127618 6894 6791 6362 6229 5659 5570 5313 2810 1383 307 52 57149 5834 5554 2536 1437 12177 --
NM_004992chrX127618 6894 6791 6362 6229 5659 5570 5313 2810 1383 307 52 57149 5834 5554 2536 1437 12177 --
NM_004993chr141572 11523 ----
NM_004999chr643996 3641 680 663 13704 11075 --
NM_005010chr74627 528 274 110 1558 ----
NM_005025chr32214 191 ------
NM_005028chr1012160 ------
NM_005032chrX31015 840 313 ------
NM_005045chr7147 ------
NM_005056chr1295393 4114 4041 1491 1284 1237 774 713 339 14783 --14242
NM_005063chr1093255 3123 2605 1208 937 799 485 394 252 33440 2803 1478 ----
NM_005065chr1475409 5090 3718 1917 1753 142 51 34252 3972 1202 ----
NM_005067chr33943 277 213 ------
NM_005068chr611376 ------
NM_005069chr2131225 247 109 ------
NM_005087chr31249 ------
NM_005088chrX1735 1742 1321 --
NM_005093chr2054536 3242 1004 539 31 35331 3434 986 25054 4089 --
NM_005095chr132063 620 67 ----1624
NM_005097chr102263 123 ------
NM_005099chr121129 76 ------
NM_005109chr342066 1682 601 58 11646 1646 --
NM_005110chr51540 ------
NM_005117chr112257 31 --2270 224 --
NM_005119chr141219 1202 1024 249 ------
NM_005120chrX2203 163 ------
NM_005121chr1753179 1104 986 596 168 ------
NM_005126chr331655 643 150 1490 11712 --
NM_005134chr182821 644 ------
NM_005135chr1563132 3059 2962 2399 852 530 13337 ----
NM_005139chr41322 ------
NM_005151chr183712 476 384 --1501 1868
NM_005153chr163738 513 220 ------
NM_005156chr954296 3736 3306 1614 1563 44793 3813 3298 721 ----
NM_005168chr211656 11189 ----
NM_005180chr1031223 1188 389 --21537 551 11120
NM_005187chr162774 150 --1153 --
NM_005188chr1187372 6917 6412 3192 2879 2806 671 423 27032 3032 1774 --
NM_005194chr201443 ------
NM_005197chr1496061 5989 5204 5044 4702 4613 2463 2352 243 14936 --2956 737
NM_005202chr161633 908 751 374 284 21 ----11545
NM_005206chr172250 97 11300 ----
NM_005207chr2273451 3177 2821 2716 1399 383 24 --1966 --
NM_005208chr17--151 --1112
NM_005215chr18----1266 --
NM_005219chr581608 1530 629 540 475 294 239 142 21812 1682 ----
NM_005221chr7151 ------
NM_005222chr71673 ------
NM_005225chr2021202 1108 ------
NM_005233chr321908 863 ------
NM_005235chr267269 6650 6298 5135 5065 1308 12771 25962 4880 16654
NM_005238chr1122407 1225 22564 32 ----
NM_005241chr321343 428 181 --1220
NM_005242chr53990 136 75 ------
NM_005245chr42602 67 ------
NM_005256chr112914 832 ------
NM_005259chr211380 ------
NM_005296chrX2846 155 ----21070 693
NM_005302chr7--1289 ----
NM_005308chr10--1432 ----
NM_005311chr722484 976 22525 701 2979 182 --
NM_005312chr9180 --11889 --
NM_005313chr15--1139 1511 --
NM_005316chr113973 348 316 1813 ----
NM_005318chr221238 11042 ----
NM_005328chr82203 108 --1111 --
NM_005329chr1661884 1803 1552 1493 1442 799 11855 ----
NM_005334chrX3698 191 119 --11204 --
NM_005339chr494094 4024 3655 3581 3468 3056 1669 953 62 --23855 3754 13832
NM_005342chrX52636 2216 788 597 288 --11785 --
NM_005347chr93169 145 128 --11713 --
NM_005349chr41255 ------
NM_005358chr1341774 1706 623 52 ----1600
NM_005359chr1866128 5363 4927 4664 4009 258 31964 963 752 26114 4002 1800
NM_005370chr1921075 215 1237 11178 --
NM_005374chr1762047 1967 813 647 468 324 --2945 816 --
NM_005378chr23561 273 162 1764 ----
NM_005381chr2162 ------
NM_005387chr112190 62 ----2664 616
NM_005388chr93539 258 95 11224 1542 --
NM_005389chr64812 643 566 163 ----1743
NM_005392chr911722 1334 --1215
NM_005397chr763799 3486 1395 1164 949 413 --21426 228 --
NM_005398chr1031269 1151 89 ------
NM_005399chr134341 4290 393 11715 12886 23494 3175
NM_005400chr222747 382 22621 692 ----
NM_005406chr1841449 1112 130 86 11234 ----
NM_005407chr1431479 560 22 --11051 --
NM_005415chr21616 2623 222 ----
NM_005426chr13771 693 367 146 ----
NM_005433chr18----12698 --
NM_005436chr1062557 1228 1059 821 404 263 --23509 3367 12708
NM_005440chr1763278 3183 1105 899 845 573 --1848 --
NM_005442chr32622 611 --1459 --
NM_005443chr4----1504 --
NM_005455chr121343 204 ----1540
NM_005461chr2021386 386 --11686 --
NM_005475chr1233290 3273 465 1118 ----
NM_005476chr921240 1133 ------
NM_005488chr223303 218 91 ------
NM_005493chr61577 170 1557 --
NM_005497chr1765345 4676 1442 891 366 113 16067 ----
NM_005499chr192154 145 ------
NM_005502chr943042 826 654 563 21993 921 --1843
NM_005523chr71480 11211 ----
NM_005530chr1521204 274 --11462 --
NM_005536chr821279 32 ------
NM_005537chr132787 742 ------
NM_005539chr1041380 1275 554 118 --11325 --
NM_005542chr711740 ------
NM_005559chr18--136 ----
NM_005561chr13--2211 190 ----
NM_005563chr12894 351 --1665 --
NM_005569chr2251450 1350 366 285 69 ----11355
NM_005578chr344853 4683 3923 111 --13822 --
NM_005581chr192484 343 ------
NM_005586chr61643 ------
NM_005587chr151889 ------
NM_005595chr11321 ------
NM_005596chr956381 6372 6353 6002 1983 ----15848
NM_005598chr121266 251 ----11070
NM_005604chr622022 2003 --1437 --
NM_005607chr8126 1951 ----
NM_005610chr13891 808 599 ------
NM_005611chr1631295 234 111 ------
NM_005614chr7--1102 1966 1747
NM_005618chr62239 109 ----2113 82
NM_005625chr83740 364 305 ------
NM_005627chr61297 --1666 --
NM_005634chrX1234 ------
NM_005637chr182295 134 1495 22051 1367 --
NM_005638chrX31180 572 502 1396 ----
NM_005647chrX53137 2752 2371 877 648 --12755 --
NM_005648chr81176 127 ----
NM_005650chr2221309 241 ------
NM_005653chr12130 ------
NM_005655chr821103 331 11009 ----
NM_005657chr15134 ------
NM_005668chr544480 3406 3335 1213 11438 ----
NM_005669chr542330 2270 1994 860 --1264 --
NM_005686chr141461 613 484 186 --1521 --
NM_005688chr361236 1161 1154 931 449 354 11094 ----
NM_005690chr122196 45 ------
NM_005698chr14250 237 199 29 ------
NM_005717chr121252 402 ------
NM_005718chr32698 149 ------
NM_005722chr252227 2008 711 487 239 22413 1626 1315 1437
NM_005724chr152306 67 --170 --
NM_005730chr1263238 3092 3023 2283 1142 984 --21386 519 --
NM_005731chr22293 54 ------
NM_005734chr114750 734 701 262 ------
NM_005737chr232870 2487 322 ------
NM_005738chr751938 1817 1770 1407 1374 ------
NM_005739chr152227 128 1414 ----
NM_005746chr722304 993 ------
NM_005748chr1233120 2651 488 ------
NM_005749chr171593 1573 ----
NM_005752chr1621222 461 2243 155 ----
NM_005754chr51100 ------
NM_005759chr253409 3351 3311 1070 889 23343 1030 41153 1150 1074 714 21446 736
NM_005766chr133880 222 33 --1396 --
NM_005777chr3----183 --
NM_005778chr3----165 1102
NM_005779chr532429 706 358 ------
NM_005780chr131811 ------
NM_005785chr1221897 1876 1729 11725 --
NM_005786chr18199 ------
NM_005789chr17----11986 --
NM_005795chr242761 2334 1995 568 11852 ----
NM_005796chr162290 29 --1134 --
NM_005798chr1384957 4796 3562 3491 3426 2107 1456 581 25255 3212 ----
NM_005808chr343462 2930 2612 978 11085 32261 1037 999 --
NM_005813chr272339 2144 798 753 647 641 576 ----1802
NM_005819chr153234 848 795 339 115 23133 1192 21340 275 1864
NM_005822chr62906 336 ------
NM_005828chr1774174 3783 2000 1500 1399 137 125 ----14178
NM_005832chr331162 147 97 ------
NM_005833chr92167 64 ------
NM_005839chr12666 112 166 ----
NM_005840chrX85269 2767 2310 1799 739 702 469 377 26818 5566 15273 25277 1803
NM_005841chr4154 11019 ----
NM_005842chr132714 126 199 ----
NM_005843chr231886 1835 630 ------
NM_005850chr1125 ------
NM_005851chr11--1400 ----
NM_005859chr521575 1150 21178 134 11535 1253
NM_005860chr1941218 364 335 54 ------
NM_005862chr32883 326 ------
NM_005863chr10--31265 391 179 ----
NM_005870chr1331411 1252 403 1243 ----
NM_005871chr103907 246 168 1412 ----
NM_005877chr2242213 2010 1942 713 ------
NM_005880chr1611425 --1408 --
NM_005881chr162278 99 ------
NM_005885chr561540 596 556 330 191 161 ------
NM_005886chr162223 108 --3260 257 111 --
NM_005892chr171300 ------
NM_005898chr1132018 1024 1002 --11005 --
NM_005899chr1751543 1072 576 146 32 1367 ----
NM_005900chr41894 21127 1032 ----
NM_005901chr18117661 5595 3058 2591 2323 1359 817 459 442 395 348 37569 2934 690 26231 1436 --
NM_005902chr1554375 4356 4290 3505 1751 1740 34359 3120 1498 --
NM_005903chr575130 5057 4435 4195 1043 794 541 15224 13232 14627
NM_005904chr181923 ----163
NM_005906chr611480 11443 11273 11216
NM_005909chr563560 3534 2953 2902 2748 296 43825 3499 252 180 ----
NM_005910chr17114124 3626 3615 3482 3354 2624 1166 958 716 358 102 ----13292
NM_005911chr21182 ------
NM_005916chr7143 1130 ----
NM_005917chr2----1175 --
NM_005920chr153745 3500 1494 1448 1168 ------
NM_005924chr741027 793 455 302 ----1797
NM_005927chr511155 1902 ----
NM_005930chr14164 --167 --
NM_005933chr1142679 2219 815 251 ------
NM_005935chr445239 2022 1752 1087 ------
NM_005938chrX31328 472 321 ------
NM_005941chr873942 3181 2735 727 207 145 79 12853 172 12739
NM_005943chr641497 1384 649 268 --11647 --
NM_005955chr194982 4656 4463 3916 1529 869 829 698 414 25484 3936 ----
NM_005962chr1031890 1461 717 ------
NM_005962chr1031890 1461 717 ------
NM_005964chr1711415 ------
NM_005966chr232374 2156 1496 21641 903 11733 --
NM_005977chr131223 ------
NM_005984chr22153 ------
NM_006003chr191205 1196 ----
NM_006007chr954484 4032 3173 2996 1024 1718 13362 14107
NM_006009chr12126 ------
NM_006010chr31188 ------
NM_006011chr1554313 4015 1181 934 844 44127 3694 2655 792 ----
NM_006016chr652238 1610 899 843 512 1790 31780 248 245 --
NM_006017chr41742 ------
NM_006022chr131787 --130 1868
NM_006023chr102171 56 ------
NM_006024chr7--2593 202 ----
NM_006030chr341424 1381 316 251 ------
NM_006033chr1852104 488 394 321 47 21669 77 1184 --
NM_006035chr1451199 1113 1100 342 224 ------
NM_006036chr262573 2070 1834 1601 798 344 --12473 --
NM_006037chr264398 1946 1752 1527 905 21 ------
NM_006040chr1631014 428 269 --21375 150 11228
NM_006041chr171341 1171 ----
NM_006043chr161681 --1684 --
NM_006047chr2021090 571 12424 13309 1378
NM_006048chr13454 246 26 ----1406
NM_006054chr1111476 --11480 --
NM_006060chr743704 727 449 232 ----11200
NM_006062chr241094 380 196 129 11108 --1200
NM_006076chr742223 2130 1087 602 1502 ----
NM_006077chr102622 174 --184 --
NM_006079chr61316 ------
NM_006080chr752970 2674 1896 915 768 23008 1115 12973 --
NM_006090chr11605 ------
NM_006094chr842443 937 476 161 12285 ----
NM_006095chr464298 1354 1330 1148 682 30 44290 2948 221 73 --12897
NM_006100chr31115 ------
NM_006106chr1142988 2974 2447 243 1819 1169 1173
NM_006107chr171474 ------
NM_006113chr131499 264 113 11603 ----
NM_006116chr2221583 384 ------
NM_006122chr1532711 2536 575 --3816 155 152 --
NM_006133chr1172147 809 743 470 367 361 261 11785 1536 1137
NM_006134chr2121571 1330 1186 ----
NM_006135chr15979 344 206 200 99 ------
NM_006136chr72226 99 ----1444
NM_006139chr22683 553 --12777 --
NM_006141chr16--22316 59 12476 --
NM_006142chr13453 185 102 ------
NM_006148chr1722912 589 --12352 --
NM_006153chr32239 25 ------
NM_006155chr231900 1810 1646 21626 590 1549 --
NM_006158chr811392 --11558 --
NM_006159chr12--131 ----
NM_006160chr1721069 155 ------
NM_006162chr1831314 613 454 11265 ----
NM_006166chr1242383 1692 921 250 2668 621 ----
NM_006180chr951796 1578 751 500 96 21948 1821 ----
NM_006183chr12--1573 ----
NM_006186chr22482 327 --1182 --
NM_006192chr2021045 823 11139 ----
NM_006195chr91473 1489 ----
NM_006197chr831606 475 378 12264 21944 479 --
NM_006201chrX3905 193 138 ------
NM_006203chr554757 1323 1282 925 447 15320 ----
NM_006206chr42673 547 --1473 --
NM_006209chr8--1370 --1363
NM_006212chr175131 3847 3281 1543 1064 1017 185 --24884 1966 --
NM_006216chr25697 613 601 266 44 186 ----
NM_006218chr3--153 ----
NM_006224chr1752399 2244 2097 1680 249 --22101 1904 --
NM_006228chr81394 ------
NM_006237chr132829 764 12105 11567 --
NM_006238chr652016 1807 794 613 253 --11894 --
NM_006241chr3164 11651 21592 927 --
NM_006245chr62756 299 ------
NM_006246chr141292 1395 --1403
NM_006251chr532340 2100 1080 ------
NM_006252chr176070 5420 5014 2353 1824 357 24 --15945 16556
NM_006254chr32401 92 --195 --
NM_006256chr132173 903 660 ------
NM_006258chr102640 128 ------
NM_006259chr41235 21015 882 1929 --
NM_006265chr831483 1338 1119 1473 ----
NM_006267chr221248 139 ------
NM_006268chr11140 ------
NM_006275chr2032279 484 333 21672 976 ----
NM_006277chr2--1550 ----
NM_006278chr112169 41 --1480 --
NM_006281chr82260 180 ------
NM_006281chr82260 180 ------
NM_006282chr2044486 2904 1669 924 21316 1013 1512 --
NM_006283chr834831 136 42 34487 1946 1902 34680 1961 544 1269
NM_006287chr21159 ------
NM_006290chr631528 1494 662 21387 1274 --1624
NM_006293chr1521024 373 1360 21018 998 --
NM_006301chr121592 ------
NM_006306chrX65904 5845 5106 4742 1816 1543 44252 3954 1118 132 ----
NM_006307chrX1238 ------
NM_006310chr1721013 32 2903 315 ----
NM_006313chr1241589 1347 1216 40 --1274 --
NM_006320chr42370 95 ------
NM_006321chr321768 423 ------
NM_006322chr13149 ------
NM_006323chr41209 1723 ----
NM_006325chr122255 211 ----1825
NM_006328chr111208 2536 156 ----
NM_006330chr831557 1367 541 ------
NM_006352chr152032 1664 1551 692 443 ------
NM_006357chr21415 ------
NM_006359chrX51995 1664 964 888 259 --1463 12286
NM_006366chr631241 975 351 1888 ----
NM_006367chr1--1940 ----
NM_006371chr395189 5000 4871 4352 3989 3855 1636 319 80 11502 ----
NM_006372chr63508 436 407 ------
NM_006375chrX11595 1341 ----
NM_006377chr931234 969 444 ------
NM_006380chr1733302 3145 1455 24385 698 21652 1351 11445
NM_006393chr1044215 4033 3517 928 ----24220 235
NM_006400chr121370 155 ----
NM_006401chr9170 ------
NM_006403chr631652 1562 1221 ------
NM_006405chr14127 ------
NM_006416chr61654 1171 ----
NM_006420chr2042598 2563 1234 146 12882 ----
NM_006434chr1043045 1205 609 339 2847 553 2968 464 --
NM_006449chr22801 145 ------
NM_006451chr51287 21017 977 ----
NM_006459chr1041789 1701 617 237 ------
NM_006460chr1731381 1220 207 ------
NM_006464chr284204 4059 3885 3863 1754 1733 213 55 22926 107 --1374
NM_006466chr20----1129 --
NM_006467chr542203 2182 2050 359 1338 ----
NM_006469chr121451 1161 ----21095 102
NM_006476chr112747 75 ------
NM_006478chr22----1183 --
NM_006480chr51497 ------
NM_006482chr1293623 3577 2734 2631 2467 1126 830 732 701 23895 878 13777 --
NM_006489chr1441823 1536 368 95 11315 ----
NM_006494chr192685 630 ------
NM_006504chr1032876 1888 140 1230 ----
NM_006520chrX21688 1271 --11572 --
NM_006526chr2021412 498 1186 --1335
NM_006527chr42743 106 ------
NM_006534chr2053323 2594 530 331 211 13179 ----
NM_006537chr152396 213 1492 1577 --
NM_006538chr234147 3482 867 13741 1992 --
NM_006540chr81117 1963 ----
NM_006542chr11167 1113 ----
NM_006544chr1485809 5507 4656 3721 1874 1675 1023 301 ----14748
NM_006546chr1766662 6132 2432 2200 1097 502 --22043 2033 --
NM_006547chr721923 1479 11788 ----
NM_006548chr311475 ------
NM_006549chr1232347 734 418 11039 32294 639 55 --
NM_006555chr771950 1556 1530 1489 1328 607 337 11406 11533 --
NM_006557chr931560 1508 367 1353 2612 371 --
NM_006559chr14967 477 338 78 ------
NM_006561chr1096025 5870 5468 4326 3803 2432 2273 2109 1242 15861 ----
NM_006565chr1611271 1889 ----
NM_006570chr91114 ------
NM_006572chr1773287 3008 2814 2193 695 564 174 11038 1478 --
NM_006574chr31245 --2271 248 --
NM_006577chr221127 918 ------
NM_006580chr31121 1198 ----
NM_006591chr112497 431 11284 1201 1779
NM_006595chr1141367 624 357 153 1396 1519 --
NM_006599chr16127701 7374 7283 5755 5725 5187 3278 1997 1058 485 342 162 26068 1564 --17878
NM_006600chr11191 ------
NM_006601chr122447 254 ------
NM_006603chrX1391 11672 1250 --
NM_006612chr173476 71 42 ------
NM_006614chr333053 2721 2239 --1344 --
NM_006621chr121783 1736 11910 --1392
NM_006624chr1032099 1610 1468 ------
NM_006625chr1----11085 --
NM_006625chr1----11085 --
NM_006625chr1----11085 --
NM_006628chr1554487 4389 3064 1209 989 130 1137 --
NM_006629chr1812418 ------
NM_006633chr5--1165 ----
NM_006640chr1731845 1474 1380 ----1759
NM_006646chr1322965 1977 33004 2168 576 ----
NM_006650chr553898 3811 3534 2859 34 --11518 --
NM_006653chr6199 ------
NM_006654chr1264727 4026 1289 1061 1015 606 24089 376 ----
NM_006662chr16--169 ----
NM_006667chrX1113 ------
NM_006670chr6--1174 ----
NM_006675chr1251263 1129 1089 1003 35 1874 ----
NM_006690chr2041574 724 544 450 ----1815
NM_006693chr73803 147 44 --1298 --
NM_006698chr2041463 1423 1271 1210 ------
NM_006699chr12719 274 --1862 --
NM_006700chr122761 571 --1224 --
NM_006703chr61151 ------
NM_006706chr5------1795
NM_006709chr6170 ------
NM_006711chr162517 171 ------
NM_006717chr911244 23339 1102 ----
NM_006718chr61877 --1271 --
NM_006720chr1074768 4646 1906 1705 1247 1008 967 --15023 --
NM_006722chr312964 --1701 --
NM_006726chr41137 --1198 --
NM_006727chr5--1504 ----
NM_006729chrX65275 4159 4143 1965 1583 1137 1668 35215 4677 1646 --
NM_006731chr965494 4876 1781 1391 1308 855 ----12133
NM_006734chr631122 1079 117 ------
NM_006735chr71366 ------
NM_006736chr261722 1690 1450 522 505 339 ------
NM_006738chr1543925 3393 1271 61 --24329 3723 --
NM_006746chrX31132 528 189 ------
NM_006750chr1658121 4894 2720 458 224 57348 6700 1185 282 133 ----
NM_006751chr22343 87 ----1347
NM_006754chr741206 787 271 134 --1928 --
NM_006755chr111176 ------
NM_006758chr21129 ------
NM_006761chr172604 561 ------
NM_006763chr171551 1333 761 753 643 586 187 --1277 --
NM_006766chr832292 2010 820 ------
NM_006769chr1----1577 --
NM_006772chr631611 1465 1215 ------
NM_006775chr633038 2183 531 163 ----
NM_006777chrX42378 1991 539 512 1380 32121 2118 2115 --
NM_006800chrX1162 ------
NM_006802chr141126 888 390 99 ------
NM_006805chr541339 1307 685 140 ------
NM_006816chr51288 ------
NM_006819chr113269 257 162 ------
NM_006826chr21204 ----1927
NM_006827chr1422317 2211 12200 11174 12179
NM_006832chr14274 60 --1952 --
NM_006833chr72144 125 ------
NM_006836chr121540 ------
NM_006838chr1241340 1325 1252 385 ------
NM_006842chr111136 ------
NM_006846chr51109 ------
NM_006852chr1721115 260 11050 1516 12236
NM_006854chr731305 753 688 ------
NM_006861chr1242071 1957 485 361 ------
NM_006868chr1823176 2083 2266 61 --12355
NM_006870chr20154 ------
NM_006874chr41891 1468 133 --
NM_006875chrX2747 600 1271 ----
NM_006884chr32456 71 11941 ----
NM_006885chr1653353 2749 1296 437 244 31575 694 468 ----
NM_006887chr2--1527 ----
NM_006888chr141807 22679 278 12974 11236
NM_006892chr202953 215 11385 ----
NM_006892chr202953 215 11385 ----
NM_006894chr1160 ------
NM_006901chr152212 183 ------
NM_006908chr71940 11469 ----
NM_006910chr162373 129 ------
NM_006912chr112427 ------
NM_006915chrX52491 2227 1688 974 703 ------
NM_006918chr1125750 5638 34597 3840 145 15881 --
NM_006920chr221829 400 31624 1562 239 ----
NM_006922chr262057 1944 1757 843 617 206 21951 233 ----
NM_006924chr1754324 4007 3890 2879 787 31307 855 773 1893 --
NM_006925chr141514 175 1490 --
NM_006936chr2141124 996 425 44 --1479 --
NM_006937chr17----1489 --
NM_006939chr141835 1787 ----
NM_006940chr1251279 641 329 115 103 --1265 --
NM_006941chr2231093 928 876 ------
NM_006943chr2032433 968 42 --21304 1301 --
NM_006946chr113536 187 98 --1101 --
NM_006947chr421483 26 11596 11219 --
NM_006948chr2122378 814 1568 --11576
NM_006950chrX1845 ------
NM_006951chr102699 129 ------
NM_006963chr1021232 126 ------
NM_006965chr1811128 ------
NM_006981chr93589 372 51 1279 12493 12861
NM_006982chr12--1102 186 --
NM_006996chr111621 1747 11221 --
NM_006997chr102183 61 ------
NM_007005chr931161 512 160 11244 11265 11166
NM_007006chr1623337 709 12559 ----
NM_007007chr12104121 3888 1734 1593 1564 1539 951 696 449 196 11424 ----
NM_007008chr2----1210 --
NM_007011chr15125873 4623 4545 4486 4367 2723 2049 1990 1493 1107 751 277 --66664 5130 4551 4548 1497 593 1597
NM_007013chr82986 83 ------
NM_007017chr5------1744
NM_007023chr21947 ------
NM_007026chr172555 187 ----1533
NM_007034chr12953 754 --1806 --
NM_007035chr122619 41 ------
NM_007038chr2165963 5785 5490 4759 3681 1759 14071 23916 559 --
NM_007040chr191432 ------
NM_007042chr362066 1067 694 666 577 532 ------
NM_007050chr20157250 7182 6920 6847 5888 5465 5240 2864 2782 2572 2433 2049 1513 464 196 11307 141 --
NM_007067chr1731240 272 81 11459 ----
NM_007069chr11159 ------
NM_007073chr674061 3735 3579 3480 3464 2636 1641 12607 --13329
NM_007078chr1072549 1942 1902 1227 1189 47 40 12998 150 --
NM_007084chr132514 471 ------
NM_007097chr5163 --195 --
NM_007114chr312575 --12563 --
NM_007115chr2175 ------
NM_007118chr5------151
NM_007124chr631842 1487 414 --11651 --
NM_007125chrY21042 75 11430 ----
NM_007126chr91421 ------
NM_007129chr132915 732 1295 ----
NM_007137chrX75098 4816 4724 4340 4279 3698 902 --15101 15318
NM_007146chr1752751 2732 2134 2124 985 1761 ----
NM_007150chrX31413 526 80 ------
NM_007158chr11330 11204 1792 --
NM_007159chr31599 11089 ----
NM_007166chr112214 84 1277 ----
NM_007172chr223594 463 38 12081 142 12066
NM_007174chr1252034 1817 1798 1543 816 173 ----
NM_007175chr853443 2991 2539 2412 1426 13535 22685 813 --
NM_007176chr1441126 593 464 393 1690 1467 --
NM_007178chr121302 ------
NM_007184chr32545 357 ----1400
NM_007187chr131272 1238 ----
NM_007191chr121711 ------
NM_007192chr141904 ----1252
NM_007197chr1231051 665 346 ------
NM_007200chr1543925 3393 1271 61 --24329 3723 --
NM_007202chr17--1691 ----
NM_007203chr973791 3495 2943 2911 2876 1392 311 ------
NM_007207chr1129 ------
NM_007214chr621055 54 11044 ----
NM_007217chr31400 ------
NM_007219chr20282 26 --1790 --
NM_007222chr831775 1330 680 21588 1456 ----
NM_007236chr1562045 924 775 367 264 115 22160 1916 1709 1268
NM_007246chr41274 --1946 --
NM_007249chr1369022 7498 7415 3024 1151 474 37890 5954 2430 26300 1699 --
NM_007260chr12563 213 --1489 --
NM_007269chr1168 --1190 --
NM_007275chr31356 ------
NM_007276chr72918 214 --1822 --
NM_007279chr19--1607 ----
NM_007282chr3--2801 745 ----
NM_007283chr353009 2999 2362 2112 466 12955 ----
NM_007286chr572002 1826 1754 604 489 446 187 --21829 1757 11583
NM_007294chr1751258 1167 1126 922 328 ----11350
NM_007295chr1751258 1167 1126 922 328 ----11350
NM_007296chr1751258 1167 1126 922 328 ----11350
NM_007297chr1751258 1167 1126 922 328 ----11350
NM_007298chr1751258 1167 1126 922 328 ----11350
NM_007299chr1751258 1167 1126 922 328 ----11350
NM_007300chr1751258 1167 1126 922 328 ----11350
NM_007302chr1751258 1167 1126 922 328 ----11350
NM_007303chr1751258 1167 1126 922 328 ----11350
NM_007304chr1751258 1167 1126 922 328 ----11350
NM_007305chr1751258 1167 1126 922 328 ----11350
NM_007322chr192488 391 --133 1529
NM_007325chrX41978 1682 600 57 1533 ----
NM_007331chr462599 2193 2149 2100 822 426 --22642 620 12003
NM_007345chr1812150 ------
NM_007347chr1522815 605 32856 1209 250 ----
NM_007349chr73334 288 106 --172 --
NM_007350chr1244439 3571 1559 871 14206 11183 --
NM_007358chr131621 1479 750 ------
NM_007363chrX2866 707 ------
NM_007373chr1021789 1481 2568 132 --11136
NM_007374chr142471 410 --1354 --
NM_009585chr33828 320 228 ----1832
NM_009585chr33828 320 228 ----1832
NM_012062chr122196 45 1280 1360 --
NM_012063chr122196 45 ------
NM_012069chrX32545 1852 172 --1263 --
NM_012073chr53998 496 132 11256 1486 --
NM_012074chr14--1973 2790 455 --
NM_012081chr593643 3632 2575 1068 910 651 177 100 68 --1814 --
NM_012082chr8179 ----1711
NM_012084chrX1506 --1555 --
NM_012089chr121130 305 ----21121 309
NM_012090chr131084 834 386 --11060 --
NM_012095chr1033401 2168 575 23414 2647 1712 --
NM_012096chr332500 823 727 21296 255 ----
NM_012102chr122513 2047 ------
NM_012104chr1163009 2992 472 437 271 223 --12588 --
NM_012104chr1163009 2992 472 437 271 223 --12588 --
NM_012110chr41238 ------
NM_012120chr662757 2701 1913 878 697 572 2812 369 22705 2405 --
NM_012124chr111916 1307 173 --
NM_012129chr742210 2198 2159 328 --1150 --
NM_012137chr142570 2239 2227 2122 1206 1684 1802
NM_012141chr1321227 1016 21665 336 23809 900 --
NM_012153chr1122194 455 22516 330 ----
NM_012154chr82835 244 1229 ----
NM_012156chr2043124 2276 1344 210 --1213 11348
NM_012164chr987357 7211 6015 5140 4694 1847 960 369 37057 6347 338 14703 --
NM_012175chr111727 ----146
NM_012193chr1195423 5290 4981 4544 3494 2142 2003 1620 541 15314 44292 2006 721 718 --
NM_012197chr941460 1310 647 203 1570 ----
NM_012199chr163625 3542 3075 1603 1467 596 --14152 11032
NM_012214chr234691 4131 935 35637 1652 236 36312 5931 998 14433
NM_012215chr1011355 ------
NM_012218chr1932996 2018 125 11876 12137 --
NM_012224chr431213 919 767 ------
NM_012229chr1041487 593 547 76 1489 ----
NM_012232chr1732191 1723 1599 --2356 155 --
NM_012233chr231186 797 209 1423 ----
NM_012234chr363662 3516 1287 896 290 71 --12615 12423
NM_012238chr1051401 1359 1106 469 247 ------
NM_012247chr102919 177 ------
NM_012249chr242728 1378 997 420 33300 3283 2880 ----
NM_012250chr1161409 1159 858 378 313 203 ------
NM_012252chr775244 5055 3443 1866 1251 1153 83 ------
NM_012255chr201164 ------
NM_012256chr751170 1153 794 213 199 --11087 --
NM_012257chr731089 914 375 ------
NM_012261chr201549 ------
NM_012262chr1114677 3818 3779 3751 3335 1699 1636 1613 1337 1316 530 34070 1092 515 13783 --
NM_012272chr122312 159 ------
NM_012278chrX1142 ------
NM_012281chr72733 196 1385 ----
NM_012286chrX----1192 --
NM_012287chr374348 4191 3661 3517 2770 1023 930 14124 ----
NM_012288chr655379 1957 1381 1102 739 --25480 337 --
NM_012290chr21250 21040 483 --11561
NM_012293chr241850 1604 688 33 --1138 --
NM_012294chr7103647 3257 2883 2493 1594 1554 1349 706 95 72 11369 13722 --
NM_012295chr221409 ------
NM_012296chr1133528 3174 1493 --1669 --
NM_012297chr452393 1757 1657 792 325 1362 ----
NM_012300chr522257 807 32459 2368 2227 ----
NM_012302chr11262 11202 1265 --
NM_012304chr51273 22489 1676 ----
NM_012308chr1132009 669 537 11775 1762 --
NM_012309chr1133297 1919 718 11114 23711 3301 --
NM_012316chr174473 4133 4106 2248 1953 1449 114 11467 24263 3427 --
NM_012320chr1651256 875 248 151 44 1906 1512 1234
NM_012321chr191381 1162 123 --
NM_012329chr1711238 ------
NM_012330chr101224 2658 309 ----
NM_012334chr574682 4461 3705 3221 1511 849 30 --12951 --
NM_012338chr72908 765 ------
NM_012342chr10158 ----1448
NM_012347chr642392 2034 1197 269 ------
NM_012382chr534493 1236 803 23961 1172 24553 1018 --
NM_012383chr9139 ------
NM_012399chr2221622 518 11771 ----
NM_012412chr71658 ------
NM_012414chr13537 296 224 ------
NM_012416chr911255 1104 31247 483 279 --
NM_012417chr17--1446 --1431
NM_012428chr152361 236 2706 55 --1333
NM_012429chr22----21393 449 --
NM_012431chr743370 3256 2510 276 13034 1257 --
NM_012434chr631650 674 237 ------
NM_012445chr42534 108 ------
NM_012446chr51426 ------
NM_012454chr62482 374 ------
NM_012460chr14148 1302 ----
NM_012465chr1033076 2768 2132 33138 740 239 ----
NM_012471chrX21625 1491 11347 ----
NM_012479chr742047 707 653 289 --22434 929 --
NM_012482chr11562 ------
NM_013230chrY2561 222 ------
NM_013231chr1441065 1031 346 251 11304 ----
NM_013233chr23930 419 261 1939 --11111
NM_013253chr115886 543 483 263 173 ------
NM_013254chr121450 --1174 --
NM_013255chr752357 2298 1951 1537 405 58808 6446 5349 1865 1805 ----
NM_013257chr83397 284 183 12316 1543 --
NM_013261chr411056 33564 3269 1188 --1200
NM_013262chr621443 923 ------
NM_013277chr121330 1978 1686 --
NM_013279chr1161963 1883 559 513 163 108 ------
NM_013281chr201187 --11217 --
NM_013283chr54864 780 359 294 ------
NM_013286chr363493 2672 2492 674 428 246 13059 13115 --
NM_013293chr71153 1550 1669 --
NM_013322chr711191 ------
NM_013354chr8----11020 --
NM_013357chr82808 225 ------
NM_013358chr141664 1386 666 38 11323 11668 --
NM_013365chr222738 311 1187 ----
NM_013372chr151214 23389 1134 ----
NM_013374chr342883 2864 2774 1995 22717 2125 2737 193 --
NM_013381chr122902 860 12123 --1612
NM_013382chr1472293 2208 1730 1611 787 236 117 --1882 --
NM_013386chr111295 21607 672 ----
NM_013392chr21417 --1421 --
NM_013396chr2121349 84 11512 188 --
NM_013410chr13796 381 313 ----11049
NM_013434chr231406 610 121 --1318 --
NM_013434chr231406 610 121 --1318 --
NM_013436chr22680 601 ------
NM_013437chr821276 939 ----1296
NM_013438chr931541 1277 1186 --1106 --
NM_013444chrX21094 311 ------
NM_013446chr711287 133 ----
NM_013448chr141177 ------
NM_013449chr1232869 1966 512 3883 285 77 ----
NM_013958chr8234 23 ----1371
NM_013959chr8234 23 ----1371
NM_013960chr81296 1654 ----
NM_013961chr8234 23 ----1371
NM_013962chr8234 23 ----1371
NM_013995chrX42373 1615 207 26 ----12239
NM_014000chr1031632 479 85 11406 1546 11213
NM_014007chr931272 396 90 --1862 --
NM_014010chr91560 ------
NM_014011chr22893 144 1590 2727 147 --
NM_014016chr341608 1512 1202 310 21598 1451 11536 --
NM_014021chr163291 3073 3005 2839 2617 1287 ------
NM_014030chr1731233 1037 474 ------
NM_014034chr6--11464 ----
NM_014043chr321384 411 ------
NM_014048chr1635118 3832 3249 24543 1815 13294 --
NM_014056chr332356 1680 440 ----2749 648
NM_014089chr1312278 ------
NM_014106chr1532733 2240 415 11988 ----
NM_014109chr81209 ------
NM_014112chr8115486 4443 4241 3917 2039 1962 1746 1619 1311 993 626 1242 11290 15294
NM_014117chr1631877 378 32 ------
NM_014153chr163630 218 159 ----1452
NM_014154chr321132 392 ------
NM_014155chr11107369 5398 2881 2455 2396 1782 1513 1018 824 689 15612 16543 11786
NM_014159chr31201 ------
NM_014181chr231872 728 157 12915 11074 12887
NM_014183chr201303 ------
NM_014189chr421279 994 --11229 11041
NM_014190chr431631 1346 1140 --11581 11393
NM_014191chr1211004 ------
NM_014212chr121316 ------
NM_014217chr131526 1493 69 --11343 --
NM_014231chr1231942 866 184 ------
NM_014232chr1731188 617 327 --1153 --
NM_014232chr1731188 617 327 --1153 --
NM_014240chr344131 2931 798 50 --43148 3099 57 54 --
NM_014241chr101354 1276 ----
NM_014243chr442122 1578 471 159 --11843 1251
NM_014248chr222124 61 --164 --
NM_014251chr71793 ------
NM_014253chrX21616 465 11961 ----
NM_014263chr10----11399 --
NM_014268chr181254 ------
NM_014271chrX182 --185 189
NM_014278chr42461 179 ------
NM_014279chr93635 337 64 ------
NM_014280chr12377 38 ------
NM_014282chr921116 103 1407 21099 151 --
NM_014283chr131325 610 419 ------
NM_014294chr831256 170 116 --11321 11352
NM_014296chr321267 1006 1314 ----
NM_014309chr2265366 5116 4970 3588 2062 1089 15142 11513 22067 1652
NM_014319chr1251950 1244 489 469 30 21963 1861 ----
NM_014322chr111142 11071 ----
NM_014323chr224948 754 686 45 ------
NM_014325chr121458 11921 ----
NM_014338chr224822 422 379 355 --1826 127
NM_014342chr1131251 587 540 ------
NM_014345chr61401 ------
NM_014350chr531156 434 390 2929 57 ----
NM_014365chr121820 ------
NM_014368chr941369 1362 1348 458 31974 1458 174 --11313
NM_014372chr131618 607 411 11705 ----
NM_014376chr552492 1674 748 672 330 ------
NM_014382chr331660 662 156 ------
NM_014392chr43473 362 137 1130 ----
NM_014393chr862273 2177 1602 1578 450 86 11731 ----
NM_014395chr431972 170 157 ------
NM_014399chr71178 2967 65 ----
NM_014408chr12541 441 ------
NM_014415chr321549 118 --11282 --
NM_014417chr191328 --1881 --
NM_014423chr595158 4679 4539 3896 1633 1340 1087 522 466 11724 14091 35377 3812 872
NM_014426chr202459 183 ------
NM_014445chr332363 1780 888 21773 859 ----
NM_014447chr411233 1168 ----
NM_014454chr67839 828 748 418 304 162 138 --1409 --
NM_014456chr1021212 1175 --2421 418 1399
NM_014458chr11899 ------
NM_014469chr11--2227 130 ----
NM_014470chr121789 ------
NM_014494chr1632010 1882 1648 --11720 --
NM_014496chrX--192 ----
NM_014502chr111302 ------
NM_014504chr72720 477 ------
NM_014515chr123975 851 787 ------
NM_014517chr331535 443 264 ------
NM_014520chr172131 98 ------
NM_014521chr25734 350 102 64 23 11840 ----
NM_014547chr151770 1202 ----
NM_014547chr151770 1202 ----
NM_014554chr1241766 613 98 83 ------
NM_014562chr22746 66 --273 70 --
NM_014570chr222657 108 ------
NM_014572chr1341643 1133 560 93 --2336 333 --
NM_014573chr17148 1637 --11429
NM_014574chr1421475 1242 ------
NM_014584chr1441602 655 443 115 ------
NM_014585chr231234 137 27 --11162 --
NM_014586chr2144294 4076 3112 340 14492 ----
NM_014587chr1621513 1345 1113 ----
NM_014602chr31349 ------
NM_014606chr421008 295 21451 1129 ----
NM_014607chr22220 191 11476 1807 --
NM_014612chr931470 1096 1072 1597 ----
NM_014613chr562481 2154 1930 1234 971 149 12814 12286 --
NM_014615chr1633307 1196 981 --1984 --
NM_014616chr353245 2695 2594 2209 295 22488 69 ----
NM_014620chr122619 254 1209 ----
NM_014629chr831332 288 22 11138 21339 953 --
NM_014630chr15103763 3479 2622 869 739 631 306 283 236 217 --1822 --
NM_014633chr111585 ------
NM_014636chr934293 3590 425 24107 3148 1820 --
NM_014637chr841029 940 430 63 ------
NM_014646chr18102731 2564 2151 2133 1243 528 508 437 270 160 175 ----
NM_014647chr1642255 1999 1883 1727 ------
NM_014659chr152863 777 1453 ----
NM_014661chr1083729 3524 3352 3323 2592 1050 413 151 ------
NM_014665chr873151 2773 2535 849 602 558 116 22709 2408 43426 3083 1440 1431 --
NM_014666chr531328 1126 140 ------
NM_014667chr342044 1573 947 290 1553 ----
NM_014670chr221011 155 --11225 --
NM_014671chr731073 976 501 --1437 --
NM_014673chr8--1115 ----
NM_014676chr13677 232 113 ----1596
NM_014682chr852037 1887 1615 1606 62 21953 81 ----
NM_014685chr163441 368 22 ------
NM_014686chr1952484 2074 805 348 251 22057 744 1775 --
NM_014690chr792622 2563 2542 2492 2002 970 803 501 395 22656 1903 ----
NM_014699chr162391 320 ------
NM_014701chr1532155 1269 820 --13095 --
NM_014702chr632495 1110 940 13312 ----
NM_014705chr782121 2097 1843 1405 595 586 577 166 ----12126
NM_014707chr752276 335 301 265 199 21610 456 ----
NM_014709chr22600 55 ------
NM_014713chr21352 1162 ----
NM_014717chr191309 1869 1312 --
NM_014719chr72369 334 11103 ----
NM_014720chr1051185 480 406 329 277 ------
NM_014721chr677380 7239 5373 5301 4987 2394 314 15129 21339 1086 --
NM_014726chr173881 127 26 ------
NM_014729chr832320 1607 1501 ----1112
NM_014732chr1665418 5378 1241 914 157 124 14306 ----
NM_014735chrX12012 ------
NM_014738chr1711050 1750 ----
NM_014742chr202408 230 --1666 11371
NM_014743chr412571 52597 2550 655 180 74 21966 936 1203
NM_014746chr244249 2887 1490 684 13914 12750 11100
NM_014747chr1115731 5467 4914 4819 4043 3675 3662 1249 987 107 49 1886 ----
NM_014751chr821587 641 --22066 822 --
NM_014752chr1131738 545 370 2263 219 ----
NM_014755chr283709 1709 1484 1447 1260 607 535 522 --13748 11310
NM_014757chr532397 633 217 --11823 --
NM_014758chr1151865 1853 633 589 233 ------
NM_014759chr841213 1050 998 567 1481 ----
NM_014761chr1621024 170 1112 --11187
NM_014764chr1211202 ------
NM_014765chr1--22407 752 1519 --
NM_014766chr733108 672 138 12477 22559 265 --
NM_014767chr102987 309 13433 ----
NM_014772chr1832455 2436 723 --12270 --
NM_014779chr31182 --1456 --
NM_014781chr8--1330 11155 --
NM_014782chrX1254 ------
NM_014784chr121082 161 ----11086
NM_014786chr1111235 ------
NM_014787chr121780 25 ------
NM_014795chr2282 70 11311 ----
NM_014802chr122455 52 --1389 --
NM_014810chr11789 1255 21334 910 --
NM_014824chr1121244 28 11675 --11844
NM_014826chr164255 3897 3296 2838 1694 253 13224 11697 11656
NM_014827chr131275 609 601 --1423 --
NM_014830chr1243384 2797 1444 1133 23157 572 1167 1347
NM_014832chr1321740 1572 --1212 1744
NM_014839chr141941 977 570 143 22301 777 ----
NM_014840chr1272982 2919 2907 2111 823 723 380 1782 12103 --
NM_014841chr62433 317 1926 21158 190 --
NM_014846chr82272 90 ------
NM_014848chr1512652 12435 ----
NM_014849chr121243 287 ------
NM_014850chr384878 4519 4430 4245 4167 3509 1507 747 12975 11557 --
NM_014868chr123853 675 369 --178 --
NM_014872chr932049 882 743 31981 1561 833 1161 --
NM_014873chr143658 1786 1506 1194 24036 195 ----
NM_014874chr12670 183 ----21792 628
NM_014877chr1787769 7244 6576 6394 5601 2486 2425 1034 11712 25679 141 --
NM_014887chr131772 --1227 --
NM_014893chrY52266 2052 1957 1660 231 12328 ----
NM_014897chr1742930 2271 1167 1036 ------
NM_014900chr21222 1976 ----
NM_014901chr532272 1787 296 --22222 544 --
NM_014902chr2021347 88 ------
NM_014903chr121388 12104 11869 --
NM_014904chr1053779 2748 2726 2541 670 21494 1331 33486 2937 718 --
NM_014905chr231650 1476 545 1329 ----
NM_014906chr1743722 3352 1243 712 22774 2625 ----
NM_014912chr1042871 1171 885 559 13186 1696 --
NM_014915chr1041032 467 235 27 11074 ----
NM_014917chr13971 220 68 2785 190 ----
NM_014920chr643754 3459 1148 587 ------
NM_014921chr1942608 1910 430 424 --32007 1913 1040 --
NM_014932chr311803 ----2653 477
NM_014934chr1373824 3680 3531 1211 1113 992 434 23435 3270 1229 --
NM_014938chr1282358 2217 1998 915 837 697 677 311 22024 179 12067 --
NM_014944chr151345 1280 1133 911 46 ------
NM_014945chr531823 1332 794 11504 ----
NM_014946chr252559 2469 2385 881 644 1811 ----
NM_014947chr163107 3006 2967 2264 838 626 196 --12625
NM_014949chr11804 2930 200 ----
NM_014950chr14--2672 242 ----
NM_014952chr1541640 1519 1300 806 ------
NM_014962chr2032171 1135 534 --32200 2019 1832 --
NM_014965chr332193 2035 337 ----1148
NM_014974chr1041761 1255 478 459 11790 ----
NM_014978chr10--11547 ----
NM_014982chr1494921 3846 3655 2131 1652 1152 916 714 701 24162 262 ----
NM_014988chr422292 1780 ------
NM_014989chr61498 ------
NM_014990chr1411156 1878 1922 --
NM_014991chr433005 1197 840 ------
NM_014994chr1572360 2025 1936 1541 1477 712 88 --1815 --
NM_014996chr31430 2693 153 ----
NM_015000chr1233133 1935 877 ------
NM_015001chr1----1183 --
NM_015002chr1252181 1539 1454 190 98 --338 35 32 --
NM_015008chr342653 2597 1156 957 --31064 1061 1058 13588
NM_015012chr111360 ------
NM_015020chr1683234 3218 2615 2376 1180 702 570 59 12927 13407 1707
NM_015023chr131807 1527 31 1585 41530 1515 1512 157 --
NM_015024chr831258 946 143 11360 21262 195 --
NM_015025chr242638 2613 2329 930 --160 1254
NM_015032chr1332898 1122 1044 22473 112 ----
NM_015035chr20156243 6040 5956 5038 4973 4927 4451 4409 2532 2217 1402 1363 659 585 81 --26585 110 --
NM_015039chr133596 2978 1489 11180 24334 3362 --
NM_015040chr273172 2714 2597 2384 2275 314 133 ----1414
NM_015042chr1563737 3406 3376 2777 819 358 --23597 361 13624
NM_015044chr1632818 427 286 --22198 439 --
NM_015045chr1032276 1823 356 2767 172 2344 341 1234
NM_015046chr942625 1953 1828 110 ------
NM_015049chr222567 2441 1503 ----
NM_015051chr922148 202 ------
NM_015052chr71219 ------
NM_015055chr1162320 1826 1182 882 541 417 22898 2640 --1751
NM_015057chr132459 170 ------
NM_015059chr1573634 3570 3425 2657 850 754 276 ------
NM_015061chr9----1717 --
NM_015062chr10----190 --
NM_015068chr7103777 3620 3283 2563 2511 1597 1565 1547 1495 368 23958 613 23974 2468 --
NM_015069chr161218 --1141 --
NM_015071chr576368 4529 2144 1893 1754 1569 386 255 25 22279 118 11160
NM_015074chr164510 3577 2001 1866 1240 748 --64972 4421 4331 4328 4149 405 --
NM_015076chr694072 3656 3624 3174 2765 1802 1368 1182 520 24492 3667 ----
NM_015077chr1794613 4021 3806 3390 3318 3283 3273 2953 27 1336 14696 11525
NM_015080chr111883 1365 1730 --
NM_015092chr1674166 3661 3134 3087 3025 1334 485 ----1766
NM_015093chr6182 2217 130 ----
NM_015094chr2284685 4420 4169 3151 2871 1714 1160 584 --22874 588 --
NM_015097chr322299 429 22351 1555 ----
NM_015100chr1--1239 ----
NM_015106chr31158 ------
NM_015115chr4113153 3006 1006 897 434 265 191 138 92 71 34 42890 2648 2352 825 ----
NM_015125chr191598 ------
NM_015129chrX21501 714 ----11780
NM_015130chr421155 310 --11308 --
NM_015132chr711614 ------
NM_015137chr822255 518 1277 ----
NM_015138chr1541031 775 683 100 22065 1912 12101 --
NM_015143chr41282 ------
NM_015144chr1633359 948 81 12866 ----
NM_015149chr122138 661 ------
NM_015151chr2131054 924 312 ------
NM_015153chr62672 81 142 ----
NM_015155chr1032600 2546 2474 11193 13022 --
NM_015156chr1423841 928 33694 3176 1342 ----
NM_015158chr92235 165 ----147
NM_015161chr1621063 62 ------
NM_015163chr1431322 1295 482 21903 391 ----
NM_015170chr832170 1590 799 41454 264 231 155 ----
NM_015172chr141391 1363 1154 531 --21370 168 --
NM_015173chr431767 1323 1254 ------
NM_015176chr1--11393 1616 --
NM_015178chr831950 345 29 --132 --
NM_015180chr141856 ------
NM_015185chrX52901 2696 2674 2556 823 ------
NM_015191chr1172524 2362 2170 1680 851 443 163 --1934 22462 536
NM_015192chr203742 573 207 1537 ----
NM_015194chr1741702 798 353 98 --166 2784 357
NM_015197chr1462912 2590 2412 958 695 592 165 43347 2418 2415 823 --
NM_015198chr711223 ----21249 246
NM_015199chr352407 2303 2159 1188 792 12318 12470 --
NM_015200chr43964 634 597 ------
NM_015206chr1523277 1268 31306 1226 752 ----
NM_015208chr1833017 1417 1318 22988 290 --11421
NM_015209chr141656 917 422 23 22135 1774 1928 --
NM_015215chr143185 2868 2283 441 11077 13109 --
NM_015225chr963076 2426 2385 2321 2208 2091 1338 ----
NM_015236chr4--2193 37 ----
NM_015245chr622493 2277 --41898 995 902 555 --
NM_015247chr1624176 3982 53813 3727 1470 1361 517 15370 --
NM_015250chr9--11464 1213 --
NM_015252chr2------1813
NM_015260chr1931563 181 117 ------
NM_015263chr151342 ------
NM_015265chr242164 2112 1927 838 11798 12669 --
NM_015267chr121379 ------
NM_015270chr121239 2906 110 11827 --
NM_015272chr16--11339 ----
NM_015275chr1221802 664 ----1596
NM_015278chr633262 3086 1216 ------
NM_015282chr222449 2226 43027 2773 837 271 12497 --
NM_015284chr141795 1461 431 157 12122 ----
NM_015285chr1861751 867 539 399 300 61 ------
NM_015286chr15--22467 522 --12193
NM_015288chr5102772 2420 2386 2365 1182 1053 950 650 585 445 23205 87 33772 2436 1534 11538
NM_015291chr173117 2860 2234 1204 1053 942 427 --3895 734 435 13312
NM_015292chr121238 ----1721
NM_015296chr1321210 922 ------
NM_015310chr8126658 6186 3315 2686 2511 2210 1778 1627 1583 1217 582 523 47266 3103 751 337 17536 16112
NM_015313chr1144295 1560 598 584 33567 1536 1104 11601 11003
NM_015315chr572979 2247 1196 1165 1123 691 554 12754 12291 --
NM_015317chr2--11094 ----
NM_015319chr12--1175 ----
NM_015326chr132150 1903 52 11083 ----
NM_015327chr151315 1185 941 276 133 ------
NM_015328chr782803 2769 2144 2003 1194 880 707 88 ------
NM_015330chr2242012 1837 1809 852 --41660 656 653 259 --
NM_015332chr742798 490 400 346 --33477 3166 197 32802 2452 1125
NM_015335chr1242230 1890 1839 68 ------
NM_015336chr1222591 600 1735 ----
NM_015338chr2051859 1284 1191 576 423 2512 143 ----
NM_015339chr201173 ------
NM_015344chr831963 658 284 1255 ----
NM_015346chr1411503 ------
NM_015347chr1252705 2534 1955 815 584 1785 1846 --
NM_015349chr632783 2273 973 13005 12172 --
NM_015350chr1--2493 171 ----
NM_015355chr172346 110 11613 11232 --
NM_015358chr2111083 ------
NM_015359chr832402 1927 616 ------
NM_015361chr2--183 ----
NM_015365chrX53755 3555 3462 1678 566 ----12731
NM_015375chr144117 1451 644 500 11094 ----
NM_015378chr152878 2789 2669 2305 1176 ------
NM_015385chr1043045 1205 609 339 2847 553 2968 464 --
NM_015387chr221776 1739 31684 453 242 --1277
NM_015393chr422480 642 --22449 157 --
NM_015396chr361447 1371 1217 1206 1175 117 ------
NM_015397chr931854 1384 380 ----1259
NM_015409chr1242649 2461 2318 2122 ------
NM_015416chr122742 208 196 ----
NM_015419chrX41075 1023 806 412 ------
NM_015423chr1111547 --2700 697 --
NM_015435chr821495 547 11172 ----
NM_015436chr432408 1140 797 42642 2156 513 431 ----
NM_015439chr62486 365 ------
NM_015442chr32182 24 ------
NM_015443chr173536 455 252 11035 ----
NM_015455chr531188 885 202 --13969 --
NM_015459chr11----1219 --
NM_015460chr331838 392 305 21486 589 11456 --
NM_015461chr181708 ------
NM_015466chr31222 ------
NM_015475chr23775 156 25 21110 915 ----
NM_015477chr152359 177 ------
NM_015483chr731012 893 788 157 --1792
NM_015488chr221483 1175 --2341 338 --
NM_015490chr105960 832 369 38 21 --141 --
NM_015497chr154980 928 713 231 11035 ----
NM_015508chr321115 210 --11445 --
NM_015537chr91137 --2787 392 --
NM_015541chr321307 334 --1496 --
NM_015542chr10--11010 ----
NM_015550chr773319 3262 3060 2902 991 686 508 13017 ----
NM_015554chr1542684 2471 1972 35 --22661 324 --
NM_015560chr33680 346 87 2755 456 ----
NM_015564chr532754 1437 422 ----11441
NM_015568chr2064282 3762 3177 1501 250 196 33291 1517 523 --14319
NM_015569chr134477 4198 513 34674 1845 197 14122 --
NM_015570chr711736 ------
NM_015571chr622356 884 1256 ----
NM_015575chr211426 2860 551 12680 --
NM_015577chr531429 1180 717 --1720 --
NM_015578chr1911566 ------
NM_015601chr101944 1178 ----
NM_015609chr132896 2635 30 --22411 1823 --
NM_015610chr722787 2422 --172 --
NM_015626chr171922 11023 2925 264 --
NM_015630chr221137 221 ------
NM_015635chr9174 136 --12213
NM_015640chr155053 4682 1920 1196 286 24452 3664 1593 14433
NM_015652chr101586 ------
NM_015657chr2----1195 --
NM_015678chr13----1195 --
NM_015686chrX2851 343 ------
NM_015691chrX22522 277 ------
NM_015693chr41244 ------
NM_015695chr641981 1945 748 191 --1634 --
NM_015702chr21256 ------
NM_015726chr111326 --21733 1560 --
NM_015831chr72958 733 ------
NM_015844chr181965 ------
NM_015845chr181743 --1196 --
NM_015846chr181965 ------
NM_015847chr181965 ------
NM_015850chr882058 1893 1868 828 817 195 103 65 22151 2002 32417 893 753 --
NM_015855chr112766 191 --1100 --
NM_015866chr121062 177 --11237 --
NM_015872chr131552 1309 275 ------
NM_015874chr41255 ------
NM_015878chr811913 ------
NM_015879chr1868430 7886 7869 2019 550 32 --16910 1247
NM_015881chr115886 543 483 263 173 ------
NM_015885chr111308 --144 --
NM_015898chr1922375 2072 11791 ----
NM_015902chr82323 204 ------
NM_015904chr23668 567 529 --1264 --
NM_015906chr144591 1461 556 91 24420 3571 11555 --
NM_015908chr7--196 ----
NM_015913chr1--1158 ----
NM_015915chr14----1239 --
NM_015920chr152588 522 ------
NM_015955chr2------1516
NM_015975chrX41755 1217 604 140 ------
NM_015981chr523131 28 --32155 296 69 --
NM_015982chr171308 ------
NM_015986chr1711366 1218 ----
NM_015995chr1564418 3551 2006 1878 1323 339 ------
NM_015999chr12677 668 ------
NM_016003chr722787 2422 --172 --
NM_016018chr861128 999 732 528 448 303 11961 ----
NM_016019chr74969 892 676 72 ------
NM_016021chr663028 2982 2584 2054 1993 670 22006 1868 1647 --
NM_016022chr11740 11052 ----
NM_016025chr1651954 1858 1630 1414 454 11616 21634 774 --
NM_016040chr142731 2515 2346 60 2937 175 11999 11879
NM_016045chr2021266 396 --1399 --
NM_016048chr53999 700 207 1628 ----
NM_016060chr1721108 345 1171 ----
NM_016061chr241469 1124 652 431 --1312 --
NM_016066chr1123 ------
NM_016070chr171229 ------
NM_016072chr1222356 1776 22145 1851 ----
NM_016073chr15--1976 1887 --
NM_016076chr153169 2641 2499 907 296 22360 266 ----
NM_016078chr171857 ------
NM_016081chr421689 1472 11981 ----
NM_016083chr641118 936 786 669 23901 151 ----
NM_016087chr7--11141 ----
NM_016090chr112807 340 ------
NM_016096chr851993 1351 540 141 77 ------
NM_016100chr201337 1374 ----
NM_016107chr52361 55 11088 ----
NM_016120chrX2840 249 ------
NM_016121chr1----1904 1772
NM_016131chr262292 1971 1742 1564 885 780 --11572 --
NM_016132chr1583079 2843 2690 2639 2627 1229 1129 758 32384 904 700 11362 --
NM_016133chr2------11669
NM_016141chr32617 211 ------
NM_016169chr1073064 2684 2656 1987 1111 441 43 11096 12371 --
NM_016195chr102282 120 --1264 --
NM_016201chr341747 805 284 92 ------
NM_016205chr421048 905 --1539 --
NM_016206chr398287 8262 7176 7015 3006 2424 1842 1478 1434 18599 12894 18356
NM_016213chr15155 ------
NM_016221chr521708 407 1129 2176 72 1411
NM_016226chr12--1137 ----
NM_016227chr131325 610 419 ------
NM_016230chr6--1409 ----
NM_016231chr17--11356 1254 --
NM_016234chr101691 1113 --2753 213
NM_016239chr171838 1779 ----
NM_016243chr12591 27 ------
NM_016248chr1343772 3678 3049 2472 22611 796 1330 --
NM_016250chr143798 702 143 ------
NM_016252chr22717 270 --1894 --
NM_016255chr61693 31176 741 189 12997 --
NM_016260chr2127670 6800 6204 5586 4707 4611 2530 2329 1891 1728 1655 1154 47157 5774 5223 1185 14807 16147
NM_016269chr41165 ------
NM_016271chr181309 ------
NM_016272chr2242506 2264 597 341 ------
NM_016275chr3--2790 381 1101 --
NM_016277chr611020 11360 ----
NM_016281chr121100 --1461 --
NM_016287chr11160 11527 ----
NM_016289chr231613 1554 105 198 3173 170 47 1109
NM_016303chrX1436 --1104 --
NM_016308chr1--11486 157 --
NM_016312chr12187 ----1216
NM_016315chr221766 699 11476 ----
NM_016322chr962561 2352 2027 1252 1169 950 33075 960 161 --22778 1173
NM_016337chr14----2339 120 --
NM_016338chr52442 271 2285 82 ----
NM_016339chr1741572 1319 694 331 21579 170 21710 1310 --
NM_016340chr52311 101 184 ----
NM_016374chr1140 11210 ----
NM_016374chr1140 11210 ----
NM_016376chr1784036 3524 2662 1101 754 421 289 54 --23625 1246 --
NM_016395chr1521353 159 --11356 1422
NM_016396chr1541961 1029 943 406 1466 ----
NM_016406chr11354 ------
NM_016422chr1163173 3106 714 477 196 126 1277 127 --
NM_016424chr1721979 485 ------
NM_016436chr2022669 1040 --12119 --
NM_016441chr261947 1832 875 864 679 435 ----1238
NM_016453chr32443 193 --1519 --
NM_016454chr151300 ----1304
NM_016467chr221122 145 ------
NM_016472chr141443 1393 31199 1126 205 --
NM_016480chr51161 ------
NM_016485chr63787 493 383 1664 1790 --
NM_016488chr1231684 747 26 ------
NM_016506chr112190 173 --1176 --
NM_016507chr1753223 852 505 490 151 ----11063
NM_016513chr643754 3459 1148 587 ------
NM_016519chr4--175 ----
NM_016525chr92653 337 1940 1385 --
NM_016526chr1152469 2278 2163 1721 710 --22284 2281 --
NM_016530chr1531425 1224 737 11491 1100 1104
NM_016531chr443365 3210 1353 387 23256 1188 12620 11132
NM_016559chr31598 ------
NM_016561chr161120 ------
NM_016575chr12125439 4625 4522 4511 4407 3931 3892 3856 2004 1696 428 83 34994 1784 926 34949 1699 474 11718
NM_016577chr3104443 3971 3319 3307 3271 2820 1480 1257 810 51 1261 41509 1506 1138 193 11099
NM_016578chr112498 75 ------
NM_016587chr72918 214 --1822 --
NM_016588chr62936 687 --2752 657 --
NM_016603chr511992 ------
NM_016604chr511184 ------
NM_016605chr542592 2362 1951 1069 22295 917 ----
NM_016607chrX2245 210 ------
NM_016612chr81537 ------
NM_016621chr11113687 3631 3511 3430 3369 3175 3146 2900 1699 1652 1084 24165 1447 13634 --
NM_016623chr82637 24 ------
NM_016626chr182601 103 21583 259 1158 --
NM_016628chr101791 1768 1656 --
NM_016651chr1441141 935 260 199 ----11145
NM_016733chr2251450 1350 366 285 69 ----11355
NM_016823chr171120 11170 ----
NM_016824chr1021619 311 11803 ----
NM_016834chr17114124 3626 3615 3482 3354 2624 1166 958 716 358 102 ----13292
NM_016835chr17114124 3626 3615 3482 3354 2624 1166 958 716 358 102 ----13292
NM_016836chr25751 635 509 209 161 ------
NM_016839chr25751 635 509 209 161 ------
NM_016841chr17114124 3626 3615 3482 3354 2624 1166 958 716 358 102 ----13292
NM_016929chr643906 1125 1081 151 11022 3642 639 636 --
NM_016937chrX2814 302 ------
NM_016946chr141149 856 678 430 1206 ----
NM_016950chr41462 --11087 --
NM_017412chr8134 ------
NM_017413chrX22481 114 --71721 1718 1715 1712 1709 1706 1694 11698
NM_017420chr1433678 3261 1509 --12893 --
NM_017423chr472208 2023 1669 1377 671 509 77 --11992 --
NM_017450chr173266 180 27 --1480 --
NM_017452chr2021393 1172 11113 ----
NM_017453chr2021393 1172 11113 ----
NM_017454chr2021393 1172 11113 ----
NM_017455chr152361 236 2706 55 --1333
NM_017456chr173480 143 78 ------
NM_017457chr191148 ------
NM_017519chr62252 61 ------
NM_017522chr11369 1278 ----
NM_017540chr523048 2082 23271 250 --13143
NM_017544chrX1923 ------
NM_017548chr341563 574 494 83 1606 ----
NM_017551chr1051059 728 549 526 368 ------
NM_017559chr17----1230 --
NM_017563chr3106143 5615 5320 4840 1951 1553 1426 842 769 376 46102 4626 1736 981 21237 39 15298
NM_017569chr131145 ------
NM_017577chr331660 1598 172 11501 ----
NM_017582chr151590 1549 1242 552 245 ----1586
NM_017583chr1131480 283 92 11340 --11485
NM_017593chr42457 148 ------
NM_017594chr953085 1157 686 576 564 ------
NM_017596chr184541 4149 3943 3777 1692 1252 668 83 1874 11178 --
NM_017599chr123816 318 229 11443 ----
NM_017602chrX1649 ------
NM_017607chr19140 ------
NM_017610chr1542085 698 317 126 --2767 506 --
NM_017613chr211354 ------
NM_017626chr1031192 643 223 11795 ----
NM_017628chr484629 4190 2085 1939 1222 954 847 837 11315 11022 --
NM_017629chr151923 1851 1691 1403 318 ------
NM_017632chr41469 ------
NM_017633chr643711 3336 3003 2592 31527 1492 556 --12596
NM_017635chr1121613 466 ------
NM_017637chr989049 8830 8754 8117 5761 3114 2621 727 12095 39316 6981 619 15979
NM_017641chr12--1136 11188 1857
NM_017643chr1712486 22447 103 12564 1366
NM_017645chr913068 ----12776
NM_017651chr61317 21186 366 ----
NM_017657chr22787 251 ------
NM_017658chr1473392 3371 3156 1458 499 323 172 22923 570 13256 --
NM_017661chr1531270 296 80 ----11069
NM_017670chr115861 208 198 184 30 --2864 22 --
NM_017672chr1531261 962 371 ------
NM_017693chr1351288 1269 1207 1173 44 ------
NM_017699chr341589 1529 458 48 --1356 --
NM_017715chr72231 24 --197 --
NM_017719chr322479 1844 --1175 --
NM_017724chr32734 228 ------
NM_017728chr1772527 2449 1993 1969 756 243 82 --22657 451 --
NM_017730chr33250 184 128 ------
NM_017736chr1642805 1213 118 56 1155 22712 218 --
NM_017737chr151655 858 702 606 54 11365 ----
NM_017738chr91397 11251 ----
NM_017740chr1611745 21482 397 1320 --
NM_017741chr422768 338 22438 234 --138
NM_017742chr1831475 1296 781 ------
NM_017745chrX1708 ------
NM_017748chr171276 ----152
NM_017752chrX31694 827 650 1642 22029 373 1629
NM_017753chr93375 71 25 ------
NM_017754chr644306 3791 650 162 34895 4563 4445 ----
NM_017758chr173484 230 157 ------
NM_017761chr1--1437 --11046
NM_017762chr1552325 2128 2039 1742 261 2609 67 12229 --
NM_017769chr1422427 1070 12487 142 --
NM_017770chr61150 21855 167 1882 --
NM_017772chr621576 352 ------
NM_017778chr821085 1044 1542 ----
NM_017780chr83890 349 100 ------
NM_017784chr31170 ------
NM_017786chr8--1574 ----
NM_017799chr142738 177 --11637 11308
NM_017811chr993154 2686 2381 2246 2220 2210 1084 672 504 22153 133 1771 --
NM_017813chr8105299 5044 4994 1788 1053 1038 989 722 338 185 11394 14215 --
NM_017824chr1021856 332 22665 2339 1103 --
NM_017831chr1874766 4559 4318 3328 1297 1252 56 ----13443
NM_017848chrX53866 3828 3497 3154 1150 24640 3873 ----
NM_017849chr21579 ----1335
NM_017866chr831144 452 308 ------
NM_017873chr933054 617 461 1669 33111 3057 2458 --
NM_017875chr31697 --163 --
NM_017880chr2130 1317 ----
NM_017893chr1011261 ------
NM_017902chr1075262 4703 4375 4011 1994 1400 38 11200 ----
NM_017907chr111104 ------
NM_017913chr92431 349 --1164 --
NM_017919chr954491 4129 2011 1684 1071 25099 4694 158 --
NM_017921chr1762249 2018 1629 1546 499 66 ------
NM_017926chr142302 41 ------
NM_017933chr231570 1321 194 --3337 200 197 --
NM_017938chrX52138 1968 1387 781 582 ------
NM_017944chr1132986 2109 1949 21194 1108 ----
NM_017946chr71424 ------
NM_017952chr264378 3409 3147 2985 1405 355 13953 4677 391 358 44 1176
NM_017953chr1170 ------
NM_017954chr731664 1132 501 ------
NM_017955chr143962 956 209 1112 2934 475 --
NM_017972chr142302 41 ------
NM_017974chr211306 ------
NM_017994chr752951 2611 2276 1933 809 158 12079 12206
NM_018004chr32387 338 ------
NM_018011chr131496 ------
NM_018014chr22471 75 ------
NM_018015chrX11014 ------
NM_018027chr1073118 2193 1051 1002 937 791 22 12924 ----
NM_018030chr183281 257 203 ------
NM_018034chr5122 ------
NM_018043chr111998 11328 ----
NM_018046chr511216 --1595 --
NM_018048chr1221957 21 ------
NM_018051chr71307 ------
NM_018054chr162667 557 1290 ----
NM_018067chr11501 ------
NM_018078chr421014 858 ------
NM_018084chr243089 1023 881 801 2409 268 ----
NM_018085chr198136 7184 6526 2923 2139 2113 637 478 288 22389 2323 16926 16930
NM_018086chr241201 343 324 59 1689 ----
NM_018095chr112190 173 --1176 --
NM_018098chr341176 956 341 171 --1269 --
NM_018100chr653239 2520 1343 825 476 1842 12090 --
NM_018103chr1--1323 ----
NM_018105chr811157 ------
NM_018107chr141992 1198 1797 --
NM_018110chr166968 477 404 352 45 31 1226 ----
NM_018112chr92430 54 ------
NM_018117chr102754 115 ----1551
NM_018120chr81201 1277 11354 --
NM_018121chr1022245 718 --22248 1001 --
NM_018124chr1642525 949 182 51 22503 693 133 --
NM_018126chr43506 269 62 ----1210
NM_018133chr311838 1130 1645 --
NM_018155chr322990 1203 21283 589 ----
NM_018156chr152878 2789 2669 2305 1176 ------
NM_018157chr121485 33146 2338 1027 22839 2836 --
NM_018159chrX1689 --11117 --
NM_018178chr12539 34 1440 ----
NM_018181chr1821714 106 --11405 --
NM_018182chr17----21858 409 --
NM_018184chr311676 2858 143 ----
NM_018193chr151169 ------
NM_018195chr1121889 617 11353 ----
NM_018200chr1571992 1804 1744 739 579 511 336 1282 1339 --
NM_018201chr922507 422 ----1972
NM_018211chr122173 51 ------
NM_018214chr6142 21171 814 21083 139 --
NM_018221chr2370 63 46 ------
NM_018227chr452495 2269 2248 2094 893 ------
NM_018228chr143927 366 256 1985 ----
NM_018229chr14--1326 ----
NM_018240chr12788 59 ------
NM_018243chr443816 3528 976 285 24014 3076 13510 --
NM_018246chr842703 1965 545 331 1404 32706 2352 1834 --
NM_018247chr672879 2542 2497 2406 2015 1259 922 33135 421 229 --12044
NM_018254chr132221 1960 567 ------
NM_018257chr205983 401 276 117 73 ------
NM_018263chr232418 2087 711 21048 965 ----
NM_018287chr101179 21182 1030 ----
NM_018293chr332500 2454 80 1669 1503 12081
NM_018307chr174984 814 661 72 ------
NM_018310chr82570 57 ------
NM_018312chr1131955 653 96 ----123
NM_018313chr32906 545 ------
NM_018315chr451241 1198 619 363 213 1603 ----
NM_018323chr431668 1392 76 --2482 79 196
NM_018330chr1051698 1648 1069 383 106 1211 ----
NM_018334chr71152 ------
NM_018339chr931445 1265 714 ----11650
NM_018348chr1621261 67 --1393 --
NM_018354chr202250 26 ----1254
NM_018360chrX2155 56 ------
NM_018361chr841460 1074 1049 360 --1209 --
NM_018362chr1123822 1277 1680 --1370
NM_018364chr193616 3440 1638 1378 1158 1136 616 369 223 --21024 226 --
NM_018368chr6147 187 ----
NM_018374chr785211 5129 4648 3882 1738 1236 983 941 34075 3217 1636 14510 --
NM_018375chr1441718 1214 1206 406 ------
NM_018403chr312548 --21102 961 --
NM_018412chr71152 ------
NM_018416chr1212246 1314 ----
NM_018425chr1042218 707 471 272 --11054 --
NM_018427chr1641477 1124 498 355 ------
NM_018429chr532242 2085 914 12504 12088 --
NM_018433chr2138 1555 ----
NM_018434chr5--1131 ----
NM_018440chr8108410 6956 6908 5830 5629 1823 1015 421 247 100 --21219 551 16713
NM_018442chr11369 ------
NM_018444chr821595 884 12286 ----
NM_018452chr6_random32821 2680 1134 21287 1224 53640 2857 2854 2825 869 12994
NM_018462chr33737 635 31 --121 --
NM_018482chr862404 1925 1874 305 264 49 --41702 1630 92 89 --
NM_018488chr172604 38 ------
NM_018489chr14797 765 595 369 ----12232
NM_018490chr1111687 21510 415 1626 1354
NM_018527chr131164 ------
NM_018553chr1731473 1366 133 --21867 395 --
NM_018557chr231465 1429 1157 1491 --1240
NM_018559chr131223 ------
NM_018566chr165014 4676 3968 3127 2063 228 --25017 1766 --
NM_018571chr2152 1489 ----
NM_018584chr131022 437 107 ------
NM_018590chr1021230 578 ------
NM_018638chr1275558 5307 5213 5027 4099 540 191 35606 5427 883 14827 --
NM_018640chr1242788 2089 892 242 ------
NM_018650chr11362 1764 ----
NM_018660chr832904 2054 1227 23042 364 11145 11891
NM_018667chr1642629 1862 366 154 ----11845
NM_018682chr71226 169 --1180
NM_018685chr71805 1225 1816 --
NM_018695chr541693 1582 746 483 ------
NM_018700chr541669 1398 1210 303 1631 --21575 1485
NM_018703chr162373 129 ------
NM_018704chr122021 292 --1803 --
NM_018710chr8----1188 --
NM_018712chr1121326 409 11363 1412 --
NM_018715chr121641 1447 11658 --1686
NM_018717chr461774 1115 779 735 666 331 ------
NM_018841chr153543 3511 2643 2607 973 33255 2651 99 ----
NM_018844chr73714 305 269 11943 ----
NM_018847chr941929 1914 1670 190 ------
NM_018890chr71940 11469 ----
NM_018896chr171251 ------
NM_018898chr562380 2140 1998 1736 1713 885 12387 ----
NM_018899chr562380 2140 1998 1736 1713 885 12387 ----
NM_018900chr562380 2140 1998 1736 1713 885 12387 ----
NM_018901chr562380 2140 1998 1736 1713 885 12387 ----
NM_018902chr562380 2140 1998 1736 1713 885 12387 ----
NM_018903chr562380 2140 1998 1736 1713 885 12387 ----
NM_018904chr562380 2140 1998 1736 1713 885 12387 ----
NM_018905chr562380 2140 1998 1736 1713 885 12387 ----
NM_018906chr562380 2140 1998 1736 1713 885 12387 ----
NM_018907chr562380 2140 1998 1736 1713 885 12387 ----
NM_018908chr562380 2140 1998 1736 1713 885 12387 ----
NM_018909chr562380 2140 1998 1736 1713 885 12387 ----
NM_018910chr562380 2140 1998 1736 1713 885 12387 ----
NM_018911chr562380 2140 1998 1736 1713 885 12387 ----
NM_018912chr52632 236 ------
NM_018913chr52632 236 ------
NM_018914chr52632 236 ------
NM_018915chr52632 236 ------
NM_018916chr52632 236 ------
NM_018917chr52632 236 ------
NM_018918chr52632 236 ------
NM_018919chr52632 236 ------
NM_018920chr52632 236 ------
NM_018921chr52632 236 ------
NM_018922chr52632 236 ------
NM_018923chr52632 236 ------
NM_018924chr52632 236 ------
NM_018925chr52632 236 ------
NM_018926chr52632 236 ------
NM_018927chr52632 236 ------
NM_018928chr52632 236 ------
NM_018929chr52632 236 ------
NM_018945chr653358 887 852 619 375 1387 --11252
NM_018948chr131276 1128 993 11294 1160 --
NM_018953chr124792 676 642 568 ------
NM_018963chr2121535 250 ------
NM_018972chr822398 1929 ------
NM_018976chr1232814 1954 737 ------
NM_018979chr121888 12487 ----
NM_018999chr1034106 4081 805 11669 --13707
NM_019001chr384263 4231 3996 3548 3168 1519 562 159 11396 ----
NM_019004chr712121 11696 1812 22391 816
NM_019006chr151452 ------
NM_019008chr2223717 97 1663 --11309
NM_019021chr112849 612 ------
NM_019022chr1842740 2276 2059 382 2758 118 ----
NM_019027chr432535 2511 558 ------
NM_019028chr111320 1360 ----
NM_019040chr11--158 ----
NM_019042chr72929 317 ------
NM_019045chrX1809 ------
NM_019063chr232266 1858 385 11730 ----
NM_019084chr1032315 819 205 ----11842
NM_019091chr2137 --2850 51 --
NM_019106chr2273455 2231 2098 1274 703 678 313 12207 33421 2257 2108 --
NM_019114chr922147 2026 1295 12510 --
NM_019116chr1673713 3064 2914 1346 1337 1330 697 23585 3311 2663 660 --
NM_019556chrX31169 1056 319 ------
NM_019557chr12595 579 ------
NM_019590chr1011222 --1196 --
NM_019593chr2083170 3106 2740 2034 940 879 795 43 --1556 --
NM_019595chr2--1550 ----
NM_019600chr152622 111 --1564 --
NM_019606chr7144 ------
NM_019613chr1721240 247 ------
NM_019842chr6------1441
NM_019843chr221116 ------
NM_019845chr22749 50 --1268 --
NM_019849chr192226 184 ------
NM_019854chr121611 ------
NM_019891chr13942 401 369 ------
NM_019895chr34812 463 427 321 ------
NM_019903chr1021619 311 11803 ----
NM_020039chr1231610 1336 343 --1677 --
NM_020116chr421440 1265 ------
NM_020120chr2--21628 90 ----
NM_020122chr275387 5179 5031 4863 1582 725 640 --24474 311 --
NM_020132chr2194935 4477 3832 3777 3208 1921 1029 427 304 1957 14706 14550
NM_020141chr141962 835 782 138 --21692 1582 --
NM_020144chr72423 199 ------
NM_020147chr153893 357 71 ------
NM_020148chr1852913 2800 863 542 21 32919 1058 510 ----
NM_020151chr251729 1536 1364 106 65 1332 ----
NM_020153chr112132 21 ------
NM_020156chr72526 417 ------
NM_020159chr431634 1189 500 21338 603 ----
NM_020177chr52895 280 128 ----
NM_020178chr17--1971 ----
NM_020179chr111100 ------
NM_020180chr181371 11124 ----
NM_020182chr2043384 2568 2505 985 12764 ----
NM_020184chr23696 242 76 12304 ----
NM_020193chr111144 ------
NM_020198chr1721261 375 --11283 --
NM_020200chr1021088 876 ------
NM_020201chr172700 125 ------
NM_020205chr163367 2601 921 690 575 477 --1973 --
NM_020211chr1561388 1243 558 537 380 132 --11126 --
NM_020214chr15131 ------
NM_020225chr41356 ----1132
NM_020228chr1162480 2332 1922 1762 734 623 1498 ----
NM_020238chr1151059 938 914 358 159 ----1854
NM_020239chr152064 2040 844 702 463 1577 ----
NM_020240chr561949 1919 1715 830 462 327 22617 2303 1529 --
NM_020243chr22--165 1567 --
NM_020244chr12122 --238 35 --
NM_020245chr664861 1979 1573 1547 342 262 1753 ----
NM_020310chr1762725 2643 2494 2112 1872 181 1942 3371 368 365 --
NM_020311chr21501 ------
NM_020336chr2053142 2890 1209 1073 1061 1214 33145 2475 1147 --
NM_020337chr443105 2503 629 481 ------
NM_020338chr1023688 972 12897 ----
NM_020341chr2021521 1314 11579 11254 11562
NM_020342chr232564 2128 2089 12490 12132 --
NM_020346chr1121560 1381 ------
NM_020347chr322192 1713 ----12196
NM_020348chr1032620 613 595 11817 ----
NM_020354chr102739 43 2908 322 ----
NM_020357chr321335 550 1204 ----
NM_020362chr11317 1585 ----
NM_020366chr14176 ------
NM_020374chr12--11424 11555 --
NM_020382chr1231026 1002 169 --11132 --
NM_020384chrX31608 1346 239 ----1114
NM_020387chr11208 ------
NM_020390chr344590 4216 1830 1448 24901 3854 ----
NM_020403chr1341266 619 420 281 11570 1284 1483
NM_020416chr442525 2035 738 418 ------
NM_020420chrY21161 123 ------
NM_020425chr621498 384 ----1307
NM_020429chr742078 1992 1149 287 1923 32925 960 457 --
NM_020432chr731877 765 681 ------
NM_020437chr22----1328 --
NM_020440chr123064 1110 --11296 1450
NM_020443chr1106531 6443 6124 5490 2741 2351 2319 2193 1143 945 14929 --12203
NM_020445chr73732 613 103 --2808 258 --
NM_020449chrX1201 ------
NM_020453chr432010 1448 1375 ------
NM_020456chr1312355 139 ----
NM_020457chr162601 23 1552 ----
NM_020463chr241022 507 335 191 ------
NM_020465chr1621919 1559 --21911 1751 --
NM_020466chr613756 1991 21135 769 --
NM_020474chr181774 1364 ----
NM_020475chr842406 1842 663 112 --22248 2144 --
NM_020476chr842406 1842 663 112 --22248 2144 --
NM_020477chr842406 1842 663 112 --22248 2144 --
NM_020478chr842469 1905 726 175 --22311 2207 --
NM_020480chr842406 1842 663 112 --22248 2144 --
NM_020482chr62595 240 --1243 --
NM_020526chr121586 737 ------
NM_020530chr224838 687 194 108 --1832 --
NM_020532chr2----1210 --
NM_020630chr102647 570 ------
NM_020640chr331764 884 76 ------
NM_020644chr113884 697 112 ------
NM_020647chr83656 581 495 1290 ----
NM_020651chr221654 1512 --11657 --
NM_020654chr3--1616 ----
NM_020655chr1641448 1406 1397 225 ------
NM_020689chr2021554 1344 ----1301
NM_020693chr112474 68 ------
NM_020699chr1114947 4398 3753 1492 1422 1313 1299 1231 1036 1025 201 ----15326
NM_020703chr11572 ------
NM_020708chr2032324 2218 408 ------
NM_020711chr232622 2565 1722 1646 12475 --
NM_020713chr2022359 662 1175 22028 2025 --
NM_020717chrX64577 3220 1854 1839 1521 1417 23424 1614 31701 1698 1420 --
NM_020718chr1656460 5688 5341 4430 1139 --14023 11697
NM_020728chr742517 1124 860 773 11222 ----
NM_020732chr62252 61 ------
NM_020734chr1273306 2933 2684 789 358 161 82 2782 263 13309 --
NM_020739chr1521501 920 12749 1136 --
NM_020742chrX22534 2336 22401 250 ----
NM_020747chr52294 164 ------
NM_020748chr1721981 1648 ------
NM_020752chr1062496 2271 2194 1844 723 656 1453 ----
NM_020754chr32315 166 --1418 --
NM_020761chr1731497 150 39 --2115 86 1128
NM_020766chrX74346 4023 3973 1159 968 608 571 13587 1881 --
NM_020769chrX1797 ------
NM_020772chr17158486 8478 7256 6673 6176 6048 5760 5685 5476 2818 2234 1667 952 355 280 38460 5905 2700 15688 --
NM_020773chr452597 2373 2306 1877 245 --1216 --
NM_020774chr18106209 5614 5068 4982 4299 2313 1742 1655 1549 1398 --11357 --
NM_020776chr1852603 2426 1146 336 128 22971 2740 1917 --
NM_020778chr1564634 1974 1470 724 474 304 --33304 3301 1488 --
NM_020783chr1822440 2194 --1122 --
NM_020791chr1731315 1306 943 ----11243
NM_020794chr121124 1015 --11018 --
NM_020796chr532834 2335 1857 --11222 12641
NM_020801chr512524 ------
NM_020805chr181512 ------
NM_020808chr141099 763 757 111 1281 11058 --
NM_020809chr1132226 1956 589 22297 121 --22230 903
NM_020810chr1461363 1148 863 792 666 183 23576 2734 12598 1773
NM_020818chr141171 --1333 --
NM_020819chr63769 356 247 1754 1468 --
NM_020824chr10143 ------
NM_020825chr1642779 426 373 141 22446 702 21285 573 13790
NM_020830chr242896 2661 562 407 ----1755
NM_020839chr321433 525 ------
NM_020841chr12--1503 --12517
NM_020844chr887608 6249 5554 5129 5106 2519 2167 665 --22522 2486 1352
NM_020845chr1262520 2468 2228 1751 1664 838 1549 ----
NM_020850chr1642994 2543 2055 1058 1372 32244 1160 1008 --
NM_020853chr1252789 2717 2096 1000 897 11713 ----
NM_020856chr1921599 181 --11248 --
NM_020858chr1511732 32207 1647 485 1837 --
NM_020860chr411047 ------
NM_020861chr621072 401 ------
NM_020868chr241255 316 287 80 --1182 --
NM_020870chr41490 12069 ----
NM_020872chr3------21158 563
NM_020873chr33863 294 103 ------
NM_020888chr141801 1774 299 164 128 11552 --
NM_020890chr32536 468 ------
NM_020895chr19269 22 ------
NM_020899chr172434 149 ------
NM_020905chr2123 1123 ----
NM_020917chr1941205 706 662 608 ------
NM_020918chr1042793 1336 941 875 32618 2580 2273 1394 --
NM_020920chr141373 --137 --
NM_020921chr1443376 2533 2229 1321 --13126 --
NM_020922chrX31757 659 379 11774 1382 --
NM_020924chr92433 78 ------
NM_020925chr11478 --11109 --
NM_020927chr1631760 695 143 11740 1421 --
NM_020935chr243069 677 625 49 173 --12892
NM_020940chr1032220 1987 334 1768 12628 --
NM_020947chr1641910 1473 843 606 1925 ----
NM_020948chr143143 3037 1106 1019 22468 824 ----
NM_020956chr1964648 3163 1426 1324 1052 185 1258 13820 11775
NM_020958chr141134 ------
NM_020962chr1541953 764 660 129 --11830 --
NM_020963chr11148 ----1174
NM_020964chr1843247 1889 60 35 1981 --11882
NM_020977chr41288 1678 ----
NM_020981chr22234 127 ------
NM_020983chr121239 2906 110 11827 --
NM_020987chr1031035 1007 114 --21266 943 1284
NM_020993chr1241115 1024 296 184 --1300 --
NM_021003chr142809 787 --1812 --
NM_021005chr152417 242 3313 115 81 ----
NM_021007chr211500 1240 12157 --
NM_021033chr1343119 2954 2195 763 --1583 --
NM_021038chr333286 2622 746 23223 2081 12103 --
NM_021064chr61384 --11687 1482
NM_021072chr542529 2429 1920 1826 --12532 --
NM_021076chr221156 ------
NM_021079chr1783157 3110 2825 2510 2317 2310 2176 1213 1269 ----
NM_021088chr23582 473 158 32173 1332 832 1392 --
NM_021096chr2273247 3227 3025 2927 2778 2115 1054 ----1572
NM_021097chr242011 1079 956 390 22606 106 11234 --
NM_021101chr321860 868 --32171 2151 1685 --
NM_021104chr121288 ------
NM_021109chrX173 ------
NM_021109chrX173 ------
NM_021111chr921266 71 ------
NM_021120chrX43110 2790 2411 438 11211 2982 845 1986
NM_021131chr971452 1161 914 432 377 339 116 --1928 --
NM_021132chr101946 --1975 --
NM_021136chr142154 143 ----1247
NM_021137chr1742354 2226 601 251 1292 285 82 12230
NM_021145chr73795 320 141 148 1145 --
NM_021155chr1942492 2258 1057 537 --1294 --
NM_021159chr42471 238 --11120 --
NM_021168chr1611478 --31579 1576 210 --
NM_021174chr81671 ------
NM_021180chr1----2759 97 --
NM_021183chrX22280 68 ------
NM_021188chr142447 396 ------
NM_021190chr131271 378 196 --2329 139 --
NM_021191chr1222333 1784 22179 2169 2948 945 --
NM_021202chr2042683 2270 1891 616 --1532 --
NM_021215chr2032136 2060 1782 11655 31742 1739 1588 --
NM_021219chr211160 ------
NM_021224chr91112 ------
NM_021239chr1411358 1287 ----
NM_021242chrX1640 ------
NM_021248chr202142 31 ------
NM_021249chr1431592 1463 1440 123 ----
NM_021252chr103640 327 75 ------
NM_021255chr1443319 1222 1174 89 12959 11575 --
NM_021260chr1431018 447 93 --2330 327 --
NM_021574chr2232181 2001 1941 11620 1423 --
NM_021614chr51209 ------
NM_021622chr1011979 12342 11555 --
NM_021627chr341216 909 400 181 1483 130 --
NM_021629chr344556 4217 3542 2029 14855 ----
NM_021639chr11181 ------
NM_021643chr22746 375 11707 ----
NM_021647chr431007 390 46 --23766 708 24506 712
NM_021728chr141637 ------
NM_021729chr111267 ------
NM_021738chr101244 --1268 --
NM_021809chr2062221 1955 1716 1642 380 268 2491 190 1259 12329
NM_021813chr6105806 5725 5668 5257 4303 4021 3882 3701 3570 81 23989 603 12333 --
NM_021814chr621580 263 --186 --
NM_021815chr233006 920 238 32121 945 380 ----
NM_021825chr11128 ------
NM_021871chr4166 ------
NM_021905chr642146 784 263 24 --5461 458 455 452 42 --
NM_021911chr575260 4721 4244 1741 391 161 122 41687 1509 697 169 ----
NM_021912chr1543129 1121 1065 491 11631 12909 --
NM_021914chr1452430 2373 2140 606 194 --1638 --
NM_021925chr211696 --11457 --
NM_021940chr631320 508 259 --11220 --
NM_021943chr661904 1760 613 293 207 31 12207 --1508
NM_021946chrX41359 1297 1143 220 ------
NM_021949chrX22790 2546 --22549 2459 --
NM_021951chr91837 --1802 --
NM_021954chr1353581 872 662 379 177 --12742 --
NM_021956chr621515 974 1220 ----
NM_021959chr61644 --1152 --
NM_021960chr132147 1709 553 ------
NM_021961chr1176947 6163 6119 5166 4603 1280 1178 25795 2374 26950 5169 --
NM_021964chr365946 5423 4551 4142 2598 247 16271 15166 --
NM_021965chr921359 73 21256 220 --1303
NM_021970chr41582 --1173 --
NM_021988chr2021339 488 --21228 1225 1351
NM_021998chrX51464 1244 1223 1029 369 ----1583
NM_022003chr1131254 426 45 1275 ----
NM_022041chr1682446 1918 1701 1672 893 698 360 291 ----12432
NM_022048chr1536395 5158 320 12321 25446 227 --
NM_022051chr12640 167 1629 ----
NM_022059chr17----152 --
NM_022073chr1431141 488 110 1218 1547 --
NM_022075chr12345 212 1840 ----
NM_022079chr101944 1178 ----
NM_022085chr651127 1094 1001 560 97 --1546 --
NM_022118chr13--1209 ----
NM_022121chr6--1391 133 137
NM_022124chr104481 422 214 152 ------
NM_022130chr52252 166 ------
NM_022133chr851553 1429 1388 245 180 11807 --11225
NM_022137chr1441761 423 396 262 ------
NM_022143chr721426 258 ----1356
NM_022145chr5--1625 ----
NM_022166chr1665996 5391 4354 1627 1079 402 24646 4238 25394 3905 --
NM_022170chr721653 233 ----1153
NM_022307chr7188 --1275 --
NM_022336chr212002 21530 620 11767 --
NM_022337chr113626 280 224 ------
NM_022351chr842885 2793 327 231 11096 13442 --
NM_022361chr62545 429 --1390 --
NM_022372chr163529 175 138 ------
NM_022373chr72629 316 ------
NM_022442chr2021339 488 --21228 1225 1351
NM_022459chr1386288 6256 5643 4536 4040 1932 1741 184 15998 1986 1188
NM_022463chr1711460 ------
NM_022465chr1263078 2591 2181 2147 1127 1076 ------
NM_022474chr1432791 2319 2047 1276 11019 --
NM_022475chr4284 76 ------
NM_022476chr162994 38 ----11041
NM_022477chr2031499 697 621 11673 11129 --
NM_022484chr72118 104 ------
NM_022497chr362546 1422 777 747 555 208 1633 1410 1187
NM_022572chr221483 1175 --2341 338 --
NM_022574chr762046 2007 815 655 426 293 --21720 1717 --
NM_022576chr11319 ------
NM_022652chr122351 76 ------
NM_022658chr1221069 928 ------
NM_022716chr162736 2346 1168 1109 83 68 ------
NM_022726chr651785 1752 1675 1513 1301 1567 ----
NM_022730chr24900 741 684 160 1887 ----
NM_022735chr131854 1528 561 ------
NM_022739chr17----1231 --
NM_022749chr811064 ----1461
NM_022751chr18------1247
NM_022753chr142651 2361 861 77 ------
NM_022756chr111070 1525 --1262
NM_022763chr352676 2333 981 846 777 --12336 --
NM_022767chr1551484 1228 641 196 146 21661 229 11908 --
NM_022768chr11371 ------
NM_022780chr22416 140 11761 ----
NM_022781chr943016 856 621 290 11109 11298 --
NM_022782chr121138 ------
NM_022784chr151208 1922 ----
NM_022802chr1031459 657 228 1445 1537 --
NM_022810chrX1361 ------
NM_022817chr241921 357 113 80 --11924 --
NM_022821chr12474 150 ------
NM_022822chr113877 856 77 ------
NM_022824chr531764 1451 598 11513 11420 --
NM_022826chr23370 189 172 ------
NM_022828chr521759 125 ------
NM_022831chr151810 1675 1358 698 486 ------
NM_022841chr151368 12696 1269 --
NM_022844chr161910 ------
NM_022845chr1622012 1962 1515 ----
NM_022893chr272913 2583 2519 2319 993 428 412 ------
NM_022894chr231120 224 196 ------
NM_022897chr521043 988 1425 ----
NM_022898chr1453437 3330 3245 1880 438 31911 1506 1348 33967 1100 920 --
NM_022900chr711043 ------
NM_022910chr1621919 1559 --21911 1751 --
NM_022912chr253047 2580 2019 1888 1106 11934 1937 1392
NM_022917chr93901 397 116 ------
NM_022918chr112517 179 ----11564
NM_022965chr431433 1378 52 --2231 55 11605
NM_022970chr1021147 529 31443 1198 521 ----
NM_022977chrX51932 1763 1007 681 85 12577 --11981
NM_023000chr1431198 487 388 1103 ----
NM_023001chr1431198 487 388 1103 ----
NM_023009chr1--1695 ----
NM_023010chrX--1788 ----
NM_023012chr12----1550 --
NM_023033chr121531 ------
NM_023037chr132746 728 1771 ----
NM_023039chr51360 ------
NM_023071chr12----1263 --
NM_023076chr1652273 796 433 126 28 ------
NM_023105chr882058 1893 1868 828 817 195 103 65 22151 2002 32417 893 753 --
NM_023106chr882058 1893 1868 828 817 195 103 65 22151 2002 32417 893 753 --
NM_023110chr882058 1893 1868 828 817 195 103 65 22151 2002 32417 893 753 --
NM_023111chr882058 1893 1868 828 817 195 103 65 22151 2002 32417 893 753 --
NM_023927chr53544 224 90 21205 953 ----
NM_023929chr83857 790 118 12320 ----
NM_023934chrX51872 1581 1450 612 147 ------
NM_024007chr542761 2433 1933 48 ------
NM_024046chr341084 494 291 256 ------
NM_024052chr1762626 2591 2135 1064 546 415 22736 614 12704 1599
NM_024055chr51615 ------
NM_024057chr121130 ------
NM_024061chr7--1611 ----
NM_024069chr191704 ------
NM_024077chr9--2562 182 --1308
NM_024087chrX1633 ------
NM_024090chr431864 1211 226 --2551 229 --
NM_024092chr114937 407 355 49 --2774 358 --
NM_024111chr151718 1263 --1556
NM_024117chr911363 --1934 --
NM_024122chrX----1251 --
NM_024293chr22159 59 ------
NM_024295chr851353 714 466 314 204 ------
NM_024312chr121133 31278 398 361 --1292
NM_024315chr7--1340 ----
NM_024328chr141172 --2690 469 --
NM_024329chr111181 ------
NM_024345chr985637 5162 4991 4948 4361 4287 2098 527 34980 617 234 35286 5059 1070 --
NM_024408chr153511 2639 1483 1473 1281 --23605 3554 152
NM_024424chr1111104 1419 ----
NM_024425chr1111104 1419 ----
NM_024426chr1111104 1419 ----
NM_024492chr621133 480 ------
NM_024494chr1----1102 --
NM_024501chr22564 471 --1269 --
NM_024511chr4103154 2777 2758 1420 1097 1067 966 773 756 724 12983 13208 --
NM_024520chr2140 ------
NM_024524chr343120 2781 2549 582 1756 ----
NM_024539chrX2498 312 1170 ----
NM_024545chr21662 1220 --1729
NM_024546chr1321192 361 ------
NM_024554chr131457 1168 170 ------
NM_024561chr13--1180 ----
NM_024563chr531738 1435 1265 ------
NM_024567chr81262 --1124 --
NM_024569chr132605 1928 329 ------
NM_024581chr62205 36 ------
NM_024582chr42720 66 ----1154
NM_024590chr42592 280 11198 ----
NM_024593chr831294 1128 1010 ------
NM_024594chr511876 125 --1120
NM_024595chr121144 917 --151 --
NM_024610chr31314 ------
NM_024612chr172834 415 --1419 --
NM_024613chr831223 510 327 ------
NM_024615chr51249 ------
NM_024618chr11----1551 --
NM_024630chr64816 555 513 250 ------
NM_024632chr5--185 ----
NM_024636chr712017 12850 ----
NM_024645chr811503 1370 ----
NM_024646chr143297 3253 713 369 ------
NM_024652chr15--2929 227 --1133
NM_024659chr22960 123 ------
NM_024665chr394137 3512 1856 1792 1786 1316 1202 231 78 ----11383
NM_024670chr1021418 426 21487 344 ----
NM_024674chr132424 562 31 12970 --11257
NM_024686chr12500 96 ------
NM_024689chrX31815 1798 274 31262 1234 623 ----
NM_024692chr251518 1478 755 720 287 11681 ----
NM_024698chr1131292 1130 427 --31344 1341 1338 --
NM_024704chr20--3760 194 108 11121 --
NM_024713chr1521616 1238 ------
NM_024721chr812684 ------
NM_024742chr1671364 1214 722 139 118 101 81 --11398 --
NM_024755chr15------1579
NM_024757chr92436 369 11080 ----
NM_024761chr955032 4383 4316 1669 37 24577 4456 21654 188 --
NM_024770chr266442 5333 4879 4613 1374 1215 --15362 --
NM_024780chr16--1702 --1393
NM_024811chr1131316 762 719 1494 1727 11321
NM_024824chr1441486 487 355 281 31230 1066 252 ----
NM_024828chr931514 1182 148 ------
NM_024837chr152484 62 --1235 --
NM_024852chr11541 ------
NM_024859chrX1123 --2796 342 --
NM_024863chrX1136 --179 --
NM_024875chr10156 ------
NM_024887chr172006 1774 1658 1341 550 515 437 ------
NM_024893chr202975 771 1210 ----
NM_024900chr491768 1555 934 874 865 827 598 473 163 --1849 --
NM_024900chr491768 1555 934 874 865 827 598 473 163 --1849 --
NM_024915chr841102 512 310 113 1534 1116 --
NM_024920chr41647 11470 ----
NM_024922chr1632093 1602 724 189 11378 1522
NM_024930chr562018 1098 856 756 402 238 12742 22372 2126 --
NM_024941chr511089 ----11227
NM_024944chr21--1218 ----
NM_024947chr3109449 6464 5954 3120 3110 2812 2571 2552 2391 1233 23771 999 27200 761 18565
NM_024948chr101749 1639 ----
NM_024949chr444539 3141 1842 336 --14631 --
NM_024953chr1221766 716 1704 32313 2310 2307 --
NM_024969chr21654 ------
NM_024989chr262985 920 730 663 470 415 33226 3171 1014 11480 1734
NM_024991chr1043045 1205 609 339 2847 553 2968 464 --
NM_025045chr22148 ------
NM_025047chr3--1343 ----
NM_025054chr853580 3136 3017 656 179 1226 1216 --
NM_025058chr11698 --1723 --
NM_025073chr143174 3159 1740 584 --14233 --
NM_025083chr1531313 39 29 11686 11424 --
NM_025106chr12695 689 --11520 --
NM_025115chr81115 1298 1320 --
NM_025126chr122514 292 ------
NM_025129chr19----141 --
NM_025133chr22923 362 ------
NM_025134chr161585 1507 12368 --
NM_025137chr15135 188 ----
NM_025146chr31699 22362 660 12735 11017
NM_025147chr23980 785 254 ------
NM_025154chr711507 1408 21510 129 --
NM_025160chr164307 3913 3458 3001 1497 339 13645 ----
NM_025164chr1182239 1890 1682 1488 828 645 154 123 ------
NM_025179chr184465 3950 3712 3666 3204 1850 839 306 33787 1923 417 13207 13358
NM_025180chr332943 981 230 1680 13184 --
NM_025181chr22284 186 ------
NM_025187chr1641389 881 203 117 1905 ----
NM_025191chr1--12491 ----
NM_025195chr851761 1273 570 456 246 ----1120
NM_025202chr241025 948 322 82 ------
NM_025203chr221264 428 11489 21341 169 --
NM_025211chr9--186 ----
NM_025221chr431340 551 346 ------
NM_025236chr6150 ------
NM_025244chr2168 ------
NM_025256chr6170 ------
NM_025263chr641271 459 406 315 1291 ----
NM_030579chr1673683 3522 3491 3363 2403 1478 1428 --72729 2699 2696 2693 2690 2687 2684 --
NM_030583chr81380 ------
NM_030621chr1464123 4030 3467 3314 993 553 --12980 11176
NM_030623chr21130 ------
NM_030625chr1041932 593 486 32 ----162
NM_030627chr533286 1640 1576 23488 3340 --11108
NM_030629chr1631872 1535 500 ------
NM_030634chr172122 1997 1961 1610 500 391 85 1952 12125 --
NM_030647chr775807 5070 4507 4149 1057 1028 678 31663 888 657 11031 --
NM_030648chr445577 1634 1571 1413 ------
NM_030650chr253952 3315 2597 1238 1139 21474 862 13435 --
NM_030652chr6----1292 --
NM_030660chr141572 11523 ----
NM_030661chr731418 206 63 11588 11146 --
NM_030664chr1031994 656 413 ------
NM_030665chr1721371 100 ------
NM_030667chr1231308 1218 832 ------
NM_030668chr1231308 1218 832 ------
NM_030669chr1231308 1218 832 ------
NM_030756chr103295 247 25 ------
NM_030761chr152644 2107 2091 1681 804 ----12632
NM_030762chr12--1775 31383 1377 1374 --
NM_030772chr1----1457 1105
NM_030780chr811402 2310 143 ----
NM_030790chr16134 ------
NM_030791chr14--1742 ----
NM_030795chr81461 ------
NM_030796chr73778 507 198 11617 --1101
NM_030797chr21256 ------
NM_030799chr542184 2084 1893 82 31914 1849 862 ----
NM_030803chr211306 ------
NM_030805chr231202 1058 902 --1225 --
NM_030806chr187475 6212 3481 3439 3142 2627 223 204 47050 3509 1939 182 46282 1779 518 227 --
NM_030810chr651127 1094 1001 560 97 --1546 --
NM_030820chr61287 ------
NM_030884chr342216 1994 1914 1860 --1750 --
NM_030906chr112160 40 --1514 1592
NM_030915chr262159 2143 1940 887 286 245 --1505 --
NM_030918chr164867 4840 4781 1900 321 309 15174 ----
NM_030920chr141576 1411 507 376 1173 11579 --
NM_030939chr61447 ------
NM_030949chr631532 1075 1058 ----1574
NM_030952chr141181 1072 988 949 1209 1953 --
NM_030953chr511552 21414 1260 1526 --
NM_030958chr81425 ------
NM_030962chr1111029 --1147 --
NM_030963chr61213 ------
NM_030964chr553442 2751 1169 332 110 ------
NM_030981chr116990 798 364 241 234 157 ------
NM_031157chr12----1113 --
NM_031205chr121391 --2282 279 --
NM_031216chr1862110 1869 1451 908 38 30 ------
NM_031243chr762419 1711 843 726 592 479 ------
NM_031262chr91122 ------
NM_031263chr91179 ------
NM_031267chr71186 ------
NM_031268chr1694893 4590 4204 3678 2089 1203 978 628 398 24317 1615 44885 4340 1725 1722 1909
NM_031297chr9146 ------
NM_031305chr42607 519 11211 11878 --
NM_031309chr831777 1647 597 ------
NM_031314chr1421271 363 --11492 --
NM_031369chr41220 2752 92 ----
NM_031370chr41220 2752 92 ----
NM_031371chr1140 11210 ----
NM_031371chr1140 11210 ----
NM_031372chr421471 189 --21508 1463 --
NM_031411chr562380 2140 1998 1736 1713 885 12387 ----
NM_031412chr123986 224 184 11157 21019 938 --
NM_031418chr1152523 1729 992 835 573 11121 --12717
NM_031431chr1341849 1359 523 126 21739 397 ----
NM_031435chr1263369 3189 2625 2534 2328 415 2282 227 ----
NM_031439chr81263 11333 11392 --
NM_031442chrX63018 2993 2443 737 449 402 12204 11177 --
NM_031445chr232801 1234 858 32776 1363 748 ----
NM_031452chr152172 42 ------
NM_031459chr131640 1251 552 --21404 1401 --
NM_031461chr822166 233 3730 595 510 ----
NM_031468chr798017 6063 5331 5258 2778 2588 2354 1965 1934 36432 5724 430 ----
NM_031469chr632546 674 262 11508 1889 12492
NM_031475chr12724 245 ----1222
NM_031476chr1652699 1785 984 316 225 --11788 --
NM_031483chr2023465 2414 12649 ----
NM_031492chr112442 399 ------
NM_031844chr164066 2612 2581 1640 1457 312 21471 986 --1652
NM_031845chr253673 3594 3547 977 355 22929 1251 ----
NM_031847chr253673 3594 3547 977 355 22929 1251 ----
NM_031849chr562380 2140 1998 1736 1713 885 12387 ----
NM_031850chr33828 320 228 ----1832
NM_031850chr33828 320 228 ----1832
NM_031857chr562380 2140 1998 1736 1713 885 12387 ----
NM_031858chr1751543 1072 576 146 32 1367 ----
NM_031860chr562380 2140 1998 1736 1713 885 12387 ----
NM_031862chr1751543 1072 576 146 32 1367 ----
NM_031890chr2272864 2602 2382 2275 2236 2229 824 ------
NM_031899chr361525 1292 1008 634 283 98 1991 ----
NM_031908chr511000 ------
NM_031911chr452813 2536 1066 701 352 ------
NM_031936chr12497 208 ------
NM_031990chr191575 11276 ----
NM_031991chr191575 11276 ----
NM_031992chr721653 233 ----1153
NM_032012chr965214 4869 4497 1199 363 177 --31261 755 720 23284 367
NM_032013chr2031499 697 621 11673 11129 --
NM_032021chr11--1924 ----
NM_032025chr31757 157 ----
NM_032042chr532108 2088 826 2751 687 1378 --
NM_032049chr33828 320 228 ----1832
NM_032049chr33828 320 228 ----1832
NM_032050chr224948 754 686 45 ------
NM_032052chr2261333 1139 1071 1011 994 430 --1396 --
NM_032088chr52632 236 ------
NM_032092chr52632 236 ------
NM_032102chr1122825 655 ------
NM_032105chr186683 6626 6490 5459 5338 2143 1539 441 12082 32594 1764 1761 --
NM_032121chrX42818 2392 1873 415 --11889 --
NM_032124chr181320 1183 ----
NM_032128chr4--1839 ----
NM_032138chr13136 ------
NM_032139chr192906 31 ------
NM_032144chr2--21791 1491 ----
NM_032145chr621813 772 ------
NM_032153chr322355 69 22426 1952 12344 --
NM_032154chr103182 101 88 ------
NM_032160chr1853959 3306 773 387 248 34358 368 235 ----
NM_032181chr2--195 ----
NM_032189chr1363847 1913 1321 1162 703 185 --21192 330 --
NM_032192chr173687 103 48 ------
NM_032195chr211201 ----1408
NM_032199chr1023560 1548 1522 13485 --
NM_032205chr8173 ------
NM_032208chr233652 2319 2231 33371 1293 842 1672 11161
NM_032211chr1031227 1212 436 1749 128 --
NM_032221chr2041777 1430 796 232 21582 1442 --11848
NM_032228chr1143471 3023 740 618 -