TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4527
miRNA Sequence: UGGUCUGCAAAGAGAUGACUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX33167 2900 540 12139 ----
NM_000084chrX25626 772 34860 1119 45 ----
NM_000089chr71642 ------
NM_000096chr32639 629 1189 ----
NM_000125chr683946 3176 2641 1275 1111 663 363 351 --33450 1167 622 --
NM_000127chr8----174 --
NM_000141chr1031388 1123 1003 ------
NM_000142chr421329 93 ------
NM_000143chr12221 54 ------
NM_000163chr52727 237 1845 11955 --
NM_000167chrX----1144 --
NM_000176chr523793 2762 13393 ----
NM_000210chr231884 799 586 22257 881 ----
NM_000217chr1265013 5003 1749 777 746 114 1494 13257 --
NM_000232chr452866 1262 1047 444 367 ------
NM_000248chr32258 171 1650 ----
NM_000259chr1554604 3890 2421 968 780 1723 --14696
NM_000276chrX31667 1554 35 11826 11934 --
NM_000280chr111306 ------
NM_000314chr1022944 317 ------
NM_000332chr646763 6136 4604 572 26718 6690 14670 --
NM_000333chr331176 936 35 --1387 --
NM_000335chr382076 2044 1756 1734 1504 649 613 209 11572 ----
NM_000337chr564788 4432 2250 1922 1915 1547 1338 ----
NM_000368chr943419 3276 3001 1642 34348 1043 413 ----
NM_000396chr11102 ------
NM_000411chr2152866 2646 2098 2036 526 22716 400 1346 --
NM_000461chr364590 4146 3917 3362 3269 2837 1425 13250 11276
NM_000462chr151202 ----1439
NM_000484chr211945 ------
NM_000503chr83546 491 52 11456 21784 61 --
NM_000533chrX1685 ------
NM_000554chr1963017 2213 1187 1109 594 457 12189 ----
NM_000555chrX55130 4800 1550 1514 663 23052 2146 57616 5850 4849 1973 413 --
NM_000599chr273969 3638 3423 3387 3373 1764 780 --1736 --
NM_000615chr1162854 2154 2055 2034 660 591 42330 2229 1011 402 ----
NM_000616chr121532 11213 2457 88 171
NM_000618chr1236220 4811 2205 14585 --12163
NM_000618chr1236220 4811 2205 14585 --12163
NM_000627chr2------1183
NM_000673chr41322 ------
NM_000680chr8----1138 --
NM_000734chr17869 688 630 358 167 41 34 1936 1256 --
NM_000793chr1494788 4635 4494 4381 4329 4320 3771 3199 503 1472 ----
NM_000801chr201851 ------
NM_000807chr41181 --1139 --
NM_000829chr112855 316 ------
NM_000831chr1145998 5614 5011 4854 4763 4417 2446 2002 1774 862 389 201 163 27 56017 3941 1102 271 173 15591 15000
NM_000845chr7195 ------
NM_000872chr1021146 1104 ----1199
NM_000875chr1555092 4637 1945 1805 919 46245 5315 4313 1175 11547 --
NM_000891chr1743087 2962 2893 281 11386 ----
NM_000901chr432555 2200 1942 11622 22145 2067 --
NM_000912chr832829 2234 927 173 11074 1155
NM_000933chr2041612 1221 1109 691 ------
NM_000961chr2023197 870 ------
NM_001001344chrX32199 1982 1866 22587 471 1517 --
NM_001001396chr134070 3091 448 23838 1298 11310 --
NM_001001433chr2083200 2691 2407 2116 1167 1101 926 835 12640 ----
NM_001001484chr1042321 2238 1911 923 22315 110 ----
NM_001001549chr741862 812 729 497 --12202 11981
NM_001001550chr741862 812 729 497 --12202 11981
NM_001001555chr741862 812 729 497 --12202 11981
NM_001001701chr442295 2232 2037 1823 ------
NM_001001890chr2154119 3198 3126 2886 164 --11358 --
NM_001001924chr822047 23 ------
NM_001001925chr822047 23 ------
NM_001001931chr822047 23 ------
NM_001002265chr103820 765 340 ----1795
NM_001002266chr103820 765 340 ----1795
NM_001002269chr91157 1144 194 --
NM_001002814chr863112 3101 2408 544 501 96 33285 1011 807 ----
NM_001002838chrX1192 --11320 --
NM_001002860chr1474229 4037 3244 2946 2918 794 253 176 --1883
NM_001002919chr22169 117 ------
NM_001003407chr1064734 4332 3119 2033 1382 1091 1995 14619 --
NM_001003408chr1064734 4332 3119 2033 1382 1091 1995 14619 --
NM_001003652chr1897982 6856 5674 5505 5294 2417 2337 1206 522 26610 5348 38288 8160 1082 --
NM_001003674chr1896955 6374 5841 4874 4358 1685 1638 671 348 24439 1437 ----
NM_001003675chr1896955 6374 5841 4874 4358 1685 1638 671 348 24439 1437 ----
NM_001003792chr31896 ------
NM_001003793chr31896 ------
NM_001003800chr973581 2843 1413 1363 1231 792 276 12755 ----
NM_001003940chr1583071 2870 2594 1483 1315 997 885 187 12893 23346 627 13419
NM_001003942chr1583071 2870 2594 1483 1315 997 885 187 12893 23346 627 13419
NM_001003943chr1583075 2874 2598 1487 1319 1001 889 191 12897 23350 631 13423
NM_001004065chr942724 1214 317 185 ----1128
NM_001004317chr62517 292 ----13325
NM_001004342chr196088 5010 4822 4282 2164 1757 1053 476 365 --31690 1157 551 15418
NM_001005266chr15151 ------
NM_001005267chr15151 ------
NM_001005268chr15151 ------
NM_001005269chr15151 ------
NM_001005404chr1763784 3387 3194 2896 1163 270 --22890 2827 --
NM_001005463chr1042111 962 898 508 ------
NM_001005473chr546485 6271 6017 4064 14785 12429 --
NM_001005474chr321549 192 174 ----
NM_001005609chrX53296 2886 1215 372 303 11431 13719 1346
NM_001005861chr31164 --1751 --
NM_001006115chr332162 85 44 1923 22473 761 1184
NM_001006624chr132013 1291 180 ------
NM_001006634chr163621 476 59 --180 --
NM_001006681chrX153 ------
NM_001006682chrX153 ------
NM_001006683chrX153 ------
NM_001006932chr683331 2526 2139 1146 1021 667 371 56 --11035 --
NM_001007023chr1494788 4635 4494 4381 4329 4320 3771 3199 503 1472 ----
NM_001007237chr171980 1926 1855 1066 861 161 119 11793 11763 --
NM_001007246chr2121361 769 --11289 --
NM_001007466chr664876 3197 1623 1360 787 641 34854 4844 1812 35222 230 52 --
NM_001008239chr1823090 2936 ------
NM_001008392chr332829 1249 298 1114 33397 2319 2189 1331
NM_001008408chr7135586 4983 4776 4347 4116 2214 2103 1507 1413 817 595 290 190 --35041 2311 2264 --
NM_001008541chr102856 358 ----1866
NM_001008541chr102856 358 ----1866
NM_001008660chr1141551 1285 591 525 ------
NM_001008707chr1461582 1563 1544 1516 1180 49 1452 1601 --
NM_001008895chr1321427 174 ------
NM_001008925chr432900 2275 988 ------
NM_001009899chr356321 6029 2271 1248 161 15262 ----
NM_001009909chr1123798 3566 2159 61 11086 --
NM_001009993chr224175 3462 14183 33792 150 72 14150
NM_001010861chr162652 2453 2084 2053 1875 757 ------
NM_001010867chr186574 5892 5824 1174 1123 979 425 24 35886 1944 1510 12358 11013
NM_001010891chr596312 5979 4991 4767 2141 1788 1585 733 284 34638 2336 398 --15712
NM_001010917chr1052203 1424 669 589 268 --155 --
NM_001010927chr61444 ------
NM_001010984chr152348 1005 687 146 97 ------
NM_001010986chrX12351 12057 12037 --
NM_001011666chr751691 1373 1318 395 88 15640 ----
NM_001012393chr1154685 3766 1974 1045 51 13992 31941 1878 1772 11271
NM_001012426chr6122902 2584 2495 2131 1367 674 636 360 253 241 116 57 --33175 882 620 --
NM_001012427chr6122902 2584 2495 2131 1367 674 636 360 253 241 116 57 --33175 882 620 --
NM_001012751chr1031418 1204 407 1365 11725 --
NM_001012968chrX----11130 --
NM_001012977chrX21409 1229 ------
NM_001013415chr4136 1158 ----
NM_001013438chr3------1677
NM_001013439chr3------1523
NM_001013615chr1----1782 --
NM_001013620chr1246277 2534 1164 972 25772 47 11869 12450
NM_001013690chr1232380 2003 186 --2269 260 --
NM_001014797chr10108239 7804 6802 6724 6710 6702 6556 2266 481 263 21712 68 --21992 845
NM_001014812chr152482 39 ------
NM_001015885chr202354 239 ------
NM_001017440chr7157404 6974 6812 6426 6353 6229 6128 5415 5327 2209 1816 1646 114 90 83 11893 45590 2584 2127 64 28044 6286
NM_001017995chr5104138 3945 3902 3895 3870 1504 1019 724 570 105 34581 3924 3089 ----
NM_001018050chr2293336 3311 3146 3098 2646 2482 1287 961 915 13211 43106 2783 2688 1362 --
NM_001018052chr2293336 3311 3146 3098 2646 2482 1287 961 915 13211 43106 2783 2688 1362 --
NM_001018065chr985252 4576 3985 3977 3695 2225 2005 234 --25883 1288 --
NM_001018066chr985252 4576 3985 3977 3695 2225 2005 234 --25883 1288 --
NM_001018074chr523793 2762 13393 ----
NM_001018075chr523793 2762 13393 ----
NM_001018076chr523793 2762 13393 ----
NM_001018077chr523793 2762 13393 ----
NM_001018111chr743445 3295 1347 1238 22485 46 ----
NM_001020825chr521268 237 1868 ----
NM_001024094chr523793 2762 13393 ----
NM_001024218chr141288 ------
NM_001024401chr16102640 2510 2385 1963 937 676 440 237 116 23 ----1418
NM_001024649chr542647 1963 900 125 21192 661 11035 --
NM_001024858chr14102333 2165 2028 1981 1123 1086 590 337 262 59 32905 800 702 ----
NM_001024934chr61277 ------
NM_001024935chr61277 ------
NM_001024936chr61277 ------
NM_001024947chr52905 103 ------
NM_001024956chr1134730 1805 701 --25010 261 --
NM_001025077chr1057108 4770 1719 1029 828 26314 1814 16187 --
NM_001025079chr31834 21042 1034 --14027
NM_001025107chr152305 1682 737 613 200 1797 1440 --
NM_001025107chr152305 1682 737 613 200 1797 1440 --
NM_001025108chr254015 4003 1531 1161 102 13407 ----
NM_001025580chrX32698 1674 855 --141 --
NM_001029858chr682991 2800 2653 2560 2382 2321 2176 379 2689 459 ----
NM_001029998chr421012 897 ------
NM_001030007chr1643872 3562 987 648 ------
NM_001031684chr231440 1252 494 --11093 --
NM_001031690chr782936 2365 2202 2007 1184 489 194 99 12143 --12227
NM_001031695chr2253637 3511 3353 1173 396 45241 4958 4102 1323 ----
NM_001032999chr2094896 3571 1984 1097 547 469 387 380 373 1927 23954 338 34501 1990 302
NM_001033025chr111530 ------
NM_001033045chr213610 12815 11249 --
NM_001033047chr44701 378 213 89 --12240 --
NM_001033117chr384597 1416 1236 743 726 661 524 193 24727 3673 ----
NM_001033518chr742720 2204 1133 453 --1486 12134
NM_001033519chr742720 2204 1133 453 --1486 12134
NM_001033520chr742720 2204 1133 453 --1486 12134
NM_001033578chr831685 1632 595 12393 --2654 577
NM_001033925chr102570 77 12181 ----
NM_001034841chr1675321 4336 3838 3751 1573 372 274 ----1820
NM_001034845chr41509 ------
NM_001034850chr521235 620 ------
NM_001034954chr1053164 1108 1019 699 687 11172 ----
NM_001034955chr1053164 1108 1019 699 687 11172 ----
NM_001034956chr1053164 1108 1019 699 687 11172 ----
NM_001034957chr1053164 1108 1019 699 687 11172 ----
NM_001035511chr1121 32189 2026 365 --152
NM_001035512chr11128 32296 2133 472 --1159
NM_001035513chr11128 32296 2133 472 --1159
NM_001037132chr731908 1754 268 ------
NM_001037133chr731908 1754 268 ------
NM_001037317chr162652 2453 2084 2053 1875 757 ------
NM_001037331chr184712 282 238 101 ------
NM_001037334chr181555 11984 --1141
NM_001037494chr121280 ------
NM_001037495chr121280 ------
NM_001037954chr111525 1913 --1204
NM_001038702chr5----32566 1978 942 --
NM_001039577chr163245 3025 2989 2769 1564 73 ----23700 1606
NM_001039580chr41875 34669 3579 1004 ----
NM_001039618chr1175356 5305 5074 4639 4469 520 446 ----13637
NM_001039690chr1681454 735 696 690 411 375 369 363 32001 1523 121 ----
NM_001039709chr2094896 3571 1984 1097 547 469 387 380 373 1927 23954 338 34501 1990 302
NM_001039762chr1061870 1632 909 743 655 330 12093 ----
NM_001039802chr1--1343 11229 --
NM_001039840chrX54929 4254 4229 4139 1033 ------
NM_001039937chr1334086 781 135 ------
NM_001040001chr631755 1704 1630 1446 ----
NM_001040102chr1032261 364 192 --127 11999
NM_001040103chr1032261 364 192 --127 11999
NM_001040144chr1681454 735 696 690 411 375 369 363 32001 1523 121 ----
NM_001040146chr1681454 735 696 690 411 375 369 363 32001 1523 121 ----
NM_001040151chr1174476 4151 3657 2864 1828 1439 199 34352 3256 2918 ----
NM_001040159chr421251 466 ------
NM_001040214chr641583 601 524 283 --1268 --
NM_001040429chr1353398 3218 1038 715 369 --12905 --
NM_001040441chr144154 3832 831 777 35386 3677 152 ----
NM_001040450chr1532494 858 157 ------
NM_001040453chr1532494 858 157 ------
NM_001040624chr862244 2160 1033 697 545 220 --11979 21794 764
NM_001040625chr862244 2160 1033 697 545 220 --11979 21794 764
NM_001040626chr862244 2160 1033 697 545 220 --11979 21794 764
NM_001040627chr862244 2160 1033 697 545 220 --11979 21794 764
NM_001040628chr862244 2160 1033 697 545 220 --11979 21794 764
NM_001040629chr862244 2160 1033 697 545 220 --11979 21794 764
NM_001040630chr862244 2160 1033 697 545 220 --11979 21794 764
NM_001040875chr842324 1941 902 49 ------
NM_001042353chr20------1507
NM_001042399chr12------124
NM_001042404chr11220 --21311 517 --
NM_001042413chr963941 3513 2491 1348 980 77 12540 ----
NM_001042414chr131106 ------
NM_001042479chrX1577 ----22120 699
NM_001042480chrX1577 ----22120 699
NM_001042481chr1432201 1888 1036 12047 ----
NM_001042537chrX3924 209 160 1685 ----
NM_001042550chr941442 548 518 317 ------
NM_001042599chr256334 4861 2327 1064 381 --15248 --
NM_001042603chr1274875 4809 3475 3417 3359 1390 1034 ------
NM_001042604chr343894 3228 1899 557 14211 13432 --
NM_001042631chr19----1439 --
NM_001042632chr204375 237 208 38 12057 22340 597 1800
NM_001042633chr204375 237 208 38 12057 22340 597 1800
NM_001042681chr1102587 2073 2059 2010 1998 1685 1660 870 789 359 11953 1411 --
NM_001042682chr1102587 2073 2059 2010 1998 1685 1660 870 789 359 11953 1411 --
NM_001042682chr1102587 2073 2059 2010 1998 1685 1660 870 789 359 11953 1411 --
NM_001043318chr1443647 3084 1459 526 12965 1422 13341
NM_001044385chr211534 --14008 --
NM_001076778chr372070 1708 985 634 516 342 89 123 1510 --
NM_001079874chr122014 1861 1860 ----
NM_001092chr1762150 1994 687 627 111 67 ------
NM_001094chr173296 148 38 ----1136
NM_001099678chr355134 4787 4409 1669 1530 11456 11885 14793
NM_001100108chr1147859 7759 7662 7135 6748 6648 6618 5971 5643 3115 1261 826 365 131 16928 11358 --
NM_001106chr3159498 7366 6930 6472 3598 3410 2788 2535 2427 1952 1201 556 247 235 28 32953 2055 1441 58017 7413 7109 6143 3272 28034 7946
NM_001109977chr42648 328 1316 ----
NM_001111chr152305 1682 737 613 200 1797 1440 --
NM_001113490chrX33528 1369 24 1790 22298 835 --
NM_001116chr1642618 2308 1922 743 --12247 1699
NM_001117chr1882357 1682 1562 809 680 567 439 364 ------
NM_001128chr1643872 3562 987 648 ------
NM_001148chr412002 193 1498 --
NM_001149chr1011200 ------
NM_001167chrX46375 6065 6002 1169 1693 --24077 1101
NM_001186chr2122843 2320 ------
NM_001204chr235932 5314 2528 15524 --15807
NM_001206chr922925 854 ------
NM_001222chr1031436 1370 564 --21951 1576 --
NM_001241chr212188 ------
NM_001241chr212188 ------
NM_001259chr746005 5960 5575 2534 11843 ----
NM_001271chr1552972 2840 1166 1138 1011 32937 2356 86 1963 --
NM_001290chr41687 ------
NM_001304chr1723835 612 ------
NM_001331chr1131839 660 276 12691 ----
NM_001343chr511563 1490 --124
NM_001356chrX1531 169 11999 1775
NM_001358chr41393 ------
NM_001364chr1144261 1694 821 307 11658 54361 3672 2928 2893 1354 --
NM_001399chrX53296 2886 1215 372 303 11431 13719 1346
NM_001417chr1221895 1420 11267 ----
NM_001419chr1984702 4149 3620 1881 1673 948 719 356 21441 195 ----
NM_001420chr19123136 3118 2846 2805 1136 1111 1086 842 807 532 405 391 22907 959 ----
NM_001423chr1251417 1345 402 355 256 --11290 --
NM_001429chr221390 ------
NM_001432chr413425 1164 ----
NM_001438chr132332 1411 112 13170 ----
NM_001439chr111530 ------
NM_001455chr653558 3393 1902 1601 1380 1797 137 --
NM_001497chr921050 743 --22074 1771 1974
NM_001498chr611356 --11164 --
NM_001527chr694767 3490 1813 1080 986 757 716 607 412 ------
NM_001530chr14----1874 --
NM_001542chr171980 1926 1855 1066 861 161 119 11793 11763 --
NM_001543chr5124707 4355 4339 4256 4225 1478 1469 830 821 437 69 22 --11191 1757
NM_001546chr6------11349
NM_001584chr111468 ------
NM_001587chrX31667 1554 35 11826 11934 --
NM_001604chr111306 ------
NM_001609chr1043840 3481 3167 1568 ------
NM_001621chr732234 1201 1097 12455 ----
NM_001621chr732234 1201 1097 12455 ----
NM_001650chr18125 23172 1199 1723 --
NM_001660chr32747 637 ------
NM_001663chr1432684 1876 294 ----1458
NM_001679chr3--1150 1778 --
NM_001681chr122606 550 ------
NM_001684chr133787 2808 165 23555 1015 11027 --
NM_001695chr81395 ------
NM_001746chr542647 1963 900 125 21192 661 11035 --
NM_001754chr2154119 3198 3126 2886 164 --11358 --
NM_001759chr1254923 4624 4031 807 733 ------
NM_001777chr31834 21042 1034 --14027
NM_001789chr3----11340 --
NM_001791chr1--1343 11229 --
NM_001802chr16176 ------
NM_001875chr22795 788 ------
NM_001895chr20----11121 --
NM_001924chr11175 ------
NM_001962chr52390 109 ------
NM_001969chr1473895 3469 3060 2809 2667 560 199 ------
NM_001977chr431487 1468 467 11511 ----
NM_001987chr1263741 1685 1302 1021 849 83 13480 24058 3022 1146
NM_001995chr4------2488 198
NM_002006chr465255 5113 3602 1698 775 707 --14028 --
NM_002009chr1521125 421 ----11977
NM_002015chr1343169 1033 310 159 13035 ----
NM_002024chrX1246 ------
NM_002025chrX68894 7264 3174 3099 2465 1748 38998 7629 2186 18921 --
NM_002040chr2123167 2944 1690 ----
NM_002061chr141753 1632 1549 104 11782 --11285
NM_002069chr7167 2560 402 ----
NM_002072chr91830 ------
NM_002076chr12124 12311 ----
NM_002092chr464685 4097 3676 3099 813 485 --1757 --
NM_002094chr16------1368
NM_002112chr151239 ------
NM_002137chr722177 162 ------
NM_002166chr21741 ------
NM_002196chr201830 ------
NM_002196chr201830 ------
NM_002199chr42647 196 ------
NM_002203chr523795 1479 1604 ----
NM_002205chr126832 803 719 661 625 245 --1690 --
NM_002223chr1264006 3883 3490 2440 1556 1292 ------
NM_002235chr1221432 473 ------
NM_002264chr355009 4536 3634 1036 446 44982 4559 4457 36 ----
NM_002268chr341890 719 442 308 --1551 --
NM_002271chr131809 1191 21922 461 --
NM_002285chr254015 4003 1531 1161 102 13407 ----
NM_002312chr13----142 --
NM_002313chr1064734 4332 3119 2033 1382 1091 1995 14619 --
NM_002336chr1234445 1270 199 ----1107
NM_002381chr21200 ------
NM_002387chr531518 592 446 21591 638 --24338 53
NM_002397chr531861 518 438 12191 1373 --
NM_002431chr141290 --160 --
NM_002499chr1551683 1652 717 360 317 11755 1124 --
NM_002501chr1963555 3477 3331 3312 860 560 --23768 1008 1885
NM_002505chr61224 --11373 --
NM_002515chr1421785 309 21295 588 ----
NM_002524chr121042 791 ------
NM_002545chr1154685 3766 1974 1045 51 13992 31941 1878 1772 11271
NM_002547chrX43695 1572 276 135 12876 ----
NM_002577chr333496 772 366 ------
NM_002581chr954894 4733 4434 3664 814 12184 ----
NM_002605chr151488 ------
NM_002613chr16124299 4073 4038 3442 2014 1688 1489 1472 1059 689 639 323 54100 1574 1338 312 84 24739 1015 11042
NM_002629chr102123 101 ------
NM_002645chr1111038 22924 1970 1980 21939 1055
NM_002655chr844946 1802 1763 992 1546 --15182
NM_002698chr1992571 2558 2048 1923 1108 849 704 625 250 13030 ----
NM_002716chr1143086 2672 2480 843 ------
NM_002719chr1422410 798 1261 ----
NM_002731chr141965 614 594 474 1223 ----
NM_002737chr1796190 6033 5868 2650 2643 2542 1986 1956 1145 24090 763 25078 287 --
NM_002740chr322597 134 12665 --1650
NM_002745chr2284470 4368 4210 4126 3389 2870 1759 1182 ----11497
NM_002753chr45828 577 224 200 68 ------
NM_002755chr151627 ------
NM_002767chr171436 1145 ----
NM_002819chr191249 ----196
NM_002822chr1221428 486 11342 --21477 581
NM_002834chr1263699 1608 1101 1048 320 251 11444 ----
NM_002835chr71249 ------
NM_002844chr6----1471 --
NM_002857chr152729 2334 2227 1672 868 2521 196 --12384
NM_002874chr91191 22150 2016 --11627
NM_002886chr364799 4329 4322 3474 1981 858 ----13965
NM_002892chr1421291 333 ------
NM_002906chr1121781 70 1486 161 --
NM_002924chr1----130 --
NM_002928chr131492 1066 459 1399 ----
NM_002948chr331091 416 97 ------
NM_002956chr12----181 --
NM_002957chr973428 3352 2478 1377 1123 1068 766 1787 21213 941 --
NM_002958chr31164 --1751 --
NM_002959chr184452 4317 3935 3677 3600 1571 834 556 33304 2901 595 ----
NM_002977chr252442 1370 1116 1032 166 ------
NM_002998chr83782 696 622 1573 ----
NM_003001chr11128 32296 2133 472 --1159
NM_003016chr1721476 331 1706 ----
NM_003028chr923510 3314 11505 23199 796 22366 304
NM_003034chr1275136 2805 2794 1935 1134 306 220 46175 2817 2570 925 --11861
NM_003045chr13114451 3926 3689 3575 3443 1706 1251 769 588 541 358 14501 ----
NM_003072chr193385 98 85 ------
NM_003077chr174327 239 216 76 --1244 --
NM_003107chr661886 1670 931 633 593 266 ------
NM_003108chr277035 6220 2732 1747 1249 933 890 21455 790 32393 1492 725 --
NM_003112chr742085 623 586 330 --1186 --
NM_003118chr542006 1530 1402 375 ------
NM_003128chr252741 2335 2093 1021 480 22013 536 12183 --
NM_003155chr821075 600 12511 11889 12054
NM_003161chr1713266 ------
NM_003185chr20140 ------
NM_003189chr143015 2120 1133 495 --12704 --
NM_003199chr1865579 4997 1961 706 619 143 ------
NM_003214chr671116 1059 523 494 481 114 107 11257 --1917
NM_003236chr22682 102 11084 --2217 44
NM_003241chr34618 601 157 107 ----1336
NM_003246chr152802 186 ------
NM_003255chr1741788 1635 322 257 --32612 1663 418 --
NM_003262chr345131 4831 4013 3916 11039 1954 --
NM_003270chrX--1114 1159 --
NM_003272chr13602 486 159 --1564 --
NM_003274chr2132496 365 91 11070 1485 --
NM_003298chr3115583 5020 4779 3798 2266 2140 1800 1355 916 719 222 --1774 --
NM_003315chr17136 ------
NM_003318chr61193 ------
NM_003338chr102788 576 ------
NM_003341chr31176 ------
NM_003344chr721162 657 ----159
NM_003348chr12----11231 --
NM_003371chr961553 654 499 486 369 29 22129 805 1668 --
NM_003392chr332741 983 647 14273 --13230
NM_003406chr8--11615 --151
NM_003407chr191623 124 ----
NM_003409chr1821150 1090 11182 ----
NM_003412chr362010 1982 1935 1254 143 108 12133 ----
NM_003458chr333515 3191 161 22814 235 43028 2877 605 166 11080
NM_003468chr224052 4017 ------
NM_003469chr21124 ------
NM_003483chr121561 --12250 --
NM_003489chr2131010 989 701 23040 946 ----
NM_003498chr1662447 2297 1891 1849 714 209 12768 1221 --
NM_003507chr231411 393 149 12044 ----
NM_003557chr131272 1095 307 2589 407 ----
NM_003558chr91174 ------
NM_003574chr1844452 3697 3600 227 21522 215 ----
NM_003575chr741469 1171 1146 157 --11529 --
NM_003583chr1263073 2944 2639 1000 873 80 ----1284
NM_003589chr1321427 174 ------
NM_003590chr233749 812 440 1125 ----
NM_003603chr41188 21641 1551 --11618
NM_003607chr154371 2720 970 200 163 --13724 11334
NM_003610chr202354 239 ------
NM_003626chr1111115 11170 11198 --
NM_003629chr132195 1189 230 23355 679 ----
NM_003632chr171649 ------
NM_003644chr1786044 2632 2598 1806 1435 604 196 183 35453 5318 4875 24677 1133 --
NM_003658chr111827 ------
NM_003666chr11209 ------
NM_003671chr913262 --13312 --
NM_003705chr2----1686 --
NM_003709chr2----1296 --
NM_003713chr141594 689 538 337 --21300 628 --
NM_003743chr211579 --21892 1445 --
NM_003746chr121280 ------
NM_003749chr133821 575 361 ------
NM_003763chr2083200 2691 2407 2116 1167 1101 926 835 12640 ----
NM_003822chr143023 819 725 621 11219 12927 --
NM_003848chr3--1389 1265 --
NM_003887chr212066 12099 --1852
NM_003888chr153457 391 260 1563 11220 21376 1188
NM_003899chr1361990 1011 932 661 624 302 1966 11972 11707
NM_003913chr653305 2972 2857 1235 204 11623 1332 1416
NM_003921chr121809 311 --11697 --
NM_003931chr61277 ------
NM_003958chr653428 2965 2846 992 242 12416 1637 --
NM_004028chr18125 23172 1199 1723 --
NM_004035chr1764891 4885 3458 434 276 172 13151 ----
NM_004080chr71425 ------
NM_004132chr1031146 913 110 1164 2956 329 --
NM_004136chr1531257 398 88 1278 ----
NM_004171chr11108174 7356 7074 7038 6947 6772 6128 3374 3161 2553 37760 6630 6039 --13035
NM_004227chr773126 2865 1234 1114 1050 369 234 11992 22490 2387 12912
NM_004238chr21129 ------
NM_004249chr4123 ------
NM_004253chr92966 897 ------
NM_004267chr3183 --1494 --
NM_004293chr953472 2718 2572 868 239 23553 2661 ----
NM_004296chr1453719 3663 2646 74 51 22628 1071 21568 39 --
NM_004311chr1052417 2115 2036 646 553 --11037 --
NM_004321chr2103458 2993 2841 2795 2289 2272 1293 830 313 142 1933 2906 31 --
NM_004331chr842379 1054 695 286 21744 335 ----
NM_004338chr1896955 6374 5841 4874 4358 1685 1638 671 348 24439 1437 ----
NM_004342chr71861 ------
NM_004354chr4--1140 1541 --
NM_004370chr642145 1995 1546 1347 ------
NM_004397chr1164181 3906 1725 1183 914 858 ------
NM_004434chr1461582 1563 1544 1516 1180 49 1452 1601 --
NM_004437chr163476 2514 2403 550 98 91 ------
NM_004464chr443521 3499 1615 388 12900 14038 --
NM_004486chr93145 135 115 --1748 1955
NM_004491chr1964156 3759 2734 977 754 242 --1201 33280 3212 569
NM_004500chr1431970 1748 80 ------
NM_004501chr113146 ------
NM_004504chr252690 1973 1016 948 257 22567 2109 ----
NM_004514chr1752273 2080 982 965 510 --12414 --
NM_004519chr8137 ------
NM_004535chr2041648 1558 1212 676 ------
NM_004549chr1111526 ----1253
NM_004560chr92974 287 --1130 --
NM_004567chr3121967 1579 1549 1432 1335 1244 771 587 560 231 64 32 ------
NM_004575chr42516 305 ------
NM_004580chr1541506 661 583 128 ------
NM_004588chr1173512 2865 2608 2498 824 701 582 13559 14014 --
NM_004612chr932944 453 40 11016 ----
NM_004660chrY2923 911 170 21924 535 --
NM_004667chr15167 ------
NM_004697chr92246 118 --1822 --
NM_004703chr1742504 2244 969 438 ----1499
NM_004705chr11------170
NM_004726chrX125655 5141 5044 5036 4678 4657 4642 3985 2272 2147 1482 809 ------
NM_004730chr551536 709 616 166 85 ------
NM_004734chr1353179 3085 3031 2369 484 --1873 1527
NM_004745chr862560 2437 2378 2307 1440 1358 26886 6268 --25899 2752
NM_004747chr1071568 1452 581 188 182 152 54 --11479 --
NM_004748chr1532930 1497 927 13001 --11027
NM_004775chr181575 --12317 130
NM_004788chr113549 529 44 --12200 --
NM_004798chr2073479 2929 2864 2615 2368 1029 536 13256 --1136
NM_004808chr1013354 ----22963 773
NM_004834chr252342 1270 1096 732 458 --23327 122 --
NM_004836chr2139 --182 --
NM_004866chr543961 3707 1577 1111 ------
NM_004902chr20------1305
NM_004904chr751691 1373 1318 395 88 15640 ----
NM_004932chr511484 ------
NM_004974chr1146 ------
NM_004975chr202940 791 ------
NM_004976chr11104956 4662 3921 3663 1910 1663 147 79 48 38 1818 33997 3713 1835 --
NM_004985chr1254079 3461 3105 1005 862 --2723 119 --
NM_004992chrX117648 5683 5228 3161 3132 2868 1864 829 808 693 285 38139 7670 7323 15970 --
NM_004992chrX117648 5683 5228 3161 3132 2868 1864 829 808 693 285 38139 7670 7323 15970 --
NM_004993chr14------1316
NM_004999chr633032 3003 2973 --1979 --
NM_005010chr731908 1754 268 ------
NM_005044chrX44192 1689 1009 427 --13806 176
NM_005056chr1295119 5053 3719 3661 3603 1634 1278 249 43 ------
NM_005065chr1454947 4648 4546 4090 3885 ------
NM_005067chr31385 ------
NM_005078chr1591516 1358 1323 1294 474 462 300 203 107 ------
NM_005080chr221703 ------
NM_005087chr3------1523
NM_005093chr2094896 3571 1984 1097 547 469 387 380 373 1927 23954 338 34501 1990 302
NM_005110chr52171 49 --1244 --
NM_005116chr2042963 930 575 128 13618 12853 --
NM_005121chr1722451 1299 1941 13062 --
NM_005151chr181555 11984 --1141
NM_005153chr161214 ----1580
NM_005156chr954580 3834 563 505 390 1334 ----
NM_005168chr211330 ----2648 176
NM_005189chr17142514 2478 2366 2307 2006 1763 1753 1655 1562 905 887 816 647 139 12187 1238 12274
NM_005192chr141116 ------
NM_005197chr1466163 6027 5854 5028 980 417 14217 1528 --
NM_005235chr256334 4861 2327 1064 381 --15248 --
NM_005254chr1511389 --11173 --
NM_005256chr112879 334 ------
NM_005259chr211111 ------
NM_005311chr741862 812 729 497 --12202 11981
NM_005312chr9122665 2535 2318 2198 2158 2049 2030 1667 1022 508 223 58 1726 2581 197 1360
NM_005316chr11188 --1462 --
NM_005329chr1661954 1846 1817 1780 1628 235 ------
NM_005334chrX3361 211 37 11382 2682 670 11348
NM_005339chr431375 1296 583 11183 13086 --
NM_005358chr132294 33 ------
NM_005359chr1844955 1543 1233 151 11744 ----
NM_005369chrX1101 ------
NM_005375chr63770 451 264 1320 ----
NM_005378chr21355 ------
NM_005397chr743445 3295 1347 1238 22485 46 ----
NM_005399chr184319 3420 3079 1458 722 598 428 163 1729 22835 1626 --
NM_005436chr1063770 3105 2857 2678 2628 471 ------
NM_005455chr121813 1593 ------
NM_005458chr961656 739 611 582 561 499 1515 1587 --
NM_005460chr52449 226 ------
NM_005461chr2071954 1365 1221 552 502 461 81 21457 72 ----
NM_005475chr1262713 2678 2623 2550 2402 373 22839 584 ----
NM_005493chr61654 ----160
NM_005504chr1276586 6352 5910 5063 2290 1957 62 1996 ----
NM_005522chr721341 158 ------
NM_005537chr1331034 736 258 ------
NM_005542chr721680 658 ------
NM_005562chr141357 291 213 45 --1608 --
NM_005563chr13730 142 136 ------
NM_005596chr9116207 6187 5103 4840 4695 3970 2482 2348 1393 1373 1207 1241 22312 2293 --
NM_005610chr14734 315 196 85 --1886 --
NM_005665chr143617 3357 1225 216 ------
NM_005677chr361284 433 402 356 349 312 --11186 --
NM_005721chr22864 165 ------
NM_005730chr1242577 2216 1273 524 43173 2527 568 177 13398 --
NM_005739chr152504 71 21822 1510 11682 --
NM_005748chr1242723 2472 676 190 --11389 --
NM_005779chr583641 3289 3092 893 354 347 259 234 23231 3215 11080 --
NM_005780chr13122 --1741 --
NM_005808chr332829 1249 298 1114 33397 2319 2189 1331
NM_005819chr163022 2853 2565 1031 384 320 --12228 --
NM_005840chrX106732 6545 6044 2559 2318 1924 1784 1027 609 351 ------
NM_005859chr5----11172 --
NM_005860chr1951305 1294 1280 1144 205 21456 119 11288 --
NM_005898chr1132950 2646 2159 12310 ----
NM_005901chr1897982 6856 5674 5505 5294 2417 2337 1206 522 26610 5348 38288 8160 1082 --
NM_005902chr15113501 3417 3126 3030 2988 2846 1804 1457 1246 309 30 11189 33038 534 439 --
NM_005909chr543039 932 777 734 ------
NM_005933chr1173011 2778 2662 2406 2063 623 458 11182 1280 --
NM_005937chr1773451 1606 1343 477 92 77 46 --13955 --
NM_005941chr854035 2596 1672 888 97 11031 ----
NM_005943chr631605 1347 153 11464 1220 --
NM_005955chr155164 4994 951 727 468 --1797 1992
NM_005962chr102856 358 ----1866
NM_005962chr102856 358 ----1866
NM_005977chr13----1343 --
NM_006007chr962807 1393 1386 986 511 72 ------
NM_006011chr1583415 2760 1177 732 635 215 97 60 13904 ----
NM_006016chr632231 2176 324 ------
NM_006022chr131259 ------
NM_006036chr252428 1723 1632 1585 287 ------
NM_006037chr2104179 3786 3570 3290 3054 3024 1382 1263 244 163 ------
NM_006076chr783051 3043 2567 2447 2358 2075 968 743 11033 12094 --
NM_006080chr722353 227 --1244 --
NM_006106chr1152891 2305 2132 1105 357 ------
NM_006113chr122014 1861 1860 ----
NM_006133chr11122366 2330 2244 2221 2064 2009 1861 1762 729 458 431 96 1330 ----
NM_006141chr1662821 2687 2310 778 407 193 ------
NM_006145chr1931075 393 320 ----1314
NM_006154chr1522458 111 --22487 529 --
NM_006166chr1232086 967 309 ----12092
NM_006190chr2----1916 --
NM_006237chr1312045 --11901 --
NM_006241chr312190 --1730 --
NM_006252chr167332 5587 5244 2920 2364 2342 --11628 --
NM_006282chr2024216 1442 34452 1390 1240 --11482
NM_006283chr844008 3110 1015 28 1801 ----
NM_006315chr433770 101 26 24173 3117 --1744
NM_006320chr431127 386 63 ------
NM_006336chr931452 1399 387 21021 337 21462 421 --
NM_006350chr51108 ------
NM_006359chrX3924 209 160 1685 ----
NM_006364chr142505 320 ------
NM_006375chrX1177 --1316 1480
NM_006386chr221160 --132 --
NM_006434chr1053164 1108 1019 699 687 11172 ----
NM_006449chr241858 1688 425 274 ------
NM_006454chr462838 2584 2496 712 371 94 --22716 2661 1605
NM_006466chr203783 120 56 ------
NM_006474chr132013 1291 180 ------
NM_006482chr1263073 2944 2639 1000 873 80 ----1284
NM_006489chr1421785 309 21295 588 ----
NM_006496chr131454 1406 736 1472 ----
NM_006520chrX1173 --11623 --
NM_006526chr2022132 638 ------
NM_006537chr151197 ----1546
NM_006538chr284162 3127 1427 1227 1127 1010 965 34 43912 3432 1320 713 --12995
NM_006540chr841425 1413 1137 125 ----11583
NM_006544chr1436079 4420 637 ------
NM_006546chr1786166 6113 5467 4607 4168 4160 1892 282 1715 25051 74 --
NM_006547chr7133 11616 ----
NM_006572chr1721312 210 22710 275 ----
NM_006595chr1131298 306 149 1218 ----
NM_006599chr1667784 7725 6410 5571 599 567 16807 --16785
NM_006602chr201604 2807 209 ----
NM_006618chr131440 1300 535 ------
NM_006620chr654502 4305 3063 1924 1216 21949 1699 1792 --
NM_006621chr122021 616 ----1157
NM_006624chr1031474 1312 310 ------
NM_006628chr1513835 --11701 14383
NM_006629chr1842491 2284 396 115 ------
NM_006667chrX11038 ------
NM_006690chr2072243 2158 2120 1682 628 550 45 --1558 12090
NM_006696chr51262 --1225 --
NM_006699chr122056 593 1880 12537 --
NM_006717chr933290 2395 56 --12980 12630
NM_006720chr1064734 4332 3119 2033 1382 1091 1995 14619 --
NM_006722chr32258 171 1650 ----
NM_006729chrX45391 5175 4390 1375 ------
NM_006731chr974888 4240 1548 1473 1225 1097 497 34924 2122 1152 ----
NM_006738chr1584625 3333 1541 1253 777 526 398 193 24265 1023 23545 1118 --
NM_006750chr1677886 6723 5216 3079 2408 1589 1050 26825 6787 11001 --
NM_006763chr141849 1794 1747 1367 157 21995 288 --
NM_006769chr1179 ------
NM_006777chrX52026 1982 1973 733 569 1665 ----
NM_006814chr2031658 194 88 --2771 124 --
NM_006826chr21849 ------
NM_006835chr4140 ------
NM_006838chr121436 --1536 --
NM_006854chr71118 --11709 --
NM_006896chr75900 721 432 409 318 1273 1770 --
NM_006912chr132383 759 492 ----1522
NM_006918chr1134730 1805 701 --25010 261 --
NM_006922chr2------11733
NM_006924chr1733221 366 242 1468 ----
NM_006930chr52790 384 21949 258 1286 --
NM_006943chr2093288 3256 2862 2644 2267 1156 295 169 145 13237 13230 --
NM_006996chr1182 ------
NM_007005chr921568 456 1602 121 --
NM_007008chr23754 301 113 ------
NM_007011chr1556374 4616 1944 1588 416 2497 443 26516 4605 15262
NM_007030chr5105042 4393 4176 3457 1654 497 420 371 143 137 1627 1933 --
NM_007038chr2125582 5152 14462 15165 --
NM_007042chr33936 270 83 12011 1809 --
NM_007050chr20157307 7262 6851 6818 6249 5271 5228 4923 2980 2622 2533 2525 2245 1583 1244 23075 298 25988 2753 17172
NM_007078chr1062677 1879 673 562 555 162 1185 ----
NM_007084chr1341096 625 256 226 --2592 199 --
NM_007144chr1741097 926 919 405 ----11079
NM_007146chr1732888 2831 1123 --12096 --
NM_007150chrX41799 1462 853 426 --12091 --
NM_007166chr1141551 1285 591 525 ------
NM_007175chr843326 2666 2245 1074 13624 140 --
NM_007177chr372070 1708 985 634 516 342 89 123 1510 --
NM_007189chr721523 501 1445 11252 1995
NM_007191chr121279 ------
NM_007195chr1823609 2717 1869 ----
NM_007200chr1584625 3333 1541 1253 777 526 398 193 24265 1023 23545 1118 --
NM_007203chr942724 1214 317 185 ----1128
NM_007220chrX64906 4316 3767 1901 547 519 ------
NM_007249chr1368596 6799 6185 2623 2459 512 28411 6179 27504 3105 --
NM_007282chr31939 1756 ----
NM_007292chr1764891 4885 3458 434 276 172 13151 ----
NM_007322chr191503 --1162 --
NM_007350chr1234353 4140 3314 21553 118 13012 1369
NM_007373chr101101 ------
NM_012083chr10----143 --
NM_012084chrX1483 --154 --
NM_012096chr322413 979 --1250 --
NM_012102chr1102587 2073 2059 2010 1998 1685 1660 870 789 359 11953 1411 --
NM_012141chr1334086 781 135 ------
NM_012154chr81671 164 1189 --
NM_012156chr2052768 867 795 439 279 1385 12389 --
NM_012164chr986444 5831 5675 5278 4664 2582 2248 1924 11713 ----
NM_012193chr1154613 3884 2149 949 880 --1189 11397
NM_012199chr164019 1449 1043 882 513 371 2520 178 ----
NM_012218chr1972897 2041 2023 1899 1055 514 99 12538 21981 731 --
NM_012238chr1011682 21314 407 ----
NM_012249chr22795 76 22644 1303 --12574
NM_012262chr165172 3463 3419 1976 1055 891 ------
NM_012269chr71115 ------
NM_012281chr762431 2026 1543 805 638 93 ------
NM_012287chr321124 239 13275 --1649
NM_012288chr674286 4268 3485 2163 1505 807 65 1236 12097 11416
NM_012293chr241873 1577 216 76 --1419 185
NM_012294chr743059 1466 790 588 --13309 --
NM_012306chr1273440 3322 3312 2950 1073 865 775 33462 1401 943 12808 --
NM_012309chr1194494 4438 4369 3793 3787 745 425 354 174 14245 24504 27 --
NM_012316chr1145522 5496 5239 4761 4324 4206 3764 3678 3474 2003 803 723 452 298 ----24984 1829
NM_012333chr111256 --11205 11667
NM_012347chr662798 2738 2572 2171 344 332 --11104 --
NM_012388chr1542404 2383 160 65 ------
NM_012420chr1021697 1496 ----11745
NM_012425chr101796 11795 ----
NM_012433chr2------192
NM_012454chr61444 ------
NM_012464chr421157 464 ----1585
NM_012479chr752775 1705 1008 493 485 12689 ----
NM_013231chr1453542 3176 391 81 31 22874 970 ----
NM_013236chr2231201 417 276 1988 ----
NM_013255chr788749 8596 2916 2889 2822 2265 1313 1152 11099 ----
NM_013257chr831685 1632 595 12393 --2654 577
NM_013283chr51299 --1289 --
NM_013286chr393783 3613 3579 3292 2926 2475 2356 1387 511 12820 11017 --
NM_013330chr11180 ------
NM_013372chr1553053 2254 903 605 58 ------
NM_013382chr1472136 864 802 691 532 465 339 11512 ----
NM_013396chr2141484 163 157 146 11229 ----
NM_013399chr1661651 1597 1313 683 399 344 1742 1729 11444
NM_013411chr142765 2659 2157 1087 1382 --12017
NM_013423chrX11136 ------
NM_013427chrX11136 ------
NM_013436chr2159 ----1562
NM_013444chrX1903 ------
NM_013989chr1494788 4635 4494 4381 4329 4320 3771 3199 503 1472 ----
NM_014011chr221047 633 ------
NM_014043chr331168 617 65 11198 ----
NM_014048chr1665232 2014 944 479 394 261 13435 ----
NM_014112chr845159 4262 1074 940 1304 ----
NM_014117chr161789 ------
NM_014141chr723344 128 1761 --14499
NM_014155chr1166407 6302 5213 2889 2643 1509 42041 1479 1347 579 --12373
NM_014191chr122917 31 ------
NM_014283chr11221 ------
NM_014286chr963243 2934 2767 2597 402 294 12209 12613 13053
NM_014288chr11309 ------
NM_014294chr81486 --11287 --
NM_014309chr2253627 3501 3343 1163 386 45231 4948 4092 1313 ----
NM_014317chr10289 40 ------
NM_014319chr1211761 ------
NM_014331chr432682 2392 1614 27065 1427 13138 --
NM_014361chr11----1373 --
NM_014363chr131114 ------
NM_014372chr121882 138 ------
NM_014415chr31204 ----11313
NM_014421chr411323 --132 11642
NM_014423chr564226 4218 4052 2183 1489 408 ------
NM_014431chr1031467 1037 286 --2403 46 --
NM_014454chr63834 90 43 ------
NM_014472chr102160 96 ------
NM_014521chr231872 1267 374 ------
NM_014554chr1232228 2024 127 12036 2866 22 --
NM_014570chr2231060 1030 98 ------
NM_014587chr1651558 1149 526 388 30 1188 21452 482 --
NM_014600chr24488 401 295 229 11596 11088 --
NM_014630chr1551446 978 701 682 406 1876 166 1836
NM_014636chr963788 3524 3377 1470 760 246 --14149 --
NM_014646chr1852921 2617 2432 2157 820 2765 154 22603 1074 12857
NM_014661chr1073447 3044 2678 2388 1290 948 811 12820 33813 3597 2515 --
NM_014665chr8113545 3421 3147 3105 3043 2950 2531 2510 1092 241 28 11268 33250 2821 2656 13578
NM_014666chr5249 21 1234 ----
NM_014667chr321737 634 --21645 720 12431
NM_014677chr81870 --1545 --
NM_014682chr831464 837 805 ------
NM_014690chr782936 2365 2202 2007 1184 489 194 99 12143 --12227
NM_014707chr731525 710 103 --11966 --
NM_014723chr2073242 2469 2445 2382 2040 907 575 11206 --1509
NM_014729chr811683 --11924 --
NM_014731chr2071702 601 533 510 472 312 92 1108 ----
NM_014733chr521776 1501 ------
NM_014739chr643996 1516 1287 167 ------
NM_014747chr175268 5111 5050 2056 1451 1138 859 22307 1113 ----
NM_014751chr821470 579 ------
NM_014752chr1131765 533 277 ------
NM_014754chr82732 166 ----1186
NM_014755chr284132 3956 3578 3199 2915 2642 1100 35 ----14019
NM_014766chr773772 3591 3112 2765 2554 1193 342 1130 ----
NM_014767chr1062897 2857 2546 1121 929 61 21313 1199 12639 --
NM_014772chr18123334 3326 3213 2987 2606 632 521 499 485 302 121 21 23412 3171 21332 1312 --
NM_014774chr142246 2039 658 110 --22337 1209 --
NM_014787chr121119 77 --31049 455 31 12082
NM_014793chr15136 --1408 --
NM_014795chr21157 ------
NM_014810chr133479 2442 2306 23534 1206 ----
NM_014812chr11220 --21311 517 --
NM_014819chr51599 ------
NM_014822chr4----1479 --
NM_014824chr1151969 611 521 310 148 1447 1238 --
NM_014826chr154371 2720 970 200 163 --13724 11334
NM_014839chr112157 12256 1161 --
NM_014841chr61955 ------
NM_014844chr14104206 2844 2547 1648 1544 1514 1240 1225 1013 821 --12720 --
NM_014849chr1131 ----21048 422
NM_014850chr384597 1416 1236 743 726 661 524 193 24727 3673 ----
NM_014860chr232162 40 31 2953 248 ----
NM_014873chr153222 1476 1090 744 43 24804 4133 ----
NM_014876chr2282142 1771 1523 1455 680 415 352 124 21698 1482 ----
NM_014877chr1775559 5170 2899 1798 1777 815 640 37044 4790 1882 ----
NM_014897chr174333 273 143 93 1813 ----
NM_014904chr1033134 1077 1023 --13835 --
NM_014906chr1773805 3306 1507 1168 1096 586 72 ----11387
NM_014912chr1043028 1355 469 300 ------
NM_014926chr3--1215 1243 --
NM_014932chr311371 21903 1319 --1433
NM_014938chr1242222 1701 902 566 42288 1630 981 846 ----
NM_014939chr1821157 1044 --11115 --
NM_014946chr242876 805 327 159 ------
NM_014950chr14282 67 11528 11464 --
NM_014953chr1353792 3097 3021 857 313 24072 3255 ----
NM_014962chr2032485 660 488 --22871 2035 --
NM_014974chr10274 42 ------
NM_014988chr41841 11858 --12313
NM_014991chr41181 --139 --
NM_015000chr1232602 1174 1165 ------
NM_015001chr14793 245 161 104 ------
NM_015008chr323634 2570 1430 --12527
NM_015020chr1641318 1243 1046 383 1746 23308 3269 --
NM_015032chr131236 ------
NM_015035chr2066556 4107 2517 2211 1986 144 24132 794 14803 --
NM_015042chr1553265 2680 1249 946 169 23756 2649 1143 --
NM_015044chr1672768 2690 2193 2131 734 723 151 --12732 --
NM_015045chr1031930 1761 1453 ------
NM_015046chr952609 1856 1103 921 278 --22102 357 11016
NM_015062chr10------1276
NM_015064chr1243452 2630 2558 304 --1960 1313
NM_015071chr566355 5543 5537 4383 4027 875 24289 2123 ----
NM_015073chr1961938 1778 1523 787 214 42 31835 813 514 11359 --
NM_015074chr164929 4858 3203 1921 1545 839 34251 3251 1755 11073 11132
NM_015077chr1761511 1282 1276 579 485 233 14460 13308 13369
NM_015079chr1553000 2958 1180 606 211 --22818 964 1814
NM_015090chr186001 5371 4824 4661 1535 1142 525 394 24587 1773 55317 2286 1520 699 75 25643 3815
NM_015092chr1621139 286 11446 ----
NM_015094chr22134215 3962 3887 3876 3744 3704 3588 3455 3398 1104 785 317 234 33066 1835 1706 33424 477 376 --
NM_015113chr1782143 1844 1807 1784 1690 620 408 57 ------
NM_015124chr2252281 2177 2011 1878 1668 --1247 --
NM_015138chr1552060 866 766 397 162 ------
NM_015156chr1483678 1496 1403 1355 995 980 526 345 23169 1330 ----
NM_015161chr161142 --11077 --
NM_015172chr12615 301 ------
NM_015176chr12266 223 1346 ----
NM_015187chr41265 1175 1318 --
NM_015192chr2042085 1067 860 278 ------
NM_015197chr1473165 2852 2823 2498 931 540 391 33145 2875 1073 13296 --
NM_015199chr352741 1924 889 649 202 ------
NM_015208chr181540 23803 2838 33245 852 258 --
NM_015239chr91446 ------
NM_015245chr6102766 2398 1825 1714 1079 760 498 219 209 104 22464 1769 12157 --
NM_015267chr122881 324 --22071 1964 --
NM_015271chr463367 3336 3144 2934 2676 1313 1792 ----
NM_015272chr16------11717
NM_015275chr121859 ------
NM_015277chr1861571 1221 384 275 106 72 ------
NM_015278chr642247 2193 675 440 ----196
NM_015288chr583823 3089 2545 415 377 349 99 25 43065 2488 915 814 ----
NM_015296chr132369 275 ------
NM_015310chr838186 2437 576 37527 6153 2068 --16672
NM_015313chr1163573 1785 1347 942 765 427 ----11323
NM_015314chr732001 389 159 --11570 --
NM_015316chr1461234 1172 1028 902 871 122 11116 --1858
NM_015327chr1140 --2474 100 --
NM_015328chr752790 1953 1939 1909 976 11986 ----
NM_015336chr122946 772 ------
NM_015347chr1262788 2712 2625 728 430 91 ------
NM_015365chrX32698 1674 855 --141 --
NM_015375chr153660 1741 1729 1471 296 13604 ----
NM_015381chr2261960 1488 1378 717 431 152 1480 1733 --
NM_015385chr1053164 1108 1019 699 687 11172 ----
NM_015435chr81122 ------
NM_015443chr1721135 26 11502 ----
NM_015455chr563318 1590 1151 797 600 414 21375 722 --13842
NM_015458chr833837 678 405 ------
NM_015459chr11----198 --
NM_015461chr182589 182 ------
NM_015470chr221173 1165 11235 11178 --
NM_015548chr61120 ------
NM_015554chr1552863 2798 1151 409 279 22078 815 32644 2137 470 --
NM_015556chr14------1156
NM_015568chr2063409 2957 1707 1097 656 132 24010 56 24163 3980 --
NM_015570chr741725 192 94 46 21526 55 ----
NM_015578chr1932062 1679 367 ------
NM_015589chr14----1180 --
NM_015590chr11529 --1576 --
NM_015609chr182958 2612 2559 2485 2478 2360 2190 82 ------
NM_015610chr742720 2204 1133 453 --1486 12134
NM_015626chr1711179 ------
NM_015635chr941410 556 318 51 --2134 31 --
NM_015677chr21628 ------
NM_015713chr842965 2414 2315 1420 ------
NM_015840chr152305 1682 737 613 200 1797 1440 --
NM_015841chr152305 1682 737 613 200 1797 1440 --
NM_015850chr831751 1723 27 --21776 219 --
NM_015879chr18108337 7725 7514 7345 6064 5554 3011 1235 411 166 37757 7444 1101 35246 3018 1315 --
NM_015885chr112755 555 ------
NM_015886chr844330 1904 1016 864 ----1826
NM_015906chr164434 3622 1639 1579 1152 510 1907 --11007
NM_015926chr31250 --263 51 --
NM_015955chr2----1333 --
NM_015975chrX21546 328 ------
NM_015981chr593008 2732 2469 2330 2022 2003 1992 450 416 --12628 --
NM_016003chr742720 2204 1133 453 --1486 12134
NM_016048chr5--1158 1316 --
NM_016061chr221620 216 ------
NM_016072chr1211886 ------
NM_016073chr151797 --1275 --
NM_016076chr132162 527 398 12992 ----
NM_016078chr1711010 ------
NM_016083chr623011 506 ------
NM_016090chr112856 293 ------
NM_016100chr20126 ------
NM_016122chr12------124
NM_016133chr231400 389 82 ------
NM_016169chr1093131 2766 2668 2323 2113 2084 903 384 167 2234 161 32716 1232 255 --
NM_016173chr364570 4204 4018 3768 1764 1584 --2867 841 --
NM_016205chr431095 1086 574 ------
NM_016221chr522393 743 --2402 23 11645
NM_016227chr11221 ------
NM_016250chr141221 ----1111
NM_016258chr1----1122 --
NM_016260chr246532 6131 1676 1529 16167 --17311
NM_016275chr341907 742 534 129 1111 ----
NM_016277chr63543 473 127 --194 --
NM_016322chr963058 3008 2439 2259 2023 925 ------
NM_016339chr1741441 1239 31 22 ------
NM_016424chr17--21897 26 1227 --
NM_016448chr121869 1316 ------
NM_016470chr20----170 1210
NM_016507chr1742623 954 736 160 ------
NM_016530chr1574000 3259 2646 1147 1120 182 125 11409 ----
NM_016531chr454020 3570 1467 383 204 11308 ----
NM_016577chr384226 3710 3444 3086 2993 2754 1619 1402 34136 3995 3384 ----
NM_016603chr542236 1469 796 213 ----1646
NM_016605chr521042 34 11889 21009 227 --
NM_016621chr1184502 4453 3983 3647 3492 3042 1440 394 ----14413
NM_016623chr8129 ------
NM_016626chr18----1229 --
NM_016628chr10188 ------
NM_016631chr211760 ------
NM_016654chr1511389 --11173 --
NM_016946chr163613 1380 1350 972 746 301 13512 ----
NM_016950chr421251 466 ------
NM_016952chr1153254 793 736 434 59 --13743 --
NM_016953chr266029 2228 2075 1946 1730 450 12404 13985 --
NM_017415chr564376 2950 1069 776 717 289 --1142 1326
NM_017420chr1412754 13330 --1374
NM_017423chr422110 394 ------
NM_017544chrX2182 41 1397 ----
NM_017548chr322021 1742 1629 11558 1108
NM_017596chr1184523 4235 4198 4101 3994 3552 3253 3069 3063 3049 1627 1415 1114 899 603 335 258 214 13155 33054 2963 1850 --
NM_017599chr12--12039 1181 --
NM_017610chr1561739 831 661 304 149 91 ------
NM_017628chr444017 1727 1445 165 --15254 --
NM_017629chr131961 1942 643 --1588 --
NM_017633chr622391 773 ------
NM_017634chr841781 1513 1355 545 1795 ----
NM_017637chr978907 7248 6004 1427 1415 771 516 11053 11812 --
NM_017672chr1521017 355 ------
NM_017693chr1321163 193 --1107 --
NM_017712chr1955535 5506 4950 4830 642 15851 14630 --
NM_017730chr3152 --1193 --
NM_017737chr13394 378 126 11769 ----
NM_017762chr1541666 850 631 344 ------
NM_017770chr652938 2150 2001 1189 255 ------
NM_017787chr1072828 2206 1797 1069 779 670 653 12419 ----
NM_017824chr1022125 975 1619 12109 --
NM_017848chrX43289 3229 975 697 ----13611
NM_017856chrX1577 ----22120 699
NM_017873chr953000 2418 2206 1981 703 --13020 12432
NM_017915chr123801 387 367 ----1848
NM_017919chr931218 1094 255 24715 3732 --13782
NM_017933chr221296 495 ------
NM_017938chrX32175 1448 359 ------
NM_017944chr1142476 1132 634 316 12802 11969 --
NM_017953chr1----152 --
NM_017998chr92926 906 ------
NM_018010chr341508 1138 1117 315 ------
NM_018014chr241280 1000 949 212 ------
NM_018017chr1012739 ----1997
NM_018027chr1033202 2317 1271 12864 ----
NM_018028chr1951177 1105 322 256 183 --1356 --
NM_018045chr172726 2486 2137 2069 517 62 39 1977 --11087
NM_018054chr163621 476 59 --180 --
NM_018121chr1052099 2052 897 648 176 12310 ----
NM_018133chr331450 848 167 1628 ----
NM_018178chr151589 513 433 160 119 1809 1180 --
NM_018184chr311404 42138 2119 734 599 12083 --
NM_018198chr161220 974 525 436 215 156 --1441 --
NM_018205chr1072220 2157 1874 1668 656 370 46 2943 364 1256 --
NM_018239chr1072220 2157 1874 1668 656 370 46 2943 364 1256 --
NM_018243chr453436 1079 670 603 502 12572 1280 12630
NM_018254chr11926 --11896 --
NM_018256chr2180 ------
NM_018315chr4136 1158 ----
NM_018328chr21111 ------
NM_018330chr1021670 296 ------
NM_018334chr71451 ------
NM_018351chr1263656 3577 3459 3287 1450 117 24160 2973 ----
NM_018362chr1153649 3035 973 258 242 ------
NM_018373chr1465704 5598 4562 3926 2265 1331 46262 6143 4637 4108 --11337
NM_018374chr774807 4643 4468 4395 4162 966 791 14136 ----
NM_018383chr211978 22039 1988 11498 --
NM_018400chr1174476 4151 3657 2864 1828 1439 199 34352 3256 2918 ----
NM_018440chr878471 7623 6053 5782 5690 3230 1314 22633 900 ----
NM_018444chr82879 53 ------
NM_018452chr6_random43663 2533 355 108 21210 461 --12629
NM_018464chr101353 ------
NM_018471chr21465 ------
NM_018490chr1111228 --11505 --
NM_018566chr124945 620 --13850 --
NM_018667chr1682256 2121 2075 2006 1105 766 442 194 ----12350
NM_018682chr7----1241 --
NM_018717chr462628 2236 683 606 564 172 2955 480 1223 --
NM_018834chr5------1783
NM_018898chr53827 560 361 --2748 245 --
NM_018899chr53827 560 361 --2748 245 --
NM_018900chr53827 560 361 --2748 245 --
NM_018901chr53827 560 361 --2748 245 --
NM_018902chr53827 560 361 --2748 245 --
NM_018903chr53827 560 361 --2748 245 --
NM_018904chr53827 560 361 --2748 245 --
NM_018905chr53827 560 361 --2748 245 --
NM_018906chr53827 560 361 --2748 245 --
NM_018907chr53827 560 361 --2748 245 --
NM_018908chr53827 560 361 --2748 245 --
NM_018909chr53827 560 361 --2748 245 --
NM_018910chr53827 560 361 --2748 245 --
NM_018911chr53827 560 361 --2748 245 --
NM_018945chr643502 3266 955 254 11284 --12833
NM_018972chr842324 1941 902 49 ------
NM_018976chr1252652 2006 852 806 112 ------
NM_018977chrX4402 242 87 48 1797 1142 --
NM_018999chr1074914 3772 3689 3019 1350 1036 113 1596 --1276
NM_019000chr521235 620 ------
NM_019001chr343894 3228 1899 557 14211 13432 --
NM_019003chrX153 ------
NM_019022chr1822707 2354 12234 1991 --
NM_019072chr544172 4013 3910 3211 ------
NM_019084chr1032502 298 31 ------
NM_019087chr541483 1423 1305 127 ------
NM_019116chr1673289 2903 2863 2592 2351 1381 924 12886 1985 --
NM_019594chr961633 1322 1274 1172 616 53 1147 2595 67 --
NM_019610chr132058 2037 1628 11774 --11757
NM_019613chr175449 424 374 322 47 ------
NM_019860chr1021225 1183 ----1278
NM_019891chr111246 ------
NM_020116chr421811 1346 ------
NM_020119chr783769 3020 2997 2805 1555 1091 881 71 23368 2609 ----
NM_020122chr275892 5646 5264 5119 5042 4846 1483 1970 24346 4074 --
NM_020133chr6106235 6123 6076 5850 5717 5594 5204 2316 1658 538 16152 11130 25674 597
NM_020159chr421461 512 ------
NM_020240chr5----32566 1978 942 --
NM_020245chr664782 3103 1529 1266 693 547 34760 4750 1718 25128 136 --
NM_020310chr1772609 1843 747 438 398 123 93 31127 539 100 11899 --
NM_020336chr2062959 2802 1185 1107 988 638 1680 12968 --
NM_020337chr41258 1800 ----
NM_020342chr21503 ------
NM_020386chr3----1119 --
NM_020390chr321691 277 --150 --
NM_020416chr442397 1687 843 590 1448 ----
NM_020429chr733089 2667 2266 2106 45 12230 2801 522
NM_020438chr961099 1003 473 396 102 33 --1500 --
NM_020440chr163253 2930 2202 2123 487 167 --23184 2974 --
NM_020456chr1352156 2015 1954 684 372 ------
NM_020457chr162253 35 1641 --161
NM_020532chr23754 301 113 ------
NM_020644chr112637 42 ------
NM_020647chr8----1102 --
NM_020673chr2097592 6285 5384 2867 2502 1128 607 376 22 11279 26625 6440 --
NM_020689chr202123 80 --11284 11378
NM_020693chr111487 ------
NM_020704chr722175 2111 ------
NM_020718chr16125939 5401 5350 5073 4169 4033 1767 1535 1500 1119 779 257 ------
NM_020724chr442003 1745 1728 255 198 12591 --
NM_020728chr732129 1256 973 --23027 836 --
NM_020734chr1233050 2625 1237 ------
NM_020739chr1532930 1497 927 13001 --11027
NM_020740chr171102 --1156 --
NM_020749chr822047 23 ------
NM_020768chr542561 2202 595 466 ------
NM_020771chr611112 ------
NM_020772chr1786594 2536 2440 2025 1517 992 920 326 15342 ----
NM_020778chr15134686 4325 4177 3673 3555 1957 1928 1383 1354 808 464 375 140 --24211 3216 2405 40
NM_020783chr18------1146
NM_020795chr1731864 1490 798 21309 500 ----
NM_020796chr582273 1841 1030 612 535 433 259 37 198 ----
NM_020805chr1851532 494 233 218 191 1338 ----
NM_020806chr141288 ------
NM_020839chr311011 21463 279 1288 1242
NM_020850chr1663070 2574 2188 2073 1202 634 ----12870
NM_020854chr18----1446 --
NM_020858chr1522254 347 11823 ----
NM_020866chr13----1938 --
NM_020872chr341260 1108 657 232 ------
NM_020873chr31725 ------
NM_020897chr14528 351 126 61 --1345 11172
NM_020899chr1712154 42454 949 855 480 --1811
NM_020918chr1063273 3241 937 247 198 101 ------
NM_020921chr1432994 479 150 --13036 1835
NM_020922chrX1192 --11320 --
NM_020939chr6171 ----21351 1282
NM_020947chr1631922 1628 337 1597 11489 11994
NM_020948chr153506 3010 1213 188 163 11449 ----
NM_020964chr1874107 4082 3690 3158 3020 744 378 11505 44354 4048 3272 3139 --
NM_020975chr1021379 199 12014 1125 --
NM_020977chr412002 193 1498 --
NM_020987chr1011200 ------
NM_021020chr8143374 3346 3191 2823 2605 2580 2555 2281 2220 1317 781 211 120 86 23386 1243 13237 --
NM_021033chr1333324 2202 1070 12606 ----
NM_021064chr631503 377 186 ------
NM_021069chr41188 21641 1551 --11618
NM_021079chr1773207 2798 2192 1035 677 607 454 1419 21148 724 --
NM_021090chr2284977 4284 4256 942 819 666 287 52 --171 --
NM_021110chr81746 ------
NM_021135chr683331 2526 2139 1146 1021 667 371 56 --11035 --
NM_021144chr92513 98 ------
NM_021148chr722301 1650 ------
NM_021155chr1972997 2797 2652 1830 724 713 411 12887 ----
NM_021161chr14191 ----1586
NM_021176chr231611 1335 121 41390 1163 81 37 ----
NM_021183chrX2928 36 ------
NM_021190chr111282 --1917 --
NM_021202chr2042983 2835 2770 721 --1867 11010
NM_021215chr2051608 1543 824 231 137 --11811 --
NM_021216chr1921087 996 21217 281 11077 --
NM_021238chr1242041 1940 795 232 11758 ----
NM_021242chrX1909 --1107 --
NM_021639chr11893 ------
NM_021643chr21505 --21586 321 --
NM_021705chr61224 --11373 --
NM_021728chr143995 941 108 ------
NM_021813chr684937 4586 4201 2305 1239 1118 1047 827 --11605 --
NM_021949chrX32494 2277 2161 22882 766 1812 --
NM_021956chr641469 1003 592 169 1456 ----
NM_021961chr1167442 6676 6496 5129 2634 1319 11981 ----
NM_021962chr1762150 1994 687 627 111 67 ------
NM_021964chr311318 --22354 2296 --
NM_022048chr1555007 4375 1109 793 27 25237 5225 24478 469 --
NM_022063chr1021789 31 11672 ----
NM_022072chr31216 ------
NM_022130chr511071 11190 ----
NM_022140chr531534 722 96 --11565 --
NM_022154chr431279 321 312 11248 ----
NM_022166chr1695615 5571 5258 4422 2294 2197 1108 870 322 1543 25445 2507 --
NM_022340chr393598 3589 3180 3143 2813 2333 826 606 71 13333 13316 1832
NM_022351chr843462 2555 2494 381 ------
NM_022362chr101329 ------
NM_022458chr772663 2509 2343 2322 261 222 116 ------
NM_022459chr1376211 4202 2364 2152 1911 1368 450 11171 26230 471 --
NM_022462chr1973115 2997 2530 1460 1394 762 562 22424 795 ----
NM_022465chr1252678 2644 2631 2151 197 12400 ----
NM_022469chr162045 857 655 503 446 247 --1928 --
NM_022473chr1564085 1329 927 787 437 301 169 21056 734 31661 1359 1335
NM_022475chr4----1147 --
NM_022484chr711091 ----1375
NM_022494chr102464 312 ------
NM_022648chr2104418 4360 4327 3835 3751 1306 1110 817 679 528 --24121 3021 --
NM_022728chr72598 62 ------
NM_022748chr742346 1141 543 114 --21931 917 12092
NM_022749chr851368 894 276 269 150 1404 11301 11096
NM_022751chr181138 ------
NM_022758chr662719 2663 2426 2024 1982 102 1156 --22615 89
NM_022776chr31325 --1107 --
NM_022781chr942632 2175 1318 1213 --12481 --
NM_022834chr16949 676 322 289 121 90 --1101 --
NM_022843chr1321139 280 ------
NM_022898chr1454220 4170 1131 881 797 --13955 13022
NM_022965chr421329 93 ------
NM_022970chr1031388 1123 1003 ------
NM_023000chr1421291 333 ------
NM_023001chr1421291 333 ------
NM_023105chr831751 1723 27 --21776 219 --
NM_023106chr831751 1723 27 --21776 219 --
NM_023110chr831751 1723 27 --21776 219 --
NM_023111chr831751 1723 27 --21776 219 --
NM_024007chr542658 2091 127 97 --1987 --
NM_024034chr201168 ------
NM_024052chr1752531 2524 2007 691 395 --1118 --
NM_024076chr1962331 2210 1699 911 407 162 21946 932 42187 2130 1519 271 --
NM_024103chr1981655 718 593 547 524 245 172 114 ------
NM_024294chr662719 2663 2426 2024 1982 102 1156 --22615 89
NM_024511chr432919 2208 762 --22966 667 --
NM_024567chr8----157 --
NM_024583chr21399 --1107 --
NM_024586chr11148 ------
NM_024639chr652031 1836 745 399 81 12867 22097 941 --
NM_024665chr334708 4245 370 ------
NM_024676chr141067 430 264 162 --21176 1131 --
NM_024713chr1511394 --11121 --
NM_024721chr832599 573 192 ----1913
NM_024761chr934465 3503 197 ----1215
NM_024770chr275297 4810 4653 1813 1122 695 393 --22507 700 --
NM_024834chr1061967 1462 1456 1236 614 328 ------
NM_024835chr171350 ------
NM_024881chr19103656 3627 3557 1236 699 513 481 455 185 23 --13320 22892 407
NM_024953chr1232413 841 458 ----1740
NM_024989chr277363 6987 3041 1730 1293 1005 70 26712 3062 --12500
NM_024991chr1053164 1108 1019 699 687 11172 ----
NM_025054chr811437 --13163 --
NM_025073chr144312 3765 3561 473 ------
NM_025074chr492991 2878 2857 1077 1031 708 316 117 83 --1353 --
NM_025076chr22474 184 ------
NM_025113chr1351379 1326 1122 551 166 --1460 --
NM_025134chr1611031 1394 ----
NM_025137chr152318 41 ------
NM_025154chr721316 393 --11057 --
NM_025179chr154581 3536 1623 1051 92 31832 1808 966 14103 13613
NM_025222chr341944 1188 272 209 --1643 --
NM_030623chr241636 538 496 138 ------
NM_030627chr553460 3225 2653 1013 29 ------
NM_030629chr1611542 ------
NM_030647chr756060 5527 5134 4288 4249 --11013 --
NM_030648chr434486 1499 1057 13824 14388 14211
NM_030650chr233454 2986 993 ----14066
NM_030660chr14------1316
NM_030664chr1042321 2238 1911 923 22315 110 ----
NM_030674chr1234825 3757 1782 24608 3717 24216 1675 --
NM_030751chr1041903 1842 278 221 ------
NM_030751chr1041903 1842 278 221 ------
NM_030761chr172162 1776 1701 726 713 532 159 12376 1311 12029
NM_030773chr2011306 21845 306 1579 --
NM_030780chr821573 1318 1474 ----
NM_030802chr17--1898 1881 --
NM_030806chr188065 7329 5807 3220 2572 2263 1650 689 --18136 --
NM_030881chr221160 --132 --
NM_030915chr21488 12065 --22098 140
NM_030918chr135042 4174 1867 45245 4768 4588 184 24343 1014 --
NM_030953chr551589 1532 1162 380 302 1291 1557 --
NM_030958chr81517 ------
NM_030979chr13----1290 --
NM_031243chr722177 162 ------
NM_031268chr16124299 4073 4038 3442 2014 1688 1489 1472 1059 689 639 323 54100 1574 1338 312 84 24739 1015 11042
NM_031309chr861837 1709 908 836 750 571 11612 31463 841 465 --
NM_031314chr1431970 1748 80 ------
NM_031411chr53827 560 361 --2748 245 --
NM_031417chr1942676 2248 1926 698 154 11858 --
NM_031419chr321549 192 174 ----
NM_031424chr20------1507
NM_031427chr1435361 4012 1211 24727 123 --34190 3940 299
NM_031461chr821625 1453 ----1782
NM_031468chr7157404 6974 6812 6426 6353 6229 6128 5415 5327 2209 1816 1646 114 90 83 11893 45590 2584 2127 64 28044 6286
NM_031483chr2032486 2480 348 ------
NM_031844chr113146 ------
NM_031849chr53827 560 361 --2748 245 --
NM_031857chr53827 560 361 --2748 245 --
NM_031860chr53827 560 361 --2748 245 --
NM_031990chr191249 ----196
NM_031991chr191249 ----196
NM_032012chr974966 3297 1933 1921 1367 1192 1170 --14431 --
NM_032018chr11593 ------
NM_032041chr862244 2160 1033 697 545 220 --11979 21794 764
NM_032105chr1137938 7673 7459 5454 5418 4940 2898 2865 2330 1870 1683 1237 1001 22833 2239 16094 15542
NM_032124chr182358 89 1825 ----
NM_032128chr41731 ------
NM_032144chr211117 ------
NM_032160chr1844334 4306 1047 912 ------
NM_032181chr2----1320 --
NM_032189chr13114087 3592 3582 1823 1667 1622 1302 768 228 78 58 --13809 14106
NM_032195chr21----141 --
NM_032217chr431225 465 27 ------
NM_032236chr13840 195 174 ------
NM_032281chr19123136 3118 2846 2805 1136 1111 1086 842 807 532 405 391 22907 959 ----
NM_032316chr362432 2378 2274 2047 739 48 11957 1911 --
NM_032343chr31184 ------
NM_032352chr14------11264
NM_032373chr1034767 1793 601 --13751 --
NM_032440chr101115 ------
NM_032446chr541480 858 743 567 ------
NM_032457chr423656 1534 23385 143 --1863
NM_032466chr8------1103
NM_032468chr8------1103
NM_032547chr41130 ------
NM_032564chr114986 848 784 728 ------
NM_032595chr1741418 321 198 175 31555 1305 1261 --1309
NM_032663chr1241530 1406 1340 132 --31806 1607 392 --
NM_032682chr332544 1331 652 --1326 1398
NM_032777chr831572 543 24 ------
NM_032784chr6125 ------
NM_032804chr103776 762 746 ----12237
NM_032837chr1771809 1453 707 570 559 309 48 ------
NM_032842chr721305 119 --21403 423 --
NM_032870chr61172 ------
NM_032932chr17106422 6088 5913 5611 5579 4800 2464 2373 2329 1821 36452 6050 5281 75136 4699 2366 2156 981 72 53 13963
NM_032968chrX42700 2580 666 143 13787 ----
NM_032969chrX42700 2580 666 143 13787 ----
NM_032973chrY42695 2579 666 143 13779 ----
NM_033020chr164434 3622 1639 1579 1152 510 1907 --11007
NM_033083chr343355 3204 1341 838 2616 332 1223 --
NM_033105chr8----2309 168 --
NM_033132chr132568 103 --11929 --
NM_033133chr1753540 3487 2495 2480 1451 --23329 1020 --
NM_033138chr71861 ------
NM_033139chr71861 ------
NM_033140chr71861 ------
NM_033143chr443852 3830 719 312 13231 14369 --
NM_033157chr71861 ------
NM_033181chr623011 506 ------
NM_033207chr1032261 364 192 --127 11999
NM_033221chr982859 2825 2812 2006 1767 896 650 30 ------
NM_033224chr787918 7002 5597 5482 5397 1576 971 24 42710 2384 1977 370 1871 --
NM_033259chr34935 768 700 626 --3727 367 202 --
NM_033285chr874356 4154 3802 3737 3101 726 688 ------
NM_033290chrX43064 1168 878 610 2555 50 --11488
NM_033309chr164448 390 363 35 21148 910 --1775
NM_033331chr913262 --13312 --
NM_033360chr1254200 3582 3226 1126 983 --2844 240 --
NM_033387chr992502 2181 1731 909 683 488 409 213 65 ------
NM_033389chr17104855 3710 3401 3126 1942 1907 1866 1764 440 366 ------
NM_033393chr452772 2423 2295 817 767 1347 12069 --
NM_033402chr8--134 141 --
NM_033406chr11151 1269 ----
NM_033425chr111525 1913 --1204
NM_033480chr662798 2738 2572 2171 344 332 --11104 --
NM_033481chr662798 2738 2572 2171 344 332 --11104 --
NM_033503chr1583071 2870 2594 1483 1315 997 885 187 12893 23346 627 13419
NM_033505chr256608 4321 1652 823 603 24540 237 14674 --
NM_033515chr6121 ------
NM_033516chr91376 ------
NM_033542chr2051690 1287 548 88 63 ----1687
NM_033631chr152762 1312 643 532 205 --1913 --
NM_033632chr4136 1158 ----
NM_052879chr1223061 2534 --11069 --
NM_052898chr831645 1558 1221 ------
NM_052906chr2284863 4603 3749 3206 1327 1196 959 469 --2127 89 23195 933
NM_052907chr1283950 3534 3462 3055 2973 1490 1053 367 13440 ----
NM_052910chr1341641 1533 1388 60 --1202 12030
NM_052928chr1741303 639 519 421 1449 --1427
NM_052937chr852428 2415 2209 959 443 22536 2505 1933 --
NM_052954chr2131784 1486 907 ------
NM_052971chr51133 ------
NM_053016chr947325 6552 2984 2108 25787 4884 35860 5031 59 --
NM_053023chr113699 229 37 --2317 298 --
NM_053025chr351238 1131 1112 717 516 ------
NM_053026chr351238 1131 1112 717 516 ------
NM_053027chr351238 1131 1112 717 516 ------
NM_053028chr351238 1131 1112 717 516 ------
NM_053031chr351238 1131 1112 717 516 ------
NM_053032chr351238 1131 1112 717 516 ------
NM_053042chr42348 89 --12629 --
NM_053043chr7135586 4983 4776 4347 4116 2214 2103 1507 1413 817 595 290 190 --35041 2311 2264 --
NM_054111chr6----1712 1144
NM_058172chr41627 1519 --1272
NM_058241chr212088 ------
NM_058241chr212088 ------
NM_078487chr923127 1078 --1115 11084
NM_080538chr361284 433 402 356 349 312 --11186 --
NM_080539chr361284 433 402 356 349 312 --11186 --
NM_080541chr361284 433 402 356 349 312 --11186 --
NM_080617chr202865 216 ------
NM_080626chr121362 ------
NM_080645chr642145 1995 1546 1347 ------
NM_080743chr61985 --1410 --
NM_080792chr2062248 1766 1588 737 718 112 11837 ----
NM_080867chr1425004 4822 ------
NM_080872chr853066 2499 1399 1099 897 22697 615 --12729
NM_100264chr10188 ------
NM_100486chr10188 ------
NM_130385chr1142892 2700 449 76 22160 46 1885 --
NM_130439chr102856 358 ----1866
NM_130439chr102856 358 ----1866
NM_130808chr31431 ------
NM_130838chr151202 ----1439
NM_130839chr151202 ----1439
NM_133170chr20157307 7262 6851 6818 6249 5271 5228 4923 2980 2622 2533 2525 2245 1583 1244 23075 298 25988 2753 17172
NM_133264chr171191 --11130 --
NM_133265chrX33528 1369 24 1790 22298 835 --
NM_133334chr476333 6242 5928 5748 4723 4445 872 34758 2101 640 14869 --
NM_133477chr452452 2275 1250 742 715 --12227 --
NM_134265chr1711179 ------
NM_138286chr1932680 552 371 ------
NM_138317chr14191 ----1586
NM_138318chr14191 ----1586
NM_138338chr2293336 3311 3146 3098 2646 2482 1287 961 915 13211 43106 2783 2688 1362 --
NM_138340chr181105 ------
NM_138444chr1363834 3308 1363 1171 1049 350 ------
NM_138457chr6122902 2584 2495 2131 1367 674 636 360 253 241 116 57 --33175 882 620 --
NM_138468chr265962 5194 3869 1410 1023 793 35170 3957 502 ----
NM_138473chr1244010 3560 1931 900 23650 1915 13497 14034
NM_138559chr241270 990 939 202 ------
NM_138576chr1454220 4170 1131 881 797 --13955 13022
NM_138621chr284162 3127 1427 1227 1127 1010 965 34 43912 3432 1320 713 --12995
NM_138713chr1667784 7725 6410 5571 599 567 16807 --16785
NM_138714chr1667784 7725 6410 5571 599 567 16807 --16785
NM_138771chr71261 ------
NM_138819chrX1111 ------
NM_138959chr1106168 5662 5373 5035 4820 2528 1400 1320 372 120 ------
NM_138981chr45828 577 224 200 68 ------
NM_139168chr51598 ------
NM_139169chr10156 ------
NM_139207chr1221594 100 ------
NM_144571chr425536 4457 ------
NM_144578chr1454530 4187 4142 1755 1059 1690 11423 --
NM_144628chr2093024 2807 2791 2682 2387 2093 1918 1100 653 --12618 --
NM_144633chr321115 243 ------
NM_144726chr521215 1153 1427 ----
NM_144767chr1584625 3333 1541 1253 777 526 398 193 24265 1023 23545 1118 --
NM_144775chr1784891 4454 4343 3732 1762 1337 809 481 23470 3294 1948 --
NM_144949chr221047 633 ------
NM_144963chr8----12170 --
NM_145013chr1162461 2317 1865 782 731 54 12548 22584 2322 --
NM_145021chr103820 765 340 ----1795
NM_145025chr621019 256 21089 200 ----
NM_145049chr51956 ------
NM_145055chr1823090 2936 ------
NM_145113chr1421398 578 --11306 2290 129
NM_145117chr1152391 2313 467 458 162 22753 2054 1187 --
NM_145203chr13133 ------
NM_145206chr1072739 2412 2367 2357 1055 491 95 13109 --12543
NM_145263chr43865 401 88 --11527 --
NM_145285chr103751 547 532 ------
NM_145307chr1034554 3968 3790 ------
NM_145686chr252342 1270 1096 732 458 --23327 122 --
NM_145687chr252342 1270 1096 732 458 --23327 122 --
NM_145690chr8--11615 --151
NM_145695chr74707 605 505 156 ------
NM_145799chrX62926 2782 2210 702 243 59 12382 ----
NM_145912chr22104467 3961 1683 1593 1547 1430 1244 869 649 611 24644 3330 33580 3248 239 --
NM_147150chr942724 1214 317 185 ----1128
NM_147223chr231762 144 135 --22075 1628 --
NM_147233chr211579 --21892 1445 --
NM_148904chr11148 ------
NM_148905chr11148 ------
NM_148906chr11148 ------
NM_148907chr11148 ------
NM_148908chr11148 ------
NM_148909chr11148 ------
NM_152247chr223710 331 316 1802 1134 1104
NM_152253chr22114096 3819 3786 3717 3702 3266 3071 2834 2824 1661 799 54188 3333 1196 402 85 23520 3356 13490
NM_152263chr145829 5455 5344 4773 15895 14832 --
NM_152280chr162961 2930 1050 1021 668 452 ----1166
NM_152308chr162922 233 ------
NM_152330chr1432201 1888 1036 12047 ----
NM_152352chr1852533 2456 1130 921 260 ------
NM_152380chr141271 371 234 63 ------
NM_152388chr211534 --14008 --
NM_152400chr422102 667 ------
NM_152414chr821506 290 11619 ----
NM_152424chrX53833 3764 3350 943 593 23170 1148 11873 --
NM_152455chr1542622 2164 1764 632 ----12209
NM_152462chr17----1259 1759
NM_152470chr1883666 3571 3224 3144 2819 1561 1113 899 --22960 1195 --
NM_152515chr21105 ------
NM_152529chr213610 12815 11249 --
NM_152545chr4----1547 147
NM_152624chr5126731 6676 6313 5859 5712 5502 5370 5089 1804 1758 802 724 ------
NM_152629chr963941 3513 2491 1348 980 77 12540 ----
NM_152641chr1231855 358 266 ------
NM_152699chr353448 3339 3077 2617 44 1101 33654 3011 2678 --
NM_152707chr101908 ------
NM_152724chr101796 11795 ----
NM_152733chr6106447 6300 5960 5813 3929 2237 2177 1515 319 139 26268 5002 ----
NM_152737chr611383 ------
NM_152754chr733177 1070 825 ------
NM_152756chr534027 1667 866 13179 11447 --
NM_152758chr842027 1068 795 46 ------
NM_152787chrX33581 3381 2511 11276 1405 --
NM_152857chr62288 99 ------
NM_152858chr62288 99 ------
NM_152924chr1556374 4616 1944 1588 416 2497 443 26516 4605 15262
NM_153018chr1793214 3193 2400 2028 1011 926 712 387 309 ------
NM_153020chr631712 1652 432 ------
NM_153029chr1693860 3482 3251 3088 2967 2596 1396 776 769 23743 3339 13170 --
NM_153035chr173143 3045 2917 2814 775 168 137 ----13051
NM_153050chr2284977 4284 4256 942 819 666 287 52 --171 --
NM_153051chr2284977 4284 4256 942 819 666 287 52 --171 --
NM_153207chr1242940 1276 1103 181 13093 ----
NM_153235chr631763 816 157 ------
NM_153261chr1631103 253 233 ------
NM_153273chr332162 85 44 1923 22473 761 1184
NM_153332chr821253 56 ------
NM_153347chr1182167 2037 1831 483 462 238 222 51 12409 12491 --
NM_153365chr422352 1899 22207 176 11102 --
NM_153367chr1063116 940 723 570 406 234 43539 1535 398 201 1114 --
NM_153487chr694815 4602 3800 3733 3450 1790 1748 484 459 --13713 --
NM_153607chr51328 ------
NM_153616chr1522254 347 11823 ----
NM_153617chr1522254 347 11823 ----
NM_153618chr1522254 347 11823 ----
NM_153619chr1523492 144 23061 1217 --1378
NM_153620chr721732 549 ------
NM_153757chr42497 305 ------
NM_153810chr1033422 3214 968 11317 --1445
NM_153828chr23754 301 113 ------
NM_153836chr241831 696 535 251 --1191 --
NM_170665chr12104441 4385 4239 3398 3027 2797 1530 1425 347 319 11616 13164 11642
NM_170672chr221587 350 1285 ----
NM_170696chr153457 391 260 1563 11220 21376 1188
NM_170697chr153457 391 260 1563 11220 21376 1188
NM_170709chr831685 1632 595 12393 --2654 577
NM_170724chr631016 793 322 1194 ----
NM_171825chr593008 2732 2469 2330 2022 2003 1992 450 416 --12628 --
NM_172058chr83546 491 52 11456 21784 61 --
NM_172059chr83546 491 52 11456 21784 61 --
NM_172060chr83546 491 52 11456 21784 61 --
NM_172070chr231819 893 817 11686 ----
NM_172071chr177380 7063 6712 5744 4882 2387 1682 22422 471 ----
NM_172169chr1031436 1370 564 --21951 1576 --
NM_172170chr1031436 1370 564 --21951 1576 --
NM_172171chr1031436 1370 564 --21951 1576 --
NM_172173chr1031436 1370 564 --21951 1576 --
NM_172337chr143995 941 108 ------
NM_173214chr1667784 7725 6410 5571 599 567 16807 --16785
NM_173454chr151488 ------
NM_173469chr1521518 64 --11463 --
NM_173476chr1671838 1776 877 833 560 409 222 --32072 1541 380 1420
NM_173477chr1751951 1910 1407 517 273 3769 421 24 ----
NM_173491chr551168 261 186 172 133 11003 11416 --
NM_173495chrX42068 1867 1651 353 ------
NM_173496chr1072773 2302 2079 1950 674 510 474 ------
NM_173519chr821576 87 ------
NM_173531chr1932590 775 595 ------
NM_173595chr1275199 5175 5058 4803 4551 3678 208 14498 1389 --
NM_173602chr1252722 2698 2506 207 73 11286 22815 2406 --
NM_173609chr15151 ------
NM_173642chr1128649 7872 6055 5818 3436 2705 2458 1836 1421 1135 679 382 --11496 18521
NM_173647chr22953 879 1244 1753 --
NM_173658chr32825 123 ------
NM_173694chrX12417 12123 12103 --
NM_173797chr511209 ----11258
NM_173808chr123235 327 ----11248
NM_173814chr15----185 --
NM_173822chr221950 547 ------
NM_173851chr843876 1549 1521 830 138 --1995
NM_174911chr853278 3093 2445 1426 1417 12498 --1585
NM_175566chr11----1373 --
NM_175624chr1257067 4863 2828 2583 961 16601 16181 --
NM_175625chr1257067 4863 2828 2583 961 16601 16181 --
NM_175733chr1142081 2056 1812 566 --31846 1534 450 --
NM_175768chr641673 1207 373 120 1660 ----
NM_175847chr191249 ----196
NM_175852chr172980 2274 2255 501 462 370 51 32664 2264 665 ----
NM_175921chr513165 ----22972 2875
NM_176824chr4----2986 352 --
NM_177414chr141594 689 538 337 --21300 628 --
NM_177553chr112879 334 ------
NM_177559chr20----11121 --
NM_177560chr20----11121 --
NM_177996chr2052768 867 795 439 279 1385 12389 --
NM_177999chr973563 2981 2769 2544 2340 1266 377 --23583 261 12995
NM_178011chr1041258 893 706 623 1967 ----
NM_178033chr13466 208 71 ------
NM_178037chr1243452 2630 2558 304 --1960 1313
NM_178038chr1243452 2630 2558 304 --1960 1313
NM_178123chr22415 280 ------
NM_178151chrX55130 4800 1550 1514 663 23052 2146 57616 5850 4849 1973 413 --
NM_178152chrX55130 4800 1550 1514 663 23052 2146 57616 5850 4849 1973 413 --
NM_178153chrX55130 4800 1550 1514 663 23052 2146 57616 5850 4849 1973 413 --
NM_178229chr1186 --1708 --
NM_178314chr124741 637 273 242 ------
NM_178454chr11803 --1529 --
NM_178539chr122490 211 ------
NM_178554chr382463 1322 1229 932 889 865 528 45 12955 --1981
NM_178557chr451692 1626 1460 1422 517 --1361 --
NM_178578chr2031658 194 88 --2771 124 --
NM_178585chr41181 --139 --
NM_178586chr1422410 798 1261 ----
NM_178815chr1022257 1791 --1429 --
NM_181054chr14----11020 --
NM_181349chr733089 2667 2266 2106 45 12230 2801 522
NM_181351chr1162854 2154 2055 2034 660 591 42330 2229 1011 402 ----
NM_181356chr62927 697 ----1254
NM_181358chr134064 2985 496 ------
NM_181443chr2032485 660 488 --22871 2035 --
NM_181457chr21259 1885 1277 --
NM_181458chr21392 11018 1410 --
NM_181459chr21158 1784 1176 --
NM_181460chr21205 1831 1223 --
NM_181481chr1896955 6374 5841 4874 4358 1685 1638 671 348 24439 1437 ----
NM_181482chr1896955 6374 5841 4874 4358 1685 1638 671 348 24439 1437 ----
NM_181483chr1896955 6374 5841 4874 4358 1685 1638 671 348 24439 1437 ----
NM_181491chr9103114 2496 2264 2138 1985 1121 1061 818 601 55 --23010 285 --
NM_181521chr16107110 6543 5522 5477 5345 4396 2143 1092 983 750 35022 2388 1753 ----
NM_181527chr20126 ------
NM_181528chr20181 ------
NM_181552chr77262 208 189 147 128 79 70 ----1961
NM_181672chrX31734 148 109 ------
NM_181673chrX31734 148 109 ------
NM_181698chr10166 --1536 --
NM_181705chr564780 4027 3652 1890 1368 79 11920 --21896 1495
NM_181784chr242012 1767 264 172 --12158 --
NM_181787chr832721 1574 926 ----22727 82
NM_181809chr163396 3116 2635 1162 1143 299 13139 23367 1611 --
NM_181836chr541652 683 669 560 --12572 --
NM_181869chr1252729 1041 954 459 76 --1647 --
NM_181876chr442397 1687 843 590 1448 ----
NM_182314chrX1177 --1316 1480
NM_182485chr433026 687 676 12621 11005 --
NM_182527chr2252119 1998 1554 1400 587 11385 31938 1495 72 --
NM_182646chr433026 687 676 12621 11005 --
NM_182666chr31176 ------
NM_182679chr11529 --1576 --
NM_182688chr2172127 2077 1661 1456 1428 519 353 --22147 106 --
NM_182697chr721162 657 ----159
NM_182703chr151534 ------
NM_182705chr1773095 3005 1029 1023 802 681 27 ------
NM_182765chr102840 356 1699 ----
NM_182767chr1231976 717 205 11381 ----
NM_182796chr51299 --1289 --
NM_182797chr2041632 1241 1129 711 ------
NM_182798chr52930 64 --11276 --
NM_182799chr52930 64 --11276 --
NM_182801chr52930 64 --11276 --
NM_182898chr751691 1373 1318 395 88 15640 ----
NM_182899chr751691 1373 1318 395 88 15640 ----
NM_182931chr7----1241 --
NM_182948chr141965 614 594 474 1223 ----
NM_182964chr1152391 2313 467 458 162 22753 2054 1187 --
NM_182970chr2074219 3867 3468 3273 744 687 69 1969 11149 1294
NM_182972chr131779 439 105 --11844 --
NM_182975chr12793 179 ------
NM_183004chr1473895 3469 3060 2809 2667 560 199 ------
NM_183043chr13----1343 --
NM_183044chr13----1343 --
NM_183078chr653334 2871 2752 898 148 --1543 --
NM_183227chr63543 473 127 --194 --
NM_183234chr1541506 661 583 128 ------
NM_183235chr1541506 661 583 128 ------
NM_183236chr1541506 661 583 128 ------
NM_183377chr173296 148 38 ----1136
NM_183380chr61120 ------
NM_183381chr31939 1756 ----
NM_183383chr31939 1756 ----
NM_183384chr31939 1756 ----
NM_183397chr2043981 1761 318 189 33560 3455 1709 44954 4123 1271 275 --
NM_183419chr81122 ------
NM_183422chr131259 ------
NM_184234chr20------1305
NM_194071chr784976 3466 1974 1007 588 561 386 279 13508 15200 15282
NM_194247chr244044 3190 3072 1287 ------
NM_194278chr1443647 3084 1459 526 12965 1422 13341
NM_194286chr1295385 4247 2424 1916 1770 940 534 513 218 15770 1721 --
NM_194291chr812837 ------
NM_194314chr122021 1082 ------
NM_194328chr942632 2175 1318 1213 --12481 --
NM_194329chr942632 2175 1318 1213 --12481 --
NM_194330chr942632 2175 1318 1213 --12481 --
NM_194332chr942632 2175 1318 1213 --12481 --
NM_194434chr1844452 3697 3600 227 21522 215 ----
NM_197941chr542366 2157 860 829 1848 22602 1035 --
NM_197972chr11180 ------
NM_198053chr17869 688 630 358 167 41 34 1936 1256 --
NM_198056chr382076 2044 1756 1734 1504 649 613 209 11572 ----
NM_198158chr32258 171 1650 ----
NM_198159chr32258 171 1650 ----
NM_198177chr32258 171 1650 ----
NM_198178chr32258 171 1650 ----
NM_198181chr1522542 1179 ------
NM_198217chr1331034 736 258 ------
NM_198218chr1331034 736 258 ------
NM_198219chr1331034 736 258 ------
NM_198240chr12----181 --
NM_198268chr134064 2985 496 ------
NM_198269chr134064 2985 496 ------
NM_198336chr721592 570 ------
NM_198390chr1611542 ------
NM_198400chr1522458 111 --22487 529 --
NM_198446chr1----1235 --
NM_198485chr372472 1933 1753 1661 970 921 183 ------
NM_198490chr343315 3022 2372 463 --42506 1402 1379 22 11293
NM_198560chr353371 887 818 348 105 --53648 3557 1478 632 309 --
NM_198570chr71332 ------
NM_198679chr9122665 2535 2318 2198 2158 2049 2030 1667 1022 508 223 58 1726 2581 197 1360
NM_198721chr4180 ------
NM_198793chr31830 21038 1030 --14023
NM_198859chr3115053 4806 4333 4238 4171 3583 3526 1760 1018 671 224 ----14996
NM_198880chr3152 --1193 --
NM_198889chr431225 465 27 ------
NM_199121chr16949 676 322 289 121 90 --1101 --
NM_199188chr1223061 2534 --11069 --
NM_199189chr5------1783
NM_199190chr1223061 2534 --11069 --
NM_199324chr422796 2579 12833 22864 2784 --
NM_199421chr1425004 4822 ------
NM_199436chr242876 805 327 159 ------
NM_199462chr153660 1741 1729 1471 296 13604 ----
NM_199478chrX1685 ------
NM_201413chr211945 ------
NM_201414chr211945 ------
NM_201432chr1786044 2632 2598 1806 1435 604 196 183 35453 5318 4875 24677 1133 --
NM_201433chr1786044 2632 2598 1806 1435 604 196 183 35453 5318 4875 24677 1133 --
NM_201435chr12173 --1251 --
NM_201535chr141221 ----1111
NM_201536chr141221 ----1111
NM_201537chr141221 ----1111
NM_201538chr141221 ----1111
NM_201539chr141221 ----1111
NM_201540chr141221 ----1111
NM_201541chr141221 ----1111
NM_201559chr653558 3393 1902 1601 1380 1797 137 --
NM_201567chr3----11340 --
NM_203327chr2042963 930 575 128 13618 12853 --
NM_203342chr163476 2514 2403 550 98 91 ------
NM_203343chr163476 2514 2403 550 98 91 ------
NM_203350chr121708 1488 ------
NM_203391chrX----1144 --
NM_203399chr13730 142 136 ------
NM_203401chr13730 142 136 ------
NM_203459chr112146 ------
NM_205842chr2159 ----1562
NM_205860chr143023 819 725 621 11219 12927 --
NM_206594chr132332 1411 112 13170 ----
NM_206595chr132332 1411 112 13170 ----
NM_206854chr643346 1299 1148 900 --12082 --
NM_206855chr664311 2264 2113 1865 680 173 ------
NM_206866chr2122843 2320 ------
NM_206909chr838186 2437 576 37527 6153 2068 --16672
NM_206937chr13----142 --
NM_206943chr2------1183
NM_207119chr1072220 2157 1874 1668 656 370 46 2943 364 1256 --
NM_207121chr20------1507
NM_207303chr1023735 867 13212 192 21528 595
NM_207380chr1573567 3340 3238 2577 2428 704 412 43277 1357 835 302 11098 --
NM_207406chr4105000 4600 4296 3962 2593 2470 2418 1591 567 188 12032 ----
NM_207412chr851464 1373 1200 1152 444 11132 ----
NM_207418chr1_random----1983 --
NM_207520chr23754 301 113 ------
NM_207521chr23754 301 113 ------
NM_207577chr1152710 984 360 290 183 --1195 21977 1023
NM_207645chr1111348 --11296 --
NM_212467chr1551991 1688 1657 977 603 11888 ----
NM_212554chr10----154 --
NM_213589chr222168 1001 13764 ----
NM_213606chr104921 635 362 327 ----11022