TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4529-3p
miRNA Sequence: AUUGGACUGCUGAUGGCCCGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51165 21070 328 11175 1152
NM_000084chrX66910 6369 2600 2191 1722 985 26480 4649 35696 5109 4892 26626 521
NM_000138chr1532561 1809 538 --12209 1178
NM_000167chrX11719 11750 --11219
NM_000321chr1331626 1405 1132 11148 --11170
NM_000332chr636021 1488 1016 25822 5301 11419 15492
NM_000368chr951807 1194 543 384 106 34686 1780 1002 1355 23167 1185
NM_000448chr11--1915 --22782 1123
NM_000555chrX86386 4776 2197 798 541 320 269 79 11032 15768 37463 2489 27
NM_000618chr1262294 2128 2108 1092 482 394 14457 12471 24809 1121
NM_000618chr1262294 2128 2108 1092 482 394 14457 12471 24809 1121
NM_000901chr452459 2441 2196 366 112 1874 --12378
NM_001001974chr1022169 398 ----22236 1691
NM_001002860chr1464157 3109 3031 541 204 81 11340 2902 633 --
NM_001003674chr1866480 5612 5177 4868 1185 1162 --36135 4557 2056 --
NM_001003675chr1866480 5612 5177 4868 1185 1162 --36135 4557 2056 --
NM_001004441chr531684 1286 109 ----1264
NM_001007097chr954891 4805 4546 4250 3280 11883 21552 454 2635 283
NM_001011666chr786502 6488 4370 4143 2136 1107 796 586 26195 543 21425 312 26154 973
NM_001012393chr1144838 3230 1456 937 34953 1765 242 24435 753 44470 3979 3344 1985
NM_001012420chr1542411 2072 917 146 --12442 32798 1029 291
NM_001012423chr1532411 2072 917 --12442 22798 291
NM_001013620chr1287957 7867 6344 3130 2920 2382 1195 961 28462 6578 --36911 3376 831
NM_001014797chr1097991 6349 6092 3051 2885 2573 2011 1939 1656 ----25810 5348
NM_001017923chr1411155 --1100 1411
NM_001018067chr175372 4062 3762 2069 1765 1713 1469 2699 50 --13525
NM_001018068chr175372 4062 3762 2069 1765 1713 1469 2699 50 --13525
NM_001018069chr175372 4062 3762 2069 1765 1713 1469 2699 50 --13525
NM_001018111chr744049 3866 2820 1244 2438 182 33338 822 538 12938
NM_001023567chr15------22190 291
NM_001025077chr1097255 5987 5829 5649 5550 1784 1425 1111 1038 1598 15736 --
NM_001031804chr162456 365 14195 --11357
NM_001034841chr1664953 4468 1469 1243 1191 1173 33468 551 257 42194 1516 312 171 --
NM_001037339chr131694 1537 643 31846 1426 1189 1648 --
NM_001037340chr131694 1537 643 31846 1426 1189 1648 --
NM_001037341chr131694 1537 643 31846 1426 1189 1648 --
NM_001037341chr131694 1537 643 31846 1426 1189 1648 --
NM_001039618chr1134524 2183 826 ----11521
NM_001040284chr1655047 3934 3846 3773 3700 ----1425
NM_001040429chr1353533 2644 1265 784 692 11295 1511 --
NM_001042355chr163837 453 340 --11630 1236
NM_001042403chr121804 2918 715 2722 303 1864
NM_001042412chr163837 453 340 --11630 1236
NM_001042599chr257427 6808 6090 5193 2456 36278 5533 5220 36268 3060 2302 --
NM_001042604chr384500 4293 4207 3646 3394 1533 1105 1056 ----13974
NM_001106chr379559 8930 8311 3779 2928 2115 1027 126 --17882
NM_001122679chr51165 21070 328 11175 1152
NM_001204chr276427 6157 3109 3074 2323 2245 842 11812 46858 6367 6015 2761 --
NM_001329chr1041519 1382 599 418 ----1357
NM_001627chr33252 128 113 126 22352 1994 12094
NM_001650chr1834055 3810 1396 ----1136
NM_001699chr1941567 1333 1241 289 1629 31481 508 274 11162
NM_001987chr1242612 937 907 694 13555 --21033 868
NM_002015chr1342863 1351 828 399 --22420 2072 22752 73
NM_002035chr1843014 2677 879 165 13549 --1355
NM_002214chr745103 4978 4919 1258 --11964 11692
NM_002267chr1311841 ----32016 1922 917
NM_002270chr51299 11422 15495 14103
NM_002310chr565456 4984 4715 2635 1747 416 11434 --1171
NM_002481chr157746 5636 2504 1734 1372 26255 343 16033 25075 1548
NM_002545chr1144838 3230 1456 937 34953 1765 242 24435 753 44470 3979 3344 1985
NM_002577chr374040 3988 3158 3144 2582 1579 585 1207 --13362
NM_002581chr984517 4406 3747 1747 1371 1105 1003 517 --13987 11097
NM_002600chr131694 1537 643 31846 1426 1189 1648 --
NM_002670chr321202 573 3491 458 310 --11325
NM_002737chr1796069 5637 5615 4774 2212 1129 724 601 226 ----26295 144
NM_003034chr1257721 6452 5845 2142 648 1273 11666 27544 293
NM_003043chr344151 2833 1328 452 ----33723 3476 1653
NM_003199chr1811772 34445 3516 1831 --11266
NM_003262chr335049 4504 4131 14243 --1514
NM_003298chr375744 5521 5389 4924 3985 1472 695 11007 --11592
NM_003342chr17------22246 610
NM_003392chr323763 1158 23862 3477 11556 12886
NM_003463chr6----21146 92 12378
NM_003615chr344033 865 433 285 23425 3074 11308 --
NM_003941chr712186 --12192 22150 2040
NM_004028chr1834055 3810 1396 ----1136
NM_004136chr1553240 2141 2132 1251 598 --23197 553 --
NM_004327chr2232108 2024 252 --1265 1326
NM_004338chr1866480 5612 5177 4868 1185 1162 --36135 4557 2056 --
NM_004501chr134149 1613 805 11097 13236 13620
NM_004586chrX74708 4700 4588 3442 814 577 471 --15325 --
NM_004612chr92946 238 11102 --1525
NM_004726chrX75349 4428 4068 3750 2256 1925 1507 ------
NM_004748chr1554069 3962 3737 3509 3447 ----1121
NM_004774chr1732561 1206 455 1663 --11143
NM_004815chr1114934 4310 4118 3838 3784 3567 1924 1623 1086 297 271 1815 13036 13441
NM_004859chr1732938 2242 1083 1401 12301 11110
NM_004904chr786502 6488 4370 4143 2136 1107 796 586 26195 543 21425 312 26154 973
NM_004956chr723653 1685 ----12967
NM_005065chr1421557 540 --24221 3659 15076
NM_005188chr1148207 1585 1528 1508 11603 11761 22193 290
NM_005235chr257427 6808 6090 5193 2456 36278 5533 5220 36268 3060 2302 --
NM_005339chr414032 --23369 2843 11218
NM_005397chr744049 3866 2820 1244 2438 182 33338 822 538 12938
NM_005455chr131787 1606 88 ----195
NM_005578chr334103 1497 1018 24570 985 --24580 3956
NM_005665chr133690 1379 591 11247 --1328
NM_005909chr584331 3995 3454 1095 880 839 548 242 1214 11202 13362
NM_006047chr2053548 2874 649 586 294 1457 --13421
NM_006251chr522110 589 13162 --22183 879
NM_006256chr142338 883 793 287 32432 1958 1692 ----
NM_006544chr1413814 24311 4064 25441 1477 31415 855 592
NM_006599chr1657736 3109 2824 2615 1912 --26544 438 --
NM_006614chr342650 2568 2445 1435 161 --1512
NM_006873chr2--22575 1419 --1895
NM_006947chr421704 385 ----11621
NM_006955chr1032506 953 97 --1586 22551 1326
NM_007011chr1576493 5161 2486 1733 1699 754 259 24262 1040 35458 1119 1046 --
NM_007050chr2088021 7355 6629 6478 6238 2271 2215 641 56963 2657 2603 1268 1146 25177 2610 133
NM_007054chr553935 2736 512 265 162 1209 --1669
NM_007249chr1379197 8468 7835 7669 7248 3707 2133 1793 ----
NM_012082chr81157 ----2811 62
NM_012164chr967277 6407 6119 6049 4742 2302 --17580 1557
NM_012249chr223503 3244 ----1102
NM_012252chr724512 648 23989 484 --2491 230
NM_012287chr364392 1768 1575 1330 607 248 13371 --1732
NM_012307chr183930 912 708 ----2381 127
NM_013352chr64713 287 253 47 ----1854
NM_013374chr352348 2046 1212 525 244 13141 --12606
NM_014011chr242535 2177 1012 529 --1775 1459
NM_014112chr834163 1055 486 1695 12125 13487
NM_014155chr1176918 6175 6065 5868 5701 1904 44 25332 90 ----
NM_014331chr446967 4973 851 80 56799 4955 1949 1095 927 ----
NM_014368chr941406 1337 91 73 ----21952 1508
NM_014423chr523669 1528 1493 44430 1774 1614 1362 --
NM_014828chr1441913 1008 583 52 12436 1783 1639
NM_014877chr1734884 4813 2782 44728 4719 2117 334 15367 --
NM_015035chr2044757 2343 281 274 14935 --1675
NM_015170chr822339 642 12161 --21860 366
NM_015206chr1521538 1037 ----12852
NM_015247chr163837 453 340 --11630 1236
NM_015275chr1252018 1823 1718 441 156 ------
NM_015483chr721107 305 ----1298
NM_015550chr742776 1362 1301 141 11313 --13393
NM_015640chr175372 4062 3762 2069 1765 1713 1469 2699 50 --13525
NM_016009chr134905 3346 1413 11924 --34418 1794 1559
NM_016206chr378731 8014 6557 6369 2668 1981 1498 38242 7483 1899 12557 --
NM_016260chr2107572 5716 5251 5049 2891 1380 1101 804 376 263 12016 11575 15491
NM_016531chr414054 --23649 675 11488
NM_017447chr2153855 3364 3089 2914 730 1997 13741 --
NM_017563chr31454 25764 903 35770 2463 2145 36030 4373 1728
NM_017628chr445177 4903 4774 3753 35326 3872 698 1299 --
NM_017637chr968362 6093 3680 2291 1774 1377 19421 15910 22986 1973
NM_017919chr975541 4335 1958 522 494 423 119 35315 5278 1574 --13893
NM_018128chr175919 585 501 396 107 11121 11213 1190
NM_018155chr343031 2707 2535 1158 23457 541 --12576
NM_018227chr443058 2464 193 83 --12993 12483
NM_018374chr743270 1682 1051 400 13541 --14657
NM_018440chr877481 7189 6975 6017 5767 5362 1089 2792 458 11522 15506
NM_018489chr152365 1714 198 189 97 ----1825
NM_018566chr145033 4562 479 372 21872 593 --13922
NM_018638chr1234870 3852 1080 15397 11500 15574
NM_019001chr384500 4293 4207 3646 3394 1533 1105 1056 ----13974
NM_019084chr1032566 2474 236 2256 81 11956 --
NM_020432chr711743 11611 --12245
NM_020673chr20116835 6336 6059 5132 4891 4853 2873 2423 2257 1452 892 ----17166
NM_020715chr1441404 413 403 91 --12139 11934
NM_020717chrX33890 3877 629 14217 44188 3980 3801 1120 13413
NM_020727chr21--23734 1241 23786 1345 2802 422
NM_020739chr1554069 3962 3737 3509 3447 ----1121
NM_020772chr1798223 7758 6856 3061 2243 1653 1580 1358 1051 12587 27365 1833 --
NM_020774chr1814516 15154 25306 4709 16062
NM_020940chr1062750 2112 1932 1174 1112 740 --12149 --
NM_020948chr143451 3087 2573 271 --12593 1410
NM_020964chr18124650 4401 3946 3748 3710 3466 3305 3234 3121 3107 1074 725 33740 3226 1283 ----
NM_021061chr853505 1811 1532 1331 734 --24339 1339 23401 3316
NM_021574chr2232108 2024 252 --1265 1326
NM_021622chr1022169 398 ----22236 1691
NM_021629chr31553 14162 24939 3264 11351
NM_021813chr664379 3769 2142 1128 368 25 14500 1633 --
NM_021913chr1941567 1333 1241 289 1629 31481 508 274 11162
NM_021951chr91816 ----2889 144
NM_022049chr121892 1346 ----11432
NM_022351chr843890 3424 749 194 23469 2739 --12462
NM_022802chr1041519 1382 599 418 ----1357
NM_024594chr531846 1494 740 21612 1184 --11903
NM_024947chr359614 8146 7597 1949 1628 1854 1455 12466
NM_024949chr484888 4354 4265 3220 1774 1730 1543 505 1815 34378 4186 3975 24856 1566
NM_024989chr256413 6385 5229 787 112 38208 7420 5333 ----
NM_030648chr424191 267 14833 --1274
NM_030674chr1255587 4813 4754 1899 1626 1851 35679 5652 615 --
NM_030755chr1463002 2878 2535 616 137 112 ------
NM_030806chr1149378 8163 7723 6871 6361 5803 3363 2881 2329 1859 1413 928 456 267 ----13082
NM_030816chr163457 3264 1209 535 514 26 ----22890 1062
NM_031483chr20--12526 --22989 1077
NM_031844chr134149 1613 805 11097 13236 13620
NM_032012chr934048 207 55 --11633 34828 4477 39
NM_032147chr121804 2918 715 2722 303 1864
NM_032199chr1043129 1504 1089 442 --33473 2747 2492 125
NM_032208chr212249 --12299 23197 2241
NM_032373chr10115663 5370 5247 5120 4811 4776 3639 1673 1178 628 527 ------
NM_032445chr1582439 2360 2196 793 697 533 170 147 --2748 575 --
NM_032457chr463840 2964 1194 1081 962 215 ------
NM_032682chr343507 2649 1412 1327 ----22806 2724
NM_032918chr1231081 1025 895 11050 1383 1844
NM_033132chr132776 118 2927 590 --11636
NM_033224chr798059 7640 6979 6934 6629 6042 5617 5151 357 37795 1207 1184 12441 17808
NM_033656chr2135421 790 21 --46034 4469 3941 3705 22158 1135
NM_052885chr1264330 4157 3959 3481 1725 409 14512 14904 23203 268
NM_052927chr531522 436 133 1890 --1871
NM_053053chr1171 ----2960 406
NM_080867chr1444916 4356 4219 1383 1106 --15064
NM_133170chr2088021 7355 6629 6478 6238 2271 2215 641 56963 2657 2603 1268 1146 25177 2610 133
NM_138426chr71833 22104 335 --1527
NM_138468chr235512 1797 1324 ----14521
NM_138694chr613565 --32938 479 220 22858 2765
NM_138713chr1657736 3109 2824 2615 1912 --26544 438 --
NM_138714chr1657736 3109 2824 2615 1912 --26544 438 --
NM_138731chr1431711 1200 393 ----12958
NM_144578chr1454256 2202 2091 1856 1188 11017 1557 14980
NM_144949chr242535 2177 1012 529 --1775 1459
NM_144973chr1274240 2107 990 937 700 604 166 --13368 129
NM_145320chr742776 1362 1301 141 11313 --13393
NM_145321chr742776 1362 1301 141 11313 --13393
NM_145322chr742776 1362 1301 141 11313 --13393
NM_145808chr723085 3026 12599 --1711
NM_152263chr134707 2231 2186 1590 --16026
NM_152622chr533398 912 629 ----1989
NM_152624chr546436 6384 5635 5272 26042 588 15107 11029
NM_152758chr832912 2074 363 --2788 482 1489
NM_152838chr2053548 2874 649 586 294 1457 --13421
NM_152890chr11894 1391 31191 1158 411 --
NM_152924chr1576493 5161 2486 1733 1699 754 259 24262 1040 35458 1119 1046 --
NM_153188chr51299 11422 15495 14103
NM_153207chr1233266 2855 581 12523 --12716
NM_153810chr1074715 4202 4028 3995 2034 1176 578 ----1986
NM_172071chr166202 4940 2352 2290 1146 176 27187 5603 24787 1488 11585
NM_173214chr1657736 3109 2824 2615 1912 --26544 438 --
NM_173468chr421230 638 ----25654 3844
NM_173470chrX12928 ----22559 929
NM_173511chr243497 3201 2494 1497 ----13359
NM_173595chr1221813 1060 13546 13273 2604 68
NM_173632chr19123341 2371 1305 1284 986 922 776 717 635 563 481 306 --33012 2750 1163 12111
NM_175624chr1236781 5715 2393 12682 34816 2894 2399 --
NM_175625chr1236781 5715 2393 12682 34816 2894 2399 --
NM_175736chr1287231 5871 3093 2330 1739 1312 1107 447 15769 65632 3102 2248 2242 1437 51 37723 4732 1969
NM_175854chr1331720 829 492 12436 --1561
NM_178011chr1032936 2627 179 33295 2713 119 --12142
NM_178123chr2132 --11049 11022
NM_178140chr512336 1589 2884 664 11766
NM_178151chrX86386 4776 2197 798 541 320 269 79 11032 15768 37463 2489 27
NM_178152chrX86386 4776 2197 798 541 320 269 79 11032 15768 37463 2489 27
NM_178153chrX86386 4776 2197 798 541 320 269 79 11032 15768 37463 2489 27
NM_181481chr1866480 5612 5177 4868 1185 1162 --36135 4557 2056 --
NM_181482chr1866480 5612 5177 4868 1185 1162 --36135 4557 2056 --
NM_181483chr1866480 5612 5177 4868 1185 1162 --36135 4557 2056 --
NM_181504chr574127 3978 3232 1066 577 435 34 --23102 1187 --
NM_181521chr1657042 4790 1192 237 123 17200 --15149
NM_181523chr574127 3978 3232 1066 577 435 34 --23102 1187 --
NM_181524chr574127 3978 3232 1066 577 435 34 --23102 1187 --
NM_182830chr1421815 1588 ----12096
NM_182898chr786502 6488 4370 4143 2136 1107 796 586 26195 543 21425 312 26154 973
NM_182899chr786502 6488 4370 4143 2136 1107 796 586 26195 543 21425 312 26154 973
NM_198181chr1522172 934 12660 --22567 377
NM_198581chr2107132 7065 7042 6788 6507 5561 5232 4935 1549 515 21710 1630 --15996
NM_198715chr184794 2457 2421 2394 1878 1775 1036 208 ------
NM_198900chr1287231 5871 3093 2330 1739 1312 1107 447 15769 65632 3102 2248 2242 1437 51 37723 4732 1969
NM_199421chr1444916 4356 4219 1383 1106 --15064
NM_203390chr841332 469 367 261 ----1513
NM_203391chrX11719 11750 --11219
NM_203459chr122075 2015 12045 --1198
NM_203463chr264796 4485 3980 3271 3009 565 --24422 380 1578
NM_206907chr522110 589 13162 --22183 879
NM_207015chr352272 2224 2010 1578 446 ------
NM_207406chr445770 5360 1836 108 14476 15957 21267 85
NM_212558chr964020 3291 3154 1316 1027 941 --11541 --