TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-454-5p
miRNA Sequence: ACCCUAUCAAUAUUGUCUCUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_012199chr153916 3719 1712 838 409 --11420 54472 1843 1393 866 105