TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-455-3p
miRNA Sequence: GCAGUCCAUGGGCAUAUACAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1262420 2049 1486 539 510 39 --21749 1734 1170
NM_000084chrX66297 6239 5500 5480 4430 2776 11509 26905 6643 --
NM_000108chr711169 1105 ----
NM_000109chrX31697 963 842 ----11844
NM_000217chr1245023 4989 4680 3513 ----14139
NM_000304chr1731105 983 690 ------
NM_000378chr1121168 273 ------
NM_000408chr222571 2435 --13043 --
NM_000430chr1743391 3354 2979 331 --22596 237 13412
NM_000459chr92275 189 ----1215
NM_000489chrX52510 2199 881 770 519 --126 --
NM_000555chrX66010 3116 2951 2829 2093 355 37239 5719 1371 27575 1753 12835
NM_000814chr1543471 3211 1392 872 ----13832
NM_000891chr1733546 2975 1064 1123 43657 2681 1210 782 11298
NM_000899chr1264133 3231 2905 1584 547 255 ------
NM_000901chr422546 176 ------
NM_000908chr5----1611 --
NM_000944chr442369 1718 140 69 ------
NM_000959chr153056 2840 2607 1333 620 --12936 --
NM_000963chr11644 ------
NM_000983chr11367 ----41490 1201 283 94
NM_001001323chr1242351 2020 705 391 ------
NM_001001395chr1272820 2792 2369 1743 284 229 147 ------
NM_001001396chr153146 2930 1320 1251 630 --1222 --
NM_001001481chr842881 840 575 517 ------
NM_001001549chr73676 572 162 12836 ----
NM_001001668chr1954281 4264 2618 754 93 11702 ----
NM_001001974chr101507 --1794 --
NM_001002860chr1443404 1529 610 369 33699 3561 1014 1427 --
NM_001003652chr1897444 7195 7021 6956 6911 5695 3203 3041 591 27375 7264 26372 81 --
NM_001003712chr12----13523 1726
NM_001004317chr62888 583 14412 ----
NM_001005474chr31472 ----11517
NM_001006634chr16----1608 --
NM_001007024chr1763990 2862 1594 630 347 138 --2502 409 --
NM_001007097chr951199 676 81 71 33 13525 31739 1456 314 14168
NM_001007277chr112321 156 ----1405
NM_001007559chr181710 --2504 292 --
NM_001008495chr82882 775 1627 --12142
NM_001008540chr21112 ------
NM_001008541chr1031605 1467 644 --32196 1561 786 --
NM_001010942chr121106 --11250 --
NM_001010984chr12874 406 --11706 --
NM_001010986chrX22398 284 ------
NM_001011666chr736287 5745 2613 15782 11010 --
NM_001011713chr1421018 89 --1362 --
NM_001012393chr1154805 4487 3617 1138 87 24425 1902 ----
NM_001012989chrX1218 --1431 --
NM_001013399chr63974 849 739 ------
NM_001013620chr1268095 6720 5450 1924 760 33 --15961 --
NM_001014797chr10117367 6815 6692 6442 6433 5171 5134 2611 2201 1870 1043 --11947 17675
NM_001015877chrX2587 433 ----1307
NM_001017371chr2------1111
NM_001017395chr34488 477 405 327 13459 11238 12377
NM_001017440chr7116663 6304 6224 5200 2104 2003 951 945 630 203 98 37876 2685 2267 15110 --
NM_001017930chrX2526 47 --11414 --
NM_001018004chr151603 ------
NM_001023587chr31958 --1173 --
NM_001024948chr111049 --11280 --
NM_001025266chr353982 3673 1164 1140 708 21066 621 13231 --
NM_001029858chr61753 --33358 555 114 --
NM_001029863chr642640 1165 443 218 11104 12444 --
NM_001029882chr1----1468 --
NM_001031684chr21124 --11378 --
NM_001031804chr1631652 507 68 13129 23823 276 --
NM_001031812chr512063 --11996 --
NM_001033059chr642021 1777 763 415 ----11528
NM_001034954chr1022718 1203 --12185 13209
NM_001037334chr1822028 949 --2645 194 --
NM_001038707chr152322 1497 927 496 155 1218 ----
NM_001039538chr242919 1146 678 62 ----12952
NM_001039577chr1104240 4056 3897 3204 2828 1784 1513 1349 647 538 ------
NM_001039618chr1185588 5516 5106 4221 4136 3872 3617 2070 --24113 2267 --
NM_001040152chr744344 1864 730 205 11646 11308 --
NM_001040152chr744344 1864 730 205 11646 11308 --
NM_001040202chr41803 --12115 --
NM_001042599chr277086 6759 6492 4804 2702 1365 1132 --11044 --
NM_001044305chr6----11613 --
NM_001046chr513035 ----12253
NM_001071775chr1331324 683 445 ----1463
NM_001100108chr1108313 7328 5884 5129 2529 2368 1907 1163 478 331 15457 12952 --
NM_001106chr3119368 8957 7997 7984 6122 3701 3320 3223 2945 1049 684 17486 68118 6229 3712 2291 626 187 --
NM_001126chr1----1832 --
NM_001149chr101233 11122 ----
NM_001167chrX56468 5007 4695 788 327 22434 86 ----
NM_001206chr912606 ------
NM_001265chr135750 640 269 256 58 1779 --2710 291
NM_001440chr852782 2279 2212 1756 251 22176 869 42607 2527 966 726 --
NM_001527chr644879 1880 1844 343 14008 1111 --
NM_001546chr611010 1316 ----
NM_001616chr212685 12679 ----
NM_001627chr322400 1624 --168 --
NM_001755chr1612032 ----11519
NM_001830chrX53200 2855 1513 1479 696 --11054 --
NM_001939chrX53275 2941 2625 1269 127 12855 12347 12435
NM_001949chr663162 1310 1141 700 516 326 --2799 352 --
NM_001955chr6------1925
NM_001968chr41766 --194 --
NM_001987chr1263784 3487 1693 719 196 61 24220 90 ----
NM_002015chr1342856 917 617 236 ------
NM_002106chr41277 --178 --
NM_002137chr72229 24 --1189 --
NM_002199chr4------11001
NM_002211chr103450 287 264 1187 ----
NM_002235chr1241721 1394 612 151 ------
NM_002264chr333113 929 503 --11381 --
NM_002265chr171385 --11178 --
NM_002270chr533723 2264 1045 --11764 --
NM_002317chr51164 --1135 --
NM_002334chr1152037 1554 432 370 220 11417 11883 --
NM_002356chr622603 2441 22343 106 ----
NM_002398chr211240 --11467 --
NM_002479chr12743 185 ------
NM_002595chr1221369 89 1282 ----
NM_002645chr1132466 2241 1138 22935 1162 --13111
NM_002655chr864874 4807 4715 4459 1084 463 --14834 1968
NM_002697chr11243 --2255 56 --
NM_002711chr71887 --159 --
NM_002717chr82265 169 --2485 276 --
NM_002745chr2244059 3838 1797 29 ------
NM_002755chr15----1209 --
NM_002758chr17----139 --
NM_002836chr20133 ------
NM_002849chr12----2424 130 --
NM_002886chr345179 4042 700 650 --25014 1976 --
NM_002890chr5130 ------
NM_002892chr14--1532 1135 --
NM_003030chr331671 348 155 ----11525
NM_003059chr51271 --1236 186
NM_003100chr5156 ------
NM_003112chr732117 347 83 1812 171 --
NM_003137chr651424 1376 473 239 219 --1491 12047
NM_003144chr611510 --11559 1123
NM_003188chr6----1851 --
NM_003211chr1221479 1329 ------
NM_003341chr31651 --1634 --
NM_003405chr221654 ----1182
NM_003410chrX33134 780 637 ------
NM_003418chr3--1265 ----
NM_003468chr242798 1665 1260 1253 11014 23556 3167 --
NM_003471chr31131 --1217 --
NM_003482chr1262747 2210 1853 1788 696 111 --22089 1955 --
NM_003583chr1213811 --23738 1264 --
NM_003590chr231474 605 333 --3777 52 34 --
NM_003626chr11----11101 --
NM_003633chr552391 2162 856 521 276 --32317 1815 496 --
NM_003659chr2187 ----1172
NM_003749chr1352374 1627 676 591 143 21867 645 ----
NM_003787chr1831687 1644 1289 ----1375
NM_003794chr321078 212 ------
NM_003822chr133040 2525 866 ----1275
NM_003873chr1041792 1697 451 325 ----11931
NM_003884chr311548 --11563 --
NM_003887chr2----1735 --
NM_004171chr1169681 9265 8661 7681 5820 3597 --28519 8374 29555 510
NM_004232chr1831427 1095 1052 --1972 --
NM_004274chr1431287 445 267 --192 --
NM_004290chr5----21339 32 --
NM_004301chr3----1301 --
NM_004302chr1232832 2731 2724 ------
NM_004311chr1062796 2521 2400 2000 1186 329 ----12604
NM_004379chr211458 --21213 43 --
NM_004392chr1322066 1941 ------
NM_004397chr1153935 3849 3673 3178 2949 --12957 1770
NM_004438chr233041 609 568 --1754 --
NM_004449chr2121454 118 ----1237
NM_004490chr2------1166
NM_004540chr211733 --149 --
NM_004571chr2143040 2170 402 214 --23407 378 12351
NM_004586chrX54113 3835 3437 1096 585 ------
NM_004588chr1173395 3280 2872 2472 1186 685 577 23333 786 13481 --
NM_004660chrY3933 518 223 ------
NM_004725chr1021317 68 --1527 --
NM_004736chr11148 --1280 --
NM_004738chr203827 821 331 1508 21913 32 --
NM_004768chr1----1299 --
NM_004792chr21139 ------
NM_004801chr21395 ------
NM_004814chr1----1412 --
NM_004815chr143487 1757 253 104 --1942 --
NM_004852chr18812187 11138 10295 9993 9596 2251 824 335 313324 13176 1419 312094 10010 5649 13679
NM_004859chr1722781 241 11034 2908 518 --
NM_004926chr1431669 1439 238 11520 11475 --
NM_004956chr734418 3320 681 --21462 168 --
NM_004992chrX147949 7583 7445 6929 6891 6458 6030 5391 2429 1939 1430 1136 1102 502 --11586 --
NM_004999chr634184 3830 3115 ----1819
NM_005045chr7----2856 390 --
NM_005095chr11459 --11739 --
NM_005100chr6----2953 888 --
NM_005121chr1753456 2764 2575 2489 401 ------
NM_005124chr6----2950 65 --
NM_005254chr152970 127 ----1400
NM_005296chrX1880 --21088 205 --
NM_005385chr342515 1932 1010 942 --12598 --
NM_005389chr61149 --191 --
NM_005399chr1124367 4330 3924 3772 3761 3615 3490 3409 1665 1635 1618 417 ----21380 61
NM_005596chr965940 4781 4496 4122 1657 938 15479 12137 15595
NM_005618chr61431 --1106 --
NM_005828chr1743286 1872 1348 754 24856 217 44295 3810 1182 1166 21159 1075
NM_005898chr113867 812 121 12061 ----
NM_005902chr1564382 3963 3868 3515 2981 376 --11026 13935
NM_005955chr145276 2189 1059 922 ----13459
NM_005966chr22562 133 ------
NM_006011chr1594333 4252 3737 1716 1471 1448 952 423 363 --12945 --
NM_006016chr641405 730 418 27 ------
NM_006022chr134961 757 689 407 ------
NM_006037chr254799 3489 3323 870 699 --24704 3678 --
NM_006047chr2023113 898 --22353 98 --
NM_006094chr842018 785 508 377 --11905 --
NM_006107chr172438 349 1194 ----
NM_006135chr111175 --1554 --
NM_006136chr721358 425 1195 197 --
NM_006160chr1711314 ----1577
NM_006191chr1221010 866 --2878 873 --
NM_006195chr911372 --1430 11386
NM_006237chr1341885 1574 215 194 12079 1364 --
NM_006246chr1431334 918 205 --1960 --
NM_006267chr231854 1431 345 ----149
NM_006287chr221868 1646 --1628 --
NM_006329chr14----1773 --
NM_006352chr131887 1365 495 --41670 1414 1370 721 11341
NM_006390chr123341 294 88 11863 11648 --
NM_006401chr9159 --149 --
NM_006421chr81180 --198 --
NM_006464chr254217 3906 765 220 211 --2194 48 --
NM_006546chr17106295 6083 5457 5231 5091 4920 4107 1916 1049 113 1856 35767 5082 261 --
NM_006595chr1111986 --1124 --
NM_006611chr121420 --162 1105
NM_006698chr2031390 1077 1054 --11420 --
NM_006713chr5----1109 --
NM_006717chr972957 2867 2370 1254 948 934 503 12246 ----
NM_006734chr641553 1172 1098 1022 --1533 --
NM_006763chr121632 490 --11984 --
NM_006777chrX1765 --12355 --
NM_006827chr142369 328 --23371 427 --
NM_006951chr10----1247 --
NM_007008chr21220 ----1791
NM_007011chr1576259 6139 4848 2742 2384 2334 971 25110 2117 24276 927 1915
NM_007013chr81353 ----1933
NM_007125chrY----1558 1303
NM_007137chrX45428 1993 1949 1584 11961 14955 13476
NM_007146chr1721987 638 --22148 2043 --
NM_007172chr2252222 737 480 435 292 --1592 12389
NM_007195chr1833585 3074 1491 --13635 --
NM_007249chr13127703 7631 7330 6341 6172 6134 3285 2575 2093 1665 1085 930 168 28747 750 --
NM_007285chr161120 ----1443
NM_007347chr151194 1285 ----
NM_007373chr1021745 503 --11578 --
NM_007375chr132030 407 312 1797 ----
NM_012100chr2175 --2284 89 --
NM_012104chr1183773 2412 1490 1154 985 973 494 180 ------
NM_012153chr1121706 678 --12575 --
NM_012154chr82759 175 ------
NM_012175chr112878 636 --1163 --
NM_012262chr165125 3606 3247 1335 540 23 --24196 81 14664
NM_012297chr432612 2503 1047 1228 ----
NM_012300chr542215 2037 1700 906 --2871 558 --
NM_012308chr1142313 2100 933 774 ------
NM_012316chr154303 4015 1771 1327 964 ----1549
NM_012330chr1041736 1587 1487 268 ----148
NM_013230chrY21450 603 --11727 --
NM_013261chr453202 2930 2312 1494 380 --23296 2789 --
NM_013281chr2021456 366 ------
NM_013302chr1644590 1603 1026 680 --23099 2880 21320 709
NM_013381chr12----1586 --
NM_013449chr1242293 2196 464 230 ----11868
NM_014028chr643008 2773 2429 727 --1699 --
NM_014112chr834414 4360 839 11335 1392 13417
NM_014117chr1632467 840 641 --1519 --
NM_014212chr125957 807 778 684 121 --1109 --
NM_014241chr10----1101 --
NM_014267chr112719 65 --1620 --
NM_014397chr921369 912 --1302 --
NM_014423chr532175 2126 941 --21456 1017 --
NM_014487chr4----2250 245 --
NM_014494chr1632109 2038 287 ----1371
NM_014612chr9----21498 1452 --
NM_014614chr241501 1057 441 422 --1544 --
NM_014634chr2263510 3268 2609 982 973 632 1901 23334 2969 --
NM_014636chr943781 805 439 120 12809 44130 1508 817 812 --
NM_014647chr1641748 1715 795 776 --12181 --
NM_014657chr20------2168 63
NM_014729chr821412 325 --160 --
NM_014730chr1295138 4831 4476 3942 3726 2097 1739 1075 573 21368 462 35199 4815 1598 --
NM_014742chr2071788 1633 594 406 308 141 65 ------
NM_014747chr165722 4472 4221 1148 985 129 35596 1008 678 35012 4226 4058 22021 256
NM_014751chr81592 --2785 720 --
NM_014827chr141512 1352 154 49 1539 ----
NM_014912chr1012657 ------
NM_014932chr311434 --138 --
NM_014991chr413095 --1837 13086
NM_015035chr2056633 4345 639 455 27 16545 36502 1539 685 --
NM_015074chr154797 3463 3257 1887 794 --13660 --
NM_015076chr613558 23397 155 --14163
NM_015092chr1624099 799 ----1565
NM_015094chr2284002 3729 3484 3136 2947 2935 1758 1691 23295 685 21763 274 --
NM_015101chr142645 2327 2299 813 ----12724
NM_015111chr573727 3581 3446 2620 1292 1069 114 1458 2330 157 1617
NM_015138chr1592239 2131 2078 1981 1764 620 454 242 232 --189 --
NM_015156chr1443438 3116 1462 33 --11261 --
NM_015192chr2012234 --22825 689 --
NM_015206chr1543709 2769 645 260 11394 ----
NM_015310chr856003 5346 5125 3339 3211 1619 15839 12477
NM_015315chr563145 2324 2152 1012 325 158 --21041 1019 --
NM_015317chr212720 --1234 --
NM_015335chr1232351 2225 828 --11888 --
NM_015344chr821891 32 ----1636
NM_015359chr822101 26 --22930 45 --
NM_015441chr1----1169 --
NM_015455chr554089 3619 3492 213 114 ----1810
NM_015458chr854898 4396 3813 538 137 --14863 --
NM_015508chr321175 76 ------
NM_015554chr1522251 112 --12901 1228
NM_015850chr842053 1994 1920 1767 --1913 --
NM_015891chr61316 ----11994
NM_015906chr131076 706 393 --23278 1263 --
NM_015995chr15105050 4927 3765 1935 1708 1617 1608 1321 1249 548 --23868 1388 14227
NM_016072chr1232076 860 512 11744 1460 --
NM_016076chr143189 2285 315 235 ------
NM_016081chr422210 1505 --12188 --
NM_016083chr653595 2936 1193 796 777 12499 --13407
NM_016147chr111889 ------
NM_016424chr1741943 1854 1238 462 11699 --1583
NM_016441chr221535 144 --2104 94 --
NM_017519chr6------11108
NM_017610chr1532017 1751 283 11937 --11503
NM_017629chr111352 ----1234
NM_017633chr653930 3854 3216 896 231 ------
NM_017637chr968942 8840 8788 8623 8607 7323 27815 5888 --16768
NM_017643chr1732066 992 263 2334 50 ----
NM_017654chr7159 ----1336
NM_017681chrX1170 ----131
NM_017752chrX3721 715 167 ----1689
NM_017761chr11566 ------
NM_017778chr811119 --1283 --
NM_017849chr272317 1191 1045 1005 868 533 387 1999 22839 1974 1448
NM_017902chr10145542 5435 5178 4978 4244 4167 3796 3732 2275 2145 1517 1432 1088 465 --2484 113 --
NM_017919chr932288 1495 925 1129 13912 1205
NM_017944chr1143092 3029 1986 907 11942 1127 --
NM_018000chr221757 343 --1406 --
NM_018013chr612680 --1388 --
NM_018112chr9----1168 --
NM_018121chr1042812 1284 729 390 ------
NM_018362chr1121230 1122 --11550 11344
NM_018482chr82768 641 ----1955
NM_018644chr1141597 796 435 317 --31996 878 873 --
NM_018959chr191767 ----1162
NM_018970chr723126 3112 22339 223 --12779
NM_018975chr16------1766
NM_019067chrX54592 4296 1837 761 504 23086 608 24730 1859 --
NM_019116chr1653717 3203 1431 641 79 --2892 424 --
NM_020150chr1021729 1417 12021 --144
NM_020205chr142611 1386 201 182 22148 1236 12598 --
NM_020346chr111275 --11704 --
NM_020403chr132417 330 --1278 --
NM_020466chr624701 3623 11163 34935 1780 1734 --
NM_020640chr352036 805 433 241 189 12234 1881 186
NM_020647chr81488 ----11626
NM_020655chr1631368 440 189 1409 11445 --
NM_020673chr2067414 6570 6479 5895 2622 64 22788 512 17524 --
NM_020699chr173945 3698 1947 1435 792 694 655 1816 14170 25030 4996
NM_020752chr1032673 1842 41 22742 2263 ----
NM_020760chr21159 ----11611
NM_020772chr1768502 7308 2456 1710 1672 755 --11749 --
NM_020783chr181736 1631 175 1134
NM_020810chr1443304 2502 993 784 ----23055 2283
NM_020860chr45978 423 357 339 321 ------
NM_020870chr462220 418 364 200 117 86 ------
NM_020935chr224115 3614 --2885 703 --
NM_021079chr1731347 1222 1154 1644 43273 2308 2100 177 12608
NM_021097chr242850 964 500 241 --1773 --
NM_021116chr768649 7980 3242 2807 2140 1864 11638 26204 1382 39008 7958 2304
NM_021136chr143691 599 22 ----1608
NM_021194chr11303 ------
NM_021639chr11816 --2771 618 --
NM_021783chrX32114 2080 56 3655 182 160 ----
NM_022037chr22726 268 ----1667
NM_022048chr1576349 2225 2062 1944 1581 317 254 --21402 476 --
NM_022114chr154730 4121 3020 1339 210 --33587 3086 781 --
NM_022118chr131118 --1511 --
NM_022130chr51541 ------
NM_022474chr1442622 439 63 31 ------
NM_022719chr22123471 3284 2998 2783 1195 1098 1037 622 611 578 338 143 33206 1227 1133 22908 2898 13004
NM_022750chr73504 323 192 ------
NM_022753chr11100 --12343 --
NM_022758chr632872 2141 882 --182 --
NM_022912chr272919 2674 1165 852 845 554 543 --22996 333 --
NM_023071chr122441 58 ----1221
NM_023112chr1462893 2706 2635 285 159 44 --41843 1146 964 471 --
NM_024056chr12----1612 --
NM_024613chr811692 ------
NM_024665chr344386 3499 436 380 ------
NM_024721chr832165 1897 129 ----1316
NM_024779chr1211081 --1655 11436
NM_024852chr1------1517
NM_024969chr23320 70 61 1916 1571 --
NM_025107chr63782 430 342 --12291 --
NM_025160chr143817 2873 2732 522 ----14315
NM_025182chr92965 135 --1372 1971
NM_025191chr113406 ------
NM_030623chr24637 450 238 228 --11692 --
NM_030648chr463399 1956 1400 1299 616 87 ------
NM_030780chr821621 317 --1359 --
NM_030918chr195227 5112 4778 4738 1916 1616 1438 466 73 --14704 14507
NM_030939chr63204 146 101 ------
NM_031445chr243022 2356 928 682 --32799 2326 243 --
NM_031453chr1042207 1866 1831 1623 --12498 --
NM_031483chr2012434 --13422 11278
NM_032128chr4136 1292 ----
NM_032195chr21--125 168 --
NM_032211chr102859 337 11187 11224 --
NM_032239chr41245 ------
NM_032312chr2----1312 --
NM_032324chr1----1182 --
NM_032445chr1542599 2116 228 156 ------
NM_032446chr562349 501 395 328 185 160 --11175 --
NM_032458chrX2917 763 ----1637
NM_032505chr342273 901 802 758 --22502 2034 --
NM_032560chr14------1308
NM_032632chr143427 139 108 --1294 --
NM_032833chr142137 649 447 407 ----22284 588
NM_033089chr2031289 1096 353 --1369 --
NM_033133chr17102935 2885 1320 1305 1176 991 830 599 485 421 --23671 835 --
NM_033224chr7127877 7815 7076 6587 6463 5491 4959 2968 1502 1176 1034 729 17278 1885 --
NM_033656chr2145763 4253 4021 1298 13993 55062 4657 4518 2104 40 --
NM_052911chr182903 108 --152 1288
NM_080617chr201122 --1201 186
NM_133496chr164080 3892 3620 3121 1340 202 --11203 --
NM_138426chr72855 39 --1892 12148
NM_138468chr255941 5698 5657 1736 189 ------
NM_138782chr512295 --12315 --
NM_138992chr21----3450 445 51 --
NM_139321chr2074101 4074 3982 3244 3094 1235 334 13389 ----
NM_144571chr431784 473 181 ------
NM_144633chr311372 ------
NM_145284chrX42239 1588 685 218 --12214 --
NM_145808chr742755 886 647 624 ----1914
NM_147189chr832258 1927 1496 1152 ----
NM_152277chr51118 --1311 --
NM_152384chr25649 589 367 262 23 --1436 --
NM_152407chr52386 113 --13064 1452
NM_152450chr1541795 472 250 93 --1621 --
NM_152653chr3------1614
NM_152716chr11----11592 --
NM_152756chr553701 1675 1463 797 55 ----11343
NM_153456chr1396236 5807 5655 5327 5207 5078 4328 2379 2286 25161 1437 ----
NM_153607chr522084 2075 --12713 --
NM_153689chr21671 --12284 1200
NM_153697chr22614 22 --1281 1303
NM_170711chr191943 ----1338
NM_171998chrX32419 2065 932 1191 11570 --
NM_172037chr821067 91 1420 ----
NM_172071chr136459 5472 1282 --27430 6944 12396
NM_173468chr454964 2442 2431 1124 788 --2318 89 --
NM_173469chr1521500 27 ----1199
NM_173510chr2242824 2775 2635 2322 ------
NM_173595chr1285150 4936 3491 3480 2056 1932 1264 689 33501 1253 190 11311 11719
NM_174909chr51639 156 ----
NM_174934chr1173257 3063 2827 2687 2595 644 268 1488 1454 12745
NM_178539chr1222135 1784 --1731 --
NM_181358chr134177 3397 67 ----11406
NM_181504chr532745 748 495 --23048 1087 --
NM_181672chrX1354 ----1338
NM_181836chr532662 1629 210 ----12465
NM_182485chr4--1647 13435 --
NM_182488chr13------1154
NM_182691chr7------11274
NM_182975chr11425 ----1854
NM_194247chr264390 4304 3625 3273 666 192 ------
NM_194285chr1122342 1168 --1589 1492
NM_198066chr1432219 1225 1218 --1164 1110
NM_198270chrX53259 3072 2847 2722 2448 --1937 --
NM_198485chr3----11728 2164 84
NM_198859chr375066 4922 4400 4163 1449 1431 1333 11085 21580 988 --
NM_199355chr1621746 1395 --2682 534 --
NM_201439chr12----162 --
NM_206853chr653395 1398 1371 809 512 ------
NM_206855chr635621 4079 1601 ----1931
NM_213589chr235462 5066 1485 --23568 346 --