TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-455-5p
miRNA Sequence: UAUGUGCCUUUGGACUACAUCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000125chr641314 1103 607 528 --1169 --
NM_000138chr1562255 2176 2083 2062 158 95 ------
NM_000141chr1021069 144 ------
NM_000161chr14179 --1605 --
NM_000176chr522508 1206 ------
NM_000217chr1265216 4613 1745 1053 547 450 25294 1381 14432 --
NM_000248chr3----1866 --
NM_000266chrX2214 127 ----1766
NM_000267chr1763160 2950 2411 2309 2254 1366 ------
NM_000314chr1072831 2760 2179 1229 723 675 658 ------
NM_000330chrX32227 782 42 --11721 --
NM_000332chr664919 4854 1926 299 219 171 21538 1102 11426 --
NM_000337chr532641 1440 404 ------
NM_000390chrX22331 190 12751 12139 --
NM_000408chr222135 245 12384 12847 11087
NM_000459chr92890 834 1109 ----
NM_000462chr15------11750
NM_000489chrX42745 819 805 161 12685 ----
NM_000495chrX----1312 --
NM_000503chr83698 650 468 ------
NM_000522chr721140 1108 ------
NM_000599chr253426 1631 1203 848 762 14259 13333 1987
NM_000681chr1021340 304 ------
NM_000719chr12106394 6163 5835 5358 4730 1886 1210 1082 870 593 1382 --12666
NM_000726chr21239 ----1301
NM_000728chr111472 --1483 --
NM_000813chr535396 3920 2243 25533 5388 ----
NM_000814chr1554128 3323 1227 589 294 21026 157 13492 --
NM_000817chr21199 1936 ----
NM_000826chr412190 12275 ----
NM_000829chr1131992 1641 331 --12319 --
NM_000831chr1114621 2263 2246 2192 2069 1993 1927 1838 1609 337 256 ------
NM_000838chr622350 617 ------
NM_000844chr32768 67 ------
NM_000868chrX42213 2132 316 32 11923 1372 --
NM_000875chr1586238 5228 5200 5022 4529 1784 1531 748 ------
NM_000891chr1763473 2466 1079 964 732 352 13663 --1212
NM_000901chr422436 710 1408 ----
NM_000912chr852912 1269 1238 847 225 ------
NM_000921chr121656 --1167 --
NM_000944chr422408 77 ------
NM_000945chr231875 1514 234 11819 ----
NM_000964chr17--1470 ----
NM_001001344chrX2614 21 1635 22017 601 --
NM_001001481chr842692 854 672 596 --22308 161 --
NM_001001484chr10----11876 --
NM_001001664chr22776 132 32967 1549 1359 --1879
NM_001001938chr953417 3199 2692 920 663 --13142 --
NM_001002814chr853469 3434 2444 306 191 --12562 --
NM_001002860chr1463456 1476 833 748 503 306 14505 ----
NM_001003674chr1877096 5513 5101 4783 4535 2592 99 15019 ----
NM_001003688chr411157 ------
NM_001004317chr61266 ----23090 1002
NM_001004419chr1254512 3235 913 757 112 13188 ----
NM_001005335chr191245 --1301 --
NM_001005473chr546020 5294 801 58 11750 14553 --
NM_001005781chr22414 408 1577 ----
NM_001005861chr31103 --2279 180 --
NM_001006933chrX----1215 --
NM_001007237chr152541 2056 1083 805 481 --12651 --
NM_001007278chr13------1857
NM_001008493chr141658 1360 535 421 11244 1545 --
NM_001008564chr1351958 1899 692 647 342 21861 492 ----
NM_001008777chr171157 --1492 --
NM_001009554chr454440 3674 3657 3022 26 1408 13156 --
NM_001009555chr47553 478 310 194 123 117 30 ------
NM_001009996chr31227 --2406 131 --
NM_001010853chr642427 1054 867 567 ----13260
NM_001010861chr122578 1009 12432 ----
NM_001010867chr1116522 5197 4980 4371 2527 2369 2040 1106 781 735 21 16088 44515 2125 1048 187 --
NM_001010891chr596662 5587 5140 1836 1718 1523 971 952 751 1594 ----
NM_001010942chr122295 163 ------
NM_001010986chrX--2919 436 ----
NM_001011551chrX1153 ------
NM_001011666chr715111 --14840 16388
NM_001012267chr921882 1657 --1133 --
NM_001012761chr512397 2326 150 ----
NM_001012979chrX----1215 --
NM_001015045chr442499 1981 254 242 11735 --11711
NM_001015877chrX72760 2419 2313 1159 854 506 418 13098 ----
NM_001017424chr161531 1311 1287 1199 1180 27 ----1775
NM_001017969chr9--1492 ----
NM_001018054chr121389 318 1295 ----
NM_001018057chr1121270 460 ------
NM_001018067chr144262 3333 654 449 --2996 824 --
NM_001018108chr1522254 2072 12102 ----
NM_001024460chr63515 412 219 --1997 --
NM_001024460chr63515 412 219 --1997 --
NM_001024596chr1923348 2278 11260 11132 --
NM_001024808chr1262714 2371 2153 1880 679 629 --144 --
NM_001025076chr1045411 2376 1352 717 15392 ----
NM_001025079chr314036 --11300 12748
NM_001025100chr1831537 1150 124 --22657 2530 179
NM_001025201chr2------1110
NM_001025252chr833099 201 59 ----1542
NM_001025580chrX1790 23306 236 --13812
NM_001025596chr11197 1410 ----
NM_001029863chr6--33252 1991 944 --12348
NM_001029875chr562789 2348 2129 1140 847 680 12471 ----
NM_001030007chr1622527 1458 ------
NM_001031684chr211222 --1216 --
NM_001031695chr2235428 4400 669 --14514 --
NM_001031700chr4171 --11962 --
NM_001031711chr521672 338 ------
NM_001032296chr1352273 1890 955 734 586 1274 ----
NM_001033087chr2041318 1172 636 568 12508 12907 --
NM_001033561chr17--2862 203 ----
NM_001034841chr1635324 5041 942 ------
NM_001035003chr421424 110 ----1268
NM_001037131chr281328 1243 460 399 313 291 285 79 1393 ----
NM_001037954chr1132816 1035 786 --1171 --
NM_001039479chr1442156 547 308 53 --31791 1564 778 --
NM_001039573chr172423 185 ------
NM_001039574chr12262 194 1216 ----
NM_001039590chrX11553 24028 822 12832 --
NM_001039618chr1125874 1673 --24045 3657 --
NM_001039690chr1641499 899 773 317 ------
NM_001039762chr101487 12342 ----
NM_001039840chrX25385 164 21248 238 ----
NM_001039937chr1332950 929 885 1397 ----
NM_001040020chr71220 --1971 --
NM_001040153chr131399 ----1941
NM_001040284chr1635900 5288 4630 24806 480 13729 --
NM_001040441chr154982 4798 4460 4128 451 13500 ----
NM_001040450chr1531039 964 573 --12218 --
NM_001040633chr72401 322 ----1918
NM_001040712chr941297 1098 866 716 13164 ----
NM_001042413chr963775 3641 3226 457 401 328 23560 3523 13600 --
NM_001042440chr552033 1914 1664 545 348 11376 --1555
NM_001042479chrX61602 1561 647 107 73 47 1239 ----
NM_001042537chrX31628 128 41 ------
NM_001042599chr264921 4799 2687 1284 1183 435 25873 1433 17556 --
NM_001042603chr1254443 3641 2046 1259 213 --1789 1330
NM_001044385chr243998 2592 1023 650 13730 ----
NM_001100108chr156911 6789 6199 6058 1742 13201 17636 --
NM_001106chr3108889 7934 7780 6426 3847 3628 2219 2137 877 208 --26599 693 11218
NM_001121chr1031829 1520 47 ----1502
NM_001156chr102649 150 ------
NM_001177chr1212465 --21787 1679 1113
NM_001198chr61495 2651 80 ----
NM_001200chr2031032 279 253 1394 ----
NM_001204chr244971 2522 2097 432 15899 --32941 2038 570
NM_001206chr94615 175 109 97 23133 405 ----
NM_001232chr121124 392 ------
NM_001241chr221919 36 1584 --11977
NM_001304chr1753486 2557 978 320 288 ------
NM_001351chr3------1721
NM_001356chrX92452 2274 2257 1583 1541 805 563 429 102 --12215 --
NM_001364chr1154680 3347 966 442 417 --11687 --
NM_001390chr1842800 2323 533 421 --12358 --
NM_001400chr11445 11341 ----
NM_001438chr131341 1287 1136 --12577 --
NM_001448chrX2588 246 --11829 1392
NM_001453chr611153 ------
NM_001455chr664440 4431 4013 1912 651 549 --13766 21511 1409
NM_001508chr2--1238 1669 --
NM_001608chr21372 --1723 --
NM_001609chr1043535 3041 1267 191 ------
NM_001627chr311551 1654 1428 --
NM_001656chr521688 575 31700 107 54 ----
NM_001656chr521688 575 31700 107 54 ----
NM_001679chr3----1115 --
NM_001701chr9------1587
NM_001721chrX2243 83 ------
NM_001755chr16--11555 11934 --
NM_001759chr1254571 3893 1898 1229 1115 1376 ----
NM_001858chr685100 4911 4884 4682 4442 3594 1268 1117 11886 ----
NM_001931chr111192 2913 335 1991 --
NM_002015chr1353074 2761 2620 2532 1018 13272 ----
NM_002024chrX41984 1474 335 104 21691 1453 ----
NM_002025chrX99125 8283 8075 6280 5920 3398 2782 2278 1623 --17922 --
NM_002048chr921356 437 --1921 --
NM_002074chr141074 677 639 72 ----11176
NM_002094chr161396 --1342 --
NM_002114chr62174 80 ------
NM_002146chr173554 487 338 ------
NM_002199chr41698 1375 1926 --
NM_002202chr521106 340 ------
NM_002214chr754729 4313 1787 1221 385 15196 --15126
NM_002232chr12390 304 11328 ----
NM_002233chr112444 138 ------
NM_002239chr21120 --1285 --
NM_002253chr4----1162 11296
NM_002264chr311910 15003 --1738
NM_002267chr131193 21823 395 ----
NM_002270chr555103 4850 1871 1715 316 13676 21491 742 11328
NM_002271chr1322312 1712 --1511 --
NM_002356chr632660 2048 846 ------
NM_002372chr5177 --1653 --
NM_002382chr14--21273 318 1363 --
NM_002397chr521368 684 --21471 522 --
NM_002430chr2232575 2387 328 --1163 --
NM_002480chr1211457 41325 361 299 36 --11407
NM_002524chr12874 805 ------
NM_002581chr964949 3734 2022 1804 1651 1525 35335 4968 237 ----
NM_002650chr22----1277 --
NM_002655chr854377 4232 2128 1109 1022 13521 13792 --
NM_002657chr2022576 958 --33849 2817 1245 --
NM_002703chr421386 96 1194 ----
NM_002709chr233452 979 614 ------
NM_002716chr1121232 430 12390 ----
NM_002740chr322677 956 --12725 2743 333
NM_002748chr1521055 476 1343 11028 --
NM_002822chr1221261 1170 ------
NM_002836chr20------1118
NM_002843chr1133350 716 151 --160 13282
NM_002886chr374765 1964 1890 865 686 293 264 ------
NM_002892chr1431536 1403 347 11348 ----
NM_002906chr1142263 1928 1884 336 1941 ----
NM_002942chr311048 --11320 --
NM_002977chr223106 1047 21347 779 12755 11021
NM_003017chr611108 ------
NM_003042chr321506 1453 ----11528
NM_003045chr1374969 4737 4284 4038 3336 1118 729 --35023 3544 1209 --
NM_003106chr3----11051 --
NM_003108chr226165 1464 16580 15018 11403
NM_003112chr732712 2570 2214 12538 ----
NM_003155chr812643 32699 821 766 11797 --
NM_003161chr171843 --1220 --
NM_003162chr2----1818 --
NM_003185chr20--1881 1894 --
NM_003204chr1731811 1399 555 ------
NM_003221chr621420 1067 13270 --11513
NM_003257chr151550 1952 11316 --
NM_003292chr122124 1675 12064 1272 --
NM_003298chr345772 4053 596 540 14107 --14768
NM_003304chr311608 --11591 --
NM_003337chr511476 ------
NM_003339chr531072 585 121 1157 --11207
NM_003374chr51168 --1762 --
NM_003390chr11--1932 11130 --
NM_003406chr81266 --21298 281 --
NM_003423chr1921687 1623 ----22474 1917
NM_003427chr6--1613 1700 --
NM_003463chr622262 671 1223 ----
NM_003468chr223439 765 ----13879
NM_003482chr1212244 22711 2454 ----
NM_003566chr1252433 2398 2317 433 387 ------
NM_003574chr1824138 240 ------
NM_003590chr243477 3037 399 114 1915 ----
NM_003603chr4--31734 1525 548 ----
NM_003630chr6--1710 --1210
NM_003633chr542284 1938 759 219 ------
NM_003713chr131345 685 371 ------
NM_003718chr71210 --124 --
NM_003722chr31852 ------
NM_003749chr1342452 2144 2028 1904 --12045 --
NM_003850chr131122 ----1651
NM_003861chr141884 12667 32552 338 103 --
NM_003870chr1511415 12088 ----
NM_003913chr643049 1618 1043 679 24006 2827 ----
NM_003922chr151339 --1302 --
NM_003927chr181440 1115 ----
NM_003955chr17172 11570 166 --
NM_003998chr4----1470 --
NM_004050chr1442578 983 884 223 --2389 287 --
NM_004064chr12--21076 285 ----
NM_004093chr1313037 32879 2346 2257 ----
NM_004114chrX11094 --1947 --
NM_004171chr11129490 9142 8677 8559 6410 3745 2844 1995 1534 503 359 170 39389 7613 1124 12085 --
NM_004232chr1863845 3449 3078 788 778 341 ------
NM_004296chr1444027 2564 997 429 11461 --12923
NM_004331chr822461 538 ------
NM_004392chr1352301 2041 638 476 374 ------
NM_004417chr51190 --1216 --
NM_004432chr942430 2382 1880 218 11961 ----
NM_004438chr223222 394 --13070 --
NM_004440chr6--1312 ----
NM_004456chr7----1228 --
NM_004525chr221359 1056 147 ----
NM_004537chr12----1553 --
NM_004575chr4----11369 --
NM_004586chrX54819 4596 4404 1488 483 34626 663 72 1913 --
NM_004612chr954633 3601 3224 1370 410 --24359 3887 --
NM_004660chrY41525 1487 427 101 ------
NM_004687chr17----21627 349 --
NM_004748chr1543815 3670 3199 485 --11369 11614
NM_004755chr1421114 52 21045 199 --1477
NM_004776chr2033308 2240 925 22901 2340 13218 --
NM_004808chr1042911 2132 578 242 22635 1204 1411 --
NM_004834chr253111 2409 2314 1099 405 12291 ----
NM_004852chr181113096 12691 10624 9204 5121 4228 3569 2892 1555 883 24 1915 11408 --
NM_004859chr171504 22121 622 21097 455 --
NM_004863chr1465287 4844 4665 3430 1911 827 --24807 1413 --
NM_004869chr1831561 239 196 11198 ----
NM_004921chr13786 507 28 ------
NM_004926chr1421714 1145 ------
NM_004956chr731278 671 383 34449 4127 897 ----
NM_004962chr103769 636 510 ------
NM_004964chr1----1575 --
NM_004973chr61640 11122 ----
NM_004985chr1264312 4303 3014 2873 57 30 ------
NM_004992chrX48210 7626 5856 2024 35362 2441 1145 ----
NM_004998chr153739 399 45 ------
NM_004999chr644135 3775 801 364 23586 3531 1255 --
NM_005065chr1453529 3276 1824 566 110 ------
NM_005066chr11519 ----1550
NM_005119chr111139 --1462 --
NM_005121chr1753203 2969 1539 1225 743 --21440 1058 --
NM_005137chr2252451 1958 410 287 117 1143 12150 --
NM_005154chr151431 2447 411 ----
NM_005156chr953690 3626 1551 1336 499 --14343 --
NM_005203chr101136 142 ----
NM_005238chr1132421 860 810 --13504 --
NM_005239chr2131415 801 193 1606 ----
NM_005316chr115807 453 430 271 160 1284 ----
NM_005339chr433775 3609 3391 31174 1088 1073 --12940
NM_005349chr4----1417 --
NM_005375chr61117 1412 ----
NM_005400chr222961 2063 ------
NM_005436chr1073946 3773 3729 1528 1277 1042 978 --185 --
NM_005458chr922182 568 12021 1729 --
NM_005465chr12503 492 --31491 734 396 1530
NM_005493chr6------140
NM_005502chr963250 2746 1172 930 700 412 --12063 --
NM_005504chr1244401 2563 2434 1438 ----24104 2107
NM_005509chr5--21580 363 ----
NM_005517chr11306 --1173 --
NM_005522chr72907 67 --11199 --
NM_005596chr935803 5321 1699 --16111 --
NM_005604chr621995 569 --32488 1942 430 --
NM_005627chr63837 171 111 ------
NM_005639chr12--1695 ----
NM_005665chr134002 1708 980 31325 1047 92 ----
NM_005678chr152301 226 ------
NM_005715chr652624 2544 2073 1934 220 ------
NM_005721chr21789 --1760 --
NM_005779chr553609 3385 2795 507 193 ----13175
NM_005898chr1142454 895 844 236 ------
NM_005906chr6--11298 11522 --
NM_005907chr611137 11391 179 --
NM_005923chr62627 582 ------
NM_005935chr454603 1556 749 672 46 14976 ----
NM_005941chr833489 1331 157 13397 --13173
NM_005986chr1312424 1711 ----
NM_006015chr141335 1203 876 488 1884 ----
NM_006016chr621626 1604 21635 130 ----
NM_006037chr241668 1051 360 184 11483 ----
NM_006038chr2021412 725 ------
NM_006106chr1132872 2572 1185 --13163 --
NM_006141chr1652591 2344 255 170 21 --21893 86 --
NM_006166chr1211791 --1800 --
NM_006186chr21842 --11183 --
NM_006206chr411014 --12748 --
NM_006246chr1421159 513 ------
NM_006275chr202115 23 1960 ----
NM_006283chr864745 3521 3140 1206 1041 125 --11855 --
NM_006290chr631880 1678 336 1787 ----
NM_006313chr1231445 1261 476 --11302 --
NM_006315chr433259 2919 1562 24187 3334 ----
NM_006380chr1733823 914 666 1177 1898 --
NM_006390chr1241399 1170 372 309 ------
NM_006420chr2023203 282 --23474 67 --
NM_006421chr811150 --11219 --
NM_006451chr5----11004 --
NM_006469chr13318 126 62 1153 1268 --
NM_006475chr132575 480 ------
NM_006496chr121373 457 ------
NM_006540chr8------11222
NM_006559chr1--11100 ----
NM_006595chr1131820 1512 22 1739 ----
NM_006599chr1666026 2024 2017 1618 479 286 16530 26728 5182 --
NM_006602chr202839 152 ------
NM_006624chr1052039 1854 829 730 558 11300 ----
NM_006628chr15----1998 --
NM_006646chr1362470 1129 875 599 210 133 --11154 --
NM_006699chr132654 2251 1843 ------
NM_006727chr52426 400 ------
NM_006734chr641497 1015 589 511 1300 ----
NM_006750chr1688033 8013 7129 6628 6423 5536 5273 1592 27281 6241 --15288
NM_006775chr6----1756 --
NM_006813chr6171 --1315 --
NM_006815chr122197 104 --1981 --
NM_006826chr221008 859 ------
NM_006827chr1423214 2274 11032 23335 103 --
NM_006851chr122286 277 ------
NM_006873chr223375 2426 12936 13327 --
NM_006885chr161936 ----11273
NM_006902chr112534 --12245 --
NM_006914chr91527 11490 11213 --
NM_006940chr122366 78 ------
NM_006947chr431745 1526 1387 --11787 --
NM_006981chr912980 12719 ----
NM_007054chr521316 451 1389 11219 13157
NM_007114chr32902 475 21178 699 11254 --
NM_007214chr631151 1035 169 135 1221 --
NM_007249chr1366647 5911 1251 755 297 146 11791 ----
NM_007345chr1842347 2223 1715 848 --11485 --
NM_007351chr42223 72 ------
NM_012081chr533206 2378 2370 1663 ----
NM_012120chr621950 1123 2850 638 ----
NM_012137chr11844 12006 1716 --
NM_012156chr2043231 3186 2199 425 1150 ----
NM_012161chr42429 74 --11056 1977
NM_012193chr1154821 3985 3977 1989 1049 ------
NM_012238chr10121 11645 11671 --
NM_012281chr741884 1643 1555 1493 11800 ----
NM_012297chr432093 1054 330 21889 1598 136 --
NM_012301chr752013 1927 1853 702 37 ------
NM_012316chr133470 1849 578 --14628 --
NM_012395chr763344 3133 2537 625 474 439 12989 --23147 2680
NM_012428chr151763 --1171 --
NM_012446chr5----1204 --
NM_012464chr421871 83 ----12689
NM_012471chrX11306 ------
NM_013231chr1454074 3848 3019 2677 1744 168 ----
NM_013261chr432370 1358 236 --1370 --
NM_013262chr6--11371 --11361
NM_013354chr831362 1050 555 ------
NM_013381chr123730 676 265 1689 --1660
NM_013436chr22592 193 ------
NM_013438chr941644 1268 495 391 11203 11347 --
NM_014023chr1062373 2206 2116 1062 489 260 22620 1890 ----
NM_014043chr32629 265 11565 ----
NM_014044chr21183 --1158 --
NM_014048chr1645219 5172 4285 3378 25243 5184 ----
NM_014112chr864785 4577 4169 3717 3698 621 23726 650 1884 --
NM_014141chr784894 4754 3877 3359 3264 1748 1679 93 --11728 14793
NM_014154chr32205 66 --11107 --
NM_014181chr231809 845 346 ------
NM_014191chr1231019 976 319 ------
NM_014231chr122846 193 --12177 --
NM_014232chr1721449 1427 --21664 507 --
NM_014253chrX62019 959 931 895 682 298 ------
NM_014300chr151471 --1172 1416
NM_014331chr456755 6540 5262 2830 145 27802 2786 11494 11116
NM_014408chr11188 --1578 --
NM_014423chr535190 4079 226 11353 11602 --
NM_014445chr312064 --1955 --
NM_014554chr1261497 771 654 648 540 153 1433 ----
NM_014562chr2--2819 705 ----
NM_014577chr222224 51 --1195 1649
NM_014623chr6--1162 ----
NM_014637chr82369 320 ------
NM_014701chr1522603 2204 1753 23346 780 --
NM_014702chr613466 --12986 --
NM_014705chr72834 402 11591 11958 --
NM_014707chr7--1424 11553 1907
NM_014730chr1235117 3770 3299 ----14573
NM_014746chr264211 4131 3473 2677 1475 220 1535 ----
NM_014751chr841995 1874 1763 226 --21409 618 --
NM_014755chr264247 4030 1608 1116 784 341 14059 ----
NM_014803chr1021885 539 ------
NM_014819chr52714 300 --1819 --
NM_014828chr1432420 1924 488 1876 ----
NM_014830chr1233872 1233 617 1159 ----
NM_014840chr1243103 2830 934 310 ------
NM_014872chr922136 183 --2870 280 --
NM_014873chr121916 1260 11166 1699 --
NM_014876chr2221649 505 ------
NM_014877chr1747446 6485 1508 689 12800 1644 --
NM_014893chrY22381 467 ------
NM_014903chr1242247 1663 1618 292 22419 1982 ----
NM_014904chr1043955 3818 3629 471 13849 --1518
NM_014910chr191802 ------
NM_014912chr1013012 ------
NM_014920chr633302 2317 95 13687 11249 --
NM_014932chr341687 1446 1406 545 ------
NM_014935chr143388 3379 3304 955 13588 ----
NM_014949chr12972 189 ------
NM_014969chr12796 356 ------
NM_014988chr442835 2118 2060 1721 ------
NM_014989chr631878 1436 1311 ------
NM_014991chr412563 ------
NM_015020chr1622854 1486 ------
NM_015025chr232188 515 265 --1665 12350
NM_015032chr13----12853 --
NM_015035chr2066608 6328 5272 2059 1523 510 --12093 --
NM_015042chr1563536 3459 2860 2854 1132 286 1627 ----
NM_015049chr253200 2348 2307 1013 40 --21060 340 --
NM_015051chr922786 2450 --22383 682 --
NM_015074chr195001 4785 4769 3875 1621 1435 1080 962 676 --11221 13548
NM_015155chr105925 835 714 579 409 ------
NM_015156chr1453889 2922 2723 591 256 ----1129
NM_015176chr1163 2309 301 ----
NM_015215chr132455 2225 601 ------
NM_015236chr421093 586 11410 11072 --
NM_015265chr2--12409 1765 --
NM_015268chr33681 248 212 1708 ----
NM_015271chr464028 2638 1260 910 738 320 ----12870
NM_015272chr1621536 547 11439 ----
NM_015285chr1841763 1662 198 125 12556 21652 945 --
NM_015296chr13--4964 845 811 305 ----
NM_015310chr868233 6093 2714 2470 1474 637 --17314 --
NM_015313chr1134395 1257 373 11330 14582 --
NM_015336chr1242106 998 468 25 1992 11783 --
NM_015349chr632484 2237 820 2890 626 1711 --
NM_015355chr1711931 22013 1626 ----
NM_015382chr141682 ----1532
NM_015435chr821019 484 1279 ----
NM_015455chr553531 3469 2883 1502 834 ------
NM_015460chr322100 1921 ------
NM_015475chr231032 682 125 ------
NM_015477chr15--2802 793 ----
NM_015523chr11------1226
NM_015554chr1532824 2710 2227 12543 179 --
NM_015564chr533573 3398 2539 ------
NM_015565chr21135 12071 11641 --
NM_015569chr174556 4180 4066 3845 3459 856 656 ----23124 287
NM_015576chr352558 1892 1198 881 857 --1782 --
NM_015578chr1921829 103 ------
NM_015609chr112827 --21169 213 --
NM_015630chr22798 739 ------
NM_015686chrX2639 382 1931 1881 --
NM_015695chr641991 1952 1591 52 ------
NM_015713chr873564 3082 2832 2468 2329 1001 952 13389 --1980
NM_015852chr722845 1408 11114 23206 3190 13156
NM_015886chr821588 1173 35676 5493 84 --11897
NM_015906chr143860 3758 1696 840 14552 ----
NM_016076chr163034 780 616 417 407 174 ------
NM_016083chr621188 825 ------
NM_016231chr1741674 1643 1088 228 11095 ----
NM_016252chr21902 ------
NM_016275chr31201 --22391 184 --
NM_016315chr211719 11789 11365 --
NM_016322chr942334 1270 1095 88 12234 ----
NM_016351chr7------1490
NM_016396chr1531107 844 624 22734 1995 ----
NM_016424chr1721634 1582 --41377 454 408 197 --
NM_016436chr2061647 1055 245 98 64 30 --1397 --
NM_016467chr2--1460 1198 --
NM_016472chr1431143 72 38 ------
NM_016525chr92884 719 ------
NM_016529chr1331052 511 397 1874 ----
NM_016530chr1543944 3448 384 297 --12561 --
NM_016559chr31293 1469 ----
NM_016604chr54454 397 320 293 --11135 --
NM_016620chr12288 258 ------
NM_016626chr18----11349 --
NM_017420chr1423690 1023 23290 478 --1451
NM_017426chr41273 ------
NM_017520chr13184 1241 ----
NM_017542chr12398 160 11832 ----
NM_017544chrX2779 308 ------
NM_017548chr32863 173 --11990 --
NM_017549chr71126 1316 --11169
NM_017576chr9----1273 --
NM_017594chr932675 2668 971 12946 ----
NM_017610chr1521314 135 2822 274 ----
NM_017628chr475195 4286 4199 4009 1761 1536 545 23714 3358 13734 --
NM_017633chr612829 --21184 1009 --
NM_017637chr987117 6920 6622 6548 3579 3233 954 682 36320 803 298 18557 --
NM_017640chr63786 615 217 ------
NM_017650chr755814 5110 4203 1757 408 ------
NM_017651chr641558 1390 1379 484 ------
NM_017684chr1512025 --12050 11278
NM_017686chr1--1745 --1158
NM_017694chr22516 112 1171 --1629
NM_017740chr1651681 1669 1292 1192 538 ------
NM_017778chr831029 326 216 ------
NM_017813chr855617 4825 4269 2083 22 15540 14929 1252
NM_017824chr102357 326 11019 ----
NM_017893chr101474 --11079 --
NM_017944chr1141128 969 837 827 1329 ----
NM_018018chr1221276 219 --1528 --
NM_018027chr1011195 12636 1566 --
NM_018084chr232977 2932 2657 ------
NM_018121chr1033033 2603 2442 ----12980
NM_018145chr15--1401 ----
NM_018150chr13627 366 297 3121 111 84 ----
NM_018164chr12131 ------
NM_018211chr112080 11693 12238 11644
NM_018214chr6------1531
NM_018247chr642810 1161 1051 606 11025 --1110
NM_018287chr1021318 850 --11039 --
NM_018293chr352790 1904 712 617 142 12977 ----
NM_018312chr1131832 1453 191 ------
NM_018360chrX2279 145 ------
NM_018364chr173478 3195 1517 1123 448 419 147 23879 3583 1481 --
NM_018440chr868445 5705 2226 593 237 226 11193 ----
NM_018444chr832269 824 410 ------
NM_018509chr1721540 1091 --1130 --
NM_018638chr1225162 1447 --1582 --
NM_018650chr131796 655 51 ------
NM_018685chr721132 742 ------
NM_018718chr731780 557 252 12349 ----
NM_018847chr931762 1752 84 ------
NM_018970chr731173 1149 981 ------
NM_018976chr1222642 604 12379 ----
NM_018979chr1222543 2230 --21894 379 --
NM_018999chr1074943 4208 3763 3719 1962 905 37 1731 --13893
NM_019004chr7138 ----12175
NM_019018chr51132 --1773 --
NM_019071chr7------1595
NM_019080chr131218 2244 211 11454 11184
NM_019556chrX31460 1444 1338 11362 ----
NM_019613chr17------11018
NM_020122chr245945 4673 1079 125 11799 ----
NM_020177chr522851 568 --12220 --
NM_020193chr112914 232 11258 ----
NM_020205chr12427 245 --13120 --
NM_020342chr231045 980 77 1176 ----
NM_020357chr341070 312 286 136 11042 ----
NM_020432chr72894 855 --11799 --
NM_020443chr145793 5287 4856 2023 ------
NM_020463chr231046 982 585 ------
NM_020466chr644709 3590 1347 1094 ------
NM_020474chr1821669 348 11478 ----
NM_020734chr1223041 916 ------
NM_020748chr1731943 1330 60 140 1188 --
NM_020750chr621498 600 ------
NM_020765chr11284 1234 ----
NM_020768chr553206 2682 2005 405 104 ------
NM_020772chr1758674 7190 5317 2977 2784 16256 17749 1725
NM_020794chr1--1603 --1456
NM_020801chr532079 543 328 ----1233
NM_020856chr1921009 330 --193 --
NM_020858chr1512280 ------
NM_020899chr1721010 445 11633 ----
NM_020940chr1072664 2555 2354 1132 1094 227 45 1667 ----
NM_020964chr1833955 3824 1737 --14018 --
NM_021038chr362587 1240 740 681 624 214 ------
NM_021079chr172623 469 ----1293
NM_021097chr233021 904 704 11148 12374 12957
NM_021111chr911177 --1106 --
NM_021148chr7------11729
NM_021252chr1052024 1384 672 242 28 1102 ----
NM_021255chr1433163 525 428 11415 11122 --
NM_021633chr121046 222 --11086 --
NM_021914chr141615 --1850 --
NM_021947chr17------1394
NM_021961chr1142348 1344 1168 214 11230 --17299
NM_021964chr374911 4793 1554 1381 1166 722 323 26516 5124 ----
NM_021998chrX11196 ------
NM_022049chr111729 ------
NM_022066chr1731044 688 381 ------
NM_022133chr821216 118 ------
NM_022374chr22355 142 1124 ----
NM_022454chr8------1133
NM_022475chr41651 1188 ----
NM_022484chr711039 ----1350
NM_022735chr111719 21573 1406 ----
NM_022758chr652779 2363 2118 533 382 ------
NM_022771chr121239 ------
NM_022781chr943229 2871 2268 2048 --13039 --
NM_022841chr1521694 727 22498 891 12017 --
NM_022894chr2148 --21475 594 --
NM_022898chr1443344 1701 1438 400 ------
NM_022918chr11----1422 --
NM_024063chr15----1180 --
NM_024345chr936111 4261 1548 14647 1462 --
NM_024513chr363779 3719 3483 3194 2861 496 --22853 2483 --
NM_024524chr353169 3152 2998 1140 298 22367 2310 ----
NM_024551chr1222486 802 11981 1152 --
NM_024561chr131368 --1123 1561
NM_024612chr171246 11120 ----
NM_024613chr8------11786
NM_024638chr332366 936 301 --11868 --
NM_024652chr1521026 485 1823 ----
NM_024665chr354474 3685 3634 3627 870 2637 44 24636 615 24113 1171
NM_024674chr121158 1075 --1793 --
NM_024692chr231824 1179 322 ------
NM_024699chr8----1658 --
NM_024745chr16144 2200 160 ----
NM_024757chr9------1979
NM_024761chr984847 4222 3362 2065 1874 1568 1106 300 25371 3723 ----
NM_024896chr952296 811 233 177 25 22399 1741 ----
NM_024947chr3139488 9258 3618 3589 3580 3291 3088 1745 1378 1285 646 484 116 17781 ----
NM_024953chr1231896 532 243 1829 21783 561 --
NM_025054chr832986 1297 1173 ------
NM_025147chr2--2169 146 ----
NM_025160chr134092 3952 194 23074 2704 13268 --
NM_030621chr1454077 3718 2696 1609 1150 ------
NM_030625chr103891 692 197 --1500 --
NM_030627chr512891 14119 ----
NM_030650chr222922 2696 1718 1679 --
NM_030791chr142522 161 ----1296
NM_030806chr159135 8623 7996 6575 2037 38734 6002 2186 28768 2351 --
NM_030918chr165252 5031 4467 3815 2184 685 11231 ----
NM_030962chr1121443 634 ------
NM_031284chr15----1121 --
NM_031296chr422187 642 ------
NM_031435chr1233483 2734 480 --1352 --
NM_032139chr191376 --1785 --
NM_032145chr61278 124 ----
NM_032195chr211421 ----1110
NM_032199chr102910 261 ----13149
NM_032217chr4--1952 ----
NM_032229chr1331066 964 295 ------
NM_032256chr1221063 847 ------
NM_032408chr71474 1256 ----
NM_032439chr1031370 635 105 ------
NM_032440chr1052806 2443 1832 1151 169 180 1845 --
NM_032458chrX63090 2749 2643 1184 836 748 13428 ----
NM_032560chr14----11070 --
NM_032576chrY144 ------
NM_032682chr323230 2395 13012 --12284
NM_032780chr113808 191 155 ----11026
NM_032859chr1343891 3584 770 708 1928 14000 --
NM_032873chr111117 13309 12920 --
NM_032961chr411033 --11265 --
NM_032968chrX21422 795 --11227 --
NM_032973chrY21422 795 --11227 --
NM_032983chr72727 663 --1615 33025 1124 32
NM_033127chr12566 257 --1721 --
NM_033224chr766992 1748 855 838 414 335 11877 --12635
NM_033225chr83822 255 134 12222 12984 --
NM_033285chr844245 4161 1640 667 --1610 --
NM_033389chr1714055 22981 1188 14522 --
NM_033540chr311042 1963 ----
NM_052876chr1912646 1930 ----
NM_052879chr1214054 --13584 12848
NM_052900chr8158 1286 ----
NM_052905chr21536 --31892 1587 1191 --
NM_052910chr1321748 120 ------
NM_052917chr212205 2638 195 --13164
NM_052927chr51709 --11978 --
NM_053023chr1122709 449 --13289 --
NM_053064chr1423054 684 ------
NM_054033chr21485 --151 --
NM_080546chr9----1476 --
NM_080552chr20------1700
NM_080738chr11192 --11327 --
NM_080743chr642282 2129 1791 83 --2772 121 --
NM_080836chr2054536 4471 4157 3528 97 --1333 --
NM_080927chr342130 185 137 41 --1327 --
NM_101395chr2141276 1179 566 518 11034 ----
NM_133369chr51663 ----1962
NM_133468chr742471 2414 2285 643 --1449 --
NM_133496chr132960 1525 734 --13870 --
NM_133646chr253792 3443 1690 1103 1080 15234 13674 --
NM_138286chr1934135 3419 1435 ----21763 1741
NM_138288chr142861 326 ----1400
NM_138340chr182263 239 --1428 --
NM_138423chr1531891 468 345 21611 162 ----
NM_138444chr1344048 1694 1108 918 14668 14388 --
NM_138731chr1433808 3650 1269 13925 ----
NM_138782chr532334 2085 227 11789 ----
NM_139246chr942166 1644 1597 288 12045 ----
NM_144571chr496295 4906 4778 4546 2596 1334 491 157 145 --15087 --
NM_144578chr1451002 768 169 57 45 168 ----
NM_144778chr13--167 ----
NM_144967chrX1913 --151 --
NM_145259chr242520 1933 1476 339 47117 2282 1487 1055 26000 844 --
NM_145912chr2274718 4378 2959 1543 1426 681 509 ------
NM_147128chr72261 102 ------
NM_152271chr82804 78 1760 ----
NM_152409chr573333 2919 2507 2477 2234 790 748 31409 684 206 ----
NM_152470chr1832833 2803 120 --13774 --
NM_152556chr722570 2189 ------
NM_152622chr523161 907 13438 11123 --
NM_152638chr1221107 414 ------
NM_152641chr121406 --12809 --
NM_152722chr111646 11861 ----
NM_152745chr73434 277 256 21163 915 ----
NM_152756chr513773 1784 23057 139 --
NM_152758chr872993 2842 2093 938 667 284 164 11093 ----
NM_152787chrX53278 2825 2803 1380 1087 13934 1634 --
NM_152890chr11859 ----1465
NM_153207chr1243895 3327 3146 85 --13355 --
NM_153208chr16----1942 1867
NM_153367chr1023123 660 --11358 13019
NM_153607chr573002 2159 1964 885 592 455 256 ------
NM_153619chr1533518 2591 727 --1487 --
NM_170665chr1254516 1495 1229 1142 1046 --22782 807 --
NM_172071chr167196 6516 6250 5559 2337 53 21218 171 ----
NM_173156chr121584 816 ------
NM_173355chr221003 905 21032 321 ----
NM_173473chr1031906 1763 118 1866 --1305
NM_173531chr1923596 2520 ------
NM_173552chr32895 311 --1753 1550
NM_173576chr1042085 614 556 290 ------
NM_173582chr1135789 4109 1243 --25244 37 12280
NM_173602chr122728 237 2564 286 11015 --
NM_173822chr211587 --1332 --
NM_174916chr151675 12337 ----
NM_175061chr762097 755 302 262 188 180 ------
NM_175709chr2252943 2925 2689 918 888 ------
NM_175852chr132533 1962 820 1166 ----
NM_178313chr232193 568 352 11421 1763 --
NM_178505chr1023114 432 ----1611
NM_178826chr123769 600 249 3634 607 575 ----
NM_181354chr81439 1640 1662 11724
NM_181358chr143857 3846 2826 1487 11270 ----
NM_181504chr5--43899 3118 3109 715 1540 --
NM_181552chr71922 1351 ----
NM_181706chr1112390 --11552 12139
NM_181712chr131725 353 345 1133 ----
NM_181789chr1511173 22282 2228 ----
NM_182515chr1935782 4851 2251 --24694 2580 22545 1859
NM_182663chr12674 448 ----22011 693
NM_182765chr1032013 749 166 ------
NM_182767chr1221632 440 --1230 --
NM_182970chr2053806 3255 1431 1248 683 --180 --
NM_194247chr223144 259 --12841 11779
NM_197941chr573043 2899 2496 2140 973 843 678 11181 ----
NM_198279chrX21241 831 1977 ----
NM_198503chr132309 1928 69 11789 ----
NM_198859chr344184 1905 512 201 --14257 --
NM_199072chr752458 2433 989 426 72 ------
NM_199168chr1031228 433 240 --1134 --
NM_199229chr2----1318 11636
NM_203301chr1431588 1564 1245 11541 ----
NM_203364chr111945 --1838 11244
NM_203459chr122601 1706 ------
NM_205833chrX------1925
NM_206853chr633415 1334 779 2582 127 ----
NM_206854chr654676 3405 2040 461 373 21843 1388 ----
NM_207015chr322286 173 11692 --1342
NM_207311chr12--11173 11262 --
NM_207406chr425339 2169 14364 ----
NM_213589chr265048 4980 3693 3433 1567 299 --11443 --