TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4633-3p
miRNA Sequence: AGGAGCUAGCCAGGCAUAUGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr53927 269 37 ------
NM_000020chr1262207 1876 1630 1574 228 214 41551 525 475 298 --11536
NM_000021chr142943 128 ------
NM_000024chr51210 1496 ----
NM_000037chr8--32256 1946 1557 21951 1657 --
NM_000051chr1153224 2588 1290 956 758 --1972 --
NM_000052chrX62634 2439 1072 714 186 175 --1807 12556
NM_000068chr192451 71 --11140 --
NM_000081chr131846 1576 624 ------
NM_000084chrX146576 6530 6286 4852 4663 2658 2645 2616 2554 2535 2074 1890 824 667 --25227 1744 26424 6303
NM_000092chr283613 3312 3069 2957 1803 1659 1012 592 ----13952
NM_000104chr22196 80 ------
NM_000109chrX31863 1828 1064 32079 1994 903 12320 --
NM_000115chr1332372 1000 909 --1264 --
NM_000125chr684077 3501 3032 1217 791 683 397 230 22948 863 2434 276 12918
NM_000129chr641069 259 251 239 1129 181 --
NM_000138chr1551780 1661 545 537 175 1502 ----
NM_000161chr1411490 --1651 --
NM_000165chr6--21644 267 ----
NM_000168chr732826 694 87 ----21005 962
NM_000176chr553052 2449 629 622 48 --13142 --
NM_000183chr2----298 91 --
NM_000189chr222009 813 1200 11921 --
NM_000192chr121171 ------
NM_000194chrX3554 209 77 ------
NM_000214chr2051558 414 300 265 50 ------
NM_000216chrX63090 1402 1375 817 616 209 12521 ----
NM_000217chr1223474 1613 ------
NM_000220chr11143 ------
NM_000240chrX21628 653 1194 1808 --
NM_000244chr113491 303 41 1788 ----
NM_000248chr331987 514 265 --32051 2019 1926 --
NM_000259chr1575714 5499 4095 3881 1868 1455 1056 22434 1801 ----
NM_000266chrX3853 261 194 ------
NM_000267chr1753317 2812 2741 2389 367 ----1987
NM_000278chr1021560 40 32084 1769 27 1767 --
NM_000284chrX51894 1866 1495 773 651 1447 ----
NM_000286chr172647 334 ------
NM_000291chrX2331 296 --122 --
NM_000293chr164718 651 306 22 ------
NM_000304chr171939 ------
NM_000314chr1033135 2848 1050 --12688 --
NM_000315chr11--177 ----
NM_000321chr1321383 116 11240 --11375
NM_000325chr41160 ------
NM_000328chrX2455 131 ------
NM_000330chrX3873 435 158 1707 ----
NM_000332chr696940 6318 5478 5199 4524 1270 1015 959 30 2541 240 24362 2294 16643
NM_000334chr1732176 426 51 2535 214 4712 699 598 114 --
NM_000337chr565848 4707 2313 1348 511 465 --15976 26281 4864
NM_000340chr321316 1283 21052 447 1269 --
NM_000346chr171570 ------
NM_000351chrX43879 3747 2943 1046 22911 545 12992 --
NM_000361chr2021500 438 21536 1311 127 --
NM_000362chr2263332 2942 2398 1302 981 48 12923 22711 1431 --
NM_000368chr964670 4237 702 618 401 275 ------
NM_000390chrX23042 2522 13228 ----
NM_000399chr10129 --11106 --
NM_000408chr262336 2287 2266 991 663 205 --12741 --
NM_000430chr1743616 3187 749 78 ------
NM_000439chr52410 278 ------
NM_000444chrX1345 ------
NM_000449chr131213 1012 423 11080 11333 1399
NM_000452chr131779 130 22019 1514 --
NM_000461chr3114578 4325 3580 3231 1855 1627 1336 1180 1115 885 289 --169 --
NM_000489chrX32999 2710 521 ------
NM_000494chr103336 295 23 1202 ----
NM_000516chr201229 ------
NM_000523chr23756 189 153 11009 1472 --
NM_000533chrX21704 1438 --11483 --
NM_000536chr111549 ------
NM_000539chr351512 1437 1394 162 120 11379 ----
NM_000555chrX137825 7816 6887 6872 5875 4975 3142 2888 2571 1820 1184 997 494 22629 1842 12293 --
NM_000589chr5130 ------
NM_000599chr274475 4271 4048 3759 3664 1624 1084 13697 33139 1676 1062 --
NM_000609chr1072793 2704 2390 2355 2158 302 45 12522 ----
NM_000610chr1142253 1978 817 247 1962 12570 --
NM_000611chr11136412 6100 5624 5260 5009 4843 4780 4479 2506 2259 1484 1050 124 16634 24409 337 --
NM_000615chr1132368 1965 627 153 ----
NM_000618chr1246640 4655 4061 761 15950 34254 4164 2057 --
NM_000618chr1246640 4655 4061 761 15950 34254 4164 2057 --
NM_000633chr1875049 4805 4236 4223 3577 3355 844 11540 13475 1337
NM_000680chr8173 ------
NM_000689chr9128 --2340 166 --
NM_000719chr1296304 5426 5106 4471 4439 688 663 609 515 36618 6470 4750 15616 --
NM_000721chr162080 1684 905 449 394 217 12010 ----
NM_000723chr1741249 501 358 165 11604 ----
NM_000756chr82386 114 ------
NM_000793chr1444520 4336 536 404 34449 1925 149 11604 --
NM_000800chr511535 1454 1409 --
NM_000801chr20--2933 790 2962 26 --
NM_000806chr531983 1449 522 ------
NM_000807chr41128 ----1675
NM_000813chr545255 5018 1769 895 35106 4564 816 ----
NM_000814chr15--1792 23926 2719 --
NM_000827chr541652 1597 771 42 ------
NM_000829chr1132249 1879 1650 ------
NM_000831chr195944 5605 4955 4160 4069 4016 1978 1822 356 85736 5635 5513 5057 4759 1920 1673 1415 15489 13885
NM_000834chr1231135 399 334 ------
NM_000838chr632717 849 543 12162 --12297
NM_000859chr531296 646 143 --11225 --
NM_000868chrX32204 707 128 ------
NM_000872chr102512 62 2298 235 ----
NM_000875chr1555931 5814 4665 970 149 --14744 --
NM_000883chr72448 116 ------
NM_000883chr72448 116 ------
NM_000899chr1244241 3728 1540 376 --11592 1343
NM_000901chr422294 2195 ----1972
NM_000921chr122267 217 1519 ----
NM_000922chr112807 311 ------
NM_000926chr1158324 8091 7982 5822 3212 27908 7384 --27715 2628
NM_000944chr41112 ------
NM_000945chr241366 732 708 351 ------
NM_000949chr53648 115 108 ------
NM_000950chrX23500 2845 11457 --12892
NM_000959chr123421 3018 ----12711
NM_000962chr962739 2296 2217 1015 967 440 1689 ----
NM_000965chr341209 1139 350 246 146 ----
NM_001001132chr2121177 359 --11475 --
NM_001001389chr1142253 1978 817 247 1962 12570 --
NM_001001390chr1142253 1978 817 247 1962 12570 --
NM_001001391chr1142253 1978 817 247 1962 12570 --
NM_001001392chr1142299 2024 863 293 11008 12616 --
NM_001001395chr1232656 2592 2242 11880 ----
NM_001001396chr163947 3858 1503 1322 256 239 34298 3555 56 12976 1981
NM_001001419chr543495 2091 1310 350 ----11056
NM_001001420chr543495 2091 1310 350 ----11056
NM_001001433chr2082817 2694 2343 2267 2097 1141 1066 563 1663 ----
NM_001001481chr813494 1292 23044 721 --
NM_001001484chr1011771 11734 1461 --
NM_001001521chr21212 ------
NM_001001522chr112157 42 ------
NM_001001523chr13347 266 118 1987 ----
NM_001001549chr742786 2480 1919 579 12504 12779 --
NM_001001550chr742786 2480 1919 579 12504 12779 --
NM_001001555chr742786 2480 1919 579 12504 12779 --
NM_001001556chr1531297 510 155 ------
NM_001001557chr81694 --11584 --
NM_001001586chr1------1387
NM_001001664chr223973 1347 13670 --1310
NM_001001668chr1933840 969 574 --13737 --
NM_001001852chr222311 187 ------
NM_001001890chr2123464 1002 13537 --11140
NM_001001933chr12507 251 ------
NM_001001974chr1021997 1912 1676 12062 --
NM_001001995chrX51812 1543 1510 544 40 1468 --11938
NM_001002031chr122100 27 ------
NM_001002243chr21942 ------
NM_001002265chr102264 212 ------
NM_001002266chr102264 212 ------
NM_001002269chr91453 ------
NM_001002295chr10----1942 --
NM_001002814chr861146 1024 537 478 386 99 --12824 --
NM_001002838chrX2652 341 --11354 --
NM_001002860chr1444174 3218 540 460 14184 13126 --
NM_001002909chr1742080 903 844 592 ------
NM_001003407chr10145014 4790 4562 2045 2010 1806 1689 1625 1366 1259 1143 945 608 562 1792 ----
NM_001003408chr10145014 4790 4562 2045 2010 1806 1689 1625 1366 1259 1143 945 608 562 1792 ----
NM_001003674chr18126948 6736 6655 6464 4372 2660 2291 2219 1881 1196 1161 550 35585 2482 862 12487 --
NM_001003675chr18126948 6736 6655 6464 4372 2660 2291 2219 1881 1196 1161 550 35585 2482 862 12487 --
NM_001003682chr151362 1219 1097 1028 409 ----11226
NM_001003683chr2--139 ----
NM_001003712chr1231282 911 232 ------
NM_001003792chr311017 ------
NM_001003793chr311017 ------
NM_001003794chr393023 2828 2770 2514 2494 2474 575 487 310 ----11891
NM_001003800chr922410 1308 11123 11507 --
NM_001003810chr41776 --179 --
NM_001003845chr23422 224 168 1484 ----
NM_001003891chr221109 ------
NM_001004065chr932468 715 631 ------
NM_001004127chr131350 1894 ----
NM_001004304chr1262997 2835 2683 2546 485 173 12024 2519 308 --
NM_001004323chr71129 ------
NM_001004342chr1105878 5750 5442 4385 2451 2299 2223 1936 1246 909 22015 1456 42143 2032 976 510 --
NM_001004419chr1234100 1273 488 13780 --1340
NM_001005266chr15163 ------
NM_001005267chr15163 ------
NM_001005268chr15163 ------
NM_001005269chr15163 ------
NM_001005271chr174816 736 368 147 ------
NM_001005273chr174816 736 368 147 ------
NM_001005354chr12--159 ----
NM_001005366chr121682 ------
NM_001005386chr231879 1581 511 --22213 1620 --
NM_001005404chr173911 897 556 13879 --12838
NM_001005463chr1022431 729 11973 ----
NM_001005473chr546219 4692 4113 1330 15542 14287 --
NM_001005474chr32277 129 ------
NM_001005476chr2--1194 ----
NM_001005732chr21273 32 ------
NM_001005733chr213224 73 32 ------
NM_001005739chr22645 26 ------
NM_001005743chr1421159 544 ------
NM_001005744chr1421159 544 ------
NM_001005745chr1421159 544 ------
NM_001005753chr232059 931 650 12361 ----
NM_001005782chr2158 1742 ----
NM_001006600chr531976 1633 387 ------
NM_001006612chrX143 ------
NM_001006613chrX143 ------
NM_001006614chrX143 ------
NM_001006641chr931138 330 250 --21560 1325 --
NM_001006642chr931138 330 250 --21560 1325 --
NM_001006643chr931138 330 250 --21560 1325 --
NM_001007023chr1444520 4336 536 404 34449 1925 149 11604 --
NM_001007024chr1764003 3684 3654 3344 2803 955 13694 24318 4179 --
NM_001007025chr1764003 3684 3654 3344 2803 955 13694 24318 4179 --
NM_001007097chr984649 3746 3313 1522 1418 688 645 280 14500 ----
NM_001007098chr12651 315 ----1309
NM_001007156chr1541683 771 428 246 41849 1652 1270 72 11262 --
NM_001007237chr11139 ----1268
NM_001007246chr2141546 782 535 286 --2759 368 --
NM_001007277chr112176 72 154 ----
NM_001007464chr61128 ------
NM_001007466chr654913 4400 3875 2021 897 13604 --13502
NM_001007546chr241223 373 301 214 11480 --11046
NM_001007553chr11811 --1958 --
NM_001007565chr3----1274 --
NM_001008220chr573273 1400 665 506 446 209 152 ----12712
NM_001008239chr1863217 2714 2642 2502 2414 1408 21138 91 --185
NM_001008401chr1921445 1208 ----11426
NM_001008407chr751806 1496 675 250 62 --11188 --
NM_001008408chr776099 5995 5960 5852 3962 1854 867 11902 25555 773 --
NM_001008495chr81705 --1503 --
NM_001008564chr131523 21472 890 ----
NM_001008701chr1952762 2309 764 610 386 32443 2274 224 ----
NM_001008707chr142372 141 11246 ----
NM_001008777chr171224 ------
NM_001008783chr61623 ------
NM_001008801chr1911341 1568 --12106
NM_001008860chr154848 809 749 178 ------
NM_001008892chr154848 809 749 178 ------
NM_001008894chr154848 809 749 178 ------
NM_001008895chr132290 207 11329 2398 133 --
NM_001008925chr453164 3045 1336 754 531 ----1368
NM_001008938chr112385 329 ------
NM_001009554chr464565 4422 3648 1849 1315 680 12884 13256 --
NM_001009554chr464565 4422 3648 1849 1315 680 12884 13256 --
NM_001009566chr131284 577 164 ------
NM_001009812chr2--177 ----
NM_001009880chr2284863 4772 4746 4370 4172 3354 1604 1171 1597 ----
NM_001009881chr11173 ------
NM_001009882chr11173 ------
NM_001009899chr3115189 4655 4397 2434 2302 2043 1973 1358 1011 455 414 22542 1410 14694 --
NM_001009909chr1153709 2816 2449 1433 1013 11513 ----
NM_001009955chr11406 ------
NM_001009955chr11406 ------
NM_001009958chr73219 67 33 ------
NM_001009960chr772562 2469 2305 1116 1107 768 116 ------
NM_001009993chr222782 953 13843 ----
NM_001010000chr1832902 2544 1190 ------
NM_001010861chr11171 1857 ----
NM_001010888chrX64176 3475 3282 2879 1713 930 21467 1330 ----
NM_001010891chr575721 5631 5466 4878 2485 929 175 --26743 4512 --
NM_001010898chr173549 3176 3068 2643 2472 441 199 --23433 2672 --
NM_001010935chr12167 22 --1799 --
NM_001010942chr1231235 462 415 --123 --
NM_001010980chr12532 94 183 22231 778 --
NM_001011513chr442941 1152 961 538 ------
NM_001011515chr431049 779 187 ------
NM_001011516chr431049 779 187 ------
NM_001011537chr332404 1797 228 ------
NM_001011546chr20129 ------
NM_001011553chr7--1212 ----
NM_001011666chr7116146 5809 5685 5658 5347 4688 4533 4491 4348 1923 635 35722 4551 4433 ----
NM_001011708chr242742 2541 1101 881 --11789 12092
NM_001011722chr11451 ------
NM_001011722chr11451 ------
NM_001012329chr151771 1589 491 350 341 --22224 59 12380
NM_001012333chr112317 114 ------
NM_001012334chr112317 114 ------
NM_001012398chr163414 220 54 1886 ----
NM_001012426chr692092 941 914 793 705 505 406 322 140 1859 --1632
NM_001012427chr692092 941 914 793 705 505 406 322 140 1859 --1632
NM_001012514chr2188 ------
NM_001012516chr2188 ------
NM_001012732chr421004 297 --11262 11021
NM_001012755chrX53134 1092 348 136 65 ------
NM_001013031chr1062414 1001 494 399 340 143 13047 1504 --
NM_001013399chr63311 264 98 ------
NM_001013438chr33805 268 168 ------
NM_001013439chr32651 114 ------
NM_001013624chr173980 952 846 1106 1336 --
NM_001013690chr1282286 2179 2141 1768 756 618 525 484 ------
NM_001013693chr172673 2629 2547 2277 730 403 171 2795 782 1255 --
NM_001013693chr172673 2629 2547 2277 730 403 171 2795 782 1255 --
NM_001013843chr152348 172 --1334 --
NM_001014283chr136867 635 332 233 185 68 2746 566 ----
NM_001014431chr14131 ------
NM_001014432chr14131 ------
NM_001015045chr452340 1970 1585 143 71 --11926 --
NM_001015877chrX22626 317 1620 ----
NM_001015881chrX31258 266 52 1390 174 --
NM_001017368chr1762818 2560 2161 2090 1025 712 12421 ----
NM_001017369chr431099 804 259 ------
NM_001017371chr21494 ------
NM_001017395chr323397 2710 13264 13024 --
NM_001017415chr1184 --1215 --
NM_001017416chr1184 --1215 --
NM_001017424chr11336 ------
NM_001017425chr11336 ------
NM_001017440chr7127909 7569 7521 7492 7121 6697 6362 5964 5313 3101 3010 1825 35165 448 175 11423 --
NM_001017923chr1451201 1154 669 520 98 ------
NM_001017926chr841779 1368 1269 1181 ------
NM_001017969chr91164 ------
NM_001017975chr13198 126 86 ------
NM_001017979chr43165 102 28 ------
NM_001017995chr584567 4203 4153 1873 758 727 604 95 54863 4089 3348 1829 537 11587 14271
NM_001017999chr121793 638 --12150 --
NM_001017999chr121793 638 --12150 --
NM_001018000chr121793 638 --12150 --
NM_001018000chr121793 638 --12150 --
NM_001018001chr121793 638 --12150 --
NM_001018005chr152160 65 ------
NM_001018008chr151481 ------
NM_001018009chr31171 --1280 --
NM_001018050chr2222106 685 ------
NM_001018052chr2222106 685 ------
NM_001018057chr1131370 550 162 ------
NM_001018064chr91142 --11921 --
NM_001018065chr995696 5556 5440 5407 4333 4113 2428 321 25 --34903 3736 138 --
NM_001018066chr995696 5556 5440 5407 4333 4113 2428 321 25 --34903 3736 138 --
NM_001018067chr185143 4672 4254 3996 3450 2068 687 389 --14607 --
NM_001018068chr185143 4672 4254 3996 3450 2068 687 389 --14607 --
NM_001018069chr185143 4672 4254 3996 3450 2068 687 389 --14607 --
NM_001018074chr553052 2449 629 622 48 --13142 --
NM_001018075chr553052 2449 629 622 48 --13142 --
NM_001018076chr553052 2449 629 622 48 --13142 --
NM_001018077chr553052 2449 629 622 48 --13142 --
NM_001018108chr1521487 265 --11581 12095
NM_001018111chr763763 2650 1535 1251 542 510 23254 41 ----
NM_001018676chr8------1175
NM_001018677chr8------1175
NM_001020658chr121205 403 1603 1437 --
NM_001020658chr121205 403 1603 1437 --
NM_001020825chr51527 ------
NM_001023567chr155884 733 465 455 347 ------
NM_001023587chr31298 1161 ----
NM_001024024chr141151 --136 --
NM_001024070chr141147 --132 --
NM_001024071chr141119 ------
NM_001024094chr553052 2449 629 622 48 --13142 --
NM_001024218chr141279 ------
NM_001024226chr11931 ------
NM_001024227chr11931 ------
NM_001024228chr11931 ------
NM_001024380chr822518 42 12034 1838 --
NM_001024381chr822518 42 12034 1838 --
NM_001024463chr152254 227 --1332 1752
NM_001024647chr1296674 5777 5601 5210 5148 2742 2403 2101 1494 26117 1604 46870 6498 369 306 --
NM_001024649chr562808 2110 831 691 685 540 1129 ----
NM_001024666chrX1580 ------
NM_001024668chr121885 ------
NM_001024847chr311906 2711 540 12291 1350
NM_001024858chr1452527 2380 2270 236 229 22475 2300 2554 209 --
NM_001024934chr61456 ------
NM_001024935chr61456 ------
NM_001024936chr61456 ------
NM_001024937chr174772 244 225 42 ------
NM_001024947chr52407 206 ------
NM_001024948chr123291 705 12319 1625 --
NM_001025076chr1095896 5117 4945 2249 2235 2104 573 66 37 35163 2204 1120 15520 15398
NM_001025077chr1077254 6475 6303 1931 1424 1284 37 26521 2478 16878 16756
NM_001025079chr343535 3449 2628 2553 ------
NM_001025081chr1831141 451 36 ------
NM_001025090chr1831141 451 36 ------
NM_001025092chr1831141 451 36 ------
NM_001025101chr1831141 451 36 ------
NM_001025105chr5180 ------
NM_001025108chr262748 2543 1189 964 212 48 --12788 --
NM_001025201chr22733 522 ------
NM_001025205chr33354 316 186 1419 ----
NM_001025233chr1242509 2429 1013 454 12144 ----
NM_001025252chr822261 112 --22935 2880 --
NM_001025253chr822261 112 --22935 2880 --
NM_001025266chr374724 4468 4223 3794 1649 802 607 14442 21322 154 --
NM_001025366chr621479 1440 --11502 --
NM_001025366chr621479 1440 --11502 --
NM_001025367chr621479 1440 --11502 --
NM_001025367chr621479 1440 --11502 --
NM_001025368chr621479 1440 --11502 --
NM_001025368chr621479 1440 --11502 --
NM_001025369chr621495 1456 --11518 --
NM_001025369chr621495 1456 --11518 --
NM_001025370chr621479 1440 --11502 --
NM_001025370chr621479 1440 --11502 --
NM_001025580chrX52625 1682 1247 641 133 --14024 11089
NM_001025595chr431623 1321 536 1521 ----
NM_001025596chr111124 ------
NM_001025603chr131213 1012 423 11080 11333 1399
NM_001025616chr42331 31 21251 345 ----
NM_001029858chr6--32649 2086 488 ----
NM_001029863chr643082 2007 1193 835 12259 ----
NM_001029864chr202368 77 --11689 31706 260 169
NM_001029875chr532012 889 725 1577 32425 2076 371 12066
NM_001029989chr154721 225 170 67 ------
NM_001030006chr1742355 2188 1978 524 11651 1176 --
NM_001030007chr1653705 3416 2832 766 572 13860 11226 --
NM_001030055chr1433141 1755 1430 --12970 --
NM_001030272chr112313 98 ------
NM_001030273chr112313 98 ------
NM_001031677chr54481 386 341 62 ------
NM_001031679chr1263463 3170 2643 2303 688 202 ------
NM_001031684chr221468 940 --1440 --
NM_001031685chr12337 111 ------
NM_001031695chr2275319 5233 3322 1690 1283 851 311 --23397 1607 --
NM_001031711chr571818 1462 1454 1425 349 217 146 11177 ----
NM_001031723chr4----1156 1401
NM_001031732chr483502 3482 3342 2911 2846 2722 2416 1149 ----13392
NM_001031740chr131731 1425 338 1600 --11151
NM_001031804chr1664162 3544 1669 308 268 77 1716 ----
NM_001031835chr162306 22 ------
NM_001032221chr931197 78 55 ----11133
NM_001032280chr6175 1571 ----
NM_001032283chr12----1234 --
NM_001032284chr12----1234 --
NM_001032288chr2021524 124 ------
NM_001032293chr172492 75 ------
NM_001032380chr1031841 1486 106 11371 ----
NM_001032393chrX2569 145 ------
NM_001032394chr642660 2645 2405 2076 12219 --32181 2136 1735
NM_001032395chr642527 2512 2272 1943 12086 --22048 2003
NM_001032999chr20115119 4885 4711 4676 4486 4356 4290 4185 1945 1431 310 23933 971 21265 441 --
NM_001033047chr42973 490 1768 ----
NM_001033057chr322038 1963 ------
NM_001033081chr171685 1480 1429 1300 464 284 188 21278 349 1293 --
NM_001033082chr171685 1480 1429 1300 464 284 188 21278 349 1293 --
NM_001033085chr21213 ------
NM_001033087chr2042647 1119 892 33 ------
NM_001033112chr5183 1367 ----
NM_001033503chr52432 198 ------
NM_001033506chr111171 ------
NM_001033507chr161484 630 577 332 152 31 11555 ----
NM_001033518chr722309 220 11066 1836 --
NM_001033519chr722309 220 11066 1836 --
NM_001033520chr722309 220 11066 1836 --
NM_001033554chr17135 ------
NM_001033557chr231154 1117 464 ------
NM_001033602chr1331889 651 27 --22298 504 --
NM_001033723chr822194 762 22379 1846 12463 --
NM_001033756chr621413 1374 1715 11436 --
NM_001033756chr621413 1374 1715 11436 --
NM_001033925chr1032101 1692 169 ------
NM_001034845chr421010 225 ------
NM_001034852chr1442075 1455 631 369 ------
NM_001035chr121275 137 ------
NM_001035003chr411137 ----1523
NM_001035004chr411137 ----1523
NM_001035511chr13498 461 246 --1212 --
NM_001035512chr13605 568 353 --1319 --
NM_001035513chr13605 568 353 --1319 --
NM_001035534chr931102 941 69 ------
NM_001037132chr712136 --1622 --
NM_001037133chr712136 --1622 --
NM_001037164chr731734 1519 574 11270 ----
NM_001037317chr11171 1857 ----
NM_001037331chr181796 1129 ----
NM_001037334chr1831520 768 705 --11737 --
NM_001037339chr111314 ------
NM_001037340chr111314 ------
NM_001037341chr111314 ------
NM_001037341chr111314 ------
NM_001037582chr421255 589 --21476 68 --
NM_001037954chr11103302 3120 3003 2674 2493 2246 1384 802 223 123 ------
NM_001038640chr152951 913 --1800 --
NM_001038707chr151803 1763 633 431 313 22025 1557 1779 --
NM_001038707chr151803 1763 633 431 313 22025 1557 1779 --
NM_001039350chr751723 1528 1430 168 31 --11118 --
NM_001039366chr22254 32 1183 190 --
NM_001039459chr7--2911 207 ----
NM_001039465chr142392 330 1413 ----
NM_001039479chr1431515 226 45 11911 127 --
NM_001039492chr22389 171 ------
NM_001039538chr233636 3380 47 12935 ----
NM_001039547chr357389 5492 2070 1991 355 1118 ----
NM_001039550chr21604 2666 37 1202 --
NM_001039577chr173980 3867 3708 3302 2811 874 93 --34424 1793 1089 --
NM_001039585chr133678 3275 260 ----22968 189
NM_001039590chrX34012 2875 397 --11160 --
NM_001039591chrX34012 2875 397 --11160 --
NM_001039618chr1165084 4972 4523 1925 653 245 --1537 --
NM_001039619chr14--140 ----
NM_001039690chr1632159 1681 868 1221 22016 959 --
NM_001039693chr2--13905 14089 --
NM_001039709chr20115119 4885 4711 4676 4486 4356 4290 4185 1945 1431 310 23933 971 21265 441 --
NM_001039711chr11377 --11058 --
NM_001039712chr11377 --11058 --
NM_001039762chr1011587 ------
NM_001039771chr142894 335 --1104 --
NM_001039840chrX35491 4572 423 13982 14262 --
NM_001039916chr121256 --1845 1108
NM_001039917chr121256 --1845 1108
NM_001039918chr121256 --1845 1108
NM_001039919chr121256 --1845 1108
NM_001039920chr121256 --1845 1108
NM_001039937chr1311370 1960 13735 --
NM_001039960chr1241416 1164 480 452 --1300 --
NM_001040020chr7--11540 ----
NM_001040057chr721511 971 ------
NM_001040101chr421469 211 --1248 --
NM_001040102chr104994 743 527 123 12056 ----
NM_001040103chr104994 743 527 123 12056 ----
NM_001040110chr741673 1471 1451 751 1627 ----
NM_001040118chr113456 444 23 ------
NM_001040144chr1632159 1681 868 1221 22016 959 --
NM_001040146chr1632159 1681 868 1221 22016 959 --
NM_001040152chr744090 3130 1204 694 24404 821 --12012
NM_001040214chr62698 411 21616 708 ----
NM_001040260chr431120 868 741 1301 ----
NM_001040261chr431120 868 741 1301 ----
NM_001040272chr942095 759 282 269 12160 ----
NM_001040284chr1685172 4861 4704 3845 3699 1552 1525 669 11039 14521 14644
NM_001040402chr432056 677 155 ------
NM_001040424chr2151950 1196 1109 929 122 1226 12600 --
NM_001040429chr1333417 2470 923 12305 ----
NM_001040441chr185020 4467 3713 1827 1646 792 612 217 22109 2041 ----
NM_001040446chr532615 943 149 1560 12031 --
NM_001040450chr1542039 1046 863 534 ------
NM_001040453chr1542039 1046 863 534 ------
NM_001040624chr841876 851 607 153 1363 22731 2064 --
NM_001040625chr841876 851 607 153 1363 22731 2064 --
NM_001040626chr841876 851 607 153 1363 22731 2064 --
NM_001040627chr841876 851 607 153 1363 22731 2064 --
NM_001040628chr841876 851 607 153 1363 22731 2064 --
NM_001040629chr841876 851 607 153 1363 22731 2064 --
NM_001040630chr841876 851 607 153 1363 22731 2064 --
NM_001040665chr733062 2012 1148 13299 1801 --
NM_001040709chr111919 21846 691 ----
NM_001040712chr912523 13586 12926 --
NM_001040715chr1641168 791 453 244 144 ----
NM_001042355chr1643833 2141 1374 707 24946 1025 11612 --
NM_001042361chr101177 ------
NM_001042364chr101177 ------
NM_001042365chr101177 ------
NM_001042387chr101177 ------
NM_001042388chr182746 85 ------
NM_001042393chr101177 ------
NM_001042396chr101177 ------
NM_001042397chr101177 ------
NM_001042403chr122861 263 ------
NM_001042412chr1643833 2141 1374 707 24946 1025 11612 --
NM_001042413chr92998 166 11249 ----
NM_001042425chr6175 1571 ----
NM_001042453chrX--2393 90 ----
NM_001042475chr61328 ------
NM_001042479chrX11734 11324 --1401
NM_001042480chrX11734 11324 --1401
NM_001042481chr1422269 323 31821 700 682 1113 --
NM_001042492chr1753317 2812 2741 2389 367 ----1987
NM_001042537chrX1743 ------
NM_001042539chr1641120 237 150 117 2956 183 ----
NM_001042550chr921829 1338 ------
NM_001042555chr1254509 3844 1285 1173 551 ------
NM_001042599chr267717 7696 7223 6807 2516 740 ------
NM_001042601chr32999 786 12054 ----
NM_001042604chr374303 3750 3449 1549 1039 853 504 2950 888 ----
NM_001042610chr1661413 1262 1195 1141 143 24 1106 ----
NM_001042632chr2021778 1698 2778 577 ----
NM_001042633chr2021778 1698 2778 577 ----
NM_001042669chr42331 31 21251 345 ----
NM_001042681chr152238 2053 2025 1744 266 12472 12425 --
NM_001042682chr152238 2053 2025 1744 266 12472 12425 --
NM_001042682chr152238 2053 2025 1744 266 12472 12425 --
NM_001042683chr6----21435 1211 --
NM_001042749chrX1623 ------
NM_001042750chrX1623 ------
NM_001042751chrX1623 ------
NM_001043318chr1463213 2674 1260 663 224 118 1651 ----
NM_001044305chr631437 1370 1161 11181 166 1303
NM_001044385chr253848 2733 843 751 504 ----11261
NM_001045556chr811281 21185 47 ----
NM_001045557chr811281 21185 47 ----
NM_001046chr542884 2652 2633 2586 ------
NM_001050chr17157 1522 11113 --
NM_001071775chr133287 145 37 1228 1279 --
NM_001077628chr11164 ------
NM_001083621chr1134731 4613 4458 3290 1798 1519 1066 940 782 671 654 155 110 13421 24627 852 --
NM_001092chr1771939 1625 1564 839 550 419 128 ------
NM_001095chr1221606 1197 --1284 --
NM_001096chr17--1190 ----
NM_001099678chr344748 2557 2183 991 15884 ----
NM_001100108chr1127468 6627 6065 5817 5425 5262 5241 2481 1805 1676 1630 936 ------
NM_001106chr3119558 9268 9163 9125 7668 6638 6219 5926 3413 2515 1178 28542 1858 12660 37656 7102 6724
NM_001113490chrX42897 2759 2310 1104 12974 --23615 1262
NM_001116chr1672816 2751 2063 1993 1138 970 584 ------
NM_001117chr1822402 1819 11555 ----
NM_001122631chr111543 ------
NM_001122679chr53927 269 37 ------
NM_001128chr1653705 3416 2832 766 572 13860 11226 --
NM_001130chr193909 715 173 ------
NM_001148chr42223 125 ------
NM_001159chr22703 637 ------
NM_001160chr1252777 2437 1723 162 93 ------
NM_001167chrX56026 5577 4166 2401 1970 ------
NM_001173chr1433141 1755 1430 --12970 --
NM_001178chr112313 98 ------
NM_001189chr42420 45 21117 126 ----
NM_001191chr2031429 1105 203 --11377 --
NM_001204chr286784 5365 4837 2110 1656 1114 551 168 16864 26696 2771 11669
NM_001219chr731824 1765 50 --22202 338 --
NM_001222chr1071962 1610 1490 589 466 356 62 11336 --11763
NM_001256chr1731133 756 200 11885 ----
NM_001258chr17--1404 ----
NM_001259chr742326 2012 1680 1021 15685 ----
NM_001260chr13161 1136 ----
NM_001273chr12167 ------
NM_001280chr19162 ------
NM_001282chr1742355 2188 1978 524 11651 1176 --
NM_001284chr5----1208 --
NM_001290chr42892 192 --11025 --
NM_001292chr155701 246 183 159 96 ------
NM_001293chr112539 384 ------
NM_001304chr1763285 3032 2581 2501 832 53 --11196 --
NM_001310chr1232841 1227 674 ----187
NM_001331chr112497 282 --12505 11847
NM_001332chr511526 ------
NM_001343chr521537 240 --1592 --
NM_001352chr19132 ------
NM_001356chrX22397 355 ----186
NM_001362chr143765 637 223 ------
NM_001364chr1163641 3082 2961 893 638 336 ------
NM_001386chr81789 21994 622 11615 --
NM_001387chr563095 2998 2911 983 557 166 ------
NM_001390chr1853199 2677 2295 1053 169 ----12570
NM_001396chr2142191 695 549 216 ------
NM_001400chr121345 294 --1181 --
NM_001406chr1731644 1377 542 1660 11637 --
NM_001407chr321569 1479 2154 128 ----
NM_001412chrX21306 1174 13212 ----
NM_001419chr1964727 3651 3018 879 861 483 24787 728 ----
NM_001420chr1932854 2464 1922 22691 372 12105 --
NM_001426chr2--1273 ----
NM_001427chr71685 31990 642 302 1423 --
NM_001430chr211675 21891 53 --1383
NM_001438chr123679 407 11204 1299 --
NM_001440chr872694 2468 1702 891 735 490 238 --32580 1805 52 --
NM_001447chr52356 302 3462 397 200 ----
NM_001448chrX31684 1508 1465 ------
NM_001450chr22389 171 ------
NM_001478chr126886 874 861 747 608 373 1616 1120 --
NM_001482chr151771 ------
NM_001483chr71120 ----1743
NM_001497chr931973 766 183 --1204 --
NM_001498chr621404 1081 ------
NM_001518chr751028 841 727 407 377 1987 ----
NM_001527chr674726 4122 3895 3570 1620 1335 548 11817 ----
NM_001530chr142124 43 ------
NM_001542chr11139 ----1268
NM_001543chr564618 4596 4439 3849 1778 1280 33770 3345 2955 ----
NM_001554chr11547 ------
NM_001565chr4--1243 ----
NM_001609chr1044284 3681 3667 3464 11451 ----
NM_001616chr242730 1418 982 865 23114 601 ----
NM_001625chr1179 ------
NM_001655chr1121924 269 11394 ----
NM_001658chr11931 ------
NM_001659chr1222624 2460 12306 ----
NM_001660chr32720 585 --1264 --
NM_001663chr1421903 763 22048 1986 ----
NM_001668chr1190 12026 ----
NM_001677chr11132 ------
NM_001678chr1731242 463 274 11226 31268 1186 543 11462
NM_001684chr143664 3575 1220 1039 34015 3272 1590 12693 1698
NM_001686chr12--155 ----
NM_001696chr22254 32 1183 190 --
NM_001699chr1931525 1510 732 21152 1129 ----
NM_001701chr921278 536 ------
NM_001704chr61541 ------
NM_001709chr1122469 2349 11993 1599 --
NM_001731chr123681 663 67 ------
NM_001742chr731745 1723 302 ------
NM_001746chr562808 2110 831 691 685 540 1129 ----
NM_001753chr7--173 ----
NM_001754chr2123464 1002 13537 --11140
NM_001755chr1621880 339 1476 1872 --
NM_001759chr1274828 4327 4196 4047 3738 3699 3370 --23332 676 --
NM_001762chr71704 184 ----
NM_001773chr141361 1090 563 230 2958 948 ----
NM_001777chr343535 3449 2628 2553 ------
NM_001788chr7--1212 ----
NM_001789chr321743 35 1311 ----
NM_001797chr16--1780 ----
NM_001822chr22733 522 ------
NM_001830chrX33770 3258 195 ------
NM_001833chr92219 59 ------
NM_001854chr111251 ------
NM_001859chr963934 3586 2888 2422 1280 317 11472 ----
NM_001865chr6145 ------
NM_001881chr10--1494 ----
NM_001884chr5--1218 ----
NM_001892chr5180 ------
NM_001893chr172297 118 ------
NM_001895chr201140 --2449 294 --
NM_001903chr53351 269 38 1679 ----
NM_001908chr882206 2153 1896 1812 398 373 361 343 1752 21738 992 --
NM_001918chr188831 8409 6704 3058 2372 1627 308 35 --27814 3628 --
NM_001921chr421004 297 --11262 11021
NM_001936chr751723 1528 1430 168 31 --11118 --
NM_001938chr1--2691 339 11421 --
NM_001939chrX22340 27 1547 21194 977 --
NM_001945chr511045 ------
NM_001946chr121443 ------
NM_001949chr663084 2812 2301 788 527 206 1238 ----
NM_001951chr81106 ------
NM_001954chr61802 ------
NM_001955chr61169 --1751 --
NM_001964chr51914 ------
NM_001965chr23186 174 53 ------
NM_001967chr31163 ------
NM_001968chr42889 281 ------
NM_001969chr1432701 320 22 --33920 522 350 --
NM_001977chr421343 336 ------
NM_001981chr132187 889 309 ----12081
NM_001987chr1273799 1666 1632 1374 1111 973 601 13650 ----
NM_001995chr4--138 ----
NM_002006chr495087 4957 4617 4083 1930 1182 1101 474 96 33534 1527 738 15424 --
NM_002009chr1511044 130 ----
NM_002014chr12--1654 ----
NM_002015chr1333327 2924 2102 --22400 2305 --
NM_002017chr1111215 ------
NM_002025chrX88346 8321 7024 6957 2438 2306 1167 349 48981 8379 2907 2820 28736 5799 --
NM_002027chr8------1175
NM_002037chr6161 ------
NM_002039chr41576 --1227 --
NM_002040chr21----161 --
NM_002044chr1531297 510 155 ------
NM_002048chr91193 1246 ----
NM_002051chr10----1942 --
NM_002054chr21482 ------
NM_002060chr12507 492 ------
NM_002071chr18----1173 191
NM_002073chr222609 446 1627 ----
NM_002076chr1232532 1000 613 1981 33140 2221 697 --
NM_002077chr942148 2060 1732 26 1263 11558 --
NM_002080chr161392 164 ----
NM_002092chr464917 4593 3428 3240 3113 1205 2856 84 13249 --
NM_002103chr191170 1157 --1212
NM_002107chr1177 ------
NM_002114chr6--1159 ----
NM_002129chr4------198
NM_002137chr751990 1672 1584 914 264 2923 76 ----
NM_002138chr41776 --179 --
NM_002139chrX1130 ------
NM_002140chr911147 --1203 --
NM_002146chr1741317 1295 139 58 1263 ----
NM_002147chr172918 637 --1163 --
NM_002165chr201372 ------
NM_002193chr221819 547 1164 ----
NM_002196chr2021019 736 11089 ----
NM_002196chr2021019 736 11089 ----
NM_002199chr41163 ------
NM_002205chr121114 1381 ----
NM_002210chr252915 1404 1355 893 743 ----1727
NM_002211chr103984 383 70 ------
NM_002214chr775236 4679 4333 3751 2187 1764 1740 13582 --25422 841
NM_002222chr3----1397 --
NM_002239chr22928 391 ------
NM_002241chr172935 1898 648 417 388 204 147 ------
NM_002247chr1042232 2103 661 274 ------
NM_002254chr271903 646 612 576 292 204 62 ------
NM_002264chr354944 3910 3147 3083 1301 --24392 308 --
NM_002265chr172825 327 ------
NM_002270chr555321 1593 1406 1026 886 ------
NM_002271chr1342252 1894 580 204 ------
NM_002285chr262748 2543 1189 964 212 48 --12788 --
NM_002293chr122237 2061 ----22530 1084
NM_002296chr131438 1199 619 ------
NM_002310chr5105224 5140 4865 2334 2293 1746 952 732 228 43 --21848 1835 --
NM_002313chr10145014 4790 4562 2045 2010 1806 1689 1625 1366 1259 1143 945 608 562 1792 ----
NM_002332chr121484 ------
NM_002336chr1254089 3722 3426 3067 1731 --1878 1857
NM_002351chrX--21293 339 ----
NM_002356chr612719 ------
NM_002359chr1753197 3191 3134 1373 738 ------
NM_002360chr74742 528 319 177 12480 ----
NM_002372chr5----189 --
NM_002373chr15143 --11333 11279
NM_002374chr233636 3380 47 12935 ----
NM_002375chr342258 2138 814 204 --11756 --
NM_002382chr143343 169 155 ------
NM_002384chr181170 ------
NM_002385chr1831141 451 36 ------
NM_002390chr1711647 11595 51898 1284 829 273 131 --
NM_002391chr112317 114 ------
NM_002395chr611018 --11444 --
NM_002397chr5----1792 --
NM_002398chr21324 21102 397 ----
NM_002399chr1521015 924 ------
NM_002401chr1752218 2104 1755 542 457 32375 1972 224 ----
NM_002402chr73992 420 171 11028 ----
NM_002430chr2262500 2147 1891 779 704 516 ------
NM_002442chr1211323 --21565 189 --
NM_002444chrX31807 1720 195 1786 1365 --
NM_002449chr521149 242 ------
NM_002473chr2251221 1060 524 274 204 ------
NM_002479chr12305 115 ------
NM_002480chr1221357 394 1292 ----
NM_002481chr197187 6956 6825 6331 5923 5517 5387 2061 1779 15897 11976 27683 5508
NM_002487chr151731 ------
NM_002499chr1532311 1533 213 ----1154
NM_002500chr221117 179 2512 120 1211 --
NM_002501chr1943512 1492 1146 985 1608 11389 --
NM_002507chr171117 21877 1403 11528 --
NM_002509chr202278 203 1139 ----
NM_002515chr1422062 341 ------
NM_002518chr211162 ------
NM_002519chr112253 159 ------
NM_002522chr1732883 2844 1495 23278 3068 32701 2579 804 --
NM_002524chr13964 139 121 21031 380 ----
NM_002539chr22267 37 ------
NM_002547chrX63626 1588 1271 759 237 111 ------
NM_002570chr153291 274 166 ----1222
NM_002572chr11135 ------
NM_002577chr363770 1135 1061 823 584 421 1524 1502 --
NM_002581chr945695 4503 516 441 --1959 --
NM_002583chr121544 ------
NM_002588chr561568 1362 444 382 207 55 --11702 --
NM_002592chr20136 ------
NM_002594chr2042081 882 805 43 1131 ----
NM_002595chr1221941 487 1692 ----
NM_002600chr111314 ------
NM_002609chr5135 11427 1434 --
NM_002610chr232370 2167 2144 11223 2606 551 --
NM_002613chr16105118 3663 3645 2005 1630 1122 824 719 600 427 22160 283 ----
NM_002616chr172367 112 ------
NM_002622chr54768 283 80 21 ------
NM_002630chr62134 26 ------
NM_002641chrX143 ------
NM_002643chr21131 ------
NM_002648chr641071 945 71 58 ------
NM_002651chr11672 ------
NM_002655chr875249 5109 4182 4038 372 352 153 14369 21979 453 --
NM_002656chr62948 857 11053 ----
NM_002657chr2052723 1568 1461 1437 34 ----1468
NM_002658chr103807 331 156 ------
NM_002660chr2041159 980 438 200 ------
NM_002698chr1942900 2524 1030 794 12567 11183 1944
NM_002699chr141505 1363 1076 586 ------
NM_002710chr12--1909 ----
NM_002713chr131034 903 247 1920 ----
NM_002714chr62774 129 ------
NM_002716chr1173485 3334 3213 2317 914 864 282 ------
NM_002717chr81162 ------
NM_002731chr122021 469 --2653 101 --
NM_002734chr171112 ------
NM_002736chr731629 491 195 ------
NM_002745chr2243011 2991 1526 398 21221 832 ----
NM_002753chr41820 --1845 --
NM_002809chr172340 272 ------
NM_002811chr161122 1509 1479 --
NM_002819chr194567 438 223 158 1907 ----
NM_002822chr12----1478 --
NM_002825chr71530 ------
NM_002828chr18126 ------
NM_002830chr21390 ------
NM_002833chr1531490 647 638 11261 ----
NM_002834chr1253236 2806 1475 1071 687 23435 2651 ----
NM_002835chr71678 ------
NM_002837chr1264532 3640 2801 1708 1562 1280 11652 11434 --
NM_002839chr912523 13586 12926 --
NM_002843chr1153261 3046 2268 1231 620 12695 ----
NM_002847chr73633 543 517 --1118 --
NM_002849chr124930 167 106 80 ------
NM_002851chr73607 576 79 ------
NM_002852chr31613 1582 ----
NM_002857chr131012 988 433 21775 245 ----
NM_002868chr1272273 1748 1633 985 840 717 138 --32212 1954 114 --
NM_002869chr112741 650 11463 --1163
NM_002884chr12167 22 --1799 --
NM_002886chr364889 4833 4008 3776 976 221 --11297 23378 466
NM_002890chr51944 ------
NM_002897chr22652 548 ------
NM_002900chr101121 ------
NM_002906chr1121502 152 --1774 --
NM_002911chr1941303 1105 651 413 ------
NM_002938chr431934 1600 1530 ------
NM_002941chr3--11511 ----
NM_002942chr32975 940 --1325 --
NM_002959chr183948 3357 3163 983 545 398 203 110 11691 --23644 69
NM_002966chr1176 ----1246
NM_002971chr31313 1896 ----
NM_002977chr223076 2958 --12683 --
NM_002998chr832013 1561 613 ------
NM_003001chr13605 568 353 --1319 --
NM_003010chr1732424 2216 1968 ------
NM_003011chr951426 1381 1125 372 283 ------
NM_003013chr44738 284 125 75 --121 --
NM_003016chr1722037 634 ------
NM_003022chrX173 1348 ----
NM_003028chr983898 3374 3317 2848 1540 846 340 309 1831 13383 --
NM_003029chr121308 1118 ------
NM_003030chr331771 324 208 --21332 216 --
NM_003034chr1267720 5079 4914 3152 2575 1516 47239 6245 2267 2243 24925 593 17466
NM_003035chr1185 2623 280 ----
NM_003043chr344150 4018 3280 1374 12788 12995 13180
NM_003045chr1374051 3852 3640 3413 1783 491 276 14591 1950 21306 664
NM_003047chr15516 369 303 157 71 --11020 --
NM_003069chrX2317 114 1222 ----
NM_003070chr92879 127 ------
NM_003071chr33820 573 199 ------
NM_003074chr31748 1116 --21822 1807
NM_003076chr1261688 1676 1341 446 220 200 21089 554 ----
NM_003079chr174980 359 194 157 --1389 --
NM_003081chr202227 148 --149 --
NM_003088chr7142 186 --11139
NM_003091chr201198 --130 --
NM_003099chr1565101 5087 4727 4313 1194 973 11002 1173 15536
NM_003106chr31815 ------
NM_003107chr642428 2074 565 382 ------
NM_003108chr2107199 6309 6176 5639 5386 2878 2812 2578 1960 1832 ------
NM_003111chr21494 ------
NM_003112chr722527 472 1557 --1761
NM_003113chr21332 ------
NM_003130chr721130 48 ------
NM_003133chr121043 346 ------
NM_003139chr112885 704 --1134 --
NM_003144chr62750 436 21601 1592 1768 --
NM_003150chr1741915 1671 939 607 ------
NM_003153chr1231048 313 35 ----1923
NM_003155chr832467 2203 844 12689 1107 --
NM_003156chr113373 311 285 1293 2865 434 --
NM_003162chr21309 ------
NM_003165chr931296 177 154 ----11232
NM_003178chr342015 1463 660 153 ----1563
NM_003180chr19196 ------
NM_003182chr7--131 ----
NM_003182chr7--131 ----
NM_003185chr202349 136 ------
NM_003186chr112157 42 ------
NM_003188chr6194 1575 ----
NM_003199chr1854895 4466 4193 2230 1581 ------
NM_003202chr551408 718 696 521 22 21316 1191 11741 --
NM_003204chr1771481 1470 1453 1436 635 460 173 1180 ----
NM_003211chr1221528 201 ------
NM_003216chr2292970 2393 2343 2029 1020 666 642 529 60 22958 149 ----
NM_003220chr6175 1571 ----
NM_003221chr6113954 3456 3073 2643 2599 2564 1644 1025 798 645 73 11658 1820 --
NM_003242chr311906 2711 540 12291 1350
NM_003244chr181123 ------
NM_003253chr2121416 1279 1612 --11745
NM_003255chr1772489 2362 947 588 535 471 68 ------
NM_003262chr343524 1842 965 682 33473 1599 893 ----
NM_003288chr2051256 1241 557 304 66 ------
NM_003289chr9130 ------
NM_003290chr193222 75 43 ------
NM_003291chr131853 ------
NM_003292chr11526 ------
NM_003298chr3126164 5377 5220 5194 4516 3826 2235 1705 960 867 703 638 11101 ----
NM_003304chr321044 442 ------
NM_003305chr41316 --1138 --
NM_003319chr23928 788 667 ------
NM_003320chr11114107 3494 3168 3067 3058 2766 1402 839 827 722 130 --24087 158 12785
NM_003325chr222250 149 ------
NM_003330chr1221343 44 11789 1501 --
NM_003336chrX2765 342 ------
NM_003337chr521531 1283 --41754 1710 1346 484 --
NM_003339chr521428 1251 1361 ----
NM_003340chr411057 ------
NM_003341chr31215 ------
NM_003342chr1733175 757 607 ----12428
NM_003344chr721497 394 ------
NM_003347chr2241436 914 812 208 1932 11916 --
NM_003349chr2021524 124 ------
NM_003352chr2158 1742 ----
NM_003368chr1184 --1215 --
NM_003376chr621479 1440 --11502 --
NM_003376chr621479 1440 --11502 --
NM_003387chr262767 2242 1168 1090 506 176 ------
NM_003392chr341141 670 534 431 22650 1093 13604 --
NM_003404chr2011339 --11848 --
NM_003405chr221209 --1532 --
NM_003406chr831886 1227 626 ----11567
NM_003409chr18----1324 --
NM_003410chrX12381 ------
NM_003411chrY31739 1587 505 ------
NM_003412chr351958 1170 1095 917 380 ----12537
NM_003413chrX21461 1329 ------
NM_003427chr6--1729 ----
NM_003439chr743556 2255 1257 1028 1633 --1362
NM_003454chr1641513 1038 465 63 ------
NM_003455chr1121661 461 1364 ----
NM_003457chr172492 75 ------
NM_003458chr373789 3729 2553 959 830 517 87 ------
NM_003459chr21229 1716 ----
NM_003463chr631186 1144 101 12694 ----
NM_003466chr252377 1532 976 866 570 11632 --1394
NM_003468chr263337 2841 2714 994 647 494 32792 876 350 ----
NM_003472chr61325 11006 ----
NM_003474chr102823 559 21734 58 ----
NM_003483chr1212345 12967 ----
NM_003505chr751635 505 160 148 130 ------
NM_003506chr81493 ------
NM_003558chr91448 --1527 --
NM_003564chr12105 97 ------
NM_003566chr1273325 2789 2377 1381 799 349 232 11011 ----
NM_003567chr1--150 ----
NM_003574chr1864903 2041 1785 1590 1350 619 14400 ----
NM_003583chr1233225 2686 75 ----1983
NM_003587chr6134 ------
NM_003589chr132290 207 11329 2398 133 --
NM_003590chr243936 3795 3489 226 1182 ----
NM_003592chr7144 ------
NM_003601chr4143 ------
NM_003603chr421383 835 11832 --1357
NM_003607chr183973 3687 2852 731 441 431 383 290 --23449 1043 --
NM_003612chr152510 88 1599 ----
NM_003613chr15--1259 1571 --
NM_003626chr11--1985 1887 1497
NM_003628chr2--1194 ----
NM_003633chr511973 ------
NM_003642chr21213 ------
NM_003644chr17104953 4498 4489 4096 2074 1985 1644 1047 167 51 --2590 366 --
NM_003655chr174752 710 276 79 ------
NM_003663chr332587 1182 737 1627 13190 --
NM_003670chr331111 451 219 1354 1943 --
NM_003671chr983493 2991 2833 2690 2607 1201 675 210 ------
NM_003672chr111674 ------
NM_003673chr172165 22 ------
NM_003688chrX1293 ------
NM_003704chr41172 --2243 216 --
NM_003713chr121584 472 --1606 --
NM_003714chr562735 2234 2050 1986 581 393 ------
NM_003722chr341708 1670 1038 209 12650 192 --
NM_003735chr561568 1362 444 382 207 55 --11702 --
NM_003736chr561568 1362 444 382 207 55 --11702 --
NM_003743chr241390 861 515 369 1351 ----
NM_003744chr1421159 544 ------
NM_003750chr101657 ------
NM_003758chr1521390 230 ------
NM_003758chr1521390 230 ------
NM_003759chr443804 946 596 512 13711 --11520
NM_003763chr2082817 2694 2343 2267 2097 1141 1066 563 1663 ----
NM_003768chr11183 1497 1193 --
NM_003774chr1243091 2830 1238 1130 ------
NM_003787chr1831279 1243 325 ------
NM_003795chr6----1215 --
NM_003816chr8----21323 396 --
NM_003822chr142201 937 661 21 --11971 1577
NM_003825chr1511298 --145 --
NM_003831chr1831587 1121 166 ------
NM_003840chr842131 2042 283 28 1478 11666 --
NM_003862chr5--1102 ----
NM_003872chr242171 2162 1906 686 ------
NM_003873chr102955 563 1137 ----
NM_003884chr321876 155 1574 ----
NM_003885chr1732290 432 24 --21989 400 --
NM_003887chr232080 1521 436 ------
NM_003888chr1521149 73 11116 11301 --
NM_003893chr101449 1486 ----
NM_003895chr2112007 1580 ----
NM_003913chr61610 11670 1829 13999
NM_003916chrX31053 946 78 ------
NM_003927chr183933 881 751 ------
NM_003930chr722410 83 12057 ----
NM_003931chr61456 ------
NM_003934chr91228 ------
NM_003939chr1063988 3642 3537 3156 1256 553 2970 457 13742 --
NM_003947chr351249 480 342 237 197 ------
NM_003948chr421724 965 12096 --1781
NM_003949chr1761833 1570 717 247 51 22 ------
NM_003955chr172294 223 --2546 110 --
NM_003966chr587063 7042 5590 3091 2468 1195 773 40 --12939 13077
NM_003972chr1031323 136 35 ------
NM_003987chr1021560 40 32084 1769 27 1767 --
NM_003988chr1031637 117 38 32161 1846 104 1844 --
NM_003994chr1244241 3728 1540 376 --11592 1343
NM_004004chr1321352 178 ----1251
NM_004006chrX31863 1828 1064 32079 1994 903 12320 --
NM_004007chrX31863 1828 1064 32079 1994 903 12320 --
NM_004009chrX31863 1828 1064 32079 1994 903 12320 --
NM_004010chrX31863 1828 1064 32079 1994 903 12320 --
NM_004011chrX31863 1828 1064 32079 1994 903 12320 --
NM_004012chrX31863 1828 1064 32079 1994 903 12320 --
NM_004013chrX31863 1828 1064 32079 1994 903 12320 --
NM_004014chrX31863 1828 1064 32079 1994 903 12320 --
NM_004015chrX31863 1828 1064 32079 1994 903 12320 --
NM_004016chrX31777 1742 978 31993 1908 817 12234 --
NM_004017chrX31863 1828 1064 32079 1994 903 12320 --
NM_004018chrX31777 1742 978 31993 1908 817 12234 --
NM_004020chrX31863 1828 1064 32079 1994 903 12320 --
NM_004021chrX31777 1742 978 31993 1908 817 12234 --
NM_004022chrX31777 1742 978 31993 1908 817 12234 --
NM_004023chrX31777 1742 978 31993 1908 817 12234 --
NM_004035chr1754999 4374 1720 1473 742 11014 13179 --
NM_004036chr22671 154 ------
NM_004050chr1432262 2213 1873 22654 1980 22344 2330 --
NM_004056chr82770 389 ------
NM_004068chr33354 316 186 1419 ----
NM_004082chr21108 1128 ----
NM_004085chrX136 --195 --
NM_004089chrX31258 266 52 1390 174 --
NM_004093chr1332665 2567 1076 1621 ----
NM_004094chr1453024 2833 1887 317 257 1883 12623 1193
NM_004096chr1031999 1529 687 1170 ----
NM_004100chr652628 2082 1974 783 79 ------
NM_004102chr12544 472 1144 ----
NM_004109chr111112 ----12222
NM_004112chr1741402 1106 359 308 11620 ----
NM_004113chr31408 11662 ----
NM_004124chr1453523 3372 2604 811 624 ------
NM_004161chr221443 455 ------
NM_004170chr921199 541 ----11272
NM_004171chr11109528 8009 6901 5949 3277 2283 2035 1289 289 146 --29016 3591 --
NM_004172chr521540 1271 ------
NM_004183chr113611 266 139 ------
NM_004186chr36950 884 806 796 750 668 --1852 --
NM_004187chrX61488 1103 949 920 557 187 1941 ----
NM_004200chr1183015 2375 2247 2215 1234 990 951 196 --1829 --
NM_004202chrY1211 ------
NM_004206chr32468 34 ------
NM_004215chr81460 146 ----
NM_004225chr83992 516 504 11047 ----
NM_004227chr773119 2226 2197 2067 2011 535 350 1810 --12318
NM_004229chrX21649 1404 ------
NM_004232chr1823414 917 13057 1847 --
NM_004235chr91123 --1747 --
NM_004241chr101172 189 ----
NM_004249chr4--181 ----
NM_004274chr1442843 2064 1219 1088 ------
NM_004279chr751863 1735 790 373 311 ------
NM_004282chr6177 ------
NM_004293chr953838 3639 2745 1510 155 13325 ----
NM_004311chr1042691 2212 1188 810 1107 12990 --
NM_004319chr142899 2455 379 324 --12638 --
NM_004326chr11930 175 ----
NM_004329chr101307 ------
NM_004331chr852705 2481 2412 1855 63 1930 ----
NM_004337chr842244 2191 843 442 ------
NM_004338chr18126948 6736 6655 6464 4372 2660 2291 2219 1881 1196 1161 550 35585 2482 862 12487 --
NM_004349chr811075 11013 ----
NM_004370chr61464 21939 262 --11528
NM_004379chr251524 1278 1267 651 356 ------
NM_004380chr1621722 1628 22290 1716 11916 --
NM_004389chr21841 ------
NM_004392chr1361879 1828 1748 1737 1678 314 ------
NM_004397chr1132860 1388 1338 24102 1301 ----
NM_004411chr7--2638 611 ----
NM_004412chr1065287 4559 4364 3673 2048 725 35232 5173 4210 24261 2346 14821
NM_004414chr211359 ------
NM_004416chr121966 --1197 --
NM_004417chr51127 ------
NM_004420chr1131569 800 292 2551 190 --1951
NM_004423chr342714 2402 1714 178 32663 2076 23 21081 388 12333
NM_004426chr123725 486 431 1703 --11875
NM_004427chr15997 811 456 334 160 ------
NM_004429chrX31166 1075 233 ------
NM_004432chr931728 944 421 ----11478
NM_004433chr141724 1472 624 617 2448 396 ----
NM_004434chr142372 141 11246 ----
NM_004437chr142279 1013 776 663 33367 2336 854 1799 13532
NM_004438chr263083 2152 1103 907 527 332 22622 1267 --12691
NM_004440chr63684 473 270 ------
NM_004454chr342018 1831 506 44 ------
NM_004456chr7------148
NM_004458chrX2361 187 ------
NM_004459chr1721586 1458 --11382 --
NM_004474chr12973 57 2342 142 ----
NM_004475chr1711092 --11125 --
NM_004481chr142078 697 637 282 --11012 --
NM_004494chr141274 1010 499 188 --11289 --
NM_004499chr5--1173 ----
NM_004500chr1411397 --1404 --
NM_004501chr143651 3359 2795 2690 --13128 --
NM_004504chr273042 2924 2468 2277 824 512 95 1172 ----
NM_004514chr1773070 2708 2679 1948 1879 694 244 21957 1896 12475 --
NM_004519chr8153 ------
NM_004523chr1041066 542 467 123 ------
NM_004537chr1241277 1203 427 168 11502 ----
NM_004540chr212118 108 1789 ----
NM_004554chr1471553 1433 1262 520 475 370 124 21184 363 1109 --
NM_004556chr6--133 --1694
NM_004560chr9--1334 ----
NM_004566chr1052515 2249 604 432 47 21646 738 ----
NM_004571chr2163082 2958 2571 1125 967 350 12157 22761 1243 12402
NM_004576chr51156 ------
NM_004586chrX75371 4699 3778 1495 576 399 202 14894 12047 --
NM_004588chr1153302 1142 659 509 244 2800 716 1669 13554
NM_004593chr31778 ------
NM_004598chr532768 2314 837 1979 ----
NM_004621chr111425 ----11248
NM_004626chr115725 674 617 521 93 ------
NM_004637chr311265 --2886 240 --
NM_004650chrX--1579 1397 --
NM_004654chrY11173 ------
NM_004655chr173873 345 44 ------
NM_004660chrY2721 353 ----185
NM_004663chr151148 ------
NM_004673chr141306 1232 1043 52 11017 ----
NM_004675chr1125 ------
NM_004686chr821573 384 ------
NM_004689chr141374 ------
NM_004690chr61709 ------
NM_004697chr93288 84 35 ------
NM_004703chr1722491 2424 ------
NM_004709chrX51797 1711 615 504 176 --130 --
NM_004711chr2253043 3004 2640 1361 134 23447 950 23102 2831 --
NM_004715chr181512 1127 ----
NM_004717chr72145 70 21244 237 ----
NM_004718chr22670 52 ------
NM_004719chr1262195 1823 1772 784 502 296 ----12779
NM_004725chr1021468 975 ----1996
NM_004726chrX45164 5151 4168 1530 15106 ----
NM_004730chr541925 1516 1496 222 ------
NM_004734chr1352736 2364 136 71 28 --12919 12204
NM_004736chr11126 --11878 --
NM_004739chr111666 ------
NM_004742chr32708 653 11533 ----
NM_004745chr8115497 5039 4960 4942 4890 2728 1527 586 572 245 234 --25180 1739 --
NM_004747chr1021427 61 1369 ----
NM_004748chr151895 13984 23477 1357 1602
NM_004756chr1921345 1046 --11557 --
NM_004762chr1761520 1479 1308 516 250 43 1220 --1133
NM_004768chr13879 132 107 11093 ----
NM_004770chr8--1247 ----
NM_004772chr51345 --21270 599 --
NM_004774chr1742095 1205 1024 716 ------
NM_004775chr1832014 648 257 --11870 --
NM_004776chr2033157 2179 1028 12580 --1669
NM_004781chr141484 1395 1165 670 1253 11695 --
NM_004781chr141484 1395 1165 670 1253 11695 --
NM_004786chr18148 ------
NM_004788chr1142275 2007 1815 1672 22474 2182 1629 --
NM_004789chr91283 ------
NM_004796chr1422401 2310 ----1302
NM_004798chr202372 249 11286 43504 1260 1145 713 --
NM_004821chr52125 93 ----1569
NM_004822chr1763068 1162 1032 627 549 279 --21570 1487 --
NM_004824chr62202 110 2288 62 1542 --
NM_004834chr212780 32591 2444 316 ----
NM_004839chr151521 ----164
NM_004841chr11224 ------
NM_004844chr31171 --1280 --
NM_004845chrX73888 3786 842 570 547 427 277 22687 558 ----
NM_004857chr1454640 4377 1548 647 381 11561 ----
NM_004866chr544110 1015 911 342 ------
NM_004867chrX1163 ------
NM_004869chr18--1133 ----
NM_004871chr1764003 3684 3654 3344 2803 955 13694 24318 4179 --
NM_004874chr81457 ------
NM_004884chr1551649 706 444 205 104 21616 1606 ----
NM_004888chr93430 264 159 172 ----
NM_004897chr102850 194 ------
NM_004898chr422134 968 191 1129 --
NM_004902chr203745 736 31 ----1269
NM_004904chr7116146 5809 5685 5658 5347 4688 4533 4491 4348 1923 635 35722 4551 4433 ----
NM_004915chr211203 ------
NM_004922chr102771 660 --2255 38 --
NM_004923chr114778 146 108 88 1702 ----
NM_004926chr14----21580 210 --
NM_004932chr51176 ------
NM_004961chrX31357 302 39 11124 ----
NM_004965chr21------1106
NM_004969chr101374 ------
NM_004973chr6------1104
NM_004976chr1194312 4082 3228 3167 1671 1576 1569 1288 693 25134 1998 2408 62 --
NM_004985chr1263039 1336 1128 967 705 127 12762 ----
NM_004992chrX197951 7656 6931 6493 6351 3178 3046 2974 2638 2343 1295 1163 648 563 436 427 263 240 90 55742 2553 2332 1673 1346 15257 28165 5530
NM_004992chrX197951 7656 6931 6493 6351 3178 3046 2974 2638 2343 1295 1163 648 563 436 427 263 240 90 55742 2553 2332 1673 1346 15257 28165 5530
NM_004993chr1441378 1172 1074 389 --1329 --
NM_005010chr712136 --1622 --
NM_005011chr741673 1471 1451 751 1627 ----
NM_005016chr122309 246 ------
NM_005032chrX31088 415 137 ------
NM_005045chr71720 --1933 --
NM_005056chr1211738 24077 527 --14094
NM_005060chr13347 266 118 1987 ----
NM_005079chr822261 112 --22935 2880 --
NM_005087chr32651 114 ------
NM_005093chr20115119 4885 4711 4676 4486 4356 4290 4185 1945 1431 310 23933 971 21265 441 --
NM_005095chr12358 216 ------
NM_005099chr1169 ------
NM_005109chr321698 212 ------
NM_005116chr2074604 3814 1709 1703 1427 848 315 1260 2561 52 --
NM_005117chr112212 107 ------
NM_005120chrX1224 ------
NM_005121chr1723618 2913 11130 12348 --
NM_005126chr312239 ------
NM_005134chr182746 85 ------
NM_005144chr81408 1948 ----
NM_005151chr1831520 768 705 --11737 --
NM_005155chr62527 510 1717 ----
NM_005157chr961530 746 620 318 245 121 1161 11874 --
NM_005159chr1532076 891 432 ----1398
NM_005163chr14131 ------
NM_005168chr221297 503 ------
NM_005176chr122100 27 ------
NM_005190chr63311 264 98 ------
NM_005197chr1445490 4111 3812 2286 24239 2402 --15109
NM_005206chr1731198 892 139 --1339 --
NM_005207chr2263702 3400 3162 2731 1463 950 ------
NM_005219chr541563 1277 703 27 1168 ----
NM_005220chr1731335 321 305 --1446 --
NM_005229chrX3987 189 85 ------
NM_005230chr121477 --1248 --
NM_005233chr311031 1102 1585 11045
NM_005235chr267717 7696 7223 6807 2516 740 ------
NM_005238chr1123398 2504 1626 ----
NM_005254chr151142 1233 ----
NM_005256chr112647 72 ------
NM_005257chr1821170 31 ------
NM_005264chr102946 158 1116 ----
NM_005266chr141191 430 378 211 --1109 --
NM_005276chr1271519 1462 1433 1406 1160 687 524 11695 1584 --
NM_005276chr1271519 1462 1433 1406 1160 687 524 11695 1584 --
NM_005277chr441721 379 258 213 ------
NM_005311chr742786 2480 1919 579 12504 12779 --
NM_005312chr992394 2364 2267 2086 1875 1014 1003 860 52 1395 ----
NM_005324chr1742019 1722 1667 1299 --11849 --
NM_005329chr1642039 897 782 171 1285 ----
NM_005333chrX21262 220 1980 ----
NM_005338chr754080 4058 3096 1465 980 11506 --1737
NM_005339chr433988 3367 1117 --14065 --
NM_005342chrX32589 2050 497 --22177 955 1556
NM_005359chr18106458 5957 5905 5698 5617 5297 5149 4541 1709 208 --16416 --
NM_005373chr151589 1509 416 221 25 --1322 --
NM_005374chr1792191 1821 1748 839 672 611 604 128 24 22248 873 ----
NM_005378chr21898 1349 ----
NM_005385chr372496 2301 2203 2059 1905 516 53 12128 ----
NM_005388chr931655 1594 449 1443 ----
NM_005392chr931459 1351 329 ------
NM_005397chr763763 2650 1535 1251 542 510 23254 41 ----
NM_005398chr1031455 287 257 ------
NM_005399chr124182 402 ----13837
NM_005400chr24978 946 606 300 22294 750 ----
NM_005407chr1421530 271 41523 1370 520 53 ----
NM_005426chr12337 111 ------
NM_005433chr1832372 1120 284 ------
NM_005436chr1033978 3689 2921 23378 317 12590 12660
NM_005437chr1061364 1150 594 304 217 107 11222 ----
NM_005445chr10------1307
NM_005450chr17--180 ----
NM_005453chr6129 ------
NM_005455chr111786 ------
NM_005458chr951830 1785 1518 404 374 11646 ----
NM_005461chr2021662 532 ------
NM_005465chr111803 --180 --
NM_005471chr511250 ------
NM_005475chr1282737 2656 2463 2333 2197 1073 529 227 --21298 251 23066 2703
NM_005493chr6165 ------
NM_005497chr17115759 5462 4886 4789 4691 4237 4027 2235 1350 118 90 ------
NM_005501chr1721207 1005 ----11064
NM_005504chr1256374 6099 5635 4595 4035 11045 ----
NM_005506chr452881 2514 1103 1066 667 ----32636 490 291
NM_005507chr111385 ------
NM_005522chr751280 1053 376 133 76 --1311 --
NM_005523chr741015 993 638 523 ----11527
NM_005544chr22969 753 ------
NM_005546chr521849 548 11709 ----
NM_005573chr51745 ------
NM_005575chr52755 134 ------
NM_005578chr373953 1949 1917 1906 1853 1835 1383 1702 ----
NM_005587chr153946 802 352 ------
NM_005591chr1152529 1700 964 736 130 ------
NM_005593chr12------1236
NM_005596chr915312 23885 2344 14940 14513
NM_005598chr141495 1309 1093 320 21488 1320 1406 11194
NM_005603chr1841830 1608 519 220 ------
NM_005604chr652408 2171 664 408 35 ------
NM_005607chr8--2772 110 ----
NM_005613chr131840 887 167 21874 86 1850 --
NM_005614chr72776 132 ------
NM_005626chr1--1524 ----
NM_005627chr6------1384
NM_005632chr1641005 697 351 141 11089 ----
NM_005634chrX3570 215 88 ------
NM_005639chr1211195 ------
NM_005647chrX33424 2830 691 22597 70 ----
NM_005648chr8156 ------
NM_005660chrX1160 1205 ----
NM_005665chr134638 3119 564 --14450 --
NM_005668chr532808 1737 738 ----14339
NM_005687chr21428 ------
NM_005688chr341215 1088 886 126 1895 ----
NM_005717chr121009 395 ----11131
NM_005721chr22877 250 ----1327
NM_005722chr231879 1581 511 --22213 1620 --
NM_005730chr1233273 1110 336 --12947 --
NM_005731chr2171 ------
NM_005734chr11------1778
NM_005738chr731734 1519 574 11270 ----
NM_005739chr1531591 1555 1543 --1485 --
NM_005746chr722191 773 12099 --12782
NM_005748chr1243423 3262 2687 708 ------
NM_005778chr31163 --1479 --
NM_005780chr13197 --2806 712 --
NM_005785chr1261690 1612 1563 1183 722 623 21439 1360 --11645
NM_005786chr18----11072 --
NM_005789chr173593 154 39 --21942 1892 --
NM_005813chr241836 706 401 146 21941 1746 --1790
NM_005819chr161405 770 734 449 367 26 12416 21021 157 --
NM_005822chr622369 1791 --1635 --
NM_005826chr13267 216 45 ------
NM_005828chr1744097 3290 2022 148 34678 1414 1293 21720 734 --
NM_005832chr32300 105 ------
NM_005840chrX127448 6668 5535 4721 4672 2394 1787 1506 1307 1183 1111 325 16170 36293 5092 2595 --
NM_005852chr174816 736 368 147 ------
NM_005857chr121186 66 ------
NM_005862chr3170 ------
NM_005868chr71389 ----22526 236
NM_005872chr12386 187 ------
NM_005885chr531079 427 224 11280 11630 --
NM_005895chr1242940 1274 629 188 13051 13743 12621
NM_005902chr1554638 4232 4168 3608 453 --11300 --
NM_005903chr543495 2091 1310 350 ----11056
NM_005904chr1831098 919 190 ------
NM_005906chr631232 382 54 ------
NM_005907chr611601 ------
NM_005909chr573924 3903 3549 3444 2798 1183 689 14302 --12959
NM_005910chr1764054 3565 3279 2783 1650 162 11363 --23730 3313
NM_005911chr251029 578 153 109 61 2592 462 1527 1397
NM_005920chr152988 2432 2357 1002 80 --31173 1160 870 --
NM_005924chr72849 186 122 1825 --
NM_005933chr1172843 2757 2239 2214 843 134 88 1932 ----
NM_005934chr1992223 2042 936 781 542 501 274 241 156 11908 12185 --
NM_005937chr17134006 3744 3587 3574 3502 3349 3256 3034 2854 1466 1456 905 147 33057 2661 2637 23786 1104 --
NM_005941chr832678 1484 186 --1553 --
NM_005943chr621711 1254 --1189 --
NM_005955chr165159 4458 3741 1915 666 641 ----11323
NM_005964chr171406 ------
NM_005966chr221737 1707 ------
NM_005977chr13------1352
NM_005984chr221116 ------
NM_005996chr12--21241 262 11002 --
NM_006007chr953739 3708 3658 1408 1375 1807 1281 --
NM_006011chr1573856 3452 3113 3097 1688 1244 29 23483 1413 12950 11110
NM_006015chr12264 124 ------
NM_006016chr632032 1956 337 1682 ----
NM_006036chr221023 519 1283 ----
NM_006037chr234571 4359 478 11362 --1928
NM_006038chr2031658 1554 1369 21873 25 ----
NM_006039chr174814 808 791 439 ------
NM_006041chr171379 ----1160
NM_006047chr2043203 2987 2873 117 --12981 --
NM_006055chr253211 2710 1278 153 124 12736 ----
NM_006060chr762936 2905 1742 1306 1251 541 13322 ----
NM_006070chr3----1274 --
NM_006080chr7--21876 137 ----
NM_006089chrX41315 1229 1187 101 ----11767
NM_006094chr842345 824 790 711 ------
NM_006095chr484269 3947 3917 1250 1023 959 607 560 --33311 1673 1127 --
NM_006099chr13897 768 734 ------
NM_006106chr1162317 2311 1342 831 418 203 ------
NM_006108chr1132074 1843 276 --1509 --
NM_006109chr14--140 ----
NM_006121chr123331 146 127 ----128
NM_006122chr1521867 996 32689 2642 1072 --22185 1102
NM_006133chr1162438 1835 1654 1587 926 546 11801 12114 11557
NM_006136chr721287 1051 ------
NM_006139chr252419 1063 953 839 753 --1539 --
NM_006141chr1642722 2088 1010 234 21057 1047 21086 853 --
NM_006142chr12485 120 ------
NM_006148chr175680 405 340 177 135 ------
NM_006153chr31197 ------
NM_006154chr15--11982 ----
NM_006157chr111376 ------
NM_006164chr2160 --1419 --
NM_006176chr116736 634 319 202 163 27 ------
NM_006180chr91142 --11921 --
NM_006187chr1262991 2715 904 456 364 260 ----12217
NM_006191chr122948 137 1171 ----
NM_006195chr91898 ------
NM_006196chr21304 ------
NM_006201chrX1210 ------
NM_006203chr565355 4646 3917 3643 1435 761 25455 1013 ----
NM_006216chr22123 80 ------
NM_006223chrX1415 1145 --1479
NM_006224chr1751963 1922 1759 846 545 22199 63 12374 --
NM_006226chr221275 477 --11368 --
NM_006237chr1311890 ------
NM_006238chr662030 1969 1351 537 228 192 --1157 11404
NM_006241chr32898 612 --1367 --
NM_006242chr2011589 1726 ----
NM_006246chr142382 319 ------
NM_006251chr553347 867 744 611 425 12165 ----
NM_006252chr1126919 6308 5732 5330 4874 4661 2545 2486 2178 1694 1440 1048 ----12045
NM_006256chr152749 1838 882 645 333 --2177 91 --
NM_006258chr10----11163 --
NM_006265chr821176 332 ------
NM_006267chr2----1599 --
NM_006268chr112941 166 --11180 --
NM_006275chr2052283 2231 2190 1846 229 --1802 --
NM_006277chr21239 1100 ----
NM_006279chr14931 732 713 226 ------
NM_006281chr81459 ------
NM_006281chr81459 ------
NM_006282chr2064518 4284 2932 1341 886 326 21418 31 14636 --
NM_006285chr9--189 1279 --
NM_006288chr113867 858 848 2139 41 ----
NM_006289chr92345 316 ------
NM_006291chr1462055 1771 747 529 407 212 --11565 11548
NM_006292chr11131 ------
NM_006298chr662745 2667 2639 489 219 188 13089 3460 351 145 --
NM_006313chr1221150 415 ------
NM_006315chr464212 2763 2744 908 601 309 --1480 --
NM_006317chr52711 567 1774 ----
NM_006328chr112495 215 ------
NM_006352chr131978 561 327 1651 ----
NM_006353chr621401 22 ------
NM_006356chr17123 ------
NM_006359chrX1743 ------
NM_006361chr1731668 1309 330 ------
NM_006364chr1411241 ------
NM_006366chr61105 ----1220
NM_006367chr11289 ------
NM_006375chrX31635 1476 98 ------
NM_006379chr722123 1886 1404 ----
NM_006380chr1763583 3509 2984 2810 1693 1036 13649 ----
NM_006389chr112557 109 11173 ----
NM_006391chr11--1273 ----
NM_006401chr9----1144 --
NM_006405chr14170 ------
NM_006409chr71227 ------
NM_006416chr61509 ------
NM_006449chr231700 1523 531 12026 11731 --
NM_006451chr531029 971 405 ------
NM_006454chr4102841 2622 2522 2263 2139 1983 1043 1007 478 229 21058 121 1812 --
NM_006457chr442941 1152 961 538 ------
NM_006460chr1731238 1120 160 ------
NM_006465chr1572170 2139 1680 1598 1453 1422 267 1151 ----
NM_006467chr541885 963 511 40 ------
NM_006471chr18179 ------
NM_006482chr1233225 2686 75 ----1983
NM_006489chr1422062 341 ------
NM_006494chr192230 91 ------
NM_006496chr141736 776 687 316 11817 ----
NM_006497chr173520 311 173 1128 1750 --
NM_006510chr64921 408 336 329 --1851 --
NM_006517chrX42044 1777 286 36 21652 151 21817 1669 --
NM_006519chr6143 ------
NM_006527chr43238 121 34 ------
NM_006540chr8--1607 ----
NM_006544chr1465389 2323 1725 1647 1248 34 ----15063
NM_006546chr17136567 6432 6273 6015 5391 5177 4862 4151 4044 2423 1547 1134 275 35613 5491 4084 24198 4093 --
NM_006547chr71266 12104 ----
NM_006549chr12102967 2351 2305 2272 1972 1167 1011 920 901 768 22675 942 22490 454 11819
NM_006557chr9--124 ----
NM_006559chr111192 ------
NM_006560chr111124 ------
NM_006561chr1095896 5117 4945 2249 2235 2104 573 66 37 35163 2204 1120 15520 15398
NM_006571chr81234 ------
NM_006580chr31125 ------
NM_006589chr13523 431 191 ------
NM_006593chr23201 72 61 ------
NM_006595chr1131532 575 390 ------
NM_006599chr1656937 5704 5648 2614 668 17866 12240 --
NM_006601chr121354 ----190
NM_006603chrX1623 ------
NM_006609chr232393 977 692 --136 --
NM_006614chr322635 577 ------
NM_006621chr141559 1434 1267 180 1492 ----
NM_006624chr101635 ------
NM_006625chr1--1391 ----
NM_006625chr1--1391 ----
NM_006625chr1--1391 ----
NM_006626chr962045 2020 955 909 851 789 1158 1927 1966
NM_006629chr1822639 82 1668 --12058
NM_006646chr1311994 12806 1956 --
NM_006650chr573273 1400 665 506 446 209 152 ----12712
NM_006654chr1254509 3844 1285 1173 551 ------
NM_006675chr1233114 2601 1119 ------
NM_006682chr742778 2079 1055 340 ------
NM_006690chr2052069 1773 1685 854 75 32043 346 268 32281 2080 394 --
NM_006695chr17193 1258 ----
NM_006696chr5--180 ----
NM_006699chr132521 773 575 1994 12482 --
NM_006710chr22906 795 ------
NM_006717chr923296 1066 1797 ----
NM_006718chr62948 857 11053 ----
NM_006720chr10145014 4790 4562 2045 2010 1806 1689 1625 1366 1259 1143 945 608 562 1792 ----
NM_006722chr331987 514 265 --32051 2019 1926 --
NM_006726chr411131 ------
NM_006734chr631227 1116 463 ------
NM_006738chr1544224 2879 2840 1104 14621 ----
NM_006744chr10--160 145 --
NM_006745chr431099 804 259 ------
NM_006748chr811281 21185 47 ----
NM_006750chr16107065 6222 6185 5747 5059 3097 2743 2486 442 294 45441 1832 1813 211 1514 11941
NM_006751chr21772 ------
NM_006756chr831074 519 58 ------
NM_006759chr21212 ------
NM_006766chr852100 1864 1808 534 388 12438 ----
NM_006771chr171231 1192 1661 --
NM_006772chr621544 1307 11085 ----
NM_006775chr653009 2436 2149 1207 430 ------
NM_006777chrX42933 2923 1967 1174 --12418 12459
NM_006805chr511317 --143 --
NM_006814chr204826 259 238 178 --1200 --
NM_006822chr171195 ------
NM_006826chr2------1226
NM_006836chr123627 504 495 ------
NM_006851chr123902 808 251 --12281 --
NM_006852chr1731892 587 193 --11023 --
NM_006854chr721823 133 ----2285 270
NM_006856chr1221136 360 ------
NM_006861chr1231755 563 477 3762 712 642 ----
NM_006868chr1893053 2954 2921 2904 2276 1132 1064 476 452 12854 ----
NM_006870chr20129 ------
NM_006873chr233504 3484 923 13338 12997 --
NM_006874chr41813 ----1938
NM_006875chrX1185 1862 ----
NM_006876chr112494 157 --2502 42 --
NM_006884chr331771 324 208 --21332 216 --
NM_006885chr16114055 3405 3320 2730 1300 968 943 790 685 661 95 11384 ----
NM_006887chr21475 ------
NM_006888chr1443351 2996 1168 409 22405 270 ----
NM_006892chr202366 127 ------
NM_006892chr202366 127 ------
NM_006893chr1147 ------
NM_006896chr72818 180 11109 2839 784 --
NM_006897chr121214 ------
NM_006902chr142961 2472 2326 2104 1632 ----
NM_006915chrX32526 2464 2385 --1807 --
NM_006922chr222287 1027 1739 ----
NM_006924chr17--1937 13182 --
NM_006925chr142392 330 1413 ----
NM_006930chr561823 1778 1660 1362 1230 203 ------
NM_006931chr1242016 1720 1651 351 1446 12056 --
NM_006940chr1231817 1506 1378 ------
NM_006950chrX1376 ------
NM_006951chr10--1156 1627 --
NM_006981chr952807 903 253 152 117 ----12336
NM_006988chr2121033 22 ------
NM_006990chr142419 2327 958 211 32541 1924 1542 ----
NM_006997chr101311 175 ----
NM_007005chr911508 ------
NM_007007chr122712 245 13116 --34654 3096 176
NM_007011chr15116056 5395 5030 5014 4221 2456 2427 2146 938 462 160 32492 2217 174 1828 15837
NM_007013chr82291 28 1309 ----
NM_007017chr5--1779 ----
NM_007023chr22913 210 ------
NM_007026chr171241 1439 ----
NM_007030chr574667 3292 1660 1562 1510 982 632 13260 34402 3549 1733 --
NM_007033chr111922 21670 127 ----
NM_007034chr11357 ------
NM_007035chr122597 276 1831 ----
NM_007039chr1422129 1985 ------
NM_007040chr195883 744 721 388 21 ------
NM_007042chr35897 614 458 401 93 --1497 --
NM_007050chr2097921 6477 5626 2300 1680 1033 841 369 91 35649 2798 1843 36812 5098 291 15897
NM_007052chrX--1168 ----
NM_007078chr1062904 2539 2402 856 662 179 1646 1748 12690
NM_007096chr92219 59 ------
NM_007107chr322029 949 ------
NM_007123chr12842 118 131 ----
NM_007124chr621942 1736 292 75 21300 99 --
NM_007129chr131832 --1786 --
NM_007137chrX65220 5200 5078 4679 4186 1723 1450 14356 --
NM_007144chr1731043 350 95 ------
NM_007146chr1752665 2281 2115 813 582 ------
NM_007150chrX31550 465 219 11331 1210 --
NM_007157chrX12125 ------
NM_007158chr11811 --1958 --
NM_007159chr311517 ------
NM_007170chr12300 139 ------
NM_007174chr1272215 2048 1710 837 502 305 114 --11779 1287
NM_007178chr12------1132
NM_007191chr121660 ----1124
NM_007192chr1421041 243 126 ----
NM_007195chr1842654 1467 1125 71 ------
NM_007200chr1544224 2879 2840 1104 14621 ----
NM_007203chr932468 715 631 ------
NM_007212chr132111 906 788 ------
NM_007214chr61461 1495 ----
NM_007218chr81274 ------
NM_007222chr841779 1368 1269 1181 ------
NM_007236chr1562374 2224 1543 567 338 230 --21889 832 --
NM_007238chr20103863 3504 3320 3144 1954 1498 544 414 364 29 23272 3176 34850 4753 3783 --
NM_007249chr1378626 7160 6957 3614 1815 1715 291 38125 6904 3566 --11511
NM_007270chr731500 499 480 ------
NM_007275chr321156 1108 ------
NM_007283chr393023 2828 2770 2514 2494 2474 575 487 310 ----11891
NM_007286chr562094 1982 1729 572 484 125 1630 --11511
NM_007292chr1754999 4374 1720 1473 742 11014 13179 --
NM_007294chr172854 80 11184 11034 --
NM_007295chr172854 80 11184 11034 --
NM_007296chr172854 80 11184 11034 --
NM_007297chr172854 80 11184 11034 --
NM_007298chr172854 80 11184 11034 --
NM_007299chr172854 80 11184 11034 --
NM_007300chr172854 80 11184 11034 --
NM_007302chr172854 80 11184 11034 --
NM_007303chr172854 80 11184 11034 --
NM_007304chr172854 80 11184 11034 --
NM_007305chr172854 80 11184 11034 --
NM_007313chr961530 746 620 318 245 121 1161 11874 --
NM_007332chr8--1481 11024 --
NM_007345chr183857 411 282 188 ----
NM_007353chr772925 2613 1850 690 669 470 127 1163 ----
NM_007363chrX----1944 --
NM_007371chr92638 458 ------
NM_007372chr173324 229 220 ------
NM_007373chr10--11843 ----
NM_007375chr111981 ------
NM_009588chr61206 1592 ----
NM_012064chr123788 418 34 --11063 --
NM_012082chr82683 328 ----1376
NM_012083chr1021067 60 ------
NM_012089chr1--11397 11241 --
NM_012090chr121072 1044 11132 ----
NM_012096chr332354 1484 701 ------
NM_012102chr152238 2053 2025 1744 266 12472 12425 --
NM_012115chr6--154 ----
NM_012120chr632384 2303 936 ------
NM_012121chr1741655 521 409 30 1388 --11616
NM_012137chr122875 1092 ------
NM_012141chr1311370 1960 13735 --
NM_012156chr2063008 3002 2688 2506 1109 718 ----12543
NM_012158chr1341626 661 432 71 ------
NM_012164chr997578 6893 5496 5000 2961 2275 2097 1363 804 17158 1465 12597
NM_012180chr41533 1118 ----
NM_012183chr12414 236 ------
NM_012193chr1165088 4368 3995 2155 1906 1284 25221 2049 13689 13675
NM_012197chr91207 --21363 642 --
NM_012199chr154607 3609 1755 1554 725 22843 1431 23634 3099 --
NM_012207chr101307 --1431 --
NM_012215chr1011945 ------
NM_012216chrX238 30 ------
NM_012224chr41758 3965 803 72 ----
NM_012233chr2----1455 --
NM_012234chr343342 3067 1403 430 ----23083 846
NM_012238chr1031629 1253 1179 ------
NM_012244chr1451502 1158 751 733 553 ------
NM_012247chr101214 ------
NM_012249chr273397 2925 2853 2822 2456 1362 1343 12336 1825 --
NM_012250chr11------11382
NM_012252chr734471 3528 1970 --23781 282 --
NM_012262chr134932 4127 3902 21601 69 --11226
NM_012264chr2231601 829 783 12064 31967 1312 401 --
NM_012264chr2231601 829 783 12064 31967 1312 401 --
NM_012281chr72693 137 --11636 --
NM_012286chrX1170 ------
NM_012287chr373447 2788 2774 1096 743 694 504 13593 1440 --
NM_012290chr221678 152 ------
NM_012297chr4--12248 1424 1740
NM_012300chr522072 1934 11960 2662 210 --
NM_012301chr74874 784 568 290 11456 ----
NM_012304chr562483 2098 1863 666 613 102 1358 --1708
NM_012306chr12113517 3303 3112 3045 1270 1259 1058 737 675 554 264 23449 2318 23507 3008 11120
NM_012307chr182929 76 ------
NM_012309chr11144167 4154 3594 3543 3351 1561 1225 1009 949 695 629 411 314 182 21638 841 24057 343 --
NM_012319chr18126 ------
NM_012325chr2031386 1291 1105 ------
NM_012327chr1831072 272 169 1493 ----
NM_012328chr721251 938 ------
NM_012334chr564381 4143 4088 3556 1357 122 --33888 3655 1012 33587 917 66
NM_012343chr52377 105 11133 ----
NM_012410chr16------1336
NM_012421chr1----1173 134
NM_012428chr15--1348 ----
NM_012430chr31103 ------
NM_012434chr621640 406 ------
NM_012448chr1752268 1986 729 662 27 ------
NM_012461chr142666 285 ------
NM_012464chr432194 1824 742 22831 565 12138 --
NM_012465chr1063189 2592 2304 1279 851 759 12205 22656 1041 --
NM_012470chr71189 ------
NM_012471chrX11603 ------
NM_012479chr752654 2501 2265 2039 936 ------
NM_012482chr11715 --1163 --
NM_013229chr1252777 2437 1723 162 93 ------
NM_013231chr1411103 13375 ----
NM_013243chr154483 435 158 55 ------
NM_013247chr22553 26 1494 ----
NM_013253chr1131370 550 162 ------
NM_013255chr7167430 6302 6079 6024 5997 5935 5917 2001 1562 1541 1364 1347 906 890 779 523 32597 1893 68 16041 --
NM_013261chr423398 869 21379 435 ----
NM_013262chr61219 2908 449 ----
NM_013269chr1234027 1200 415 13707 --1267
NM_013277chr1221094 416 ------
NM_013279chr1131816 1520 104 1844 1629 12106
NM_013281chr2011004 --11196 --
NM_013305chr182188 132 1882 1762 --
NM_013322chr71182 167 ----
NM_013323chr1731194 836 794 ------
NM_013326chr18165 ------
NM_013341chr242742 2541 1101 881 --11789 12092
NM_013357chr81831 ------
NM_013372chr1553165 3068 2261 390 147 ------
NM_013374chr312307 1162 1800 --
NM_013382chr1482341 2066 1947 1850 1720 1487 195 136 --1625 --
NM_013390chr911159 1165 --11224
NM_013396chr212395 45 ------
NM_013401chr112886 29 ------
NM_013433chr1951958 1865 1253 771 565 ------
NM_013438chr911814 ------
NM_013449chr1232928 2800 392 12123 ----
NM_013450chr2--1330 ----
NM_013937chr611042 1999 1378 --
NM_013951chr252377 1532 976 866 570 11632 --1394
NM_013952chr242454 1609 943 647 21709 24 --1471
NM_013953chr242454 1609 943 647 21709 24 --1471
NM_013989chr1444520 4336 536 404 34449 1925 149 11604 --
NM_013992chr242454 1609 943 647 21709 24 --1471
NM_013993chr61802 ------
NM_013994chr61802 ------
NM_013995chrX21973 103 154 ----
NM_013996chr7--131 ----
NM_013996chr7--131 ----
NM_013997chr7--131 ----
NM_013997chr7--131 ----
NM_013998chr7--131 ----
NM_013998chr7--131 ----
NM_014007chr931006 987 513 2325 144 ----
NM_014016chr331502 1089 383 --1345 --
NM_014021chr121201 1108 ------
NM_014023chr1032232 1916 509 12110 ----
NM_014034chr631429 1037 566 ------
NM_014055chr121433 ------
NM_014056chr341987 484 435 298 --11737 12136
NM_014057chr911446 ------
NM_014059chr132269 52 143 ----
NM_014089chr131523 21472 890 ----
NM_014109chr821249 38 --1930 --
NM_014110chr131034 903 247 1920 ----
NM_014112chr895353 4977 4678 3674 3484 1857 1607 1221 61 34619 3758 3465 ----
NM_014117chr1642560 2506 1780 979 --12553 --
NM_014154chr32591 474 21359 253 1602 --
NM_014155chr11107328 7127 6552 6071 5771 4594 2320 1327 1316 543 25474 975 15370 36586 2724 2552
NM_014157chr1663656 2972 2683 251 75 57 13235 21217 442 --
NM_014181chr262663 2439 2385 1172 1078 896 11141 ----
NM_014183chr201259 ------
NM_014190chr441609 572 395 305 ------
NM_014191chr12--1797 ----
NM_014216chr1451613 1440 1170 597 65 ------
NM_014217chr11336 ------
NM_014230chr17--2530 73 ----
NM_014231chr1242026 1800 1709 265 11387 1828 --
NM_014233chr1731435 621 45 ------
NM_014240chr353687 3659 951 899 120 31186 556 500 11376 --
NM_014253chrX42111 1583 787 203 ------
NM_014267chr111689 ------
NM_014283chr12331 287 ------
NM_014289chrX11373 --1424 --
NM_014294chr821003 194 --11380 --
NM_014299chr1961756 1478 1466 1430 470 67 141 ----
NM_014300chr151368 1324 ----
NM_014309chr2275309 5223 3312 1680 1273 841 301 --23387 1597 --
NM_014323chr222785 398 ------
NM_014325chr1242073 1448 1416 436 --1607 --
NM_014331chr447534 2623 2342 2335 ----16331
NM_014332chrX2365 60 ------
NM_014333chr111547 12066 ----
NM_014352chr1121122 1022 1296 --1277
NM_014360chr142640 327 ------
NM_014361chr11138 ------
NM_014386chr5------132
NM_014392chr421469 211 --1248 --
NM_014393chr831647 1552 675 ------
NM_014397chr91431 ------
NM_014399chr71952 171 1387 --
NM_014400chr193475 208 138 --1391 --
NM_014415chr3--11075 ----
NM_014423chr5104583 4302 3592 1871 1574 1307 1261 1070 741 326 ------
NM_014426chr201259 ----193
NM_014445chr331936 562 381 ------
NM_014447chr431622 1320 536 1521 ----
NM_014454chr61913 1191 ----
NM_014469chr111221 ------
NM_014472chr10--3680 637 83 ----
NM_014494chr1632251 1839 955 ------
NM_014496chrX1266 ------
NM_014498chr31339 ------
NM_014517chr32293 232 ------
NM_014521chr21216 1686 ----
NM_014548chr1531445 1187 405 ----1522
NM_014554chr1221749 46 2681 294 --1631
NM_014562chr21680 ------
NM_014569chr721505 1308 1337 1372 --
NM_014574chr141430 1420 ----
NM_014575chr31490 --1428 --
NM_014577chr221268 --1102 --
NM_014584chr1411409 11111 ----
NM_014588chr201262 ------
NM_014603chr1751618 1532 272 225 71 11597 ----
NM_014606chr411543 ------
NM_014607chr21269 ------
NM_014608chr152423 377 ------
NM_014612chr91358 ------
NM_014613chr542922 941 639 348 ------
NM_014614chr241035 162 108 74 ------
NM_014615chr1653102 2318 679 645 601 3696 301 144 ----
NM_014616chr331345 370 117 12625 185 --
NM_014620chr12--1151 ----
NM_014630chr1593671 3431 2906 2532 1093 592 485 415 201 21131 393 ----
NM_014634chr2263451 3431 3380 3281 2739 260 33425 2987 2373 12331 --
NM_014636chr931693 1237 1097 1924 ----
NM_014646chr1862960 2890 2032 1061 189 66 ----11167
NM_014657chr202320 280 ------
NM_014659chr152254 227 --1332 1752
NM_014661chr1073934 3293 1389 783 473 213 111 --21270 1203 --
NM_014665chr843199 2792 2426 1159 33325 3099 809 ----
NM_014670chr211614 ------
NM_014676chr121205 403 1603 1437 --
NM_014683chr172827 497 --2248 101 --
NM_014686chr1962562 2013 917 656 468 329 22141 162 ----
NM_014689chr22536 245 ----1133
NM_014701chr1542704 2450 157 134 ------
NM_014702chr623501 2601 --13188 --
NM_014705chr751901 1762 1718 1339 104 31830 733 706 ----
NM_014711chr1611868 --21954 720 --
NM_014717chr191746 ------
NM_014720chr104445 402 85 33 ------
NM_014721chr677065 6751 4975 4587 2800 1153 681 37250 5699 858 1308 1181
NM_014723chr2072419 2360 870 810 455 295 188 22485 2036 12944 --
NM_014726chr1751166 491 382 207 177 ------
NM_014729chr841653 864 575 488 11961 ----
NM_014730chr12103553 3398 2020 1923 1759 1691 1472 1402 1101 795 24620 4099 35036 1733 226 11588
NM_014730chr12103553 3398 2020 1923 1759 1691 1472 1402 1101 795 24620 4099 35036 1733 226 11588
NM_014733chr522093 210 ------
NM_014736chr154746 250 195 92 ------
NM_014739chr644085 4061 3142 309 --11214 1376
NM_014742chr2031479 397 255 2515 451 11251 --
NM_014743chr432612 2458 2436 11986 32532 1105 974 --
NM_014746chr274010 3483 3193 3039 2882 1697 48 33764 1086 119 ----
NM_014748chr21378 ------
NM_014751chr841976 1679 1482 432 --1120 1686
NM_014752chr1141807 1387 511 317 --1187 --
NM_014755chr241587 1434 1355 1280 13551 1654 --
NM_014756chr112385 329 ------
NM_014757chr542157 1906 1719 711 1129 11664 --
NM_014758chr1161878 1736 1668 691 448 125 2535 385 --11618
NM_014767chr1093311 2656 2560 1407 917 699 513 464 47 13105 21037 443 --
NM_014771chr164883 395 285 180 ------
NM_014772chr1882900 2550 2257 2229 1276 1203 1127 819 1675 --22358 1387
NM_014781chr81344 ------
NM_014787chr132651 1905 183 ------
NM_014790chr51153 ------
NM_014791chr91286 ------
NM_014795chr231042 986 23 ------
NM_014800chr7--2911 207 ----
NM_014810chr143385 3054 2554 1100 12343 ----
NM_014811chr92473 191 ------
NM_014819chr522069 999 --11957 --
NM_014826chr183973 3687 2852 731 441 431 383 290 --23449 1043 --
NM_014828chr1432063 1912 1593 12338 11623 --
NM_014830chr1273200 3152 2552 2513 1381 1351 30 13065 --11256
NM_014832chr1331604 836 249 11511 12091 --
NM_014835chr2042039 1868 1683 1619 1209 1302 --
NM_014836chr1031841 1486 106 11371 ----
NM_014839chr131594 613 600 ------
NM_014841chr621174 1165 ------
NM_014847chr1--1142 ----
NM_014860chr231715 613 458 --12471 11926
NM_014868chr122248 185 --1115 --
NM_014870chr1134731 4613 4458 3290 1798 1519 1066 940 782 671 654 155 110 13421 24627 852 --
NM_014873chr133961 1173 628 11892 ----
NM_014874chr151707 654 513 202 68 --189 --
NM_014876chr2231794 688 289 ------
NM_014877chr1787694 7288 6866 6156 5641 4703 2881 94 21700 1665 12854 --
NM_014879chr31126 ------
NM_014881chr10248 35 ------
NM_014883chr452340 1970 1585 143 71 --11926 --
NM_014888chr7--11540 ----
NM_014891chr711250 21528 1226 ----
NM_014893chrY42345 2339 2322 424 --1747 --
NM_014897chr1752531 1978 903 118 86 --1537 --
NM_014898chr1922444 1878 11666 ----
NM_014899chr573144 2493 1166 996 508 139 122 --12358 --
NM_014900chr221010 921 1869 ----
NM_014901chr542226 1626 530 43 1188 11424 --
NM_014903chr1212400 1240 ----
NM_014904chr1043793 3671 3310 896 ----1406
NM_014905chr231666 352 266 --11563 1504
NM_014906chr1743630 3136 928 116 11605 129 11164
NM_014909chr14113969 3837 3653 3473 2965 2937 2475 772 746 708 603 --13086 --
NM_014912chr1051388 1308 837 687 508 ----11351
NM_014921chr1952762 2309 764 610 386 32443 2274 224 ----
NM_014926chr331148 755 722 ------
NM_014932chr31707 ------
NM_014934chr1343281 3264 2905 2756 --13228 --
NM_014935chr143492 3270 3136 2750 31358 1142 45 2644 94 --
NM_014942chr622628 652 ------
NM_014944chr131284 577 164 ------
NM_014946chr222619 1115 --11080 --
NM_014947chr12764 524 12091 2860 228 1724
NM_014950chr141441 1141 ----
NM_014953chr1354312 4280 2961 2701 519 1666 ----
NM_014961chr461592 1382 471 315 218 87 12071 ----
NM_014962chr2062924 2779 2450 885 506 70 131 ----
NM_014964chr1741954 1901 583 243 2431 119 1983 11718
NM_014969chr131093 409 252 ------
NM_014974chr1051667 1534 1455 1432 1410 ------
NM_014978chr1071372 1333 1320 556 327 269 145 ------
NM_014982chr1475118 4768 3737 3635 3572 912 854 --11018 1791
NM_014989chr61672 ----11504
NM_014990chr143331 156 28 --1832 --
NM_014991chr432614 1019 959 ------
NM_014994chr1531905 1595 752 11510 1361 --
NM_014996chr3173 ------
NM_014997chr731854 1115 922 11975 --1342
NM_014999chr1221259 1231 1315 ----
NM_015000chr1252682 2185 2120 1986 187 ------
NM_015008chr323397 2710 13264 13024 --
NM_015012chr111356 ------
NM_015017chr121304 844 ------
NM_015023chr121472 1421 --2629 457 11170
NM_015024chr831288 1282 97 ------
NM_015025chr212220 ------
NM_015026chr1274740 4596 3051 1482 1295 862 184 1585 --1683
NM_015032chr1332022 1939 309 12568 ----
NM_015033chr943285 3073 2154 227 12143 --12532
NM_015035chr2085279 4940 4918 4628 4077 2381 273 128 14185 21456 1151 24717 1677
NM_015037chr101107 ------
NM_015039chr153924 3496 3169 1648 428 13564 ----
NM_015042chr1593968 3669 3470 2826 1455 1413 1147 929 737 23711 35 11616 --
NM_015045chr1011610 --1457 --
NM_015050chr651252 1198 1141 1072 938 1377 ----
NM_015052chr711123 11362 ----
NM_015054chr12----134 --
NM_015059chr15113928 3536 3008 2778 1552 1233 864 793 735 595 532 11429 ----
NM_015063chr193519 488 177 ------
NM_015064chr1293413 3254 2928 2449 2222 1424 1373 663 163 1232 ----
NM_015068chr722942 56 23256 1256 --1864
NM_015071chr595201 5157 4545 4239 2469 2389 2249 1540 148 14566 ----
NM_015074chr184871 4631 4037 3854 1426 1403 1087 910 --2859 147 --
NM_015075chrX62083 2071 2045 1867 727 106 2401 279 ----
NM_015076chr674348 3382 3311 2805 1423 713 358 147 1162 --
NM_015077chr17154358 4129 3992 3678 3597 1893 1668 1618 967 913 792 591 473 121 67 24289 1507 34156 3530 3129 14032
NM_015079chr1563198 2544 2226 2137 1193 858 ------
NM_015090chr165729 5721 4918 4438 1380 1365 --1652 --
NM_015091chr141785 ------
NM_015092chr1654582 4319 2997 1526 1330 ------
NM_015093chr61371 11730 ----
NM_015097chr311577 ------
NM_015106chr31152 ------
NM_015107chrX11954 1777 1170 --
NM_015113chr1761952 964 666 159 104 30 --21586 552 --
NM_015115chr432056 677 155 ------
NM_015129chrX51729 1437 1257 623 152 1706 ----
NM_015137chr81857 ----1797
NM_015138chr1542709 2669 1128 960 ------
NM_015147chr242738 940 246 132 --11154 11288
NM_015149chr141555 744 686 127 ----12067
NM_015155chr1041004 889 666 318 ------
NM_015158chr91868 ------
NM_015161chr1621136 359 --199 --
NM_015176chr13705 100 47 ----123
NM_015191chr1162728 2555 2382 1849 262 234 12707 ----
NM_015192chr2022886 350 3282 175 139 ----
NM_015193chr841240 1087 290 126 2602 208 11148 --
NM_015197chr1423386 162 12328 ----
NM_015199chr332944 2856 2491 22152 38 ----
NM_015200chr422391 304 150 ----
NM_015205chr13164820 3931 3783 3734 3697 3658 3607 3562 3463 3410 3351 3203 1600 1111 829 57 24030 151 ----
NM_015206chr1553738 3368 3244 2749 190 ----1826
NM_015208chr1823816 728 --1911 13968
NM_015209chr121793 638 --12150 --
NM_015213chr11152 ------
NM_015215chr112395 12963 ----
NM_015216chr511213 ------
NM_015221chr1051546 1153 998 518 440 1973 ----
NM_015225chr922792 2714 1754 32592 2584 725 --
NM_015230chr431482 1241 591 1220 ----
NM_015233chr1331889 651 27 --22298 504 --
NM_015234chr631231 1163 586 --11131 --
NM_015242chr113456 444 23 ------
NM_015245chr652367 2320 320 91 55 --11961 --
NM_015247chr1643833 2141 1374 707 24946 1025 11612 --
NM_015250chr94712 510 451 305 ------
NM_015252chr21799 ----1194
NM_015264chr2284863 4772 4746 4370 4172 3354 1604 1171 1597 ----
NM_015265chr212210 ------
NM_015267chr1221381 156 ------
NM_015269chr11173 ------
NM_015270chr1231893 684 564 --11577 --
NM_015271chr453507 1238 670 559 355 --13397 --
NM_015272chr1631804 1771 57 ----1439
NM_015278chr623023 1325 12888 ----
NM_015284chr161880 1808 1567 563 474 335 11514 ----
NM_015288chr572998 2749 2587 1221 963 281 214 1845 13781 1567
NM_015293chr62494 278 ------
NM_015294chr171241 1443 ----
NM_015299chr14103915 3711 3694 3552 3426 3317 2718 916 425 192 139 22834 281 1304
NM_015310chr897742 7503 6895 6780 6585 5843 5198 1538 643 56468 5711 2365 2086 542 ----
NM_015313chr1184475 4180 3446 3324 1282 640 578 165 11248 13827 175
NM_015315chr531091 987 316 --22922 235 --
NM_015317chr232751 956 377 --1991 --
NM_015319chr12--1338 ----
NM_015321chr19104757 4423 4386 4336 4236 3679 3154 1956 425 336 14045 21467 277 --
NM_015323chr611410 ------
NM_015326chr122278 78 ------
NM_015327chr161181 1121 1052 930 537 269 --11212 --
NM_015328chr733004 2732 2559 1754 --12402
NM_015335chr1232470 34 28 1591 ----
NM_015336chr1232375 1709 624 1826 ----
NM_015339chr201924 1137 ----
NM_015344chr812066 11368 ----
NM_015346chr1431315 1307 105 --1462 --
NM_015349chr612288 12230 12760 --
NM_015355chr1731530 1289 586 ------
NM_015359chr822510 2482 12859 ----
NM_015361chr22127 77 1314 ----
NM_015365chrX52625 1682 1247 641 133 --14024 11089
NM_015375chr184870 3772 3554 3494 1500 705 442 395 11174 13530 --
NM_015378chr142320 2163 2142 68 22824 1071 12444 11012
NM_015379chr7137 188 ----
NM_015381chr2251878 1630 1576 333 169 1821 21264 42 --
NM_015382chr141286 ------
NM_015387chr222072 1596 --197 --
NM_015393chr453866 3242 2558 557 536 1435 --12792
NM_015397chr951775 1400 360 328 155 ------
NM_015416chr121885 ------
NM_015436chr452983 2864 1155 573 350 ----1187
NM_015439chr6--1399 ----
NM_015443chr171450 152 --1945
NM_015444chr33441 225 177 --1104 --
NM_015446chr111684 ------
NM_015455chr543579 3290 3119 898 ------
NM_015460chr32790 215 ----11933
NM_015466chr32216 76 ------
NM_015483chr72800 768 ------
NM_015488chr231427 1171 1127 --1346 --
NM_015497chr152904 213 180 ----
NM_015508chr311240 ------
NM_015509chr12--21427 605 1132 --
NM_015520chr332736 2661 407 1636 ----
NM_015523chr112290 188 ------
NM_015534chr13167 152 125 ------
NM_015535chr263735 3065 1576 1496 1177 854 1158 21316 1200 1785
NM_015541chr31366 1532 ----
NM_015550chr753581 2712 652 479 118 --12725 13193
NM_015553chr665044 4981 4103 1263 172 119 --11689 11608
NM_015554chr1531043 910 370 --12622 --
NM_015567chr131134 ------
NM_015568chr20134243 3953 3662 3431 3361 3314 3123 2849 1664 1321 1302 990 42 23818 288 13285 11684
NM_015570chr721692 85 11589 --11438
NM_015571chr612305 12014 ----
NM_015575chr243041 3035 2862 520 32961 2573 747 ----
NM_015576chr332137 429 76 22652 24 --11158
NM_015578chr1931732 1630 497 --141 11482
NM_015601chr101798 ------
NM_015605chr101177 ------
NM_015609chr122945 2455 1448 2788 653 11837
NM_015610chr722309 220 11066 1836 --
NM_015626chr171304 ------
NM_015630chr211119 ------
NM_015640chr185143 4672 4254 3996 3450 2068 687 389 --14607 --
NM_015646chr1231235 462 415 --123 --
NM_015651chr931680 184 64 --11910 --
NM_015659chr1673320 3097 2792 2334 2166 686 155 22737 737 12613 --
NM_015670chr17175 ------
NM_015686chrX42120 397 252 76 31966 167 46 22332 1917 --
NM_015696chr11215 ------
NM_015702chr21234 ------
NM_015713chr822364 1259 --2853 790 --
NM_015716chr174772 244 225 42 ------
NM_015726chr131712 1360 1169 11580 1486 --
NM_015844chr181170 ------
NM_015846chr181170 ------
NM_015847chr181170 ------
NM_015850chr821945 338 --22224 1928 --
NM_015879chr18178546 8053 7172 6347 6202 5687 5206 3303 2776 2712 2653 2641 2515 2035 1607 1534 338 25856 5447 15654 25835 2313
NM_015881chr1131370 550 162 ------
NM_015886chr855727 4642 4262 3665 931 22136 1144 15250 11659
NM_015888chr133235 1040 652 --1886 --
NM_015889chr221109 ------
NM_015902chr81158 ------
NM_015904chr22664 318 1210 1691 --
NM_015906chr141398 868 483 139 --24478 4030 --
NM_015912chr861937 1773 856 379 372 299 31651 1008 100 ----
NM_015920chr151583 ------
NM_015926chr31264 ------
NM_015952chr61128 ------
NM_015967chr12825 133 ------
NM_015980chr531427 1190 1146 31265 448 68 --2436 366
NM_015981chr573058 2494 2460 2198 2181 2102 1020 12343 --12883
NM_015982chr171290 ------
NM_015995chr1555417 5239 4910 3389 927 34956 2206 1297 --11843
NM_015999chr1--1138 ----
NM_016002chr12156 49 ------
NM_016003chr722309 220 11066 1836 --
NM_016009chr163951 3369 1512 1412 637 253 33299 3173 1961 --13203
NM_016018chr832640 2019 1081 11024 11139 --
NM_016019chr7263 34 ------
NM_016021chr62851 210 1348 1461 --
NM_016037chr12860 283 --11111 --
NM_016039chr14121 ------
NM_016047chr21167 ------
NM_016059chr6253 25 ------
NM_016061chr221447 1103 ----1437
NM_016072chr122807 96 ------
NM_016076chr152487 981 583 261 106 ------
NM_016078chr1721097 717 1389 ----
NM_016079chr232059 931 650 12361 ----
NM_016081chr431763 1460 815 ------
NM_016083chr623563 486 ----13804
NM_016100chr20--180 ----
NM_016103chr52432 198 ------
NM_016104chr61128 ------
NM_016107chr51989 --2273 226 --
NM_016131chr242000 1709 1657 676 ------
NM_016132chr1533349 2569 1119 ------
NM_016133chr221096 468 ------
NM_016147chr113870 221 36 --2257 116 --
NM_016152chr341209 1139 350 246 146 ----
NM_016173chr3103788 1647 1553 1415 1148 827 700 625 567 536 33356 3115 1091 23234 2971 1162
NM_016200chr71197 ------
NM_016201chr34903 781 499 324 ----1896
NM_016205chr441183 1143 186 22 1415 ----
NM_016206chr3118615 7083 6452 6088 2977 2453 2386 1567 1106 725 697 25464 1796 11392 22272 385
NM_016210chr3159 11592 ----
NM_016223chr113327 278 55 ------
NM_016227chr12331 287 ------
NM_016231chr1731548 260 40 --1570 --
NM_016248chr1363912 3601 2490 541 169 131 13400 ----
NM_016250chr142649 183 ------
NM_016255chr663212 2538 1068 989 593 558 ------
NM_016260chr275715 5488 5328 4981 2589 1971 1100 ----12560
NM_016269chr41479 1232 ----
NM_016271chr1831724 736 203 ------
NM_016272chr2211874 11761 21905 1111 --
NM_016284chr163951 667 86 ----1379
NM_016287chr11164 ------
NM_016290chr5180 ------
NM_016303chrX143 ------
NM_016322chr932526 897 601 12784 --1849
NM_016339chr1761351 1204 653 403 298 252 ------
NM_016340chr531085 483 373 ------
NM_016351chr71418 ------
NM_016374chr111259 ------
NM_016374chr111259 ------
NM_016376chr1733304 1122 336 --14282 --
NM_016399chr123726 643 568 ------
NM_016403chr111607 1731 ----
NM_016418chr2223244 274 42616 1001 178 59 --1963
NM_016423chr14124 ------
NM_016436chr2032161 781 58 12043 12531 1465
NM_016441chr242342 1529 715 351 1911 ----
NM_016453chr31427 132 1669 --
NM_016467chr221111 515 ------
NM_016472chr143607 415 138 ------
NM_016480chr5183 1367 ----
NM_016484chrX1552 1186 1164 --
NM_016507chr1742924 359 301 193 ------
NM_016516chr22645 26 ------
NM_016521chrX--128 ----
NM_016530chr1543993 3854 3798 3304 11249 11073 --
NM_016542chrX--2393 90 ----
NM_016545chr1--1720 ----
NM_016559chr331518 1288 1215 ------
NM_016569chr12--21241 262 11002 --
NM_016577chr334070 3074 1490 --2581 68 --
NM_016578chr11----144 --
NM_016588chr62678 79 ------
NM_016603chr51619 ------
NM_016605chr551972 1871 1742 731 115 --1599 --
NM_016607chrX2512 293 1542 --11198
NM_016612chr81267 ------
NM_016619chr4121 ------
NM_016621chr1184429 4114 3642 3457 3327 3272 1770 1522 24261 883 ----
NM_016628chr103699 624 350 ------
NM_016630chr151207 ------
NM_016654chr151142 1233 ----
NM_016818chr211203 ------
NM_016829chr32162 69 ----1261
NM_016834chr1764054 3565 3279 2783 1650 162 11363 --23730 3313
NM_016835chr1764054 3565 3279 2783 1650 162 11363 --23730 3313
NM_016836chr22652 548 ------
NM_016839chr22652 548 ------
NM_016841chr1764054 3565 3279 2783 1650 162 11363 --23730 3313
NM_016929chr654386 4367 3388 1578 1548 2529 66 1311 --
NM_016936chr164596 426 406 228 1260 11429 --
NM_016946chr183175 2821 2584 2490 1337 1230 716 615 12916 21103 1025 --
NM_017409chr12----1782 --
NM_017410chr1241061 1003 783 435 1145 ----
NM_017412chr821427 375 ------
NM_017413chrX3566 137 98 2718 405 ----
NM_017415chr553540 3531 3115 2991 908 --43387 3129 2857 816 13177
NM_017420chr1421308 577 --12958 --
NM_017423chr4--11807 21591 278 1108
NM_017426chr41181 ------
NM_017450chr173924 81 39 ------
NM_017451chr172892 381 ----11009
NM_017455chr15--1348 ----
NM_017456chr1761520 1479 1308 516 250 43 1220 --1133
NM_017488chr231458 1231 356 --11601 --
NM_017544chrX2753 170 ------
NM_017548chr3--1436 ----
NM_017563chr395706 5148 4966 4806 4670 4637 1662 355 211 34858 3873 1925 14142 --
NM_017575chr1761586 1385 1237 1135 1048 423 ------
NM_017580chr1021490 394 --11926 --
NM_017581chr4----1372 1133
NM_017582chr111350 --1124 --
NM_017590chr2222042 469 1289 12104 --
NM_017599chr12------160
NM_017602chrX----1793 --
NM_017612chr121172 ------
NM_017615chr101116 ------
NM_017628chr465176 4621 3541 2111 2000 1574 14293 22090 215 1573
NM_017632chr42284 136 ------
NM_017633chr642941 2702 2427 342 ----13231
NM_017634chr821437 485 1780 ----
NM_017637chr988638 8063 7783 7502 7399 6191 6032 31 27857 5904 19208 1655
NM_017640chr61792 ------
NM_017643chr1742172 972 872 460 22077 124 ----
NM_017644chr321318 746 25039 4949 11251 --
NM_017650chr765238 4947 4462 4088 1741 855 ------
NM_017651chr611365 11071 ----
NM_017657chr21942 ------
NM_017658chr1411328 14287 1354 13225
NM_017660chr1942380 456 90 31 43369 2980 2114 1370 13033 --
NM_017664chr132915 147 ------
NM_017666chrX61924 1382 1370 229 138 53 --21851 124 --
NM_017668chr163549 141 113 ------
NM_017670chr112827 262 ------
NM_017680chr9--1981 ----
NM_017686chr11990 ------
NM_017693chr1331259 506 136 ------
NM_017709chr163451 3029 1250 877 309 112 23272 2925 23113 844 --
NM_017714chr20----1707 --
NM_017715chr71565 ------
NM_017719chr331012 1003 691 11632 ----
NM_017737chr142000 357 209 203 ------
NM_017740chr1631252 1164 391 --1475 --
NM_017744chr152110 1700 1693 776 140 --2662 308 --
NM_017752chrX2854 364 ----11732
NM_017753chr931014 966 160 ------
NM_017754chr684169 3862 3192 926 882 701 640 434 24812 4796 24535 3878 11974
NM_017763chr172932 459 1191 ----
NM_017769chr14128 --1105 --
NM_017778chr8--11230 ----
NM_017780chr8--2799 650 ----
NM_017787chr1052890 2449 1114 952 814 ------
NM_017799chr1451722 1681 1525 733 39 ------
NM_017801chr332072 938 72 --21685 339 --
NM_017807chr14----131 --
NM_017810chr16130 --1643 --
NM_017811chr962871 2612 2445 2101 1911 127 12357 ----
NM_017813chr824327 1924 167 ----
NM_017822chr122762 223 1831 ----
NM_017830chr4--145 ----
NM_017831chr1863536 3218 3077 1414 1397 966 14219 --13469
NM_017848chrX43538 3020 1551 546 24509 350 ----
NM_017856chrX11734 11324 --1401
NM_017880chr2--1418 ----
NM_017893chr1031445 1231 275 --11138 --
NM_017902chr10145437 5219 5164 4660 4426 4314 3975 3798 3779 3639 1662 1312 1205 776 34323 3769 552 11839 15580
NM_017907chr112202 24 ------
NM_017921chr1771853 1771 535 423 244 155 137 --12234 --
NM_017922chr141168 ------
NM_017923chr41100 --1682 --
NM_017944chr1133017 2192 370 ------
NM_017958chr25761 555 473 397 219 22924 529 130 --
NM_017964chr21847 ------
NM_017983chr171167 ------
NM_017987chr102834 82 1373 ----
NM_017998chr92994 573 ------
NM_018011chr131122 ----158
NM_018014chr211337 ------
NM_018015chrX1997 1114 ----
NM_018017chr1062861 2450 1010 949 846 783 --1558 --
NM_018018chr1241867 1795 1305 1295 ------
NM_018036chr1464246 4146 4048 3425 1428 384 170 2746 341 --
NM_018045chr172708 2289 2047 695 660 179 28 182 22628 118 1762
NM_018046chr511908 ------
NM_018048chr121780 --11710 21834 1392
NM_018061chr131372 102 86 ------
NM_018070chr11406 ------
NM_018071chr143759 183 33 --1730 --
NM_018084chr232501 2495 1307 12510 --11134
NM_018086chr241743 1479 1182 184 ------
NM_018092chr1621320 352 --11047 --
NM_018098chr31289 ------
NM_018121chr1033096 2689 800 32702 1967 430 ----
NM_018125chr11451 ------
NM_018126chr411436 ----1320
NM_018133chr33408 205 91 ------
NM_018144chr101365 --181 --
NM_018155chr311190 ------
NM_018156chr142320 2163 2142 68 22824 1071 12444 11012
NM_018157chr1232087 1115 652 ----159
NM_018171chr122837 741 1733 ----
NM_018172chr1121107 1052 ----1262
NM_018181chr1821215 344 1697 ----
NM_018184chr31402 ------
NM_018195chr1121755 1343 ----1689
NM_018199chr141868 11190 --1819
NM_018205chr1062237 936 812 686 318 157 12351 ----
NM_018214chr61367 ------
NM_018227chr433099 2852 2511 --23078 1240 12363
NM_018239chr1062237 936 812 686 318 157 12351 ----
NM_018244chr201306 11188 1210 --
NM_018247chr632000 571 63 ------
NM_018254chr131705 816 119 ----22086 1550
NM_018275chr71218 ------
NM_018279chr1262844 1920 1848 774 382 109 13026 ----
NM_018281chr1------1204
NM_018293chr331813 984 677 ------
NM_018299chr813494 1292 23044 721 --
NM_018314chr111298 1539 ----
NM_018323chr411452 188 ----
NM_018325chr941462 1382 608 56 ------
NM_018327chr2021273 1214 1489 ----
NM_018330chr1021351 632 1203 ----
NM_018334chr7--1141 ----
NM_018354chr20------135
NM_018361chr82539 396 1390 ----
NM_018364chr153115 2659 694 547 503 ------
NM_018368chr6194 ------
NM_018370chr1242135 1573 293 143 ------
NM_018374chr764654 3944 3916 3204 517 496 ----1312
NM_018383chr231820 717 309 12022 ----
NM_018387chr91163 ------
NM_018403chr363949 3924 3891 2633 1329 468 --1481 --
NM_018407chr8162 ------
NM_018416chr1232222 924 217 --1854 --
NM_018444chr81196 12380 1264 --
NM_018448chr12--199 ----
NM_018449chr91687 ------
NM_018453chr142340 268 ------
NM_018457chr12--159 ----
NM_018460chr2--1153 ----
NM_018471chr21202 ------
NM_018482chr822330 1613 ----1454
NM_018489chr12783 675 ----1452
NM_018509chr1721352 1316 21681 1526 21462 1324 --
NM_018553chr1741813 1612 1147 206 ------
NM_018557chr2----1505 --
NM_018566chr123598 789 ----11356
NM_018590chr1031665 468 266 ------
NM_018602chr1541635 1112 654 179 11067 1574 --
NM_018640chr1232656 2592 2242 11880 ----
NM_018650chr121556 194 ------
NM_018667chr163553 528 338 --22088 932 --
NM_018674chr24559 552 505 122 ------
NM_018685chr721157 727 ------
NM_018695chr531976 1633 387 ------
NM_018710chr821355 1108 ------
NM_018715chr132003 1712 1636 --1786 --
NM_018718chr741712 1658 544 152 1827 ----
NM_018719chr721266 334 ------
NM_018834chr5------1327
NM_018844chr721368 199 ----11982
NM_018896chr17--188 155 1200
NM_018898chr522089 134 ----12052
NM_018899chr522089 134 ----12052
NM_018900chr522089 134 ----12052
NM_018901chr522089 134 ----12052
NM_018902chr522089 134 ----12052
NM_018903chr522089 134 ----12052
NM_018904chr522089 134 ----12052
NM_018905chr522089 134 ----12052
NM_018906chr522089 134 ----12052
NM_018907chr522089 134 ----12052
NM_018908chr522089 134 ----12052
NM_018909chr522089 134 ----12052
NM_018910chr522089 134 ----12052
NM_018911chr522089 134 ----12052
NM_018912chr561568 1362 444 382 207 55 --11702 --
NM_018913chr561568 1362 444 382 207 55 --11702 --
NM_018914chr561568 1362 444 382 207 55 --11702 --
NM_018915chr561568 1362 444 382 207 55 --11702 --
NM_018916chr561568 1362 444 382 207 55 --11702 --
NM_018917chr561568 1362 444 382 207 55 --11702 --
NM_018918chr561568 1362 444 382 207 55 --11702 --
NM_018919chr561568 1362 444 382 207 55 --11702 --
NM_018920chr561568 1362 444 382 207 55 --11702 --
NM_018921chr561568 1362 444 382 207 55 --11702 --
NM_018922chr561568 1362 444 382 207 55 --11702 --
NM_018923chr561568 1362 444 382 207 55 --11702 --
NM_018924chr561568 1362 444 382 207 55 --11702 --
NM_018925chr561568 1362 444 382 207 55 --11702 --
NM_018926chr561568 1362 444 382 207 55 --11702 --
NM_018927chr561568 1362 444 382 207 55 --11702 --
NM_018928chr561568 1362 444 382 207 55 --11702 --
NM_018929chr561568 1362 444 382 207 55 --11702 --
NM_018952chr171169 --1565 --
NM_018958chr1563301 3253 2895 2671 2542 1186 22880 855 13697 --
NM_018959chr191530 ------
NM_018963chr211157 181 ----
NM_018976chr1232104 1940 959 ------
NM_018979chr1231947 637 365 2750 238 1765 --
NM_018994chr11531 ------
NM_018999chr1063572 3247 862 782 589 524 --1877 --
NM_019001chr374303 3750 3449 1549 1039 853 504 2950 888 ----
NM_019004chr73787 208 139 ----1156
NM_019030chr5----1176 --
NM_019040chr11164 ------
NM_019042chr73205 144 77 --155 --
NM_019063chr231981 1748 400 ------
NM_019083chr121093 145 11357 ----
NM_019084chr1042319 1859 1044 853 --31633 1606 872 --
NM_019091chr22874 341 ------
NM_019098chr82314 128 --137 --
NM_019102chr7------1415
NM_019102chr7------1415
NM_019106chr2222496 1064 1615 1259 --
NM_019114chr92898 657 --1891 --
NM_019116chr16103055 2790 2433 2293 1209 915 718 643 200 174 2814 220 32976 2875 2301 --
NM_019590chr1051442 1366 1318 1296 465 ------
NM_019593chr2033092 3069 322 --11989 --
NM_019594chr92341 290 --174 --
NM_019595chr21239 1100 ----
NM_019597chrX2569 145 ------
NM_019605chr11184 --151 --
NM_019610chr121888 1869 ----11358
NM_019613chr1721193 901 1314 1285 1277
NM_019845chr22786 335 ------
NM_019849chr19----1189 --
NM_019854chr125730 702 642 187 150 ------
NM_019859chr102543 93 2329 266 ----
NM_019860chr102591 141 2377 314 ----
NM_019884chr192533 81 ------
NM_019885chr252953 2355 2305 940 185 ----1198
NM_020039chr1221606 1197 --1284 --
NM_020116chr421783 1373 ------
NM_020122chr2105958 5516 5208 4771 4714 1644 1629 1331 571 510 --15149 11248
NM_020123chr102296 271 ------
NM_020137chrX1104 ------
NM_020141chr152358 2000 1904 331 204 ----11983
NM_020148chr1852469 1190 341 286 73 --12319 --
NM_020150chr1041982 546 95 60 12111 ----
NM_020152chr212159 153 ------
NM_020159chr42486 215 11230 ----
NM_020177chr563278 2908 2433 1292 695 96 --12998 --
NM_020178chr1731124 1003 455 11028 --1868
NM_020179chr11------1333
NM_020182chr2073460 3242 2902 2749 2335 2268 1382 22644 943 ----
NM_020198chr1721081 43 ------
NM_020205chr142816 2483 2450 59 --13255 --
NM_020211chr154979 340 240 31 11210 11065 --
NM_020228chr1141737 688 79 64 ------
NM_020229chr113394 174 120 ------
NM_020239chr151803 1763 633 431 313 22025 1557 1779 --
NM_020245chr654819 4306 3781 1927 803 13510 --13408
NM_020248chr151771 1589 491 350 341 --22224 59 12380
NM_020336chr2043155 2663 1524 190 ------
NM_020337chr41273 11992 ----
NM_020338chr1042503 2457 2442 1084 1761 --13279
NM_020342chr222231 1883 1668 --12215
NM_020357chr311467 11310 2575 398 --
NM_020362chr12832 598 184 1746 --
NM_020366chr14172 ------
NM_020381chr631674 1463 472 ------
NM_020382chr1221569 462 11017 ----
NM_020390chr384580 4551 4385 4015 3795 3726 3112 1684 ----1271
NM_020403chr1321796 177 ------
NM_020423chr11525 1384 ----
NM_020428chr193800 452 293 ------
NM_020429chr763028 2378 2243 330 60 30 --1177 --
NM_020433chr2091731 1648 1587 1568 1371 277 224 212 27 --1652 11450
NM_020440chr172892 2485 2154 1088 708 417 324 --12406 13091
NM_020443chr1155956 5048 4386 2613 2151 2130 1893 1333 1151 1109 1078 765 431 360 95 56069 5548 2433 2427 1925 36536 6455 61 14395
NM_020455chr642660 2645 2405 2076 12219 --32181 2136 1735
NM_020463chr23989 260 151 ------
NM_020473chrX143 ------
NM_020474chr1821883 156 ------
NM_020478chr8--32256 1946 1557 21951 1657 --
NM_020530chr223923 220 79 ------
NM_020546chr573066 2576 2214 1999 851 778 361 22490 2411 12947 --
NM_020640chr311959 ------
NM_020647chr822262 1838 --11886 --
NM_020651chr231789 518 501 ------
NM_020654chr311335 ------
NM_020689chr2031145 547 30 1259 ----
NM_020697chr841378 1190 1058 490 ------
NM_020699chr164284 3973 3458 3428 1949 1801 ----11571
NM_020703chr11430 ------
NM_020704chr732190 297 238 144 --1503
NM_020708chr2051606 861 604 201 48 --1418 --
NM_020713chr2092834 2599 1022 955 887 554 336 208 69 21974 1157 11268 --
NM_020717chrX114696 4678 4260 4004 3881 3746 1817 1619 1360 1310 195 35034 1345 401 21722 1535 1786
NM_020718chr1655584 5051 4994 1373 1031 34332 986 457 ----
NM_020728chr753209 2618 2521 2513 215 --2245 38 --
NM_020734chr1253214 2446 2438 2333 459 ------
NM_020738chr221278 179 1218 ----
NM_020739chr151895 13984 23477 1357 1602
NM_020742chrX42418 2395 1890 442 11807 ----
NM_020747chr51787 171 ----
NM_020748chr173584 540 306 ------
NM_020753chr174763 507 295 166 ------
NM_020760chr211925 1304 ----
NM_020766chrX104153 3746 3440 3301 1777 1771 1738 386 206 59 ------
NM_020768chr52659 156 32182 1282 786 ----
NM_020769chrX2682 276 --1744 --
NM_020771chr611193 ----11308
NM_020772chr17158222 7986 7788 7313 7302 7287 7264 7147 6903 5964 5374 2943 1652 1561 350 22204 1862 11155 --
NM_020774chr1865421 5350 4865 3876 1468 929 21975 487 --16055
NM_020777chr492133 1829 1798 928 718 653 641 554 402 ------
NM_020778chr1574666 1175 1154 769 741 312 228 13192 13892 13831
NM_020782chr1254748 4528 1180 969 904 13650 ----
NM_020791chr1711340 1976 ----
NM_020792chr332107 925 356 --12040 --
NM_020794chr131509 1413 329 ------
NM_020795chr1711942 --11807 --
NM_020801chr531969 1665 370 --11784 --
NM_020804chr632054 1884 1854 32284 1932 90 22545 2382 --
NM_020806chr141279 ------
NM_020807chr1621572 1524 --176 --
NM_020808chr12740 705 ------
NM_020824chr101142 ------
NM_020826chr112255 129 1700 12390 --
NM_020830chr242797 2570 2392 2168 272 43 12652 --
NM_020834chr1431882 1679 737 ------
NM_020839chr341559 1442 1261 404 ------
NM_020841chr1231282 911 232 ------
NM_020843chr151402 ------
NM_020844chr8107561 7141 7072 5366 4962 2835 2085 1590 978 683 --24717 1242 --
NM_020850chr1662984 2365 1228 1097 991 408 ------
NM_020854chr1811368 11122 ----
NM_020856chr191460 ------
NM_020861chr6180 ------
NM_020873chr31857 ------
NM_020888chr121624 503 169 --11365
NM_020895chr191269 ------
NM_020899chr1751660 591 329 253 67 21775 778 12193 12460
NM_020918chr10103473 3141 2992 2252 1122 924 174 69 63 46 ------
NM_020922chrX2652 341 --11354 --
NM_020927chr163913 615 384 ------
NM_020940chr1052612 2537 2135 2111 1111 22306 69 1951 --
NM_020956chr1984436 4049 3413 1616 1562 1548 1538 1044 14549 ----
NM_020967chr202850 431 1405 ----
NM_020977chr42223 125 ------
NM_021003chr141753 ------
NM_021005chr152866 736 ------
NM_021032chr31408 11662 ----
NM_021033chr1333362 1277 461 --12689 --
NM_021035chr2031335 1165 56 11176 ----
NM_021061chr824159 703 11119 11257 --
NM_021069chr421383 835 11832 --1357
NM_021079chr1782847 2243 2123 2036 958 631 544 279 13244 ----
NM_021090chr22104537 4526 4134 3236 3221 1840 1692 1514 1474 746 --11847 --
NM_021097chr2--1121 1767 --
NM_021111chr91856 ------
NM_021120chrX32251 2107 450 12856 ----
NM_021132chr101537 11286 ----
NM_021136chr14158 --1682 --
NM_021155chr1982487 2411 2201 2065 1081 998 638 32 1477 1983 --
NM_021156chr202105 50 --1369 --
NM_021159chr41387 --11431 1422
NM_021183chrX41951 980 889 261 21564 725 12259 --
NM_021188chr141171 1413 ----
NM_021189chr1--11085 ----
NM_021190chr121151 931 ------
NM_021191chr1262432 2156 1664 1021 556 119 --1621 --
NM_021202chr2082783 2123 2079 993 499 368 347 55 ----12887
NM_021219chr211177 ------
NM_021229chr12--1333 ----
NM_021235chr19145 ------
NM_021238chr1261779 1685 1437 751 411 146 ------
NM_021239chr1411163 123 ----
NM_021240chr9----1195 --
NM_021242chrX1751 ------
NM_021252chr1021750 633 ------
NM_021253chr611343 ------
NM_021255chr1463264 2666 2495 1628 786 457 33275 3113 1210 ----
NM_021614chr5161 ------
NM_021622chr1021997 1912 1676 12062 --
NM_021627chr311064 ----1420
NM_021629chr323581 3202 14984 13889 1509
NM_021633chr111008 1503 ----
NM_021638chr494420 3712 3587 3145 3038 1846 964 131 80 1119 44433 3249 3187 896 14943
NM_021639chr11334 ------
NM_021643chr211352 ------
NM_021644chr101307 --1431 --
NM_021647chr464565 4422 3648 1849 1315 680 12884 13256 --
NM_021648chr642497 2470 1714 22 11843 1825 --
NM_021722chr71377 ------
NM_021723chr71418 ------
NM_021724chr171282 ------
NM_021728chr141125 ------
NM_021808chr122482 191 ------
NM_021813chr6105592 4841 4781 3587 2318 1824 1758 1749 391 254 25207 2203 11248 --
NM_021814chr611663 --1497 --
NM_021818chr1451417 1368 1060 1038 550 ------
NM_021831chr21302 --169 --
NM_021908chr71827 ------
NM_021911chr545255 5018 1769 895 35106 4564 816 ----
NM_021912chr15--1792 23926 2719 --
NM_021913chr1931525 1510 732 21152 1129 ----
NM_021914chr1472377 2319 2234 1634 1614 309 38 ------
NM_021931chr2041021 818 251 94 1315 ----
NM_021940chr631437 1370 1161 11181 166 1303
NM_021943chr631834 382 39 ----1671
NM_021945chr682519 2491 2410 1087 842 669 574 393 32575 624 26 --1811
NM_021946chrX2573 183 ------
NM_021961chr1187454 7378 7287 1838 1718 1594 830 404 ------
NM_021962chr1771939 1625 1564 839 550 419 128 ------
NM_021964chr346365 6143 5216 4245 14227 11651 --
NM_021979chr14--1169 ----
NM_021984chrX31357 302 39 11124 ----
NM_021987chrX31357 302 39 11124 ----
NM_021988chr2021524 124 ------
NM_021990chrX31357 302 39 11124 ----
NM_021998chrX11344 ------
NM_022041chr1632701 378 212 --2160 56 --
NM_022048chr1575501 4220 3901 2416 2126 670 61 15220 11076 --
NM_022060chr1431377 1110 502 1460 21283 954 --
NM_022062chr1151715 1476 1239 468 134 2587 182 1118 --
NM_022068chr182490 89 ------
NM_022075chr12288 85 ------
NM_022079chr101798 ------
NM_022085chr62553 36 11214 1341 --
NM_022090chr5----1516 --
NM_022091chr632710 1834 701 11947 --11785
NM_022095chr20143 ------
NM_022114chr134539 3866 1085 ------
NM_022137chr1442075 1455 631 369 ------
NM_022143chr721474 1351 11310 ----
NM_022166chr16105211 4884 4749 4562 4294 2395 2158 1315 677 208 26061 1817 ----
NM_022337chr112655 630 --1503 --
NM_022351chr821387 179 --13356 --
NM_022442chr2021524 124 ------
NM_022456chr1296674 5777 5601 5210 5148 2742 2403 2101 1494 26117 1604 46870 6498 369 306 --
NM_022459chr1395405 4046 2294 1695 1309 687 606 527 179 14489 ----
NM_022461chr31890 ----1200
NM_022465chr1292968 2706 2497 2461 2008 1167 1040 428 401 --22069 509 --
NM_022473chr1564069 3896 3585 3118 1573 1290 23434 153 ----
NM_022476chr163414 220 54 1886 ----
NM_022477chr2041587 1163 635 357 11627 ----
NM_022494chr101320 ------
NM_022497chr34976 806 772 471 --1782 --
NM_022552chr231216 902 249 ------
NM_022572chr231427 1171 1127 --1346 --
NM_022574chr761732 1366 861 697 593 81 ------
NM_022650chr51944 ------
NM_022652chr121443 ------
NM_022658chr121153 ------
NM_022659chr82532 74 --1172 --
NM_022730chr21258 2217 97 ----
NM_022733chr121168 329 ------
NM_022739chr172746 446 --1862 --
NM_022742chr72310 60 ------
NM_022753chr112290 --12113 --
NM_022755chr941667 986 888 274 22131 604 22232 1805 --
NM_022763chr332093 556 253 --11101 --
NM_022780chr211746 1566 1595 --
NM_022781chr931237 1149 233 ------
NM_022782chr12----1403 --
NM_022821chr1--1201 1419 --
NM_022824chr541916 1545 775 321 11218 ----
NM_022828chr541618 1549 1469 1456 11223 --11694
NM_022831chr121569 1530 --164 11495
NM_022833chr931102 941 69 ------
NM_022836chr131477 1247 711 --21526 1397 --
NM_022843chr1321294 1158 187 ----
NM_022845chr1621834 293 1430 1826 --
NM_022893chr22785 440 ------
NM_022898chr1433665 3000 832 11260 ----
NM_022900chr71847 ------
NM_022912chr282945 2732 2090 1237 1068 892 861 646 ----11977
NM_022918chr1141528 862 349 194 ------
NM_022977chrX2361 187 ------
NM_023009chr11224 ------
NM_023012chr122236 88 ------
NM_023019chr21108 1128 ----
NM_023076chr1662632 2420 2333 2089 971 764 12259 12559 143
NM_023105chr821945 338 --22224 1928 --
NM_023106chr821945 338 --22224 1928 --
NM_023110chr821945 338 --22224 1928 --
NM_023111chr821945 338 --22224 1928 --
NM_023929chr811005 ------
NM_024007chr532933 1275 565 1336 ----
NM_024016chr172260 91 --1183 --
NM_024017chr1721142 288 11681 134 --
NM_024043chr1661413 1262 1195 1141 143 24 1106 ----
NM_024061chr73219 67 33 ------
NM_024076chr1942295 2245 503 262 12051 12345 --
NM_024090chr431831 1586 29 21374 746 11402 --
NM_024107chr17--1852 ----
NM_024312chr1221031 208 2370 62 ----
NM_024326chr10--1122 ----
NM_024332chrX21688 658 ------
NM_024345chr976060 5152 5035 4843 2348 1555 1212 --24154 283 --
NM_024416chr911446 ------
NM_024423chr1834164 1066 915 --1971 --
NM_024430chr1831794 1640 1244 --1369 --
NM_024511chr463309 2973 2936 2373 1089 384 ------
NM_024522chr151710 1674 1648 414 191 1758 ----
NM_024524chr33703 124 95 --1714 --
NM_024539chrX1386 11037 ----
NM_024541chr1061823 1708 1199 520 377 260 ----11737
NM_024545chr21549 --1118 --
NM_024546chr13------1836
NM_024551chr1221026 140 22405 917 ----
NM_024551chr1221026 140 22405 917 ----
NM_024556chr112368 323 1445 ----
NM_024581chr6123 ------
NM_024607chr854210 3357 3258 806 554 --2737 51 --
NM_024628chr331098 792 224 11046 ----
NM_024646chr153950 2747 1560 1499 1426 23356 358 ----
NM_024652chr1541108 770 497 81 ----1170
NM_024665chr344664 4054 4037 3057 --44259 3908 1060 626 14587
NM_024670chr1031528 1266 694 1588 11380 --
NM_024692chr22594 371 11198 ----
NM_024698chr1111144 1365 ----
NM_024704chr20272 56 ----11049
NM_024705chr133923 402 223 --1164 --
NM_024713chr15--21193 211 ----
NM_024721chr832665 408 86 179 ----
NM_024722chr172367 217 1176 ----
NM_024744chr222713 956 1156 12538 --
NM_024755chr152348 172 --1334 --
NM_024761chr965149 4365 3311 2108 549 505 13292 ----
NM_024770chr2116471 6281 6183 5607 5458 4625 1838 967 656 377 137 35764 2582 1497 35150 5116 559 --
NM_024792chr171283 ------
NM_024817chr15115328 5144 4248 2131 1897 1797 1788 1356 1131 548 299 11440 24294 598 --
NM_024830chr531590 1411 82 1128 ----
NM_024835chr171160 ------
NM_024837chr151684 11338 --168
NM_024854chr1231314 1015 286 135 11472 --
NM_024866chr2243493 3025 1211 1058 1812 --1569
NM_024875chr102612 46 11677 ----
NM_024881chr19113422 3354 1413 1350 1217 1064 1044 649 601 332 198 21426 819 ----
NM_024887chr151355 532 421 404 183 2718 51 1371 --
NM_024909chr631100 1055 517 ------
NM_024920chr411187 --1156 1401
NM_024921chrX31956 1584 152 11369 ----
NM_024922chr1681892 1764 1723 1642 1478 1289 837 398 11595 1264 --
NM_024930chr552488 2078 1880 831 159 ----12576
NM_024939chr1651145 1030 373 237 114 21641 150 193 --
NM_024944chr213877 120 72 --11203 --
NM_024947chr379181 8119 8047 6475 3451 3267 1941 48740 7835 6553 2611 ----
NM_024953chr121767 --31133 656 510 --
NM_024969chr22833 748 2854 309 ----
NM_024979chr132644 407 11582 --1278
NM_025052chr2--130 ----
NM_025057chr141922 1551 --1527
NM_025069chr81167 ------
NM_025074chr452664 1195 1142 244 105 ------
NM_025076chr21166 ------
NM_025126chr122611 206 --1638 --
NM_025133chr21992 ------
NM_025134chr16--11653 ----
NM_025146chr332636 2521 2094 11803 ----
NM_025160chr131562 636 494 22949 2735 14117 --
NM_025164chr1131736 1365 785 ------
NM_025179chr194650 4434 3865 3722 3077 3007 1997 1813 1292 53741 1866 1658 1514 182 ----
NM_025181chr21750 ------
NM_025182chr92278 155 1724 ----
NM_025184chrX2844 646 ------
NM_025191chr121242 221 ------
NM_025214chr1842679 2564 826 670 ------
NM_025221chr411137 ----1523
NM_025222chr372266 2199 1978 986 732 354 252 ------
NM_025235chr1062109 2043 1789 1699 787 763 1730 11427 --
NM_025248chr1732119 566 356 13027 --12734
NM_025251chr851078 450 429 275 233 21022 890 1348 --
NM_030576chr1772040 1948 1859 908 877 358 296 22358 1628 ----
NM_030594chr15----1273 --
NM_030621chr1422860 1261 --1946 --
NM_030625chr1022062 399 21618 736 12012 --
NM_030627chr554028 3986 3046 2617 1390 --12552 --
NM_030634chr132117 1662 997 --1599 --
NM_030647chr766126 5773 5456 3974 2159 67 --21426 646 --
NM_030648chr465180 4725 3719 3380 1359 701 11510 ----
NM_030650chr244021 3629 3487 934 13698 1446 --
NM_030660chr1441378 1172 1074 389 --1329 --
NM_030664chr1011771 11734 1461 --
NM_030670chr1251726 644 245 148 35 21686 531 ----
NM_030671chr1251726 644 245 148 35 21686 531 ----
NM_030751chr1021864 1174 ----1543
NM_030751chr1021864 1174 ----1543
NM_030753chr171255 ------
NM_030756chr102312 303 ------
NM_030761chr162620 2433 2297 2034 1785 1660 22453 1841 21896 1792 --
NM_030762chr1241442 486 279 182 ------
NM_030767chr91665 22496 2059 1104 12483
NM_030791chr1411787 ------
NM_030806chr199215 8043 7877 7626 7418 7260 2578 1348 875 16438 12284 --
NM_030808chr174990 845 426 26 ------
NM_030809chr1252271 2012 1960 1793 1658 ----12320
NM_030810chr62553 36 11214 1341 --
NM_030884chr342258 2138 814 204 --11756 --
NM_030885chr33939 617 141 ----11969
NM_030906chr11------1115
NM_030912chr101283 ------
NM_030918chr1104710 4595 4512 4493 4148 1893 1741 1584 1289 543 24884 4227 34979 4902 698 14620
NM_030920chr132058 1944 573 11422 11775 --
NM_030922chr154848 809 749 178 ------
NM_030926chr2188 ------
NM_030937chr12944 266 --11388 --
NM_030938chr172726 333 ------
NM_030939chr6----11185 --
NM_030953chr571614 1509 1102 645 482 442 357 1619 ----
NM_030964chr573533 3118 2598 2426 571 410 137 23641 3311 12840 --
NM_030978chr91458 ------
NM_031216chr1841674 902 363 72 --1786 --
NM_031243chr751990 1672 1584 914 264 2923 76 ----
NM_031244chr6--1308 --11121
NM_031262chr911090 --1146 --
NM_031263chr911147 --1203 --
NM_031266chr5--1173 ----
NM_031268chr16105118 3663 3645 2005 1630 1122 824 719 600 427 22160 283 ----
NM_031284chr152719 234 1875 --1657
NM_031286chr12328 21 ------
NM_031291chr41118 ------
NM_031305chr42331 31 21251 345 ----
NM_031314chr1411397 --1404 --
NM_031369chr41776 --179 --
NM_031370chr41776 --179 --
NM_031371chr111259 ------
NM_031371chr111259 ------
NM_031411chr522089 134 ----12052
NM_031417chr1952752 1748 1132 270 43 ------
NM_031419chr32277 129 ------
NM_031427chr1485759 5550 4145 2247 1536 992 478 448 21996 522 1793 --
NM_031435chr1233147 2284 728 ------
NM_031442chrX22709 375 1802 ----
NM_031445chr262602 1176 1021 731 575 250 --22665 125 --
NM_031459chr13568 516 33 11649 ----
NM_031461chr81178 --11493 --
NM_031468chr7127909 7569 7521 7492 7121 6697 6362 5964 5313 3101 3010 1825 35165 448 175 11423 --
NM_031469chr653606 3059 2792 871 514 1823 ----
NM_031477chr16185 --1123 129
NM_031483chr2053526 2313 2266 752 95 --11429 --
NM_031492chr11----1404 --
NM_031844chr143651 3359 2795 2690 --13128 --
NM_031845chr233636 3380 47 12935 ----
NM_031847chr233636 3380 47 12935 ----
NM_031849chr522089 134 ----12052
NM_031857chr522089 134 ----12052
NM_031860chr522089 134 ----12052
NM_031866chr103973 879 242 ------
NM_031885chr16128 ------
NM_031891chr181134 ------
NM_031892chrX1771 ------
NM_031908chr521129 38 ------
NM_031924chr61252 ------
NM_031935chr1------1751
NM_031940chr822518 42 12034 1838 --
NM_031948chr16136 ------
NM_031989chr122309 246 ------
NM_031990chr194567 438 223 158 1907 ----
NM_031991chr194567 438 223 158 1907 ----
NM_032013chr2041587 1163 635 357 11627 ----
NM_032017chr161745 1425 773 667 598 430 ------
NM_032021chr111992 ------
NM_032041chr841876 851 607 153 1363 22731 2064 --
NM_032042chr532054 776 277 2525 293 ----
NM_032050chr222785 398 ------
NM_032088chr561568 1362 444 382 207 55 --11702 --
NM_032092chr561568 1362 444 382 207 55 --11702 --
NM_032121chrX32684 1093 758 --1449 12512
NM_032124chr1841197 1104 428 39 ------
NM_032128chr42987 790 ------
NM_032139chr191131 ------
NM_032144chr2--11320 ----
NM_032147chr122861 263 ------
NM_032181chr2190 --1572 --
NM_032182chr1021137 587 31536 1331 1325 ----
NM_032189chr13144622 3733 3585 3536 3499 3460 3409 3364 3265 3212 3153 1402 913 631 13832 ----
NM_032193chr1171770 1493 1347 318 178 91 55 12001 21289 360 --
NM_032199chr1033121 2817 613 148 11265 1598
NM_032208chr223431 1385 ------
NM_032217chr41960 ------
NM_032228chr1132871 2234 1193 ------
NM_032229chr1311047 ------
NM_032233chr143843 739 315 1814 1167 --
NM_032239chr421352 506 ------
NM_032242chr3113077 2909 2845 2702 2629 2389 2228 2206 1240 1080 878 22254 1255 ----
NM_032246chr152536 336 ------
NM_032268chr1642599 2133 2124 1206 11130 12869 --
NM_032271chr1621554 385 ------
NM_032281chr1932854 2464 1922 22691 372 12105 --
NM_032283chr191809 1382 1334 1159 722 667 656 466 411 21731 568 ----
NM_032288chr332404 1797 228 ------
NM_032289chr551851 1782 1677 747 344 193 ----
NM_032303chr931309 1247 541 1191 1327 --
NM_032316chr352145 2120 1623 700 181 --1591 --
NM_032320chr11--1203 ----
NM_032373chr1045605 3904 1769 349 25146 4292 13710 --
NM_032376chr171687 ----1660
NM_032382chr161486 ------
NM_032389chr1161045 879 865 403 386 57 --11164 --
NM_032403chr561568 1362 444 382 207 55 --11702 --
NM_032408chr751110 930 890 325 157 11088 ----
NM_032412chr52101 35 ------
NM_032431chr1131064 117 80 1214 1386 --
NM_032434chr251372 381 272 248 124 1350 ----
NM_032440chr1041959 1880 816 197 ------
NM_032445chr1512118 32188 2171 831 --198
NM_032446chr523669 1394 1385 --1771
NM_032457chr41961 ----13186
NM_032458chrX32956 2133 647 1950 ----
NM_032466chr82605 566 --11200 --
NM_032468chr82605 566 --11200 --
NM_032482chr1972401 2060 1035 769 582 471 88 2309 128 ----
NM_032486chr1672285 2208 2200 2121 1955 1644 1032 21727 37 ----
NM_032491chr122836 181 ------
NM_032510chr1831969 871 501 ----131
NM_032521chr2053204 2115 941 556 433 1954 ----
NM_032538chr672592 2577 2188 1911 1781 1126 77 32118 980 510 --1661
NM_032539chrX3726 585 72 ------
NM_032547chr411254 --11172 --
NM_032552chr961853 1792 1773 1362 1334 265 21640 249 --1775
NM_032557chr41927 ------
NM_032558chr921474 1060 ------
NM_032560chr141214 ------
NM_032569chr1631733 437 223 ------
NM_032575chr1671938 1628 1512 495 415 266 41 ----11961
NM_032581chr721419 129 --2486 376 11714
NM_032582chr1731719 1486 201 ------
NM_032594chr141435 ------
NM_032632chr1461278 1238 798 743 541 535 ----11732
NM_032682chr343181 2648 1326 763 22532 2428 ----
NM_032711chr1753197 3191 3134 1373 738 ------
NM_032784chr62737 369 ------
NM_032801chr1142168 2114 1978 1951 22561 875 12205 --
NM_032804chr1032268 2029 468 ----11816
NM_032808chr151838 ------
NM_032812chr102360 245 1106 ----
NM_032818chr971860 1839 971 716 654 420 191 --11740 --
NM_032832chr641081 425 386 83 1677 ----
NM_032840chr122134 64 --1774 --
NM_032842chr721529 449 ------
NM_032846chr1411035 --1545 143
NM_032859chr1323126 407 --1820 --
NM_032866chr1542954 585 400 132 ------
NM_032869chr821815 536 1775 ----
NM_032870chr62564 557 ------
NM_032871chr1161897 1802 1268 736 663 594 11593 ----
NM_032876chr146826 797 672 647 565 500 --12211 --
NM_032900chr1052914 1380 1251 959 610 --13531 --
NM_032906chr4----1356 1654
NM_032924chr72219 49 ------
NM_032947chr551148 1017 967 906 863 21282 364 --1984
NM_032961chr411302 11228 ----
NM_032968chrX43828 3696 3130 1102 14139 ----
NM_032969chrX43828 3696 3130 1102 14139 ----
NM_032973chrY43820 3688 3125 1102 14131 ----
NM_032975chr1853199 2677 2295 1053 169 ----12570
NM_032980chr1853199 2677 2295 1053 169 ----12570
NM_032983chr752773 2727 1313 994 353 42702 2086 1151 336 13193 --
NM_032998chr11377 --11058 --
NM_032999chr751028 841 727 407 377 1987 ----
NM_033000chr751028 841 727 407 377 1987 ----
NM_033001chr751028 841 727 407 377 1987 ----
NM_033014chr911446 ------
NM_033018chrX1210 ------
NM_033020chr141398 868 483 139 --24478 4030 --
NM_033030chr2--175 ----
NM_033044chr121072 1044 11132 ----
NM_033055chr1160 ------
NM_033071chr62494 278 ------
NM_033081chr203924 460 65 ------
NM_033089chr202598 498 ------
NM_033102chr13430 123 52 21097 276 1445 --
NM_033102chr13430 123 52 21097 276 1445 --
NM_033116chr141266 ------
NM_033127chr11460 ----1199
NM_033129chr203767 689 269 31810 1780 741 ----
NM_033132chr131664 ------
NM_033141chr1441974 1374 403 226 11897 ----
NM_033181chr623563 486 ----13804
NM_033201chr162749 87 --1429 --
NM_033207chr104994 743 527 123 12056 ----
NM_033211chr522118 249 ------
NM_033215chrX2142 123 1416 ----
NM_033224chr767353 6847 6580 5101 3060 267 27914 199 ----
NM_033225chr821095 573 13071 --1883
NM_033274chr5133295 3033 2945 2772 2688 2304 1339 946 476 406 280 103 36 13257 11368 --
NM_033281chr51178 ------
NM_033290chrX1909 13051 1870 23574 3542
NM_033315chr173643 513 460 1867 21806 845 --
NM_033326chr1131944 1844 1693 --11673 193
NM_033331chr983493 2991 2833 2690 2607 1201 675 210 ------
NM_033360chr1273160 1457 1249 1088 826 248 35 12883 ----
NM_033389chr1773449 3435 1551 1430 1378 803 520 13346 34232 3313 1694 --
NM_033393chr472969 2937 2600 2417 2108 956 793 12216 ----
NM_033394chr231400 1174 583 21056 443 ----
NM_033407chr1------1484
NM_033425chr11103302 3120 3003 2674 2493 2246 1384 802 223 123 ------
NM_033426chr1452621 2323 2042 1947 44 12016 ----
NM_033429chr1532109 613 289 12591 ----
NM_033449chr542006 1749 1510 304 ----1334
NM_033484chr51627 ------
NM_033495chrX2784 31 11017 ----
NM_033505chr256400 5778 4389 4168 762 16464 24375 584 --
NM_033540chr31285 ------
NM_033551chr531091 987 316 --22922 235 --
NM_033631chr1123918 3888 3817 3809 3290 2903 2695 1141 695 339 142 48 23751 484 22395 607 1943
NM_033637chr1063988 3642 3537 3156 1256 553 2970 457 13742 --
NM_033644chr522072 1934 11960 2662 210 --
NM_033645chr522072 1934 11960 2662 210 --
NM_033655chr911116 ------
NM_033656chr2156013 5481 5420 3970 3703 14529 12275 15336
NM_048368chr183631 530 65 1246 ----
NM_052818chr1321902 1863 31930 331 89 11842 --
NM_052832chr832597 843 25 ----1720
NM_052845chr1242928 2698 2647 217 12265 ----
NM_052847chr1963206 3111 2632 2438 1161 98 12862 1412 --
NM_052849chr152810 299 ----1767
NM_052864chr4144 1410 11883 --
NM_052879chr1263781 3599 3118 2782 2579 330 --21369 1050 --
NM_052885chr1233983 3810 1573 14604 23116 1109 11504
NM_052886chr821998 1397 ----11730
NM_052896chr121934 80 12078 ----
NM_052898chr831338 458 107 ------
NM_052899chr54775 337 189 46 1259 ----
NM_052901chr931138 330 250 --21560 1325 --
NM_052904chr61226 --139 --
NM_052905chr221242 155 ------
NM_052907chr1224024 567 ------
NM_052910chr131524 21863 619 31340 424 179 --
NM_052911chr1831032 365 166 ------
NM_052918chr1062613 1200 693 598 539 342 13246 1703 --
NM_052928chr1741434 1234 382 83 --11533 --
NM_052937chr83795 548 225 --12492 --
NM_052954chr2141705 1622 580 408 1895 ----
NM_052968chr115735 647 532 53 32 ----1605
NM_052978chr1421235 291 1163 ----
NM_052998chr11182 ------
NM_053001chr82281 133 1163 ----
NM_053016chr9117862 7722 7661 7074 7001 4889 4876 2212 1244 555 469 12047 37995 6329 1271 17571
NM_053023chr1162633 2387 2213 702 669 252 --31304 1021 433 --
NM_053024chr311063 11099 ----
NM_053043chr776099 5995 5960 5852 3962 1854 867 11902 25555 773 --
NM_053064chr1432003 692 35 11204 ----
NM_053274chr11118 ------
NM_054014chr201369 --126 --
NM_054114chr63719 101 29 ------
NM_057161chr61350 ------
NM_057178chr1762818 2560 2161 2090 1025 712 12421 ----
NM_057749chr811109 ------
NM_058167chr17509 399 392 371 251 117 105 --21017 920 --
NM_058170chr1----11388 --
NM_058237chr142909 410 ------
NM_058241chr211644 ------
NM_058241chr211644 ------
NM_058243chr191711 ------
NM_078470chr1062648 2191 1778 1720 308 48 --22618 905 1598
NM_078473chr822518 42 12034 1838 --
NM_078483chr563373 2904 2841 2794 2531 261 22493 1123 1659 --
NM_078487chr932444 1333 1301 ----23246 2313
NM_080425chr201229 ------
NM_080426chr201229 ------
NM_080546chr91591 ------
NM_080591chr962739 2296 2217 1015 967 440 1689 ----
NM_080614chr20124 ------
NM_080625chr203377 134 27 31030 312 162 ----
NM_080629chr111251 ------
NM_080630chr111251 ------
NM_080645chr61464 21939 262 --11528
NM_080669chr1734536 3942 1581 1612 ----
NM_080670chr55873 831 811 752 318 ------
NM_080676chr2042647 1119 892 33 ------
NM_080679chr63943 89 66 ------
NM_080680chr63943 89 66 ------
NM_080681chr63943 89 66 ------
NM_080717chr121171 ------
NM_080738chr131746 549 157 1664 ----
NM_080743chr642104 1798 484 144 ------
NM_080759chr1361879 1828 1748 1737 1678 314 ------
NM_080760chr1361879 1828 1748 1737 1678 314 ------
NM_080867chr1453680 3534 3484 1600 886 --1456 --
NM_080868chr1123 ------
NM_080874chr431833 310 67 ------
NM_080927chr373388 2916 2288 1284 1234 347 264 ------
NM_100264chr103699 624 350 ------
NM_100486chr103699 624 350 ------
NM_130385chr1143149 2645 606 282 ------
NM_130386chr18139 ------
NM_130391chr912523 13586 12926 --
NM_130392chr912523 13586 12926 --
NM_130393chr912523 13586 12926 --
NM_130434chr1521147 465 1412 ----
NM_130436chr2142191 695 549 216 ------
NM_130438chr2162768 1272 1126 793 573 103 --1205 --
NM_130442chr7--2911 207 ----
NM_130463chr62581 35 ------
NM_130466chr1241833 1823 55 30 1362 ----
NM_130468chr153584 143 88 ----2572 282
NM_130781chr54481 386 341 62 ------
NM_130797chr751723 1528 1430 168 31 --11118 --
NM_130798chr1511298 --145 --
NM_130799chr113491 303 41 1788 ----
NM_130800chr113491 303 41 1788 ----
NM_130801chr113491 303 41 1788 ----
NM_130802chr113491 303 41 1788 ----
NM_130803chr113491 303 41 1788 ----
NM_130804chr113491 303 41 1788 ----
NM_130811chr202227 148 --149 --
NM_130846chr124930 167 106 80 ------
NM_133170chr2097921 6477 5626 2300 1680 1033 841 369 91 35649 2798 1843 36812 5098 291 15897
NM_133171chr2011266 1518 ----
NM_133264chr1753592 2809 1559 980 94 11443 ----
NM_133265chrX42897 2759 2310 1104 12974 --23615 1262
NM_133329chr211451 ------
NM_133370chr483502 3482 3342 2911 2846 2722 2416 1149 ----13392
NM_133378chr23928 788 667 ------
NM_133432chr23928 788 667 ------
NM_133437chr23928 788 667 ------
NM_133445chr982809 2428 1028 742 433 238 165 30 ------
NM_133452chr1921122 474 ------
NM_133476chr121256 --1845 1108
NM_133478chr262491 1935 1810 1774 368 213 21844 70 ----
NM_133496chr163988 3641 3264 3204 3019 263 ------
NM_133631chr3--11511 ----
NM_133639chr151118 ------
NM_133650chr62494 278 ------
NM_134265chr171304 ------
NM_134268chr172933 240 --11082 1842
NM_134325chr1166 ------
NM_134428chr91310 ------
NM_134442chr251524 1278 1267 651 356 ------
NM_138270chrX32999 2710 521 ------
NM_138281chr171504 199 ----
NM_138282chr62581 35 ------
NM_138292chr1153224 2588 1290 956 758 --1972 --
NM_138319chr153291 274 166 ----1222
NM_138323chr152170 136 2737 362 ----
NM_138328chr1763029 2915 2411 1202 437 352 3733 701 494 ----
NM_138333chr931917 1837 825 2963 306 --12216
NM_138338chr2222106 685 ------
NM_138369chr51507 ------
NM_138385chr421319 1090 ------
NM_138396chr122297 214 1322 1758 --
NM_138415chr2231678 1334 1183 --1500 --
NM_138426chr722504 1581 22038 312 22017 1823 1505
NM_138434chr721093 110 11268 ----
NM_138444chr1334152 706 430 ------
NM_138457chr692092 941 914 793 705 505 406 322 140 1859 --1632
NM_138459chr623131 102 1493 12607 --
NM_138468chr285511 5422 5341 4868 2198 1704 1371 1037 12081 25855 1688 16150
NM_138473chr1274145 3990 3858 1020 692 631 315 --23726 1691 21170 815
NM_138479chr142069 130 46 21 11979 ----
NM_138494chr772562 2469 2305 1116 1107 768 116 ------
NM_138558chr131034 903 247 1920 ----
NM_138559chr211327 ------
NM_138576chr1433665 3000 832 11260 ----
NM_138578chr2031429 1105 203 --11377 --
NM_138638chr1472377 2319 2234 1634 1614 309 38 ------
NM_138694chr693467 3297 2936 2762 1309 1150 1086 372 218 12596 ----
NM_138701chr7--128 1194 --
NM_138713chr1656937 5704 5648 2614 668 17866 12240 --
NM_138714chr1656937 5704 5648 2614 668 17866 12240 --
NM_138717chr62527 510 1717 ----
NM_138727chr152110 1700 1693 776 140 --2662 308 --
NM_138728chr152110 1700 1693 776 140 --2662 308 --
NM_138768chr113892 768 293 3654 349 142 ----
NM_138771chr7--1111 11294 --
NM_138774chr192214 156 1208 1801 --
NM_138775chr111262 ------
NM_138782chr52970 366 11629 ----
NM_138795chr131519 1331 61 ------
NM_138933chr101138 ------
NM_138957chr221116 138 ----
NM_138959chr196532 6176 5819 4605 2342 1866 1379 741 253 25738 1972 ----
NM_138970chr1422401 2310 ----1302
NM_138980chr41689 --1714 --
NM_138981chr41820 --1845 --
NM_138982chr41689 --1714 --
NM_139014chr632219 2207 362 ------
NM_139035chrX2317 114 1222 ----
NM_139045chr92879 127 ------
NM_139068chr51730 ------
NM_139069chr51730 ------
NM_139071chr1261688 1676 1341 446 220 200 21089 554 ----
NM_139072chr21217 ------
NM_139135chr12264 124 ------
NM_139167chr8196 ------
NM_139181chr113456 444 23 ------
NM_139182chr431482 1241 591 1220 ----
NM_139207chr1231951 1877 842 12176 21420 270 --
NM_139211chr4--126 ----
NM_139212chr4--126 ----
NM_139241chr12165 ------
NM_139244chr61649 ------
NM_139273chr112225 68 131 ----
NM_139276chr1741915 1671 939 607 ------
NM_139283chr1242544 2039 625 186 ------
NM_139321chr2033933 1579 1013 --13059 13715
NM_139323chr2011339 --11848 --
NM_144498chr2042039 1868 1683 1619 1209 1302 --
NM_144499chr351172 997 878 346 130 ------
NM_144571chr436530 4896 1883 --12558 --
NM_144578chr1485260 4149 3881 3466 1773 1522 896 272 13767 11957 11259
NM_144582chr262563 2362 1765 733 468 168 --32217 995 898 --
NM_144583chr221767 1654 ------
NM_144586chr231100 426 413 ------
NM_144594chr121193 ------
NM_144598chr15--1135 ----
NM_144599chr15105374 5109 4196 3515 2107 1830 1553 1388 645 151 --33847 1897 1452 --
NM_144600chr1621098 175 ------
NM_144609chr171932 ------
NM_144628chr2062906 2700 2567 1143 842 822 22998 525 1800 --
NM_144632chr241817 475 302 222 11587 ----
NM_144635chr351233 824 794 114 85 198 1482 --
NM_144642chr32301 122 ------
NM_144643chr41428 ------
NM_144664chr1132128 1969 1645 --1951 --
NM_144691chr19----1254 --
NM_144710chr2--1238 ----
NM_144721chr431101 910 675 --11033 1806
NM_144723chr52718 252 ------
NM_144732chr195883 744 721 388 21 ------
NM_144767chr1544224 2879 2840 1104 14621 ----
NM_144778chr131128 1720 --1459
NM_144963chr82818 59 ------
NM_144967chrX1234 1119 --1795
NM_144973chr12105151 5052 3434 2070 2010 1645 1392 685 309 165 --14366 --
NM_144982chr121131 --1262 --
NM_145021chr102264 212 ------
NM_145024chr16----167 --
NM_145025chr64461 322 273 228 ------
NM_145055chr1863217 2714 2642 2502 2414 1408 21138 91 --185
NM_145056chr195245 220 214 160 23 ------
NM_145074chr22553 26 1494 ----
NM_145102chr721505 1308 1337 1372 --
NM_145112chr143343 169 155 ------
NM_145113chr144615 441 427 255 ------
NM_145166chr382798 2701 2474 2391 1931 1918 1797 942 22443 2279 11814 11078
NM_145203chr13179 ------
NM_145206chr1042090 2057 400 365 22810 2166 ----
NM_145207chr495054 4820 4777 1973 1787 1205 1100 765 249 25243 4511 13355 --
NM_145251chr141559 ------
NM_145259chr266250 5155 4712 2443 2139 38 1288 25748 769 --
NM_145268chr72924 343 1731 ----
NM_145274chr171639 --1602 --
NM_145284chrX--22185 511 ----
NM_145313chr1011242 1518 --11344
NM_145320chr753581 2712 652 479 118 --12725 13193
NM_145321chr753581 2712 652 479 118 --12725 13193
NM_145322chr753581 2712 652 479 118 --12725 13193
NM_145331chr6194 1575 ----
NM_145332chr61242 1723 1671 --
NM_145333chr61242 1723 1671 --
NM_145351chr1752323 857 583 451 179 3921 831 283 11790 --
NM_145686chr212780 32591 2444 316 ----
NM_145687chr212780 32591 2444 316 ----
NM_145690chr831886 1227 626 ----11567
NM_145716chr11406 ------
NM_145735chr1362279 1096 921 912 696 663 1507 --1267
NM_145793chr102946 158 1116 ----
NM_145798chr174798 593 586 86 1902 1312 --
NM_145802chrX1184 ------
NM_145805chr153401 89 80 ------
NM_145808chr753084 2642 2627 317 91 12570 --1453
NM_145861chr131746 549 157 1664 ----
NM_145891chr1621245 685 ------
NM_145892chr1621245 685 ------
NM_145893chr1611367 ------
NM_147150chr932468 715 631 ------
NM_147156chr1011011 ------
NM_147175chrX32146 1720 61 ------
NM_147181chr411137 ----1523
NM_147182chr411137 ----1523
NM_147183chr411137 ----1523
NM_147202chr952545 2472 2243 2236 930 11969 22497 2397 --
NM_147223chr241573 1563 698 552 1534 ----
NM_147233chr241390 861 515 369 1351 ----
NM_147780chr882206 2153 1896 1812 398 373 361 343 1752 21738 992 --
NM_147781chr882206 2153 1896 1812 398 373 361 343 1752 21738 992 --
NM_147782chr882206 2153 1896 1812 398 373 361 343 1752 21738 992 --
NM_147783chr882206 2153 1896 1812 398 373 361 343 1752 21738 992 --
NM_148571chr1731574 697 407 ----11436
NM_148894chr41838 ------
NM_148921chr1741954 1901 583 243 2431 119 1983 11718
NM_148955chr1565101 5087 4727 4313 1194 973 11002 1173 15536
NM_152133chr63719 101 29 ------
NM_152222chr1161897 1802 1268 736 663 594 11593 ----
NM_152227chr201259 ----193
NM_152237chr2251251 1143 1115 214 110 ------
NM_152244chr1731194 836 794 ------
NM_152253chr22104071 3938 3648 3372 3294 3239 3122 2684 677 458 24060 2734 12846 --
NM_152261chr1212343 2335 201 ----
NM_152265chr121520 99 ------
NM_152272chr83439 378 323 ------
NM_152277chr551979 629 547 124 23 ------
NM_152280chr163117 2943 2809 1390 1367 975 --12741 --
NM_152283chr541131 399 193 187 1172 ----
NM_152330chr1422269 323 31821 700 682 1113 --
NM_152335chr15151 1169 ----
NM_152371chr171929 1770 1359 1236 649 183 157 1409 ----
NM_152374chr131433 1381 1076 --21688 1439 --
NM_152380chr11571 ------
NM_152388chr253848 2733 843 751 504 ----11261
NM_152398chr4143 ------
NM_152401chr4124 ------
NM_152402chr4193 ------
NM_152407chr543019 976 787 420 11220 ----
NM_152415chr8--1357 ----
NM_152424chrX44596 1730 887 774 --14659 13251
NM_152437chr1262206 1679 855 834 437 217 ------
NM_152442chr1241378 1369 1075 44 ------
NM_152450chr1522118 1846 ------
NM_152453chr151180 ------
NM_152455chr1532511 1013 99 --22319 423 --
NM_152470chr1853471 3030 1267 892 435 2942 857 ----
NM_152493chr151323 1159 563 103 71 1618 ----
NM_152519chr212015 22045 1648 --11939
NM_152520chr21864 --2995 813 --
NM_152551chr643025 2543 2236 797 ------
NM_152557chr7--181 ----
NM_152563chr1121107 1052 ----1262
NM_152594chr1521615 569 ------
NM_152608chr152300 1616 867 622 560 11951 1898 --
NM_152622chr543227 2863 1101 246 13502 ----
NM_152624chr576328 6238 5634 5476 1950 1478 564 --12162 15666
NM_152625chr5158 ------
NM_152629chr92998 166 11249 ----
NM_152636chr1173065 3041 2321 1173 941 885 364 12716 ----
NM_152638chr1211033 21095 93 ----
NM_152641chr1252495 2368 2362 540 143 12412 ----
NM_152653chr3--1537 ----
NM_152660chr12708 659 ------
NM_152666chr1129 ------
NM_152678chr31788 ----1527
NM_152688chr62754 650 1638 ----
NM_152707chr103981 309 277 ------
NM_152716chr11196 11436 11468 --
NM_152723chr112706 329 ------
NM_152733chr6146335 6317 5918 5069 5025 4886 4613 4078 2192 1816 1714 1635 1577 1205 11050 11115 11598
NM_152740chr72230 64 ------
NM_152744chr783176 2904 2871 2810 2594 1016 629 479 --13344 --
NM_152745chr7--1181 ----
NM_152749chr73768 470 119 ------
NM_152756chr513010 23652 1561 --13645
NM_152758chr842911 954 921 89 1549 ----
NM_152765chr821816 494 --12241 --
NM_152780chrX4426 322 128 92 1250 ----
NM_152787chrX41422 1412 440 283 1709 ----
NM_152789chr721511 971 ------
NM_152826chr1565101 5087 4727 4313 1194 973 11002 1173 15536
NM_152835chr132692 1058 864 11007 12561 --
NM_152838chr2043203 2987 2873 117 --12981 --
NM_152862chr2171 ------
NM_152890chr111189 ------
NM_152896chr9--1247 1201 --
NM_152903chr1342653 2427 1780 540 ------
NM_152904chr17135 ------
NM_152914chr1784318 3952 3628 3136 1713 1030 541 444 1313 ----
NM_152924chr15116056 5395 5030 5014 4221 2456 2427 2146 938 462 160 32492 2217 174 1828 15837
NM_152989chr1231817 1506 1378 ------
NM_152996chr12422 121 ------
NM_152998chr7------148
NM_152999chr733062 2012 1148 13299 1801 --
NM_153020chr61411 ------
NM_153035chr122045 551 22670 2128 1435 --
NM_153042chr62552 311 ------
NM_153047chr6161 ------
NM_153048chr6161 ------
NM_153050chr22104537 4526 4134 3236 3221 1840 1692 1514 1474 746 --11847 --
NM_153051chr22104537 4526 4134 3236 3221 1840 1692 1514 1474 746 --11847 --
NM_153183chrX2370 91 ------
NM_153184chr311557 11254 --1710
NM_153186chr91868 ------
NM_153188chr555321 1593 1406 1026 886 ------
NM_153211chr18175 ------
NM_153223chr511584 ------
NM_153234chr522435 977 42759 2543 2190 85 1942 2280 220
NM_153235chr6--1400 ----
NM_153252chrX1329 ------
NM_153261chr1641522 1469 630 441 ------
NM_153262chr132862 572 460 ------
NM_153266chr112917 283 ------
NM_153321chr171939 ------
NM_153322chr171939 ------
NM_153332chr853236 3107 1092 670 234 ------
NM_153335chr1751376 347 316 109 77 --21017 434 --
NM_153340chr11120 ------
NM_153347chr1142111 901 768 303 1992 21972 1870 --
NM_153354chr5----1743 --
NM_153367chr1063891 3653 2642 2493 1571 1003 ------
NM_153371chr1352302 2195 1568 547 190 ------
NM_153374chr151131 --1165 --
NM_153426chr41160 ------
NM_153427chr41160 ------
NM_153449chr12--1447 ----
NM_153456chr1354701 4434 1962 1545 288 11656 44944 2332 1860 1737 --
NM_153498chr10--1254 ----
NM_153499chr12103065 2449 2403 2370 2070 1109 1018 999 866 47 22773 1040 22588 552 11917
NM_153500chr12103065 2449 2403 2370 2070 1109 1018 999 866 47 22773 1040 22588 552 11917
NM_153607chr553103 1983 1275 1134 833 ------
NM_153619chr15--2577 419 ----
NM_153620chr751671 1444 524 467 331 2401 129 1702 --
NM_153633chr12--1151 ----
NM_153686chr462366 1947 1835 1541 977 498 11625 1932 --
NM_153705chr112826 105 ------
NM_153706chr51251 ------
NM_153712chr273795 3502 1372 1015 463 266 158 --43276 2444 817 199 1349
NM_153756chr141943 1766 1358 1238 11888 ----
NM_153757chr41908 --11188 --
NM_153759chr231216 902 249 ------
NM_153764chr11143 ------
NM_153765chr11143 ------
NM_153766chr11143 ------
NM_153767chr11143 ------
NM_153810chr10105041 4728 4570 4170 4156 3964 1116 920 319 101 14449 ----
NM_153816chr61315 ------
NM_153827chr174772 244 225 42 ------
NM_153831chr8--2772 110 ----
NM_170606chr721489 125 ------
NM_170607chr1741558 991 297 190 11498 ----
NM_170662chr31142 1507 ----
NM_170663chr174772 244 225 42 ------
NM_170665chr1284182 4055 4016 3191 3070 2859 972 932 13141 11842 --
NM_170674chr1521015 924 ------
NM_170675chr151691 ------
NM_170676chr151691 ------
NM_170677chr1521015 924 ------
NM_170679chr541128 1083 965 535 ------
NM_170692chr11224 ------
NM_170695chr181123 ------
NM_170696chr1521149 73 11116 11301 --
NM_170697chr1521149 73 11116 11301 --
NM_170706chr153924 3496 3169 1648 428 13564 ----
NM_170711chr191706 ------
NM_170721chr1721271 1046 ------
NM_170731chr1122469 2349 11993 1599 --
NM_170732chr1122469 2349 11993 1599 --
NM_170733chr1122469 2349 11993 1599 --
NM_170734chr1122469 2349 11993 1599 --
NM_170735chr1122469 2349 11993 1599 --
NM_170751chr62202 110 2288 62 1542 --
NM_170752chr62202 110 2288 62 1542 --
NM_170754chr12--1338 ----
NM_170775chr5161 ------
NM_171825chr573058 2494 2460 2198 2181 2102 1020 12343 --12883
NM_171998chrX1518 1450 ----
NM_172016chr611343 ------
NM_172020chr781860 1795 1682 1543 735 691 579 537 ------
NM_172037chr811092 --1504 --
NM_172070chr211518 ------
NM_172071chr167366 6767 6033 5129 1493 175 ----1612
NM_172103chr652628 2082 1974 783 79 ------
NM_172105chr652628 2082 1974 783 79 ------
NM_172127chr4122 --11332 --
NM_172169chr1071962 1610 1490 589 466 356 62 11336 --11763
NM_172170chr1071962 1610 1490 589 466 356 62 11336 --11763
NM_172171chr1071962 1610 1490 589 466 356 62 11336 --11763
NM_172173chr1071962 1610 1490 589 466 356 62 11336 --11763
NM_172193chr1411269 ------
NM_172201chr211104 ------
NM_172216chr12102967 2351 2305 2272 1972 1167 1011 920 901 768 22675 942 22490 454 11819
NM_172226chr12103065 2449 2403 2370 2070 1109 1018 999 866 47 22773 1040 22588 552 11917
NM_172230chr1131064 117 80 1214 1386 --
NM_172236chr202724 231 131 ----
NM_172240chr1211290 ------
NM_172315chr1521015 924 ------
NM_172316chr1521015 924 ------
NM_172337chr141125 ------
NM_172344chr211451 ------
NM_172348chr5130 ------
NM_172375chr14195 ------
NM_173054chr71720 --1933 --
NM_173065chr183262 2749 2489 1321 455 274 252 154 23644 205 ----
NM_173074chr22275 237 1226 ----
NM_173079chr1751792 1570 588 234 29 --21883 170 --
NM_173082chr6----11172 --
NM_173156chr121998 1893 133 ----
NM_173198chr952807 903 253 152 117 ----12336
NM_173200chr952807 903 253 152 117 ----12336
NM_173207chr181123 ------
NM_173208chr181123 ------
NM_173209chr181123 ------
NM_173210chr181123 ------
NM_173211chr181123 ------
NM_173214chr1656937 5704 5648 2614 668 17866 12240 --
NM_173353chr121621 ------
NM_173355chr231053 96 46 ------
NM_173359chr321203 463 1708 1380 --
NM_173462chr1461738 1631 700 280 175 38 --1124 --
NM_173465chr53871 654 266 21010 683 ----
NM_173468chr414971 1655 ----
NM_173469chr1531398 1183 1099 --1460 --
NM_173471chr31384 1822 ----
NM_173473chr1022068 1892 22437 711 11771 --
NM_173475chr1631756 1750 590 ----11592
NM_173478chr171270 --11053 --
NM_173495chrX2834 791 22357 752 21588 513 1469
NM_173500chr1521156 265 ------
NM_173511chr213484 --12843 12995
NM_173531chr1922999 2537 ------
NM_173556chr11194 ----1323
NM_173589chr112549 37 --1584 --
NM_173595chr1284613 4373 3924 2084 1884 1181 825 322 14493 34633 668 273 13807
NM_173602chr1221323 374 --12499 --
NM_173609chr15163 ------
NM_173626chr171531 ------
NM_173631chr1941339 1250 400 128 ------
NM_173642chr1198937 8927 8592 8176 7490 7421 7386 6309 6109 6028 5655 3583 3274 3044 711 546 333 323 163 48764 6704 1652 703 --28511 7179
NM_173644chr2011812 1265 ----
NM_173653chr331059 1025 405 11164 ----
NM_173681chr741583 769 123 80 3806 306 178 ----
NM_173694chrX1933 ------
NM_173698chrX31638 430 38 11626 ----
NM_173797chr51102 ------
NM_173814chr152598 98 ------
NM_173822chr211425 --1581 --
NM_173829chr575963 5757 4419 2063 1622 711 448 --14715 --
NM_173832chr892520 1516 1083 823 776 497 373 274 245 2938 540 166 --
NM_173834chrX1395 ------
NM_173851chr833256 1375 1264 13605 22853 2837 23676 145
NM_174886chr181123 ------
NM_174890chr102518 230 ------
NM_174911chr853841 3213 2483 719 705 12812 11548 --
NM_174916chr152713 380 ----12082
NM_174921chr44933 896 876 139 ------
NM_174934chr1183617 2943 2783 2417 975 918 183 109 13273 --12269
NM_174938chr91142 ------
NM_174963chr14931 732 713 226 ------
NM_174964chr14931 732 713 226 ------
NM_174965chr14950 751 732 245 ------
NM_174966chr14931 732 713 226 ------
NM_174967chr14950 751 732 245 ------
NM_174968chr14931 732 713 226 ------
NM_174969chr14931 732 713 226 ------
NM_174970chr14950 751 732 245 ------
NM_174971chr14931 732 713 226 ------
NM_175061chr711872 1247 11830 --
NM_175077chr202400 58 --11040 --
NM_175566chr11138 ------
NM_175605chr131217 ------
NM_175607chr331650 1111 178 ------
NM_175612chr331650 1111 178 ------
NM_175623chr1296674 5777 5601 5210 5148 2742 2403 2101 1494 26117 1604 46870 6498 369 306 --
NM_175624chr1296769 5872 5696 5305 5243 2837 2498 2196 1589 26212 1699 46965 6593 464 401 --
NM_175625chr1296769 5872 5696 5305 5243 2837 2498 2196 1589 26212 1699 46965 6593 464 401 --
NM_175629chr231216 902 249 ------
NM_175634chr811075 11013 ----
NM_175635chr811075 11013 ----
NM_175636chr811075 11013 ----
NM_175709chr2282876 2803 2748 2377 2354 2277 2069 601 ------
NM_175736chr12147814 7732 6940 6438 4741 2572 2395 2266 2053 1987 1871 1856 393 125 24920 2769 24942 4794 --
NM_175737chr4147 ------
NM_175767chr511242 1481 11699 --
NM_175847chr194567 438 223 158 1907 ----
NM_175848chr202366 127 ------
NM_175848chr202366 127 ------
NM_175849chr202366 127 ------
NM_175849chr202366 127 ------
NM_175850chr202366 127 ------
NM_175850chr202366 127 ------
NM_175852chr152538 2492 1061 485 69 22585 2241 1927 --
NM_175854chr1331820 558 534 --1705 --
NM_175856chr51649 ------
NM_175861chr1275344 5338 4871 3948 621 508 385 11007 15351 --
NM_175898chr1551242 280 259 230 75 ------
NM_175920chr52755 134 ------
NM_176081chr1065287 4559 4364 3673 2048 725 35232 5173 4210 24261 2346 14821
NM_176083chr1065287 4559 4364 3673 2048 725 35232 5173 4210 24261 2346 14821
NM_176787chr1831072 272 169 1493 ----
NM_176792chr1011015 11155 ----
NM_176801chr441609 572 395 305 ------
NM_176812chr201283 1661 ----
NM_176814chr72564 520 ------
NM_176823chr133470 2769 2356 43796 3195 2932 756 ----
NM_176863chr173593 154 39 --21942 1892 --
NM_177398chr161484 630 577 332 152 31 11555 ----
NM_177399chr161484 630 577 332 152 31 11555 ----
NM_177402chr13339 264 215 1285 1812 --
NM_177414chr121584 472 --1606 --
NM_177438chr1422860 1261 --1946 --
NM_177441chr17--1852 ----
NM_177524chr73992 420 171 11028 ----
NM_177525chr73992 420 171 11028 ----
NM_177531chr82337 141 --1325 --
NM_177553chr112647 72 ------
NM_177559chr201140 --2449 294 --
NM_177560chr201140 --2449 294 --
NM_177947chrX2512 293 1542 --11198
NM_177948chrX2512 293 1542 --11198
NM_177952chr141753 ------
NM_177972chr11114107 3494 3168 3067 3058 2766 1402 839 827 722 130 --24087 158 12785
NM_177977chr1761833 1570 717 247 51 22 ------
NM_177996chr2063008 3002 2688 2506 1109 718 ----12543
NM_177999chr973491 3334 3280 2843 2681 2453 744 12440 21133 545 --
NM_178010chr1231817 1506 1378 ------
NM_178037chr1293413 3254 2928 2449 2222 1424 1373 663 163 1232 ----
NM_178038chr1293413 3254 2928 2449 2222 1424 1373 663 163 1232 ----
NM_178120chr21363 ------
NM_178151chrX137825 7816 6887 6872 5875 4975 3142 2888 2571 1820 1184 997 494 22629 1842 12293 --
NM_178152chrX137825 7816 6887 6872 5875 4975 3142 2888 2571 1820 1184 997 494 22629 1842 12293 --
NM_178153chrX137825 7816 6887 6872 5875 4975 3142 2888 2571 1820 1184 997 494 22629 1842 12293 --
NM_178313chr221829 1470 11581 1625 11600
NM_178423chr7--1151 ----
NM_178424chr5--1516 ----
NM_178425chr7--1151 ----
NM_178426chr11190 12126 ----
NM_178427chr1190 12026 ----
NM_178502chr123613 441 131 ------
NM_178509chr1741452 1119 652 315 --1206 1792
NM_178554chr383101 3057 1417 1208 836 804 487 220 ------
NM_178566chr921536 224 ------
NM_178578chr204826 259 238 178 --<