TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4633-5p
miRNA Sequence: AUAUGCCUGGCUAGCUCCUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000055chr31360 ------
NM_000081chr12673 295 ------
NM_000084chrX26408 2579 --46554 6047 5462 2439 --
NM_000092chr234131 3297 1506 ------
NM_000138chr1511878 ------
NM_000214chr20--11619 ----
NM_000217chr1234469 4431 2128 --23366 1305 --
NM_000232chr443142 710 698 391 --22430 1288 1863
NM_000259chr1546135 5604 4465 4302 25249 351 23893 1409 --
NM_000317chr11--1345 ----
NM_000332chr644919 547 469 245 --22708 1425 --
NM_000461chr354622 1437 1391 654 136 14234 ----
NM_000503chr811415 ----1531
NM_000555chrX97540 7108 5681 5674 5436 5342 5055 2482 2319 27456 2110 --15200
NM_000618chr1226590 4954 25352 1332 1720 15570
NM_000618chr1226590 4954 25352 1332 1720 15570
NM_000693chr1511671 ------
NM_000793chr1451903 1408 847 584 415 13123 ----
NM_000806chr511614 --11503 --
NM_000844chr33827 704 67 ------
NM_000845chr7137 ------
NM_000901chr42578 432 ----1752
NM_000927chr71100 ------
NM_000958chr51464 ----1515
NM_001001436chr162585 325 ------
NM_001001481chr822481 743 13121 ----
NM_001001664chr2----12601 1915
NM_001001701chr431609 861 824 11458 ----
NM_001001890chr2132623 1582 1507 13861 ----
NM_001001933chr11138 ------
NM_001002243chr2----1145 --
NM_001002860chr1453681 2880 974 235 160 14377 ----
NM_001003652chr1877186 6974 3084 2090 1723 1625 1058 1259 16662 --
NM_001003674chr1867096 6044 5592 5101 369 312 ----1518
NM_001003675chr1867096 6044 5592 5101 369 312 ----1518
NM_001004330chr122733 21 --1575 152
NM_001005463chr101495 ------
NM_001005739chr21748 ------
NM_001005849chr171174 ------
NM_001006636chr22674 652 ------
NM_001007023chr1451903 1408 847 584 415 13123 ----
NM_001007097chr934656 1596 565 --1814 1434
NM_001008408chr785286 4787 4475 4221 2092 1249 1000 714 --24905 4636 --
NM_001008540chr21422 ------
NM_001008541chr101453 ------
NM_001008541chr101453 ------
NM_001009993chr264376 3365 3202 1085 1021 931 14098 ----
NM_001010862chrX33271 3079 2208 ------
NM_001010867chr1156456 5964 5794 4837 4514 2553 1666 1561 1125 1002 845 735 579 532 516 35505 5198 366 14754 22528 2209
NM_001010891chr586097 5609 5587 5399 5359 4686 2777 95 --12641 --
NM_001011537chr31618 11869 12232 1747
NM_001011551chrX--1128 ----
NM_001011885chr15----21484 1354 --
NM_001012264chr141728 ------
NM_001012398chr16----1392 --
NM_001012420chr1532158 665 207 12363 11048 --
NM_001012423chr1532158 665 207 12363 ----
NM_001012751chr10--1289 ----
NM_001012755chrX64961 4151 3823 1916 1706 1462 14009 ----
NM_001012968chrX22272 627 --22677 754 --
NM_001013031chr1013333 ----12196
NM_001013620chr12107569 7047 6927 6213 6131 5500 3101 2230 950 600 15293 --17861
NM_001013674chr11645 --2663 309 --
NM_001014380chr1324267 1283 12306 --14286
NM_001014797chr10107568 7330 7191 6182 6160 5144 5031 2630 1845 930 --15118 --
NM_001015877chrX----12926 --
NM_001017395chr312980 ------
NM_001017424chr111221 --127 11312
NM_001017425chr111221 --127 11312
NM_001018676chr81118 ------
NM_001018677chr81118 ------
NM_001024463chr151767 ------
NM_001024666chrX1595 ------
NM_001024855chr3------2712 196
NM_001025266chr353989 3457 1362 957 403 13306 11415 --
NM_001029858chr6184 ------
NM_001030001chr141136 ------
NM_001030055chr1453594 2926 1873 1788 1500 11542 ----
NM_001031684chr221205 536 11417 ----
NM_001033087chr2042756 1202 1163 243 23143 2559 --1637
NM_001033506chr11------1350
NM_001033925chr1011456 11363 ----
NM_001034025chr123957 901 160 ------
NM_001037872chr22687 58 ------
NM_001037954chr112319 170 --13298 1787
NM_001039547chr398073 7515 7381 7263 5628 3151 2888 1588 1526 27573 2673 12756 --
NM_001039585chr134029 1303 88 ------
NM_001039618chr1155980 4044 1275 770 730 --13656 --
NM_001040440chr52190 138 ------
NM_001040446chr51479 ------
NM_001040633chr72916 120 1323 ----
NM_001040665chr733248 891 224 --23400 936 --
NM_001042410chr21153 ------
NM_001042493chr631422 699 419 12020 ----
NM_001042555chr1243406 1914 817 676 23645 3566 13356 24332 3816
NM_001042599chr215073 11444 17555 14922
NM_001042604chr314191 ------
NM_001046chr522246 520 12388 12049 --
NM_001099678chr345080 4875 2148 1465 --24741 591 11840
NM_001106chr3127933 7342 6557 3846 3581 3048 3000 2537 2147 1690 876 249 13629 ----
NM_001113490chrX43495 3314 1400 1074 13084 ----
NM_001126chr11174 ----1977
NM_001167chrX56151 5746 5316 5221 4359 11609 45619 1699 934 21 --
NM_001173chr1453594 2926 1873 1788 1500 11542 ----
NM_001177chr1231915 1678 111 11948 22090 243 1528
NM_001396chr2132807 997 224 --12746 --
NM_001412chrX--13511 13003 12606
NM_001451chr16------189
NM_001455chr613757 23224 1423 11509 14014
NM_001530chr14--1856 ----
NM_001616chr2----1590 --
NM_001650chr181370 ------
NM_001663chr1422282 1737 ----12163
NM_001668chr11689 --1442 --
NM_001695chr844077 2805 1074 454 12929 --13153
NM_001701chr9----1277 --
NM_001742chr711561 ------
NM_001754chr2132623 1582 1507 13861 ----
NM_001830chrX61211 776 413 406 255 185 --11020 --
NM_001854chr121234 96 ------
NM_001858chr634442 1672 130 35101 1322 709 ----
NM_001903chr5------1851
NM_001918chr179236 7225 5889 5751 3661 2935 300 18160 27044 3395 17180
NM_001942chr1812032 ------
NM_001967chr3--1221 ----
NM_001969chr14----23889 2731 11529
NM_001981chr122411 245 ------
NM_002025chrX49267 1541 1015 714 --17113 15921
NM_002027chr81118 ------
NM_002040chr2131287 964 718 --1803 11135
NM_002077chr9----11405 --
NM_002107chr11165 ------
NM_002145chr171117 ------
NM_002210chr232436 1231 218 ------
NM_002214chr745674 4413 1787 1304 13629 --11441
NM_002264chr313642 ------
NM_002290chr611346 ------
NM_002336chr1253829 3500 3314 726 335 ------
NM_002651chr11778 ------
NM_002717chr82606 538 1596 ----
NM_002833chr1511082 ------
NM_002837chr1234566 4035 1429 ------
NM_002849chr123670 235 125 1700 1888 --
NM_002886chr333394 1724 1289 ------
NM_002948chr3--1259 ----
NM_002968chr161973 --2947 766 --
NM_002998chr812062 ------
NM_003016chr171547 ------
NM_003030chr3----1639 --
NM_003034chr1223046 959 1848 26499 1445 16634
NM_003054chr101275 ------
NM_003071chr32134 111 --11347 1702
NM_003077chr171701 ------
NM_003079chr1721030 1018 ------
NM_003090chr15--166 ----
NM_003110chr1711014 ------
NM_003188chr61318 ------
NM_003272chr1--1215 ----
NM_003274chr2112892 ------
NM_003291chr131705 157 ----
NM_003339chr521228 249 ----11073
NM_003367chr191524 ------
NM_003380chr101237 ------
NM_003409chr1811295 ------
NM_003453chr131245 ------
NM_003454chr16------193
NM_003467chr21422 ------
NM_003470chr1611881 ------
NM_003489chr2122458 2164 1100 --1291
NM_003579chr11182 ------
NM_003615chr31634 13032 11546 23115 903
NM_003620chr171893 1197 ----
NM_003657chr201798 ------
NM_003663chr312299 1198 12334 --
NM_003714chr512257 ----12380
NM_003722chr352621 934 672 512 379 ------
NM_003750chr102321 296 ------
NM_003759chr411491 ------
NM_003774chr1252990 766 573 343 150 ------
NM_003787chr1811372 31693 314 262 ----
NM_003795chr6--197 ----
NM_003822chr1------1154
NM_003872chr222919 128 ------
NM_003873chr1022324 684 ------
NM_003895chr2152115 1956 464 437 64 ------
NM_003913chr621292 679 11536 --11044
NM_003924chr411500 ------
NM_003971chr171558 ------
NM_004028chr181370 ------
NM_004080chr721273 190 ----1594
NM_004086chr141624 ------
NM_004093chr1312245 13014 ----
NM_004098chr101417 ------
NM_004162chr311183 ------
NM_004229chrX11832 ------
NM_004235chr9--1305 ----
NM_004282chr61503 ----191
NM_004319chr122364 1218 ----13133
NM_004330chr15----1421 --
NM_004331chr832074 661 173 1358 ----
NM_004338chr1867096 6044 5592 5101 369 312 ----1518
NM_004342chr732345 867 546 11667 ----
NM_004376chr1011283 ------
NM_004397chr1113565 ------
NM_004429chrX--11009 ----
NM_004458chrX1541 --199 12325
NM_004459chr171761 ------
NM_004499chr51461 ------
NM_004501chr112869 1585 --13218
NM_004525chr221275 135 ------
NM_004575chr411187 ------
NM_004586chrX54900 4403 3763 1623 912 24820 784 25166 5011 --
NM_004654chrY----1243 --
NM_004705chr11----1644 --
NM_004723chr11371 ------
NM_004725chr101217 ------
NM_004726chrX75294 4862 3987 2106 1484 1288 261 ------
NM_004745chr877025 5792 5439 4438 1961 1822 428 ------
NM_004748chr1543138 1368 810 803 13200 23538 1612 --
NM_004772chr5----11426 --
NM_004796chr141117 11609 ----
NM_004801chr211355 ------
NM_004857chr1434214 3803 262 23625 3253 --24339 1757
NM_004859chr172999 454 12761 --11012
NM_004866chr554850 3932 3821 950 874 13428 11632 11454
NM_004985chr1263627 3501 3432 3246 1481 485 12874 130 --
NM_004992chrX77711 7682 3106 2042 1532 737 654 --37939 2160 1935 --
NM_004992chrX77711 7682 3106 2042 1532 737 654 --37939 2160 1935 --
NM_005012chr1128 ------
NM_005025chr3162 ------
NM_005121chr1742631 1438 1135 1057 --11067 --
NM_005126chr311418 --12161 11850
NM_005160chr2255574 2392 807 672 76 11099 ----
NM_005180chr1031266 1161 1130 ------
NM_005206chr171398 ------
NM_005231chr1111368 ------
NM_005235chr215073 11444 17555 14922
NM_005249chr14181 ------
NM_005254chr15------1426
NM_005257chr1811011 ------
NM_005259chr211011 ------
NM_005296chrX1307 --1133 --
NM_005324chr1732115 1917 1642 ------
NM_005339chr433873 3609 2720 13096 13250 --
NM_005392chr911229 ------
NM_005475chr1213202 12867 ----
NM_005497chr1735602 5266 749 --24230 1754 45649 5313 4974 1215
NM_005504chr1236535 4102 1773 --11438 24915 2564
NM_005570chr1811145 ------
NM_005578chr354978 4600 3321 3251 748 ----11510
NM_005665chr124266 223 --14727 --
NM_005717chr1----1887 --
NM_005734chr11--1178 ----
NM_005736chr1011477 ------
NM_005746chr712598 ------
NM_005749chr17--1671 ----
NM_005776chr141775 ------
NM_005828chr17104476 4300 3631 3547 1425 1108 1063 1055 746 296 ------
NM_005840chrX77401 7081 5601 5308 4966 1117 1070 ------
NM_005850chr11157 ------
NM_005880chr1621267 141 ------
NM_005898chr11--11111 ----
NM_005901chr1877186 6974 3084 2090 1723 1625 1058 1259 16662 --
NM_005904chr181235 ------
NM_005907chr6----1157 --
NM_005924chr73422 265 123 ------
NM_005930chr141729 1201 ----
NM_005941chr821384 1249 --23171 1331 13490
NM_005962chr101453 ------
NM_005962chr101453 ------
NM_005966chr212248 ------
NM_005977chr13----1849 --
NM_006007chr954025 3686 3014 1651 846 ----1358
NM_006016chr6----12133 --
NM_006095chr43821 676 214 ------
NM_006114chr19--1433 ----
NM_006135chr121113 362 --11102 --
NM_006153chr31499 ------
NM_006154chr151776 --11847 --
NM_006166chr1232220 2037 215 ------
NM_006216chr21166 ------
NM_006380chr1763781 3252 3017 1341 897 417 ------
NM_006386chr2221823 344 ----12475
NM_006413chr1021399 299 1362 --11079
NM_006451chr5143 ------
NM_006469chr121400 91 ------
NM_006504chr1012625 ------
NM_006526chr2011991 ------
NM_006529chr431386 121 90 ------
NM_006540chr8----11302 --
NM_006544chr1424428 3767 --24646 848 --
NM_006570chr91362 ------
NM_006575chr1411012 ------
NM_006599chr1647058 1986 1804 1444 25933 2025 --12728
NM_006609chr252306 1976 1157 1105 603 ------
NM_006614chr333515 3139 379 23133 2630 1976 --
NM_006625chr11371 ----11033
NM_006625chr11371 ----11033
NM_006625chr11371 ----11033
NM_006654chr1243406 1914 817 676 23645 3566 13356 24332 3816
NM_006727chr51461 ------
NM_006729chrX21615 736 11336 ----
NM_006750chr1656197 5875 3139 1370 1169 37446 2020 1397 12563 15537
NM_006751chr21274 ------
NM_006754chr7----21094 1056 --
NM_006777chrX42737 2173 2098 969 1440 12756 --
NM_006790chr51403 ------
NM_006813chr6----1216 --
NM_006827chr14176 22275 1008 13334 --
NM_006836chr121524 ------
NM_006873chr223279 1189 13445 13326 --
NM_006874chr41477 ------
NM_006884chr3----1639 --
NM_006915chrX2624 578 --21853 738 1868
NM_006922chr212439 ------
NM_006937chr171174 ------
NM_006951chr101209 ------
NM_006965chr1811095 ------
NM_007010chr1731788 1757 507 --11416 --
NM_007013chr81754 ------
NM_007038chr2135818 4844 1005 26111 4008 --25695 2159
NM_007124chr61256 ------
NM_007145chr1911207 ------
NM_007159chr3--11376 ----
NM_007173chr112547 369 --1228 --
NM_007218chr8131 ------
NM_007235chr121170 ------
NM_007249chr1358598 839 745 245 100 --11251 19369
NM_007276chr71251 ------
NM_007358chr11186 ----11586
NM_007373chr102605 93 ------
NM_012081chr533377 2956 247 --11125 12612
NM_012115chr61416 ------
NM_012120chr612309 ------
NM_012262chr154146 2031 1407 1361 191 25144 1836 ----
NM_012302chr11247 ------
NM_012327chr1841357 1323 516 235 ----1197
NM_012382chr533440 1608 1577 13645 1129 --
NM_012428chr15--1649 ----
NM_012464chr432872 2675 236 --12687 --
NM_013255chr7118150 7381 6566 5561 5454 1641 1145 1079 1065 687 224 18551 ----
NM_013354chr8----1969 --
NM_013363chr31151 ------
NM_013374chr3--12368 11266 22847 217
NM_013381chr1222048 438 --1658 11789
NM_013396chr2111360 --1456 --
NM_013423chrX1298 ------
NM_013427chrX1298 ------
NM_013444chrX1381 ------
NM_013448chr141507 ------
NM_013989chr1451903 1408 847 584 415 13123 ----
NM_014048chr1624734 4651 --21332 708 --
NM_014155chr1166999 6015 5933 1845 863 795 --11390 --
NM_014213chr21173 ------
NM_014217chr111221 --127 11312
NM_014313chr1--1257 ----
NM_014317chr101237 ------
NM_014319chr1211917 ------
NM_014393chr8----12066 1566
NM_014415chr311270 --1498 --
NM_014423chr535238 5068 4415 ------
NM_014426chr20----1593 --
NM_014461chr31155 ------
NM_014515chr121724 ------
NM_014521chr21407 ------
NM_014570chr222740 125 ------
NM_014577chr22----1621 --
NM_014584chr14------21526 72
NM_014612chr9----11248 --
NM_014614chr231423 1254 236 ----11434
NM_014615chr1613602 ------
NM_014659chr151767 ------
NM_014700chr1611340 ------
NM_014705chr7----11398 --
NM_014713chr2--1413 ----
NM_014721chr637400 6254 5419 16869 ----
NM_014755chr243283 1247 484 233 11117 13855 14115
NM_014764chr121218 ------
NM_014841chr6----1862 --
NM_014877chr1742681 1364 689 629 25963 919 26046 643 27447 6181
NM_014892chr61456 ------
NM_014893chrY1565 ------
NM_014903chr1221781 62 ------
NM_014904chr1012518 --23663 516 1872
NM_014923chr1341535 926 851 832 1327 ----
NM_014926chr321144 989 ------
NM_014934chr1343606 2887 2483 413 ----13209
NM_014939chr181319 ----11419
NM_014950chr14--11656 11450 --
NM_014953chr1321589 1529 --33919 3385 1070 13913
NM_014961chr41903 1213 ----
NM_014996chr3137 ------
NM_015008chr312980 ------
NM_015025chr242587 1889 664 276 ------
NM_015051chr953108 3099 2616 2570 681 33174 2451 1173 12382 --
NM_015062chr101189 ------
NM_015090chr165449 5148 4942 4911 4118 1837 11112 14563 --
NM_015097chr3----11795 --
NM_015107chrX1352 ------
NM_015200chr411690 ------
NM_015206chr1543163 699 659 116 23556 3401 ----
NM_015265chr232363 2284 699 ----11825
NM_015271chr431067 470 330 13650 1988 --
NM_015278chr622982 757 ------
NM_015291chr122573 62 --11263 --
NM_015355chr1711245 ------
NM_015378chr152371 1147 1002 462 224 ------
NM_015429chr31994 --1344 --
NM_015477chr151236 ------
NM_015569chr154312 3122 1088 856 285 13846 13416 --
NM_015630chr21852 ------
NM_015635chr941373 714 422 121 ------
NM_015680chr21599 ------
NM_015693chr41254 ------
NM_015695chr6--12058 ----
NM_015852chr723216 3189 13354 13205 --
NM_015902chr81768 ------
NM_015906chr144343 3204 2982 343 ------
NM_015975chrX11775 ------
NM_016009chr113495 ----24334 379
NM_016022chr1----1690 --
NM_016025chr16--11330 1414 --
NM_016041chr17--1292 ----
NM_016073chr1521167 469 ------
NM_016078chr174978 956 262 245 1808 ----
NM_016083chr632782 1360 1320 ------
NM_016131chr21817 ------
NM_016133chr2----11583 --
NM_016203chr72916 120 1323 ----
NM_016206chr378334 7142 6625 5652 2623 2307 1053 25603 828 1103 17663
NM_016260chr236726 4829 1505 1418 1279 --
NM_016281chr121824 ------
NM_016300chr31201 ------
NM_016315chr221440 82 11775 11657 --
NM_016316chr22687 58 ------
NM_016319chr121737 --1765 --
NM_016357chr12188 ------
NM_016451chr11144 ------
NM_016516chr21748 ------
NM_016587chr71251 ------
NM_016588chr61786 ------
NM_016626chr1811348 21198 59 152 --
NM_016654chr15------1426
NM_017455chr15--1649 ----
NM_017519chr61537 --1520 --
NM_017563chr365832 4261 4068 1861 1701 743 24150 616 1221 --
NM_017607chr191506 ------
NM_017628chr425250 1885 14368 24533 545 14241
NM_017641chr121452 11096 ----
NM_017644chr353927 3494 3157 561 404 ------
NM_017657chr2----1145 --
NM_017672chr151548 ------
NM_017677chrX1411 --130 --
NM_017686chr111037 ------
NM_017693chr13--1118 ----
NM_017742chr1821854 77 ------
NM_017748chr17----1820 --
NM_017780chr81163 ------
NM_017805chr191199 ------
NM_017813chr833897 2336 2292 11808 34825 2083 1781 --
NM_017905chr13--1657 ----
NM_017998chr91367 ------
NM_018030chr18--1156 ----
NM_018062chr21119 ------
NM_018087chr1--1229 ----
NM_018089chr21153 ------
NM_018092chr1621477 511 11109 ----
NM_018112chr9--1219 ----
NM_018156chr152371 1147 1002 462 224 ------
NM_018164chr12187 1232 ----
NM_018171chr121689 1831 ----
NM_018211chr131783 647 582 --12237 --
NM_018214chr61475 ------
NM_018216chr11257 ------
NM_018299chr822481 743 13121 ----
NM_018328chr2169 ------
NM_018364chr122639 448 --12552 13196
NM_018369chr5--1659 ----
NM_018374chr735037 3671 69 1893 --14835
NM_018409chr443135 2765 2648 2615 12668 ----
NM_018426chr61127 ------
NM_018429chr522190 1107 12132 --12751
NM_018489chr12354 76 11676 --1387
NM_018590chr101423 ----11153
NM_018638chr1211131 15163 --1238
NM_018641chr71166 ------
NM_018712chr111249 ------
NM_018717chr41365 ------
NM_018718chr722238 683 ------
NM_018834chr5--1752 ----
NM_018841chr141394 1349 1095 412 12737 13029 --
NM_018945chr643689 2913 2470 925 ----12613
NM_018999chr1024943 3785 11728 13891 --
NM_019001chr314191 ------
NM_019063chr241697 1506 1424 371 --11843 --
NM_019106chr221217 ------
NM_019593chr202888 493 ----22547 184
NM_020144chr732088 1309 816 ------
NM_020177chr533047 1105 1087 11062 --12852
NM_020342chr212323 ------
NM_020425chr631422 699 419 12020 ----
NM_020466chr633977 1748 1110 ----13591
NM_020727chr2121469 1218 ----13258
NM_020732chr61537 --1520 --
NM_020734chr1283071 2359 2202 1256 961 675 629 221 ------
NM_020739chr1543138 1368 810 803 13200 23538 1612 --
NM_020772chr1768472 2754 2679 2050 1480 684 13005 ----
NM_020791chr171122 ------
NM_020794chr121178 454 1611 1444 --
NM_020800chr311182 ------
NM_020824chr101232 ------
NM_020834chr1421824 1438 ------
NM_020856chr1941477 1200 1024 991 1536 ----
NM_020858chr1521722 897 12281 ----
NM_020870chr4--12044 ----
NM_020918chr1053495 1105 573 411 381 ------
NM_020948chr122645 2306 ------
NM_021033chr1332537 2404 1072 --1238 --
NM_021148chr721808 1756 --31772 976 704 --
NM_021638chr434030 517 482 1422 13175 21194 564
NM_021813chr654438 3605 1487 1241 47 1913 ----
NM_021960chr122361 2070 ------
NM_021964chr375255 4792 2565 2100 2068 1153 785 ------
NM_021979chr141119 --1410 --
NM_022085chr61128 ------
NM_022091chr61155 1804 1193 12418
NM_022143chr7--1285 ----
NM_022154chr431041 219 35 ------
NM_022340chr363536 3369 3309 2309 913 163 11437 ----
NM_022353chr2----1163 --
NM_022374chr21373 ------
NM_022459chr1355873 5792 3995 2096 1187 --11371 14681
NM_022469chr132651 1298 1116 --22433 1105 --
NM_022473chr1523404 250 14404 33733 3707 126 --
NM_022476chr16----1392 --
NM_022484chr73985 162 152 11215 1348 11040
NM_022763chr342245 992 730 21 ------
NM_022776chr331109 1041 546 ------
NM_022780chr211146 ------
NM_022893chr212337 ------
NM_022900chr7----11051 --
NM_022901chr951814 1725 680 328 100 11781 11247 1580
NM_022977chrX1541 --199 12325
NM_023943chr31217 ------
NM_024007chr511032 ------
NM_024052chr1713151 ------
NM_024312chr1221562 1521 1144 --11396
NM_024315chr7177 ------
NM_024345chr944731 3889 461 177 --24923 2187 --
NM_024429chr72916 120 1323 ----
NM_024496chr141195 ------
NM_024511chr443084 3047 2714 2598 33491 3276 2151 11283 22368 592
NM_024529chr11847 11015 ----
NM_024596chr845107 1330 744 99 24279 3352 24846 4379 23884 3398
NM_024612chr171442 ------
NM_024615chr5--1176 ----
NM_024641chr622646 2362 32785 2770 226 ----
NM_024659chr22674 652 ------
NM_024670chr10------1558
NM_024770chr234969 2054 950 16348 24274 784 15880
NM_024828chr92635 30 ------
NM_024835chr171148 ------
NM_024854chr1221447 1393 ----11156
NM_024884chr1434051 2867 21 21310 687 1181 --
NM_024930chr522112 354 ------
NM_024947chr348818 8193 7797 2296 --37211 2997 431 38330 7579 160
NM_024989chr248142 4984 2453 1846 17992 15352 --
NM_025047chr31387 ------
NM_025054chr813987 ------
NM_025133chr2--11032 ----
NM_025208chr112868 306 --32135 718 177 --
NM_025238chr15----21281 1151 --
NM_030594chr152346 338 1502 ----
NM_030647chr725491 1362 11456 --25138 4156
NM_030648chr445256 4419 3675 220 ------
NM_030755chr1422935 331 12499 52802 2582 2005 492 165 --
NM_030786chr11561 11427 ----
NM_030791chr1451796 1564 1437 603 434 --11654 --
NM_030806chr1118538 8528 8501 7996 7896 7634 3569 3316 1386 641 271 --16501 13074
NM_030810chr61128 ------
NM_030816chr123669 3017 ------
NM_030881chr2221823 344 ----12475
NM_030912chr101896 ------
NM_030939chr6------1417
NM_031266chr51461 ------
NM_031844chr112869 1585 --13218
NM_032116chr1324267 1283 12306 --14286
NM_032121chrX1193 ------
NM_032142chr181275 ------
NM_032146chr31158 ------
NM_032160chr1833424 1097 867 13370 --13887
NM_032174chr1--11178 ----
NM_032228chr1121162 136 12503 ----
NM_032233chr141283 ------
NM_032288chr31618 11869 12232 1747
NM_032291chr111784 ----11257
NM_032312chr21685 ----1768
NM_032327chr101463 ------
NM_032373chr1042369 2267 923 218 --2908 650 --
NM_032424chr1121063 649 ------
NM_032427chr111425 ------
NM_032433chr1931494 1190 441 ----1214
NM_032434chr231479 1274 330 ------
NM_032445chr1522525 2035 ----11625
NM_032457chr433282 2876 1173 12522 13462 --
NM_032458chrX----13256 --
NM_032505chr312695 22509 232 ----
NM_032558chr921329 1237 ------
NM_032560chr141844 ------
NM_032594chr141195 1208 ----
NM_032622chr41330 ------
NM_032784chr6----1979 --
NM_032828chr1974273 4057 3765 3390 3257 1337 665 21697 782 34341 1777 475 1411
NM_033020chr144343 3204 2982 343 ------
NM_033132chr1322343 2044 ------
NM_033135chr112868 306 --32135 718 177 --
NM_033138chr732345 867 546 11667 ----
NM_033139chr732345 867 546 11667 ----
NM_033140chr732345 867 546 11667 ----
NM_033157chr732345 867 546 11667 ----
NM_033181chr632782 1360 1320 ------
NM_033224chr735214 1630 1556 25272 415 12633 36873 6204 856
NM_033227chr51499 ------
NM_033228chr51539 ------
NM_033326chr111384 ------
NM_033360chr1273748 3622 3553 3367 2814 1602 606 12995 1151 --
NM_033389chr1784716 4521 4340 3788 3712 3594 795 448 --34037 3522 338 --
NM_033425chr112319 170 --13298 1787
NM_033430chr454203 3973 3842 3427 100 ------
NM_033437chr454203 3973 3842 3427 100 ------
NM_033495chrX1306 ------
NM_033515chr61450 ------
NM_033656chr2135166 4366 3647 12047 ----
NM_052879chr1223582 2762 ----12740
NM_052897chr121251 ------
NM_052902chr21234 ------
NM_052913chr6133 11095 ----
NM_052918chr1013532 ----12395
NM_052923chr6128 ------
NM_052953chr31211 ------
NM_053016chr955686 5410 3130 2103 1253 16199 14839 15182
NM_053023chr1122098 22 --23288 2917 --
NM_053043chr785286 4787 4475 4221 2092 1249 1000 714 --24905 4636 --
NM_057749chr81379 ------
NM_058191chr212151 91 ------
NM_058237chr14------1201
NM_080597chr18--1156 ----
NM_080618chr201274 ------
NM_080629chr121234 96 ------
NM_080630chr121234 96 ------
NM_080676chr2042756 1202 1163 243 23143 2559 --1637
NM_080742chr6189 ------
NM_080745chr15145 ------
NM_080764chr222266 177 1807 ----
NM_130435chr1012625 ------
NM_130436chr2132807 997 224 --12746 --
NM_130438chr2133384 801 427 --13323 --
NM_130439chr101453 ------
NM_130439chr101453 ------
NM_130830chr312579 ------
NM_130846chr123670 235 125 1700 1888 --
NM_130847chr11105135 4794 4614 4574 4304 4011 3717 2071 761 231 1447 ----
NM_133265chrX43495 3314 1400 1074 13084 ----
NM_133334chr422166 39 21374 1082 14590 14151
NM_133493chr644182 3446 305 288 --13796 13219
NM_138423chr1531902 1842 345 --1196 1713
NM_138444chr1334592 4380 3100 14049 13208 --
NM_138565chr1111368 ------
NM_138713chr1647058 1986 1804 1444 25933 2025 --12728
NM_138714chr1647058 1986 1804 1444 25933 2025 --12728
NM_138731chr1423389 454 ----23041 621
NM_138735chr211337 ------
NM_138773chr51387 --2168 162 --
NM_138970chr141117 11609 ----
NM_139283chr1211658 11733 1468 --
NM_144599chr1521239 38 12218 1499 --
NM_144600chr1611048 ------
NM_144657chrX1564 ------
NM_144664chr112595 318 ------
NM_144778chr131749 ------
NM_144979chr41115 ------
NM_145029chr61270 ------
NM_145052chrX1132 ------
NM_145251chr141287 ------
NM_145280chr2--1319 1576 --
NM_145307chr1053846 3544 2936 2877 62 14060 1133 --
NM_145331chr61318 ------
NM_145332chr61638 ------
NM_145333chr61638 ------
NM_147223chr211605 ------
NM_152227chr20----1593 --
NM_152261chr1242383 1806 879 471 ------
NM_152280chr113130 ----11190
NM_152300chr1731788 1757 507 --11416 --
NM_152417chr8--1370 ----
NM_152512chr221435 ------
NM_152522chr21997 ------
NM_152549chr52190 138 ------
NM_152553chr6130 ------
NM_152556chr711963 ------
NM_152621chr4----161 --
NM_152641chr1221134 981 --12808 --
NM_152678chr352712 1946 713 553 229 --22229 916 12197
NM_152685chr52373 32 ------
NM_152692chrX--1128 ----
NM_152707chr101961 ------
NM_152758chr822509 897 ------
NM_152774chr722548 794 ----11955
NM_152787chrX33892 3646 2614 --23278 633 --
NM_152896chr91663 ------
NM_152999chr733248 891 224 --23400 936 --
NM_153042chr631324 684 559 ------
NM_153331chr31260 ------
NM_153365chr412235 --1801 --
NM_153453chr61727 ------
NM_153464chr191255 ------
NM_153498chr101539 ------
NM_153616chr1521722 897 12281 ----
NM_153617chr1521722 897 12281 ----
NM_153618chr1521722 897 12281 ----
NM_153702chr41289 ------
NM_170675chr151434 ------
NM_170676chr151434 ------
NM_172058chr811415 ----1531
NM_172059chr811415 ----1531
NM_172060chr811415 ----1531
NM_172071chr146026 5364 2864 52 --16587 --
NM_173039chr111181 ------
NM_173074chr2134 ------
NM_173082chr621121 110 ------
NM_173214chr1647058 1986 1804 1444 25933 2025 --12728
NM_173468chr42912 573 2999 335 --14830
NM_173470chrX--164 ----
NM_173517chr7------1358
NM_173582chr1152278 1832 579 494 35 24813 2298 12324 14536
NM_173666chr5------11139
NM_173670chr511009 ------
NM_173808chr114161 14139 ----
NM_173814chr151169 ------
NM_173834chrX1106 ------
NM_173851chr833175 1551 1227 11195 23563 2505 --
NM_174916chr1511492 ------
NM_175607chr311711 ------
NM_175612chr311711 ------
NM_175619chr41135 ------
NM_175856chr5----1817 --
NM_175863chr61537 --1520 --
NM_175921chr543954 1674 597 322 --12759 12673
NM_176787chr1841357 1323 516 235 ----1197
NM_177974chr1531902 1842 345 --1196 1713
NM_177976chr31158 ------
NM_178123chr2----1926 1169
NM_178151chrX97540 7108 5681 5674 5436 5342 5055 2482 2319 27456 2110 --15200
NM_178152chrX97540 7108 5681 5674 5436 5342 5055 2482 2319 27456 2110 --15200
NM_178153chrX97540 7108 5681 5674 5436 5342 5055 2482 2319 27456 2110 --15200
NM_178426chr11789 --1542 --
NM_178427chr11689 --1442 --
NM_178812chr811178 ------
NM_178868chr3------169
NM_181054chr141835 11002 ----
NM_181481chr1867096 6044 5592 5101 369 312 ----1518
NM_181482chr1856044 5592 5101 369 312 ----1518
NM_181483chr1867096 6044 5592 5101 369 312 ----1518
NM_181656chr17----130 --
NM_181672chrX1410 ------
NM_181673chrX1410 ------
NM_181713chr2--1297 ----
NM_181782chr61709 ------
NM_181838chr521228 249 ----11073
NM_182485chr41800 ------
NM_182488chr131197 ------
NM_182641chr171761 ------
NM_182645chr61727 ------
NM_182646chr41800 ------
NM_182648chr141507 ------
NM_182691chr72977 971 --11244 --
NM_182692chr72977 971 --11244 --
NM_182715chr7----21094 1056 --
NM_182763chr122350 2059 ------
NM_182765chr1061625 1567 452 337 292 231 --1426 1167
NM_182789chr5143 ------
NM_182894chr1411751 ------
NM_182896chr31447 ------
NM_183004chr14----23889 2731 11529
NM_183043chr13----1849 --
NM_183044chr13----1849 --
NM_183323chr5143 ------
NM_194247chr233900 1776 1154 --1323 11213
NM_194282chr442616 2237 2157 853 ----11220
NM_194291chr812632 22134 910 12200 --
NM_194314chr155322 3536 2134 2060 717 1190 ----
NM_197968chr131245 ------
NM_198043chr101463 ------
NM_198044chr101463 ------
NM_198045chr101463 ------
NM_198046chr101463 ------
NM_198047chr21498 --2556 132 --
NM_198066chr1412906 ----12741
NM_198087chr16------193
NM_198088chr16------193
NM_198243chr15----1120 --
NM_198273chr511081 ------
NM_198400chr151776 --11847 --
NM_198443chr16198 ------
NM_198513chr821645 241 1253 1152 --
NM_198567chr5----1213 --
NM_198568chr61792 ------
NM_198581chr267387 7075 7000 5743 5115 528 15526 25608 634 36689 5976 5417
NM_198595chr434030 517 482 1422 13175 21194 564
NM_198794chr1411012 ------
NM_198968chr1343606 2887 2483 413 ----13209
NM_199188chr1223582 2762 ----12740
NM_199189chr5--1752 ----
NM_199190chr1223582 2762 ----12740
NM_199280chr2199 ------
NM_199320chr412098 ------
NM_199320chr412098 ------
NM_199324chr4----1670 --
NM_201266chr222919 128 ------
NM_201279chr222919 128 ------
NM_201559chr613757 23224 1423 11509 14014
NM_201999chr41477 ------
NM_203354chr141729 1201 ----
NM_203355chr141729 1201 ----
NM_203356chr141729 1201 ----
NM_203390chr811573 ------
NM_203437chr2----1145 --
NM_203463chr244547 4405 3623 3175 --21831 197 --
NM_205860chr1------1154
NM_206853chr612969 ------
NM_206854chr624230 1239 ------
NM_206855chr635195 2204 611 ----1684
NM_207291chr191524 ------
NM_207304chr131636 ------
NM_207337chr122344 159 ------
NM_207429chr112315 51 1446 42576 2141 1637 529 1663
NM_212558chr953757 3453 2948 1427 356 --1162 --
NM_213589chr221011 381 21373 700 1299 24172 3829