TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4638-3p
miRNA Sequence: CCUGGACACCGCUCAGCCGGCCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX26370 1723 1987 36910 5764 2600 26480 6388
NM_000108chr741538 1343 463 277 ----11626
NM_000208chr1973104 1355 1271 817 651 140 103 24347 115 13593 --
NM_000217chr1265344 4696 4335 2115 2039 291 --14484 --
NM_000332chr657002 5820 5447 5299 1135 1486 22189 1488 12410
NM_000337chr545773 5558 1943 1383 11913 --12600
NM_000368chr973024 1808 1778 1195 954 919 544 2566 386 24058 1636 --
NM_000430chr1743470 3283 3275 2543 --13259 1208
NM_000555chrX76365 4777 1877 1030 797 319 78 127 35670 5534 541 17713
NM_000615chr1163025 2631 2623 768 526 364 --22178 542 --
NM_000633chr1844279 1767 1465 482 --25238 3574 13407
NM_000814chr1583581 3510 3405 3231 3196 1162 771 530 --13373 --
NM_000838chr632628 1773 1691 --22713 1986 12083
NM_000875chr1576987 6663 5596 5528 5413 1905 376 11235 24719 1682 1643
NM_000945chr23741 705 72 ----11672
NM_001001323chr1233162 1272 771 ----11136
NM_001001419chr544551 3778 779 181 1242 23915 558 --
NM_001001420chr544551 3778 779 181 1242 23915 558 --
NM_001001664chr283713 3687 3330 3052 1368 636 238 107 155 ----
NM_001001890chr2174132 3046 2935 2673 1562 262 237 --14228 1785
NM_001002838chrX21734 1660 ----1272
NM_001002860chr1464156 3819 1338 660 633 203 23111 543 ----
NM_001003652chr1846812 1875 1760 1708 --22350 624 1195
NM_001003674chr1866062 6011 5611 4869 2597 1163 --36687 5580 85 16372
NM_001003675chr1866062 6011 5611 4869 2597 1163 --36687 5580 85 16372
NM_001003712chr1252950 1284 362 249 62 --21178 930 --
NM_001004419chr1221586 900 14121 11559 23038 74
NM_001005473chr576363 5631 5065 4709 1431 1250 347 ----15482
NM_001007067chr831075 889 366 ----1172
NM_001007068chr831075 889 366 ----1172
NM_001007069chr831075 889 366 ----1172
NM_001007070chr831075 889 366 ----1172
NM_001007466chr695113 4866 4382 4141 3821 3708 3410 1264 856 --15195 14874
NM_001008405chr72566 180 11634 --11425
NM_001008408chr786261 5975 5499 5444 2244 1842 973 959 14345 11746 --
NM_001009554chr434651 1661 235 --1346 23964 3329
NM_001009554chr434651 1661 235 --1346 23964 3329
NM_001009909chr1173961 3887 3401 2962 1435 696 539 ------
NM_001010867chr175674 5641 4842 4105 1365 793 542 21941 502 45735 2395 414 66 --
NM_001010986chrX32195 988 104 ----186
NM_001011666chr7106501 6337 6193 5484 5380 4371 4331 1883 1106 541 --12136 --
NM_001014797chr10118004 7992 7034 6637 6348 5270 3050 1938 1801 1750 796 26470 5810 ----
NM_001018111chr793865 3410 2821 1479 1244 985 822 538 419 1438 --1182
NM_001025580chrX43300 2896 1059 75 11685 --12846
NM_001031732chr463103 2901 2855 691 404 297 --31172 860 626 12649
NM_001033723chr852058 1131 709 700 660 --12418 21059 282
NM_001034841chr16105378 4954 4873 3466 1470 1244 844 549 312 171 --11173 --
NM_001034954chr1043181 1223 308 160 --1930 1643
NM_001034955chr1043181 1223 308 160 --1930 1643
NM_001034956chr1043181 1223 308 160 --1930 1643
NM_001034957chr1043181 1223 308 160 --1930 1643
NM_001039547chr387157 6610 6466 5145 3071 1418 1052 629 --1991 --
NM_001039711chr131027 790 390 11010 --11075
NM_001039712chr131027 790 390 11010 --11075
NM_001039762chr1022178 2035 12090 --12120
NM_001039840chrX86033 5934 5855 4460 4344 3788 880 94 --11434 --
NM_001040450chr1562587 1859 917 871 865 536 ------
NM_001040453chr1562587 1859 917 871 865 536 ------
NM_001042355chr1664976 4633 3509 656 530 79 --25217 3741 1928
NM_001042403chr121916 --1947 1715
NM_001042412chr1664976 4633 3509 656 530 79 --25217 3741 1928
NM_001042413chr974088 3968 3961 3721 2736 891 477 12526 13093 --
NM_001042494chr1521469 857 ----13107
NM_001042495chr1521469 857 ----13107
NM_001042496chr1521469 857 ----13107
NM_001042497chr1521469 857 ----13107
NM_001042555chr1263883 1113 951 588 423 319 --11042 1683
NM_001042599chr287426 6276 5823 3060 2259 1973 1054 973 --27407 1327 --
NM_001042604chr354854 4511 4499 3393 1055 11535 14207 --
NM_001099678chr375965 5269 4138 1765 927 175 108 --14114 1510
NM_001100108chr197689 6993 6972 6866 6697 5936 2892 2699 2239 17384 25803 473 --
NM_001106chr348929 8310 3056 1028 17538 23779 2169 46537 3893 1904 26
NM_001256chr172954 646 ----12470
NM_001259chr766119 5739 4341 1121 548 206 --14846 --
NM_001304chr1752583 2537 1172 1084 773 --13167 --
NM_001343chr511586 --1181 1402
NM_001356chrX----11675 22141 194
NM_001396chr2132732 2437 194 12547 11872 12528
NM_001419chr19104689 4280 3898 3422 3387 821 777 571 325 166 ------
NM_001438chr143535 3448 2835 1221 23619 2566 ----
NM_001682chr1232876 986 485 ----1850
NM_001695chr863827 2590 843 808 380 343 13208 13244 --
NM_001754chr2174132 3046 2935 2673 1562 262 237 --14228 1785
NM_001858chr665131 4333 4072 3843 3397 1638 ----24658 3427
NM_001859chr962974 2943 813 505 325 304 --13104 12479
NM_001938chr151828 1683 1301 460 205 11689 ----
NM_001987chr1273902 3553 2729 936 906 695 494 21033 868 ----
NM_002025chrX87694 7573 7192 7041 5711 2590 1587 889 --18318 --
NM_002074chr161416 1149 541 514 440 423 --11435 1657
NM_002092chr454943 4843 4083 1888 718 1811 1242 13418
NM_002214chr765557 4977 4918 4418 1729 1590 --14764 --
NM_002310chr585455 4983 4110 4030 1432 944 415 149 14594 32635 2541 1760 --
NM_002480chr1231436 1132 312 ----11258
NM_002481chr156253 6033 2505 1373 325 25075 1548 11734 --
NM_002552chr251219 1119 941 431 68 1478 --1221
NM_002581chr975532 5478 3987 3748 1748 1582 1104 35030 1698 1097 11488 --
NM_002655chr865193 4681 4103 3263 498 339 --1185 --
NM_002745chr2241728 1414 1357 595 24393 188 24546 3993 --
NM_002837chr1244589 2972 1276 271 --23492 2797 --
NM_003108chr277304 6562 6484 5469 2531 1737 1207 --15559 --
NM_003199chr1864623 4443 3514 2078 1771 693 --23928 2188 14827
NM_003298chr345743 5520 4924 1471 21592 697 13985 11007
NM_003320chr1184412 4355 4203 2956 2801 2763 1529 887 13171 --13191
NM_003392chr344337 4062 3475 1556 ----11529
NM_003468chr274314 3902 2875 2716 668 518 360 --21727 638 --
NM_003574chr1824736 1081 --11920 1317
NM_003615chr353766 3423 2872 504 306 --12903 --
NM_003629chr133259 2537 1208 13104 --23391 650
NM_003663chr343116 2600 2325 2222 1960 11130 11038
NM_003774chr1242956 2937 2684 2067 13280 11357 12256
NM_003884chr32663 257 --11609 11515
NM_004124chr1433054 2591 563 21270 552 12601 --
NM_004136chr1563241 3155 3124 2142 1252 597 ------
NM_004171chr1156405 2768 2377 2023 1251 --38335 6010 489 19304
NM_004232chr1842908 2543 1233 685 12601 --11438
NM_004274chr1432321 2284 241 --22361 922 1397
NM_004338chr1866062 6011 5611 4869 2597 1163 --36687 5580 85 16372
NM_004342chr722350 183 22001 175 12073 --
NM_004464chr474086 4069 3909 2876 2824 952 220 13115 ----
NM_004501chr121614 804 --14149 13669
NM_004505chr1721630 1563 --1396 1291
NM_004586chrX34707 4505 4392 24590 3797 13442 12088
NM_004703chr1752563 2378 2165 812 366 --12007 1407
NM_004745chr886778 5541 2581 2344 1955 1383 1233 219 11356 ----
NM_004748chr1543508 2892 652 420 14071 --12998
NM_004798chr2043364 2495 1394 778 11215 13624 13395
NM_004815chr184421 4240 3566 3165 1925 1442 1087 272 44936 4120 3671 3441 ----
NM_004866chr564487 3572 3117 975 119 81 ------
NM_004904chr7106501 6337 6193 5484 5380 4371 4331 1883 1106 541 --12136 --
NM_004992chrX66721 5676 2449 2089 1714 1245 25842 1708 46506 3262 2283 2001 28362 2804
NM_004992chrX66721 5676 2449 2089 1714 1245 25842 1708 46506 3262 2283 2001 28362 2804
NM_005028chr1042091 1787 853 688 --1807 21707 729
NM_005135chr1521469 857 ----13107
NM_005197chr1485995 5184 5090 992 936 674 449 414 --14042 --
NM_005235chr287426 6276 5823 3060 2259 1973 1054 973 --27407 1327 --
NM_005397chr793865 3410 2821 1479 1244 985 822 538 419 1438 --1182
NM_005596chr996184 5715 5690 5092 4176 2404 1476 1349 54 ------
NM_005625chr831075 889 366 ----1172
NM_005668chr564554 4260 4252 3531 2922 308 --12877 --
NM_005759chr224535 3566 31573 1438 916 23045 1431 --
NM_005901chr1846812 1875 1760 1708 --22350 624 1195
NM_005903chr544551 3778 779 181 1242 23915 558 --
NM_005906chr631267 84 74 --1628 11569
NM_005935chr455261 4633 4156 2015 137 2288 70 34569 1141 1016 --
NM_005955chr155347 4666 3817 2140 533 --11723 13523
NM_006036chr262374 2273 2092 1751 831 631 --1743 1858
NM_006047chr2063547 2775 2264 813 585 455 23421 296 ----
NM_006094chr882121 2088 1648 792 627 563 499 86 ------
NM_006186chr221088 981 1376 --1314
NM_006203chr531154 532 146 ----1645
NM_006252chr1107351 6931 6348 5185 4930 2927 2309 2080 1567 1014 25573 5510 ----
NM_006256chr142527 2430 1956 424 1795 1811 11692
NM_006434chr1043181 1223 308 160 --1930 1643
NM_006534chr2063110 2842 2598 2487 630 227 --1482 --
NM_006544chr1484309 4062 3907 3813 1934 1477 1262 1038 11415 ----
NM_006577chr21959 ----2994 485
NM_006599chr1676105 5497 3108 2823 2616 2209 1524 --27736 5237 --
NM_006621chr141851 695 357 202 2821 532 1526 --
NM_006629chr1862468 2090 1973 1135 211 31 ------
NM_006654chr1263883 1113 951 588 423 319 --11042 1683
NM_006717chr953207 2667 2226 1246 218 1663 --11179
NM_006852chr1792619 2582 2320 921 667 403 397 58 28 ------
NM_006912chr132374 2368 56 1587 --12417
NM_006924chr1733396 2896 263 --13893 198
NM_007007chr1264627 1912 1687 1079 592 451 --33638 493 69 13738
NM_007038chr2176102 3872 2436 2378 1069 1060 985 13903 --14459
NM_007050chr20116961 6796 6647 5177 2610 2216 1861 1266 1144 668 641 133 --25781 2603
NM_007150chrX62067 1628 1506 1475 470 349 ----11385
NM_007157chrX32828 2600 988 ----22016 927
NM_007249chr13148661 8361 8183 8177 8101 7834 7247 6548 5697 3632 2903 2740 791 691 38470 7102 3601 28916 3027 --
NM_012234chr333730 684 390 --13632 12324
NM_012252chr734614 482 120 --2702 470 --
NM_012281chr72695 598 --11979 1687
NM_012287chr333603 562 249 2464 255 1607 13371
NM_012288chr695544 5405 5351 5336 5280 2160 1633 1329 1104 --35209 2200 1079 --
NM_012294chr773781 2495 1522 1443 418 289 56 12616 2541 152 --
NM_012309chr1174651 4623 4601 4121 3935 3810 151 --21188 541 --
NM_012316chr144445 3547 2013 1538 25563 3755 34040 3675 3513 --
NM_013255chr758872 7812 2928 2922 489 46947 1119 882 782 11058 --
NM_013261chr432709 2486 901 --1966 11042
NM_013269chr1221513 827 14048 11486 12965
NM_013286chr362482 2472 1483 993 647 144 --21026 801 1336
NM_013448chr14145 --1190 1276
NM_014023chr1042802 996 785 484 11002 --22475 1822
NM_014048chr1633765 703 527 --1178 11773
NM_014112chr865415 4162 1917 739 693 487 ----1346
NM_014155chr1166174 5700 5330 4613 88 43 14810 12030 --
NM_014331chr4107152 6797 4972 4953 2167 2159 1947 1867 925 400 182 --36219 1307 1095
NM_014674chr373469 3225 1556 298 183 104 69 --22680 1019 --
NM_014730chr1255279 4128 3352 1207 1174 --24344 655 24037 436
NM_014730chr1255279 4128 3352 1207 1174 --24344 655 24037 436
NM_014877chr1755367 4812 2926 2115 332 --17306 --
NM_014906chr1774083 4040 3926 3505 3331 2936 1064 1931 ----
NM_014912chr1011214 --33433 916 183 11364
NM_014991chr4103268 3196 2666 2658 2638 2409 2154 2037 1180 732 ------
NM_015032chr1342806 2508 2217 2196 1871 --1915
NM_015039chr194127 4035 3598 3239 1238 965 539 506 276 ----13212
NM_015064chr1243135 2876 2417 21 12952 1585 135
NM_015071chr586132 6105 6019 5995 5576 5188 4986 1240 --36390 2262 1929 26454 5703
NM_015247chr1664976 4633 3509 656 530 79 --25217 3741 1928
NM_015310chr8108164 6745 3119 2458 2279 1730 1647 1340 1274 1070 27524 844 17518 --
NM_015313chr1134324 4001 3662 --1589 11724
NM_015314chr722309 963 --22504 630 1387
NM_015336chr126814 716 626 559 404 58 --21677 350 --
NM_015365chrX43300 2896 1059 75 11685 --12846
NM_015385chr1043181 1223 308 160 --1930 1643
NM_015458chr8114958 4339 4016 2070 1708 1277 1214 1044 890 321 47 13743 ----
NM_015554chr153550 477 286 --2624 340 1792
NM_015906chr141670 1238 1107 1094 11631 ----
NM_016083chr663941 3934 3210 488 389 371 ----12847
NM_016206chr358015 6970 6368 555 355 12670 38731 1706 1631 18242
NM_016248chr1343858 3368 3195 2724 13183 --11185
NM_016255chr612055 12525 1380 1174
NM_016260chr277571 5652 5631 2300 2014 1575 1094 32893 1382 378 ----
NM_016507chr1773134 2832 2734 2690 2175 474 128 --11980 --
NM_016559chr321118 361 11456 --1168
NM_017637chr989419 8481 6094 3524 3041 2051 1775 1376 12986 38362 2247 1558 --
NM_017650chr755908 4535 4526 3958 2312 13945 1820 14780
NM_017658chr1433843 3562 292 --1979 1914
NM_017666chrX51819 1748 1737 401 310 ----11872
NM_017736chr1622340 533 ----22226 884
NM_017768chr12354 251 ----1968
NM_017770chr631926 737 565 ----1366
NM_017799chr1461925 1885 1631 1558 136 35 11590 ----
NM_017848chrX54043 3665 3211 1621 137 ----11286
NM_017919chr9115080 4637 4336 3558 1958 1572 1291 845 172 118 37 23893 425 15541 --
NM_018184chr371839 1686 877 769 396 369 56 ----1731
NM_018243chr453749 3678 3557 3148 1215 13253 --1601
NM_018254chr132253 510 151 --31963 1955 232 --
NM_018348chr16--1925 1487 1345
NM_018374chr755131 3539 3269 1833 1050 ----14133
NM_018416chr1262338 2109 1710 748 303 269 ----12057
NM_018440chr877274 5633 5361 3186 1670 1522 1088 16977 26017 156 22790 458
NM_018452chr6_random53464 2886 2646 950 386 ----11029
NM_018638chr1255537 5395 4869 1708 1081 --1430 --
NM_018650chr162205 2128 1663 254 243 24 ----2427 306
NM_018844chr72808 422 21876 80 --11667
NM_018947chr7114992 4860 4698 4682 3255 3077 1733 479 430 424 269 --23125 178 13064
NM_018976chr1252392 2188 1136 1125 762 ----11052
NM_019001chr354854 4511 4499 3393 1055 11535 14207 --
NM_019041chr622392 2096 ----32335 2141 2121
NM_019094chr1273818 3540 3081 2494 2416 302 270 --1970 --
NM_020123chr1021258 201 --11502 11331
NM_020141chr151876 1668 1483 716 90 ----2388 255
NM_020228chr1142237 1853 1728 338 11684 21678 968 --
NM_020245chr695019 4772 4288 4047 3727 3614 3316 1170 762 --15101 14780
NM_020336chr2032469 1552 957 13790 22677 784 13825
NM_020440chr133282 2322 2274 --1784 22680 440
NM_020717chrX74215 4188 4128 3891 3878 1216 630 --23948 1050 --
NM_020718chr1672410 2118 1999 1855 592 174 154 --12329 22488 1911
NM_020739chr1543508 2892 652 420 14071 --12998
NM_020772chr1777885 6072 5556 2585 2312 2242 1833 23063 1840 38560 8234 1580 12548
NM_020774chr1865684 5152 4515 3799 1796 1386 --25258 805 --
NM_020805chr182401 180 ----11530
NM_020841chr1252950 1284 362 249 62 --21178 930 --
NM_020922chrX21734 1660 ----1272
NM_020935chr254209 4155 3080 1361 793 ----14509
NM_020964chr18104649 4368 3738 3709 3304 3249 3235 3122 1516 1281 --24401 3107 13226
NM_021038chr332916 2428 251 ----11286
NM_021097chr252323 1938 853 192 94 22168 234 12845 --
NM_021190chr13933 924 40 ----167
NM_021252chr1011547 --1841 1563
NM_021253chr64971 243 100 89 1488 --11373
NM_021647chr434651 1661 235 --1346 23964 3329
NM_021813chr643770 1849 367 74 11130 --25829 1150
NM_021815chr222364 397 --1110 11233
NM_021912chr1583581 3510 3405 3231 3196 1162 771 530 --13373 --
NM_022459chr1396245 6052 5756 5348 5101 4877 2442 2385 1059 ------
NM_022735chr141807 1520 621 28 2570 525 --11436
NM_024638chr372337 2326 2305 2216 2208 2094 809 --1974 --
NM_024770chr275800 5505 4560 4067 2643 499 170 --16617 --
NM_024947chr359281 7659 7596 748 455 22466 81 56262 6185 5855 3560 772 --
NM_024949chr4104378 4355 4266 4186 3975 3354 1875 813 355 36 ------
NM_024991chr1043181 1223 308 160 --1930 1643
NM_030674chr1285652 5586 4753 1520 1343 963 849 615 11901 1390 12037
NM_030762chr1221983 1821 --1580 11239
NM_030806chr199164 8296 8261 6362 3364 2882 1960 1860 1414 47725 5805 3082 458 78163 7391 6871 6110 2763 1205 267 --
NM_030816chr143456 2852 534 515 11062 ----
NM_030817chr1243152 2987 1401 272 1515 --1756
NM_030918chr123651 1497 ----21179 106
NM_031427chr1475622 4245 3919 2347 2279 345 74 1502 ----
NM_031453chr1031015 711 464 --1751 1243
NM_031844chr121614 804 --14149 13669
NM_032012chr933877 1633 56 44828 4477 1120 209 1583 --
NM_032147chr121916 --1947 1715
NM_032189chr1384721 4534 4374 4244 3902 1950 662 290 --21838 1155 --
NM_032435chr162396 2268 744 736 319 176 --21822 612 --
NM_032440chr1021819 1077 --161 12365
NM_032582chr1721653 1586 --1407 1303
NM_032998chr131027 790 390 11010 --11075
NM_033020chr141670 1238 1107 1094 11631 ----
NM_033138chr722350 183 22001 175 12073 --
NM_033139chr722350 183 22001 175 12073 --
NM_033140chr722350 183 22001 175 12073 --
NM_033143chr474417 4400 4240 3207 3155 1283 551 13446 ----
NM_033157chr722350 183 22001 175 12073 --
NM_033181chr663941 3934 3210 488 389 371 ----12847
NM_033224chr796629 6177 5616 5152 2200 1182 546 449 356 47808 6936 6044 1207 ----
NM_052864chr442207 1717 1381 601 ----11375
NM_052879chr1243325 2626 1029 966 1322 --11470
NM_052885chr1243945 3080 879 557 ----24151 763
NM_052886chr83298 276 44 ----184
NM_053043chr786261 5975 5499 5444 2244 1842 973 959 14345 11746 --
NM_057175chr442065 950 601 196 ----12279
NM_080618chr202125 23 21158 401 --1225
NM_130436chr2132732 2437 194 12547 11872 12528
NM_130438chr2143309 3014 771 39 23124 2236 22449 2114 13105
NM_133170chr20116961 6796 6647 5177 2610 2216 1861 1266 1144 668 641 133 --25781 2603
NM_133367chr673451 3365 3234 1061 1008 619 588 ----1480
NM_133370chr463103 2901 2855 691 404 297 --31172 860 626 12649
NM_133647chr1521469 857 ----13107
NM_138426chr732102 834 333 --1882 1946
NM_138444chr1354869 1920 595 393 143 ----1373
NM_138473chr1284669 4552 4262 3693 1864 1848 1118 881 13216 ----
NM_138554chr972550 2477 2351 2175 1945 524 402 --161 --
NM_138713chr1676105 5497 3108 2823 2616 2209 1524 --27736 5237 --
NM_138714chr1676105 5497 3108 2823 2616 2209 1524 --27736 5237 --
NM_138782chr52811 293 ----1856
NM_144578chr1475117 4656 4019 1813 1189 1138 574 14980 12202 --
NM_144590chr1022658 1031 --22035 504 12190
NM_144599chr1554009 3469 1639 1381 1205 25149 4260 14390 14685
NM_145011chr1052256 1834 857 671 564 --1799 --
NM_145735chr1342419 2266 705 209 --11816 1596
NM_152608chr121915 39 ----11824
NM_152622chr533397 3167 823 ----11161
NM_152624chr597007 6918 6435 6040 5207 5107 4927 4826 586 --22325 217 17393
NM_152629chr974088 3968 3961 3721 2736 891 477 12526 13093 --
NM_152754chr733264 2871 357 ----12523
NM_152838chr2063547 2775 2264 813 585 455 23421 296 ----
NM_153207chr1222588 580 --23059 2540 12523
NM_153487chr664056 4049 1486 1464 567 54 14292 53631 3119 1541 1347 1048 1612
NM_170706chr194127 4035 3598 3239 1238 965 539 506 276 ----13212
NM_172016chr64971 243 100 89 1488 --11373
NM_172071chr187450 6137 5601 5233 2352 1500 1145 866 --16803 --
NM_173171chr221088 981 1376 --1314
NM_173172chr241396 1289 1044 171 ----1622
NM_173173chr221088 981 1376 --1314
NM_173214chr1676105 5497 3108 2823 2616 2209 1524 --27736 5237 --
NM_173582chr1175975 5872 5587 5208 4990 2025 1129 1191 ----
NM_173694chrX22261 170 ----1152
NM_175624chr1266782 6277 5014 4998 2680 2344 ----11475
NM_175625chr1266782 6277 5014 4998 2680 2344 ----11475
NM_175736chr1295870 5767 5632 5298 2248 2202 1658 1437 115 21969 401 11107 --
NM_175767chr511565 21407 741 11201 1569
NM_175854chr1342434 1719 830 493 ----1987
NM_177972chr1184412 4355 4203 2956 2801 2763 1529 887 13171 --13191
NM_178011chr1053293 2802 2711 117 73 --12627 1621
NM_178037chr1243135 2876 2417 21 12952 1585 135
NM_178038chr1243135 2876 2417 21 12952 1585 135
NM_178151chrX76365 4777 1877 1030 797 319 78 127 35670 5534 541 17713
NM_178152chrX76365 4777 1877 1030 797 319 78 127 35670 5534 541 17713
NM_178153chrX76365 4777 1877 1030 797 319 78 127 35670 5534 541 17713
NM_178585chr4103268 3196 2666 2658 2638 2409 2154 2037 1180 732 ------
NM_181351chr1163025 2631 2623 768 526 364 --22178 542 --
NM_181481chr1866062 6011 5611 4869 2597 1163 --36687 5580 85 16372
NM_181482chr1866062 6011 5611 4869 2597 1163 --36687 5580 85 16372
NM_181483chr1866062 6011 5611 4869 2597 1163 --36687 5580 85 16372
NM_181504chr543977 3134 436 35 ----1589
NM_181521chr1657198 5716 4843 1193 991 24792 4514 16307 --
NM_181523chr543977 3134 436 35 ----1589
NM_181524chr543977 3134 436 35 ----1589
NM_181659chr2063110 2842 2598 2487 630 227 --1482 --
NM_181659chr2063110 2842 2598 2487 630 227 --1482 --
NM_181741chr251219 1119 941 431 68 1478 --1221
NM_181742chr251219 1119 941 431 68 1478 --1221
NM_181836chr532049 2013 369 --1463 11814
NM_182620chr173852 704 195 --21835 1439 22207 90
NM_182643chr882121 2088 1648 792 627 563 499 86 ------
NM_182648chr14145 --1190 1276
NM_182757chr663548 3426 3288 864 295 214 ----1121
NM_182762chr786260 5420 4873 4863 4735 1865 1341 1251 --14428 --
NM_182898chr7106501 6337 6193 5484 5380 4371 4331 1883 1106 541 --12136 --
NM_182899chr7106501 6337 6193 5484 5380 4371 4331 1883 1106 541 --12136 --
NM_194247chr264494 3205 1460 1220 1207 402 --1187 --
NM_194434chr1824736 1081 --11920 1317
NM_198081chr642904 2425 783 203 --1659 11189
NM_198581chr267066 7043 2064 1708 1628 828 --27132 917 --
NM_198900chr1295870 5767 5632 5298 2248 2202 1658 1437 115 21969 401 11107 --
NM_198904chr532081 380 123 1476 --11411
NM_199040chr1273818 3540 3081 2494 2416 302 270 --1970 --
NM_199188chr1243325 2626 1029 966 1322 --11470
NM_199190chr1243325 2626 1029 966 1322 --11470
NM_199437chr1142237 1853 1728 338 11684 21678 968 --
NM_199438chr1142237 1853 1728 338 11684 21678 968 --
NM_199439chr1142237 1853 1728 338 11684 21678 968 --
NM_203446chr2142676 2204 2186 116 ----1593
NM_203463chr254250 3981 3957 564 448 --34881 3271 1838 --
NM_206594chr143535 3448 2835 1221 23619 2566 ----
NM_206595chr143535 3448 2835 1221 23619 2566 ----
NM_206854chr664217 3506 2135 2113 2053 279 --13331 --
NM_206909chr8108164 6745 3119 2458 2279 1730 1647 1340 1274 1070 27524 844 17518 --
NM_207292chr332916 2428 251 ----11286
NM_207293chr332916 2428 251 ----11286
NM_207294chr332916 2428 251 ----11286
NM_207295chr332916 2428 251 ----11286
NM_207296chr332916 2428 251 ----11286
NM_207297chr332941 2453 276 ----11311
NM_213589chr274787 1890 1831 1333 1292 650 398 --1119 184
NM_213606chr1022482 723 ----12682