TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4638-5p
miRNA Sequence: ACUCGGCUGCGGUGGACAAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000070chr151515 ------
NM_000089chr7188 ------
NM_000138chr1531928 1696 1638 ------
NM_000139chr1131134 995 763 11776 ----
NM_000151chr1711753 ------
NM_000170chr92176 170 ------
NM_000176chr5137 ----11070
NM_000217chr1245134 4554 1549 1417 1907 --11709
NM_000245chr712186 ------
NM_000248chr312219 ------
NM_000264chr923205 999 12736 ----
NM_000267chr1711026 ------
NM_000276chrX------1391
NM_000288chr61155 ------
NM_000314chr1012092 ------
NM_000332chr656555 5833 5084 4541 476 --1311 14963
NM_000351chrX23540 1748 12959 14060 --
NM_000362chr2232279 2246 44 ----12454
NM_000368chr933999 1142 143 --24181 1362 --
NM_000369chr1411842 ------
NM_000376chr1232174 2025 980 1598 12130 22219 865
NM_000399chr1021086 277 ------
NM_000439chr5----12517 --
NM_000461chr354243 4091 3384 1005 919 ------
NM_000462chr1511419 ------
NM_000489chrX23027 219 --1407 --
NM_000533chrX1806 ------
NM_000572chr14839 792 657 82 --1748 --
NM_000594chr62720 592 ------
NM_000615chr1122349 572 ------
NM_000616chr1211448 ------
NM_000618chr1225802 5232 11414 ----
NM_000618chr1225802 5232 11414 ----
NM_000621chr13--21363 1223 ----
NM_000721chr12607 583 1753 ----
NM_000809chr438512 6712 1486 12727 ----
NM_000829chr1121726 769 1112 --1465
NM_000831chr135960 5905 832 --14465 23852 232
NM_000832chr92593 193 --1210 --
NM_000840chr71177 ------
NM_000859chr531421 1149 414 ------
NM_000860chr4126 ------
NM_000868chrX12000 ------
NM_000872chr1021599 39 ------
NM_000878chr2241839 1463 89 47 11733 ----
NM_000883chr71640 ------
NM_000883chr71640 ------
NM_000935chr3--179 ----
NM_000944chr412394 ------
NM_000966chr1231071 810 414 ------
NM_001001132chr2111140 ------
NM_001001323chr1222762 297 ------
NM_001001330chr101519 11066 ----
NM_001001664chr224050 122 ------
NM_001001740chr1155 ------
NM_001001740chr1155 ------
NM_001002243chr21115 ------
NM_001002265chr102284 44 ------
NM_001002266chr102284 44 ------
NM_001002860chr1443525 1015 870 95 14265 --13021
NM_001002906chrY1484 --1386 --
NM_001002914chr1721062 253 ------
NM_001003652chr1847777 7606 6382 1191 11837 18439 --
NM_001003789chr2211105 --1443 1906
NM_001003800chr943229 3052 1340 646 --33035 2999 126 --
NM_001004065chr933359 1458 1156 1674 ----
NM_001004127chr13--2401 215 ----
NM_001004304chr1231991 337 259 --1587 --
NM_001004356chr411496 ------
NM_001004358chr411496 ------
NM_001004360chr21405 ------
NM_001004419chr1233317 1105 659 ------
NM_001004720chr21777 ------
NM_001004722chr21946 ------
NM_001005336chr91212 1578 ----
NM_001005404chr1732991 1578 652 14019 ----
NM_001005463chr1011593 ------
NM_001005474chr3----11479 --
NM_001005502chr1244778 3765 3626 1466 1585 23844 3721 21515 633
NM_001005732chr211536 ------
NM_001006115chr322263 590 ------
NM_001006636chr21135 --1113 --
NM_001006933chrX1100 ------
NM_001006938chrX3675 537 150 ------
NM_001007024chr1743305 565 488 163 2751 627 ----
NM_001007025chr1743305 565 488 163 2751 627 ----
NM_001007102chr61437 ------
NM_001007237chr112160 --31877 1039 42 --
NM_001007246chr211637 ------
NM_001007257chr13504 145 120 ------
NM_001007471chr9----2798 108 --
NM_001008222chrX21075 400 ------
NM_001008392chr351315 1269 556 365 86 ----1427
NM_001008408chr745405 5229 1490 170 ------
NM_001009909chr1113916 ------
NM_001009993chr253539 2920 1234 1007 174 --11325 --
NM_001009996chr31217 1487 ----
NM_001010862chrX23326 297 2615 364 ----
NM_001010911chr1031047 786 263 1190 1824 1926
NM_001011666chr735797 5515 2333 ----14871
NM_001011708chr232554 2175 968 12323 --11965
NM_001011885chr1521496 694 ------
NM_001012329chr162190 2122 1946 1683 958 72 ------
NM_001012393chr1134426 3331 1545 --21794 1615 --
NM_001012420chr1522584 2168 1553 ----
NM_001012423chr1522584 2168 1553 ----
NM_001012751chr1011280 ------
NM_001012761chr512608 ------
NM_001013415chr411378 ------
NM_001013438chr31825 ------
NM_001013439chr31671 ------
NM_001013624chr17124 --11054 --
NM_001013746chr721866 1846 ------
NM_001014283chr1331645 1385 856 22181 1445 ----
NM_001015877chrX22181 180 ------
NM_001017388chr41418 ----1467
NM_001017395chr313248 ------
NM_001017405chr41854 ------
NM_001017406chr12202 68 ------
NM_001017535chr1232174 2025 980 1598 12130 22219 865
NM_001017926chr821402 700 ------
NM_001017979chr41708 ------
NM_001018005chr15139 ------
NM_001018050chr221633 --21336 76 12993
NM_001018052chr221633 --21336 76 12993
NM_001018065chr91478 1435 33751 2384 273 --
NM_001018066chr91478 1435 33751 2384 273 --
NM_001018067chr145199 3570 1685 1518 ------
NM_001018068chr145199 3570 1685 1518 ------
NM_001018069chr145199 3570 1685 1518 ------
NM_001018074chr5137 ----11070
NM_001018075chr5137 ----11070
NM_001018076chr5137 ----11070
NM_001018077chr5137 ----11070
NM_001024094chr5137 ----11070
NM_001024372chr8179 ------
NM_001024948chr142955 2894 1174 406 --1131 --
NM_001025580chrX11014 ------
NM_001025616chr42583 435 ------
NM_001029870chr42189 108 186 ----
NM_001029875chr532699 240 73 ------
NM_001030007chr162125 111 ------
NM_001031685chr12848 730 ------
NM_001031690chr7187 --21089 608 1633
NM_001031740chr131593 535 291 11459 1419 11642
NM_001032380chr101207 ------
NM_001033045chr283466 3238 3104 1238 530 392 349 200 ----1579
NM_001033047chr422482 1915 12211 ----
NM_001033057chr3----21319 501 --
NM_001033081chr141621 601 256 138 ------
NM_001033082chr141621 601 256 138 ------
NM_001033112chr51685 1155 ----
NM_001033117chr314235 --24220 143 14362
NM_001033506chr111398 ------
NM_001033518chr742397 2246 384 164 12216 ----
NM_001033519chr742397 2246 384 164 12216 ----
NM_001033520chr742397 2246 384 164 12216 ----
NM_001033566chr17----1289 --
NM_001033568chr17----1289 --
NM_001033723chr822453 2374 --22390 695 --
NM_001033953chr11137 ------
NM_001034845chr41278 1184 ----
NM_001034850chr531171 1126 167 ------
NM_001034954chr104554 448 201 187 ------
NM_001034955chr104554 448 201 187 ------
NM_001034956chr104554 448 201 187 ------
NM_001034957chr104554 448 201 187 ------
NM_001035chr111107 ------
NM_001035254chr941763 1666 382 340 1868 ----
NM_001037174chr21647 ------
NM_001037533chr1----1572 --
NM_001037582chr4------1335
NM_001037631chr22834 423 --186 --
NM_001039547chr367556 7378 7295 2775 2233 1029 15661 --27605 5709
NM_001039580chr434458 1914 1025 ----14471
NM_001039618chr1124207 3721 ------
NM_001039844chr1022467 1913 12810 ----
NM_001039937chr1323896 892 ----13641
NM_001040057chr7------11100
NM_001040142chr221856 231 ------
NM_001040143chr221856 231 ------
NM_001040151chr1144464 4426 4357 1371 11265 ----
NM_001040152chr731537 816 370 --14001 --
NM_001040214chr612255 ------
NM_001040273chr1041986 1694 124 59 --11527 --
NM_001040429chr1343485 2479 1314 609 ------
NM_001040441chr195472 4635 4499 4456 1860 1812 1679 958 824 25190 4683 21768 914 11007
NM_001040446chr532488 1668 52 --1939 --
NM_001042406chr6----1201 --
NM_001042479chrX41936 1505 686 643 --21319 775 1868
NM_001042480chrX41936 1505 686 643 --21319 775 1868
NM_001042492chr1711026 ------
NM_001042494chr1543612 3374 1360 764 --2283 140 --
NM_001042495chr1543612 3374 1360 764 --2283 140 --
NM_001042496chr1543612 3374 1360 764 --2283 140 --
NM_001042497chr1543612 3374 1360 764 --2283 140 --
NM_001042533chr312782 --32100 1286 71 --
NM_001042550chr91342 ------
NM_001042599chr227798 2402 ------
NM_001042601chr322710 937 ------
NM_001042603chr1243479 3421 3363 353 14608 ----
NM_001042604chr311954 ------
NM_001042669chr42583 435 ------
NM_001042681chr111922 22275 175 12188 --
NM_001042682chr111922 22275 175 12188 --
NM_001042682chr111922 22275 175 12188 --
NM_001042728chr1231071 810 414 ------
NM_001042749chrX--11674 ----
NM_001042750chrX--11674 ----
NM_001042751chrX--11674 ----
NM_001043318chr142459 370 ------
NM_001043351chr12205 76 --12165 --
NM_001046chr512742 ------
NM_001049chr142800 84 --21804 428 1791
NM_001076chr41171 ------
NM_001076chr41171 ------
NM_001077628chr11661 ------
NM_001080418chr1168 ------
NM_001092chr1742047 1648 948 176 12089 12201 --
NM_001095chr1211308 --11469 --
NM_001106chr368329 7444 6912 3865 770 261 ------
NM_001126chr111067 ------
NM_001128chr162125 111 ------
NM_001146chr81269 ------
NM_001149chr1011404 ------
NM_001163chr93961 840 382 ------
NM_001197chr221145 ------
NM_001204chr227613 7259 14871 --15055
NM_001206chr911252 ------
NM_001222chr102718 35 ----21564 614
NM_001241chr2----12007 --
NM_001241chr2----12007 --
NM_001275chr14------1334
NM_001304chr1733268 1232 1176 ----1737
NM_001310chr121443 1967 ----
NM_001332chr511551 ------
NM_001343chr5171 ------
NM_001364chr1124017 319 --24239 3476 --
NM_001378chr21207 ------
NM_001387chr513155 1573 --1839
NM_001394chr8----1644 --
NM_001396chr212622 132 ------
NM_001406chr1721466 1421 ------
NM_001407chr341581 1323 683 148 --132 --
NM_001419chr1973679 3553 3285 3045 594 540 420 ------
NM_001448chrX------11331
NM_001493chrX1483 1610 ----
NM_001514chr11357 ------
NM_001542chr112160 --31877 1039 42 --
NM_001546chr611322 ------
NM_001584chr111328 ------
NM_001587chrX------1391
NM_001664chr31999 ------
NM_001682chr1212476 ------
NM_001859chr953744 2621 2589 1108 692 --2648 446 1219
NM_001874chr1244778 3765 3626 1466 1585 23844 3721 21515 633
NM_001895chr2011110 ------
NM_001901chr61950 ------
NM_001904chr3--1365 1422 --
NM_001918chr188615 8067 7675 2537 1803 1659 476 297 --28076 432 37033 1974 525
NM_001924chr12389 125 ------
NM_001945chr511236 11212 ----
NM_001949chr622171 143 ------
NM_001964chr51905 --1910 --
NM_001969chr141337 ------
NM_001999chr52607 567 ------
NM_002017chr1121354 1061 ------
NM_002025chrX39237 2061 1869 --18608 --
NM_002061chr121405 1272 ----21929 1454
NM_002063chrX----1506 --
NM_002077chr93754 319 185 ------
NM_002092chr424980 1815 ------
NM_002129chr41131 ------
NM_002214chr725610 792 ------
NM_002228chr12472 22 ------
NM_002246chr261203 1171 1036 821 177 165 ------
NM_002253chr42427 347 ------
NM_002264chr313717 11977 151 --
NM_002270chr534792 1177 190 ------
NM_002291chr7125 ------
NM_002293chr11726 ------
NM_002336chr1225050 797 ------
NM_002351chrX1153 11370 ----
NM_002356chr61232 ------
NM_002373chr152954 66 --11072 --
NM_002397chr5--1192 ----
NM_002442chr123653 275 40 --11546 1568
NM_002472chr17198 ------
NM_002480chr1211478 1250 ----
NM_002481chr142831 2228 2093 1516 16083 37723 6721 5903 --
NM_002499chr1531884 836 205 --11568 --
NM_002505chr621282 24 ------
NM_002508chr1193 --1431 11356
NM_002515chr1411446 ------
NM_002522chr1773363 2826 2568 2562 696 573 249 --23386 959 --
NM_002545chr1134426 3331 1545 --21794 1615 --
NM_002642chr1135 ------
NM_002657chr2033587 3574 2936 --188 --
NM_002709chr253247 2934 2760 1013 669 ------
NM_002711chr71761 ------
NM_002716chr1121264 1046 --13415 11313
NM_002731chr112637 ----171
NM_002737chr1745653 1607 1407 932 1547 24167 2082 --
NM_002745chr2221175 874 ------
NM_002752chr51470 ------
NM_002814chrX1151 ------
NM_002823chr21677 ------
NM_002833chr1531455 1274 62 ------
NM_002855chr1143173 2398 630 93 --22753 2583 2950 911
NM_002865chr8------178
NM_002886chr343260 1675 1546 1072 15102 ----
NM_002892chr142375 184 ------
NM_002906chr11137 ------
NM_002994chr411824 --1568 --
NM_003000chr1143 ------
NM_003010chr17--139 ----
NM_003016chr1711826 ------
NM_003017chr611295 ----11022
NM_003043chr31684 ----13980
NM_003081chr2011058 11044 ----
NM_003095chr121111 ----1305
NM_003110chr171322 ------
NM_003112chr712262 ------
NM_003136chr14--151 ----
NM_003155chr832619 746 384 ------
NM_003173chrX1534 180 ----
NM_003178chr321855 1673 ------
NM_003179chrX----11058 --
NM_003199chr1855051 4391 3447 1308 1183 1275 15379 --
NM_003203chr21955 ------
NM_003206chr61353 ------
NM_003216chr2252928 2786 2373 2320 365 1757 --13324
NM_003234chr3------12198
NM_003246chr151593 ------
NM_003253chr2121869 126 ------
NM_003255chr1722248 2207 --32238 705 683 --
NM_003286chr20----1167 --
NM_003291chr131690 ------
NM_003314chr5128 ------
NM_003338chr101288 ------
NM_003340chr411216 ------
NM_003341chr31230 ------
NM_003348chr1211192 ------
NM_003387chr221160 443 ------
NM_003404chr2011765 ------
NM_003430chr19166 1613 122 1115
NM_003442chr111581 ------
NM_003445chr193688 622 569 ------
NM_003452chr91321 ----1856
NM_003463chr611246 ------
NM_003468chr212910 --136 --
NM_003498chr1622756 37 --2440 279 --
NM_003581chr21777 ------
NM_003598chr191183 ------
NM_003603chr41745 ------
NM_003615chr311590 ------
NM_003637chr12518 449 ----11388
NM_003644chr1765548 5509 5325 991 299 72 34357 2422 1413 14844 --
NM_003651chr12------1225
NM_003663chr312923 ------
NM_003666chr11593 ----1642
NM_003667chr12----191 --
NM_003671chr92218 24 21273 1257 ----
NM_003701chr132842 335 ------
NM_003743chr2----1812 --
NM_003750chr101692 ------
NM_003774chr12129 --11137 --
NM_003778chr31117 --1594 --
NM_003787chr182382 338 ------
NM_003790chr1--2240 194 ----
NM_003798chr9146 ------
NM_003861chr14------12821
NM_003872chr242939 2654 2085 1127 ------
NM_003884chr321801 1762 ------
NM_003913chr624240 3131 22751 1659 ----
NM_003939chr1023566 2647 12851 1130 --
NM_003966chr547672 6665 1926 90 ----15947
NM_003971chr17----1411 --
NM_003980chr621077 27 ------
NM_003983chr1633984 2769 902 11524 ----
NM_004050chr1422361 849 --21837 148 --
NM_004055chr1141950 1693 470 306 21581 215 --11548
NM_004075chr12132 ------
NM_004094chr1422125 102 12549 ----
NM_004097chr22913 183 ------
NM_004102chr11387 ------
NM_004112chr1711591 1180 11234 --
NM_004124chr1413204 ----1992
NM_004132chr1011202 ------
NM_004171chr1123563 3406 26103 1615 27373 131 --
NM_004172chr521795 1595 ------
NM_004200chr1172418 2410 685 655 500 423 29 1747 12773 --
NM_004209chr1621197 918 ------
NM_004229chrX11725 ------
NM_004247chr17------166
NM_004272chr5--1494 1760 11805
NM_004287chr1732574 2275 307 --11854 --
NM_004293chr913830 ----12927
NM_004294chr131733 ------
NM_004311chr1052632 2605 875 390 39 ------
NM_004321chr273303 2995 2984 2892 2416 1007 25 13077 --11346
NM_004330chr151878 ------
NM_004342chr722163 600 ------
NM_004364chr192946 246 ----1455
NM_004379chr22399 352 --11513 11742
NM_004397chr1154265 3867 3639 771 377 ------
NM_004408chr91136 1502 ----
NM_004412chr1055653 5625 4904 1971 753 ------
NM_004418chr22531 47 ------
NM_004430chr852753 2051 864 592 303 ------
NM_004431chr12314 134 --1224 --
NM_004432chr911752 ------
NM_004437chr113557 1614 22723 1177 --
NM_004454chr332223 680 515 ------
NM_004458chrX1199 ----1800
NM_004496chr1411207 ------
NM_004501chr122507 56 ------
NM_004504chr21577 ------
NM_004505chr172811 59 ------
NM_004588chr1133434 1296 787 --1779 12571
NM_004593chr3--1263 ----
NM_004612chr914148 --13088 --
NM_004621chr1111307 ------
NM_004635chr321095 463 ------
NM_004637chr321322 525 ------
NM_004650chrX--1520 ----
NM_004677chrY1484 --1386 --
NM_004681chrY----1163 --
NM_004687chr1711673 ------
NM_004726chrX15416 ----11463
NM_004731chr12195 ------
NM_004733chr3--1505 ----
NM_004745chr866698 5343 4832 2224 1718 939 --31764 717 500 11141
NM_004779chr5----1418 --
NM_004808chr1053087 3042 894 717 117 --22430 850 23135 942
NM_004845chrX43792 3260 1365 179 ----1483
NM_004846chr2------1168
NM_004866chr534549 4281 566 --14237 14330
NM_004869chr1811425 ------
NM_004871chr1743305 565 488 163 2751 627 ----
NM_004872chr11345 ------
NM_004904chr735797 5515 2333 ----14871
NM_004907chr191875 1146 1223 2881 808
NM_004922chr10197 ------
NM_004956chr713404 ------
NM_004965chr211597 ------
NM_004976chr1143163 761 723 251 25074 933 1520 --
NM_004985chr1213843 ------
NM_004992chrX128023 7561 7389 7381 7300 6910 6426 6019 2902 1683 1438 832 28224 8107 ----
NM_004992chrX128023 7561 7389 7381 7300 6910 6426 6019 2902 1683 1438 832 28224 8107 ----
NM_004999chr634010 3875 1339 ----14059
NM_005054chr221503 473 ------
NM_005056chr1243723 3665 3607 597 14852 ----
NM_005066chr11602 ------
NM_005072chr16----4475 470 451 31 --
NM_005078chr1521600 752 1144 21660 114 --
NM_005080chr222818 360 ------
NM_005087chr31671 ------
NM_005105chr122050 323 11847 ----
NM_005109chr332418 1647 687 1924 ----
NM_005135chr1543612 3374 1360 764 --2283 140 --
NM_005171chr1211044 ------
NM_005184chr191600 --11484 --
NM_005197chr1466039 5599 5170 3990 2108 1978 ------
NM_005202chr121561 99 1164 11937 1303
NM_005206chr1721365 1230 --1131 11414
NM_005214chr22797 386 --149 --
NM_005224chr191135 ------
NM_005235chr227798 2402 ------
NM_005238chr1163493 3331 2386 2315 1315 680 134 --13246
NM_005241chr3182 ------
NM_005250chr163624 543 51 11825 ----
NM_005264chr102793 79 ------
NM_005316chr111141 ------
NM_005324chr1722106 724 ------
NM_005333chrX21255 889 ------
NM_005334chrX21443 1096 --1302 --
NM_005338chr753624 897 840 706 130 --43580 2734 2658 2519 --
NM_005339chr421641 481 ------
NM_005349chr41620 ------
NM_005359chr1826515 4566 ------
NM_005370chr1921011 40 --177 1869
NM_005399chr134277 2932 1597 ------
NM_005413chr21457 ------
NM_005417chr2041929 1467 320 314 2512 400 ----
NM_005426chr12848 730 ------
NM_005436chr1022500 756 ------
NM_005437chr1021247 204 --157 --
NM_005460chr5152 ------
NM_005465chr111682 1678 ----
NM_005497chr1735643 5172 161 14405 25263 4360 35697 5356 4451
NM_005504chr1226083 4178 ------
NM_005513chr3--1189 --11121
NM_005544chr21308 --1749 --
NM_005570chr1811204 ------
NM_005596chr924901 2220 ------
NM_005600chr12265 258 ------
NM_005603chr184508 386 253 209 11443 1343 2679 436
NM_005611chr1621081 94 11219 ----
NM_005626chr1----1475 --
NM_005639chr121415 ------
NM_005644chr1------156
NM_005665chr114034 14282 --13895
NM_005668chr543286 1361 953 151 11108 ----
NM_005669chr512301 ------
NM_005676chrX1204 ------
NM_005704chr111095 1264 ----
NM_005721chr21905 ------
NM_005730chr1251189 672 624 308 159 ------
NM_005734chr111741 ------
NM_005786chr182825 49 ------
NM_005789chr1711792 --1372 --
NM_005797chr11------122
NM_005808chr351315 1269 556 365 86 ----1427
NM_005819chr142963 1183 502 304 11194 163 --
NM_005828chr1754504 3136 1992 893 218 --13092 1841
NM_005839chr11205 ------
NM_005841chr41810 --1900 --
NM_005880chr161496 ------
NM_005882chr41854 ------
NM_005896chr21719 ------
NM_005898chr111636 ------
NM_005901chr1847777 7606 6382 1191 11837 18439 --
NM_005904chr1811463 --132 --
NM_005909chr531111 1082 850 ----14071
NM_005920chr141537 788 671 366 1684 12445 --
NM_005922chr6--177 ----
NM_005923chr6153 ------
NM_005933chr111130 --1110 --
NM_005937chr1751361 1256 721 157 124 --1542 --
NM_005938chrX11177 --1400 --
NM_005941chr813745 ------
NM_005957chr154130 3105 3037 1961 1892 --44833 4698 4086 3537 14882
NM_005977chr13166 ------
NM_006038chr2021763 606 ------
NM_006040chr1621149 476 ------
NM_006062chr221109 201 1798 ----
NM_006080chr722096 409 --1132 --
NM_006094chr812286 12140 --1875
NM_006096chr841607 1121 547 430 11214 ----
NM_006106chr111514 ------
NM_006141chr1632107 673 476 ------
NM_006148chr1722429 2336 ------
NM_006159chr12----1123 --
NM_006166chr1212216 ----12262
NM_006203chr522215 251 ------
NM_006237chr1332106 799 617 --142 --
NM_006238chr631958 1842 691 1647 ----
NM_006251chr5----1982 --
NM_006256chr132081 755 28 ------
NM_006281chr81848 ------
NM_006281chr81848 ------
NM_006310chr17171 ------
NM_006330chr811379 ------
NM_006393chr1034297 3608 3240 ------
NM_006420chr2033020 1371 1084 --13091 --
NM_006424chr4--11903 11223 --
NM_006425chr521462 38 1521 ----
NM_006434chr104554 448 201 187 ------
NM_006454chr431221 622 173 --11889 --
NM_006459chr1011823 ----1330
NM_006486chr22----1141 --
NM_006489chr1411446 ------
NM_006502chr61142 ----2950 659
NM_006517chrX2762 410 ------
NM_006534chr2023030 172 --1712 --
NM_006546chr1755974 4625 4147 1778 110 ----35312 4026 2310
NM_006549chr1252769 2685 1069 965 759 ------
NM_006559chr111067 ------
NM_006565chr162861 241 ------
NM_006572chr171265 ------
NM_006591chr11----11522 --
NM_006599chr1617638 ------
NM_006603chrX--11674 ----
NM_006621chr12815 750 ------
NM_006633chr51304 ------
NM_006668chr141548 ------
NM_006690chr2051820 1465 888 155 127 --1850 12097
NM_006691chr11--11034 ----
NM_006717chr923039 2247 ------
NM_006722chr312219 ------
NM_006724chr6--177 ----
NM_006726chr411184 ------
NM_006729chrX1581 ----13470
NM_006775chr612656 --22043 116 --
NM_006812chr121536 --1115 --
NM_006885chr1623030 961 13811 ----
NM_006888chr1432680 2400 757 ----1922
NM_006910chr161318 ------
NM_006922chr23882 234 224 ------
NM_006927chr1641953 1401 643 149 ----22002 606
NM_006946chr112431 62 ------
NM_006990chr162508 2475 1986 887 477 440 11932 --12525
NM_006996chr131373 1335 1256 ------
NM_007011chr1586331 5562 5426 5384 4719 2406 1022 916 1599 14861 15611
NM_007039chr1421511 1448 1929 11542 --
NM_007042chr321983 517 ------
NM_007050chr2012561 ----15713
NM_007081chr2211105 --1443 1906
NM_007084chr131997 ------
NM_007111chr131306 ------
NM_007114chr312432 ------
NM_007122chr1----2524 411 --
NM_007129chr131226 ------
NM_007144chr17----1974 11165
NM_007146chr1732466 2033 227 ------
NM_007170chr13309 208 45 ------
NM_007174chr121176 ----1709
NM_007189chr711041 ----11190
NM_007191chr121143 ------
NM_007203chr933359 1458 1156 1674 ----
NM_007222chr821402 700 ------
NM_007246chr41211 ------
NM_007249chr1326541 1659 --123 11258
NM_007270chr721548 1233 11200 ----
NM_007278chr171434 ------
NM_007332chr811312 ------
NM_007358chr111904 ------
NM_007361chr141164 ------
NM_012082chr81123 ------
NM_012083chr10283 77 --1955 --
NM_012096chr332322 425 256 12864 ----
NM_012097chr21647 ------
NM_012102chr111922 22275 175 12188 --
NM_012104chr1111130 --23153 2770 --
NM_012104chr1111130 --23153 2770 --
NM_012120chr6165 ------
NM_012141chr1323896 892 ----13641
NM_012156chr2011001 ------
NM_012164chr942503 1031 76 40 17515 --11860
NM_012193chr1134312 1933 968 ------
NM_012197chr931395 304 213 ------
NM_012210chr91244 ------
NM_012215chr101505 1253 21657 1370 --
NM_012229chr1021299 1173 11037 ----
NM_012234chr333506 3251 2397 ------
NM_012249chr2--13239 12414 --
NM_012281chr711826 --1592 --
NM_012290chr211698 ------
NM_012293chr282024 1938 1833 1457 909 871 413 58 ------
NM_012294chr72873 98 ------
NM_012301chr71434 ------
NM_012306chr1232461 1202 875 --22766 2568 --
NM_012316chr165557 5115 4972 4658 3773 1842 14793 ----
NM_012382chr513962 ------
NM_012396chr13202 153 52 ------
NM_012398chr1962220 2052 2025 873 156 79 12823 130 --
NM_012416chr911088 ------
NM_012419chr6--136 ----
NM_012421chr11161 179 ----
NM_012425chr1022368 1099 --22324 1057 12417
NM_012434chr61303 ------
NM_012463chr1241714 1696 1674 410 ----11658
NM_012465chr1013111 2742 432 ----
NM_012471chrX11348 --1407 --
NM_013269chr1233244 1032 586 ------
NM_013316chr71770 ------
NM_013341chr232554 2175 968 12323 --11965
NM_013354chr811096 ------
NM_013377chr12--1193 ----
NM_013391chr51362 ------
NM_013396chr211174 ------
NM_013423chrX11035 ------
NM_013427chrX11035 ------
NM_013438chr91692 --1592 --
NM_013449chr1232864 884 758 ------
NM_014021chr1----23091 692 --
NM_014048chr1645262 3403 1977 1565 ------
NM_014141chr744182 4125 3765 3326 13349 1202 --
NM_014155chr1136681 5613 218 --1369 --
NM_014240chr333720 1578 1564 --42913 1396 697 44 23903 3390
NM_014243chr41313 ------
NM_014283chr11194 ------
NM_014309chr2244818 1302 1269 357 --14195 --
NM_014319chr1231866 1247 177 ------
NM_014325chr1221922 1699 --1212 --
NM_014331chr457187 3129 2053 1525 1392 --11348 --
NM_014365chr122880 78 ------
NM_014368chr931639 429 302 2176 61 ----
NM_014409chr1------173
NM_014423chr5188 ------
NM_014426chr20------1555
NM_014494chr1612291 ------
NM_014615chr1653134 2673 1399 472 23 ------
NM_014616chr332700 1044 298 ------
NM_014635chr221475 437 ------
NM_014636chr9--13365 11075 --
NM_014647chr1621699 174 1821 1890 --
NM_014663chr13909 360 234 --1226 --
NM_014665chr883435 3253 3170 3077 2842 2710 1465 1379 11446 --23594 334
NM_014671chr711278 1418 ----
NM_014682chr81148 ------
NM_014690chr7187 --21089 608 1633
NM_014707chr711960 ------
NM_014710chrX2182 169 --1695 --
NM_014717chr191792 ------
NM_014721chr626096 1876 ----1492
NM_014729chr8------11955
NM_014733chr5167 ------
NM_014743chr432121 1237 1135 22599 2294 ----
NM_014767chr1043216 2572 597 25 13240 21469 576 1758
NM_014779chr3----11167 --
NM_014807chr113332 287 196 ----1695
NM_014819chr531896 723 191 1495 ----
NM_014827chr121448 540 ------
NM_014830chr122964 84 ------
NM_014832chr1341966 709 122 96 ------
NM_014836chr101207 ------
NM_014839chr111716 ------
NM_014841chr6177 ------
NM_014848chr15--22437 29 ----
NM_014850chr314235 --24220 143 14362
NM_014857chr1------150
NM_014867chr843435 2684 1053 322 23843 2487 ----
NM_014868chr121828 ------
NM_014872chr9128 ------
NM_014877chr1732700 1841 783 ----16984
NM_014906chr1712632 ------
NM_014918chr1511620 ------
NM_014920chr633638 2461 60 ------
NM_014935chr132422 1276 25 ----11192
NM_014939chr1811455 ------
NM_014961chr421857 232 ------
NM_014982chr1434681 3692 202 1229 15364 --
NM_014991chr412966 ------
NM_015002chr121304 11883 ----
NM_015008chr313248 ------
NM_015023chr12586 335 --11794 --
NM_015025chr252101 1705 435 300 218 ------
NM_015026chr1214762 ------
NM_015035chr2026515 5447 --25403 4985 15496
NM_015039chr124140 989 --11305 --
NM_015045chr1011911 ------
NM_015051chr912333 12547 ----
NM_015052chr72549 472 ------
NM_015064chr1213446 1762 1791 13624
NM_015068chr731332 1036 389 11601 12853 --
NM_015071chr544514 1819 68 26 1414 ----
NM_015074chr154022 3324 1119 1076 1067 1200 14482 14313
NM_015077chr1733983 1414 1073 192 --34339 3567 3559
NM_015094chr2284286 4046 3799 3427 1745 1552 1001 686 ----23214 183
NM_015097chr322182 1994 12353 ----
NM_015107chrX31918 246 103 ------
NM_015132chr7----1597 --
NM_015147chr242969 2198 2080 168 --12276 12129
NM_015156chr1434018 1612 1343 ------
NM_015170chr832109 324 232 ------
NM_015200chr412227 ------
NM_015205chr1374376 4113 3885 1559 1121 752 639 1938 ----
NM_015206chr1523136 2489 ------
NM_015215chr122551 473 ----11932
NM_015221chr1031011 404 52 ------
NM_015239chr9197 ------
NM_015263chr15----1135 --
NM_015270chr122381 26 ------
NM_015271chr411191 ------
NM_015277chr18--1715 31818 1211 124 --
NM_015278chr623180 2637 --12267 --
NM_015282chr252535 2281 2239 603 463 2839 273 ----
NM_015288chr552389 1355 907 880 88 ------
NM_015291chr143500 3224 1252 667 ------
NM_015299chr1423132 421 --22732 317 --
NM_015313chr1123843 3197 --14030 --
NM_015315chr532872 1142 133 --11370 --
NM_015317chr211889 ------
NM_015321chr1953781 3722 3308 1786 90 21769 743 1190 11340
NM_015323chr611663 ------
NM_015328chr721052 230 ------
NM_015336chr1221018 32 ------
NM_015355chr1711825 ------
NM_015365chrX11014 ------
NM_015375chr154297 3469 1915 872 738 --31871 828 255 21964 921
NM_015385chr104554 448 201 187 ------
NM_015443chr1711461 ------
NM_015455chr51778 ------
NM_015458chr834085 549 221 --34852 1972 1804 14134
NM_015475chr21964 ------
NM_015477chr151203 ------
NM_015483chr71358 ------
NM_015503chr16169 ------
NM_015535chr21397 --1775 --
NM_015564chr513503 --1635 --
NM_015567chr1321103 952 ------
NM_015571chr612376 ------
NM_015602chr131771 579 276 ------
NM_015610chr742397 2246 384 164 12216 ----
NM_015635chr9----1639 --
NM_015640chr145199 3570 1685 1518 ------
NM_015678chr13------2399 38
NM_015691chrX169 ------
NM_015866chr13504 145 120 ------
NM_015874chr41620 ------
NM_015885chr111112 ------
NM_015902chr82286 148 ------
NM_015912chr812293 --1177 22071 60
NM_015980chr551559 1064 555 537 219 11386 ----
NM_015989chr123585 125 82 --1217 1307
NM_016003chr742397 2246 384 164 12216 ----
NM_016032chrX21075 400 ------
NM_016057chr121363 11014 ----
NM_016076chr1143 ------
NM_016083chr611578 ------
NM_016098chr6156 ----1146
NM_016131chr221640 688 ------
NM_016132chr1522756 778 ------
NM_016162chr123651 275 156 ------
NM_016206chr328058 2664 ------
NM_016210chr331533 520 122 1257 ----
NM_016220chr721866 1846 ------
NM_016227chr11194 ------
NM_016231chr1721415 497 ------
NM_016248chr1333216 2634 353 ------
NM_016258chr1------1656
NM_016260chr212452 --26635 537 --
NM_016269chr421162 120 --1309 --
NM_016271chr182725 501 --12217 --
NM_016284chr162837 348 ------
NM_016289chr211524 ------
NM_016300chr3181 ------
NM_016374chr11132 ------
NM_016374chr11132 ------
NM_016376chr1733404 1599 605 ----13571
NM_016448chr111878 --150 --
NM_016480chr51685 1155 ----
NM_016481chr9--187 ----
NM_016513chr633638 2461 60 ------
NM_016520chr94731 256 118 75 ----1305
NM_016530chr1533842 826 641 2845 106 ----
NM_016588chr61611 ------
NM_016626chr182282 265 ------
NM_016628chr101299 ------
NM_016644chr51471 ------
NM_016931chr112410 312 ------
NM_016953chr244016 2259 2121 1343 --1326 12308
NM_017415chr554588 4510 3840 3488 3369 ------
NM_017420chr14--1590 ----
NM_017519chr611057 ------
NM_017551chr102682 569 11951 --11713
NM_017582chr131690 1641 608 ------
NM_017629chr111620 11881 11935 --
NM_017632chr41366 ------
NM_017637chr958079 5889 3616 3085 1296 18586 12403 --
NM_017644chr323735 2016 ----13794
NM_017657chr21115 ------
NM_017672chr15------1205
NM_017686chr11938 ------
NM_017694chr232001 1374 1301 --1687 --
NM_017700chr41147 ------
NM_017709chr12928 679 ------
NM_017736chr162525 287 ------
NM_017737chr121664 1603 ------
NM_017741chr442808 2439 2112 217 --22204 308 12297
NM_017755chr51182 ------
NM_017799chr1431466 1414 1322 ------
NM_017813chr821744 37 --23572 284 --
NM_017849chr232713 1188 1000 1337 13162 --
NM_017856chrX41936 1505 686 643 --21319 775 1868
NM_017873chr973048 2667 2403 2156 1999 967 758 --1844 --
NM_017893chr10------11276
NM_017919chr935814 1971 206 ----11059
NM_017938chrX1452 ------
NM_017944chr1132609 2395 507 ------
NM_017948chr9178 ------
NM_017988chr12155 ------
NM_017994chr722944 2429 ------
NM_018014chr2149 ------
NM_018024chr81485 ------
NM_018027chr1032361 413 56 --22612 1032 --
NM_018028chr192204 190 ------
NM_018031chr34563 550 415 145 ------
NM_018045chr121077 168 --12600 12108
NM_018098chr31277 ------
NM_018114chr31217 1487 ----
NM_018133chr32464 238 ------
NM_018143chr17151 ------
NM_018155chr323436 3018 ------
NM_018182chr1721387 505 ------
NM_018206chr161100 ------
NM_018214chr6--148 ----
NM_018225chr955047 4343 4210 4167 311 13964 24624 4299 14392
NM_018241chr41117 ------
NM_018247chr6------12847
NM_018254chr111725 ------
NM_018265chr131947 1656 104 151 11510 1120
NM_018287chr10------1151
NM_018302chr43976 933 43 ----1621
NM_018307chr17----1289 --
NM_018315chr411378 ------
NM_018327chr20----1674 --
NM_018361chr843779 2492 578 151 ------
NM_018364chr112622 ------
NM_018400chr1144464 4426 4357 1371 11265 ----
NM_018424chr931759 1699 1332 ------
NM_018440chr847468 6321 6139 5701 16184 16085 16370
NM_018441chr21550 ----1599
NM_018452chr6_random12592 12996 ----
NM_018486chrX1391 --133 --
NM_018509chr1721655 1137 ------
NM_018557chr211139 ------
NM_018561chr62695 289 --1245 11025
NM_018569chr421108 397 ------
NM_018602chr1521062 135 ------
NM_018638chr12----132 --
NM_018652chr15194 ----158
NM_018667chr1621846 1050 12613 ----
NM_018700chr5188 ------
NM_018703chr161318 ------
NM_018945chr623211 240 --12954 --
NM_018948chr1--1168 ----
NM_018955chr171104 ------
NM_018970chr722796 51 ------
NM_019000chr531171 1126 167 ------
NM_019001chr311954 ------
NM_019006chr151188 ------
NM_019036chr6----1201 --
NM_019057chr52143 56 ------
NM_019089chr152980 2802 1166 329 133 --22495 1131 13029
NM_019117chrX32840 225 167 ------
NM_019843chr221412 --1177 --
NM_019859chr1021630 70 ------
NM_019860chr1021678 118 ------
NM_019885chr212295 --12222 --
NM_020039chr1211308 --11469 --
NM_020122chr255338 4877 4703 3671 1194 1963 1599 24925 3720
NM_020140chr12125 ------
NM_020205chr142572 1333 1161 830 ------
NM_020248chr162190 2122 1946 1683 958 72 ------
NM_020310chr1731805 943 751 ------
NM_020337chr41287 ------
NM_020384chrX2403 115 --11364 --
NM_020416chr442345 729 538 407 1580 21695 1011 --
NM_020432chr7----11955 --
NM_020433chr202454 34 --11286 --
NM_020443chr176906 6097 5372 4292 2735 1902 1725 --16837 --
NM_020463chr2162 ------
NM_020474chr181704 ------
NM_020526chr11132 --21581 698 --
NM_020673chr2022632 1576 ------
NM_020699chr145327 4997 4280 3726 13477 13958 --
NM_020703chr1--1541 ----
NM_020715chr1412212 ----11768
NM_020718chr1655865 5817 5354 1713 394 ------
NM_020731chr543179 2546 2091 1107 ------
NM_020732chr611057 ------
NM_020734chr1211031 ------
NM_020748chr17----1232 --
NM_020766chrX13199 --14108 --
NM_020772chr1737721 6507 5857 --18299 --
NM_020783chr1821916 632 --11893 1609
NM_020801chr5159 ------
NM_020805chr1811668 ------
NM_020810chr1422824 1308 ------
NM_020813chr1932100 275 137 --3804 604 212 --
NM_020850chr1632977 636 358 22565 2306 12426 12129
NM_020856chr1911441 ------
NM_020858chr151291 ------
NM_020868chr21405 ------
NM_020924chr9--1415 ----
NM_020927chr1611857 159 1130 --
NM_020935chr221292 204 ----11602
NM_020948chr111442 ------
NM_020951chr191164 ------
NM_020952chr9----2798 108 --
NM_020956chr19244325 4319 4167 4075 4011 3991 3936 3677 3636 3469 3389 3337 3243 3133 3127 3077 3052 1451 1327 1227 871 804 676 259 24688 3300 23601 724 13894
NM_020962chr151138 ------
NM_020983chr122381 26 ------
NM_020987chr1011404 ------
NM_020995chr162135 110 ------
NM_021005chr1521124 814 ------
NM_021007chr221856 231 ------
NM_021069chr41745 ------
NM_021072chr522553 1925 --1646 --
NM_021079chr1733371 3137 409 --12657 --
NM_021111chr9----11075 --
NM_021129chr10126 ------
NM_021136chr141504 ------
NM_021140chrX1194 ------
NM_021165chr12330 146 ------
NM_021191chr1212180 ------
NM_021200chr112793 424 11186 ----
NM_021218chr92927 151 ----1976
NM_021255chr1422820 1177 11332 --13911
NM_021572chr6------11204
NM_021643chr22153 91 ------
NM_021648chr612234 ------
NM_021705chr621282 24 ------
NM_021784chr20--177 ----
NM_021914chr1412063 ------
NM_021923chr411496 ------
NM_021962chr1742047 1648 948 176 12089 12201 --
NM_021964chr365994 5688 5545 4335 2238 123 ------
NM_021979chr141455 ------
NM_022048chr1511017 --21385 1102 --
NM_022062chr1121602 219 21966 53 1245 --
NM_022103chr1921211 411 2870 291 ----
NM_022114chr164700 4076 3177 957 752 341 1317 23782 917 --
NM_022121chr6--139 ----
NM_022133chr81641 ------
NM_022143chr72636 357 1302 --1453
NM_022154chr4176 ------
NM_022166chr1665151 4697 4424 3982 1605 416 14648 ----
NM_022351chr813318 ------
NM_022437chr21185 ------
NM_022457chr1155 ------
NM_022465chr12------12095
NM_022475chr4--1582 ----
NM_022477chr201229 11675 --11226
NM_022497chr312572 --21143 180 --
NM_022552chr2------11089
NM_022719chr2263005 2367 1457 1185 1134 1042 ------
NM_022728chr73625 481 76 ------
NM_022755chr932123 792 778 22174 1001 22335 452 --
NM_022757chr31957 ----1834
NM_022763chr322480 2458 12000 ----
NM_022771chr12------1396
NM_022781chr923109 638 ------
NM_022841chr151282 ------
NM_022893chr21415 ------
NM_022898chr1444387 4211 1841 955 ----23919 1486
NM_022912chr212908 21870 394 ----
NM_022918chr11--11834 ----
NM_022977chrX1199 ----1800
NM_023000chr142375 184 ------
NM_023001chr142375 184 ------
NM_023076chr1632609 2571 1132 12219 12254 11181
NM_023079chr171760 ------
NM_023929chr812148 ------
NM_024019chr41453 --162 --
NM_024106chr192277 143 ------
NM_024111chr153557 536 264 ------
NM_024295chr811893 ------
NM_024312chr12--11384 --11416
NM_024344chr151515 ------
NM_024607chr861761 1582 1131 995 952 510 --11718 11810
NM_024636chr732710 2619 380 ----1258
NM_024640chr11233 ------
NM_024659chr21135 --1113 --
NM_024700chr111101 ------
NM_024740chr1123350 873 ------
NM_024745chr162873 731 --1829 --
NM_024761chr954111 729 602 433 402 ------
NM_024770chr286538 4233 2095 1959 1916 1156 959 689 ----32144 1034 873
NM_024834chr1011781 --1314 --
NM_024835chr171327 ------
NM_024837chr152393 52 ------
NM_024893chr20--1999 ----
NM_024913chr7------11215
NM_024939chr1621608 31 ------
NM_024971chr9----2798 108 --
NM_024991chr104554 448 201 187 ------
NM_025054chr8--1228 ----
NM_025058chr11711 --1622 --
NM_025126chr122738 562 ------
NM_025133chr2------1956
NM_025134chr161711 --1596 --
NM_025179chr113788 2532 245 14929 1268
NM_025222chr362657 2433 2298 1181 338 331 --12389 --
NM_025237chr17--21249 133 1193 --
NM_030625chr1022453 438 ------
NM_030634chr1--122 ----
NM_030648chr421515 227 ------
NM_030674chr1254739 4104 1444 679 600 --14929 --
NM_030751chr1031231 662 332 ------
NM_030751chr1031231 662 332 ------
NM_030766chr12176 ------
NM_030780chr81293 ------
NM_030816chr112821 ------
NM_030820chr61923 ------
NM_030912chr102279 271 ------
NM_030954chr84833 699 655 554 ------
NM_030962chr11187 ------
NM_030964chr533412 2761 1130 ----23099 2701
NM_030981chr11----11239 --
NM_031283chr21167 ------
NM_031305chr42583 435 ------
NM_031371chr11132 ------
NM_031371chr11132 ------
NM_031419chr3----11479 --
NM_031442chrX1205 ------
NM_031445chr252777 2473 2135 749 337 ------
NM_031844chr122507 56 ------
NM_031886chr1952530 2049 1913 1870 1009 --32005 1636 1592 12098
NM_032013chr201229 11675 --11226
NM_032042chr54543 228 217 71 ------
NM_032047chr31793 ------
NM_032102chr1163077 2574 2196 2018 807 650 --12269 12245
NM_032139chr19162 ------
NM_032193chr1141387 660 405 206 12045 ----
NM_032199chr1013751 12694 ----
NM_032205chr8154 ------
NM_032208chr232847 2322 159 ----22306 1053
NM_032239chr411225 ------
NM_032256chr121274 ------
NM_032289chr521571 565 ------
NM_032295chr7183 --11124 --
NM_032320chr111157 ------
NM_032327chr101414 ----1370
NM_032376chr171491 122 1246 --
NM_032438chr61437 ------
NM_032440chr10--12586 ----
NM_032445chr151289 ------
NM_032446chr543489 2415 1415 138 --1146 --
NM_032449chr13722 299 142 12660 12523 --
NM_032457chr41382 ------
NM_032458chrX52511 2192 510 179 137 ------
NM_032499chr152507 107 ------
NM_032505chr322596 1869 ----195
NM_032511chr61310 ------
NM_032622chr41308 1407 ----
NM_032682chr341408 1311 740 666 ------
NM_032778chr312782 --32100 1286 71 --
NM_032788chr221393 288 21530 1010 --11578
NM_032809chr931602 1548 82 ------
NM_032822chr221070 30 ------
NM_032826chr794820 4814 1629 926 791 747 574 105 88 13675 21158 974 15352
NM_032859chr131846 1637 ----
NM_032864chr11156 ------
NM_032873chr1114087 14474 1462 --
NM_032905chr1011102 159 ----
NM_032918chr1211035 --1425 --
NM_032926chrX1100 ------
NM_032961chr4148 ------
NM_032967chrX31006 757 399 ----1806
NM_032971chrY31033 784 426 ----1833
NM_032972chrY31033 784 426 ----1833
NM_033012chr132842 335 ------
NM_033058chr82710 54 1153 ----
NM_033092chr11192 ------
NM_033133chr1743348 1401 1373 246 --23200 2340 --
NM_033138chr722163 600 ------
NM_033139chr722163 600 ------
NM_033140chr722163 600 ------
NM_033157chr722163 600 ------
NM_033181chr611578 ------
NM_033224chr765255 5134 5090 2601 1328 829 27626 1853 15211 12253
NM_033225chr833059 2588 1074 1331 ----
NM_033227chr51450 ------
NM_033228chr51490 ------
NM_033266chr161127 --154 --
NM_033326chr1112143 ------
NM_033331chr92218 24 21273 1257 ----
NM_033360chr1213964 ------
NM_033375chr172289 200 21003 568 --1412
NM_033426chr1442291 769 750 722 12155 ----
NM_033429chr151402 ----2697 505
NM_033495chrX1223 ------
NM_033515chr6155 ------
NM_033540chr31948 ------
NM_033551chr532872 1142 133 --11370 --
NM_033624chr121304 11883 ----
NM_033631chr143016 1069 1028 814 --1133 --
NM_033632chr411378 ------
NM_033637chr1023566 2647 12851 1130 --
NM_044472chr1--1663 ----
NM_052840chr1521536 1321 ------
NM_052849chr153800 295 71 ------
NM_052897chr12153 --146 --
NM_052906chr2264631 4470 3951 3926 697 303 23958 3809 21940 854 --
NM_052913chr61730 ------
NM_052928chr1761294 1142 1083 414 371 252 ----2599 301
NM_052934chr11320 1682 ----
NM_052978chr1421175 225 ------
NM_053016chr967977 5982 3218 2986 644 476 16820 11240 --
NM_053023chr1112088 ------
NM_053043chr745405 5229 1490 170 ------
NM_053279chr812173 --170 --
NM_054022chr171721 ------
NM_057158chr8----1644 --
NM_058172chr421340 55 ------
NM_058237chr142397 156 ------
NM_058241chr2----11907 --
NM_058241chr2----11907 --
NM_078487chr982320 828 747 722 681 454 248 195 ------
NM_080743chr62975 713 ------
NM_080872chr833988 817 387 ----13762
NM_100264chr101299 ------
NM_100486chr101299 ------
NM_130436chr212622 132 ------
NM_130438chr2121199 709 ------
NM_130468chr151786 ------
NM_130469chr141192 1219 1143 --
NM_130807chr194810 481 132 123 --12097 --
NM_130811chr2011058 11044 ----
NM_130838chr1511419 ------
NM_130839chr1511419 ------
NM_133170chr2012561 ----15713
NM_133177chr111095 1264 ----
NM_133178chr111095 1264 ----
NM_133264chr1753534 3293 2403 1391 782 ------
NM_133329chr221624 138 ------
NM_133445chr9----23132 105 --
NM_133499chrX------123
NM_133510chr14191 ------
NM_133647chr1543612 3374 1360 764 --2283 140 --
NM_134442chr22399 352 --11513 11742
NM_138270chrX23027 219 --1407 --
NM_138290chr71303 ------
NM_138338chr221633 --21336 76 12993
NM_138415chr221345 1671 1450 1432
NM_138423chr1521702 287 --1933 --
NM_138559chr2139 ------
NM_138569chr61262 ------
NM_138576chr1444387 4211 1841 955 ----23919 1486
NM_138638chr1412063 ------
NM_138713chr1617638 ------
NM_138714chr1617638 ------
NM_138731chr14------1139
NM_138782chr51123 ------
NM_138799chr252010 1874 1831 1333 641 ------
NM_138971chr1111130 --23153 2770 --
NM_138971chr1111130 --23153 2770 --
NM_138972chr1111130 --23153 2770 --
NM_138972chr1111130 --23153 2770 --
NM_138973chr1111130 --23153 2770 --
NM_138973chr1111130 --23153 2770 --
NM_139070chr51470 ------
NM_139136chr12--172 ----
NM_139168chr511564 ------
NM_139323chr2011765 ------
NM_144571chr4------26727 5861
NM_144579chr252745 2716 2448 390 283 1893 32708 49 41 --
NM_144632chr212021 ------
NM_144703chr202980 310 ------
NM_144778chr1321688 341 ------
NM_144967chrX21025 932 ------
NM_145004chr8184 ------
NM_145021chr102284 44 ------
NM_145171chr14134 ------
NM_145245chr19----1422 1937
NM_145793chr102793 79 ------
NM_145912chr2264515 3634 3408 3038 2856 1088 1635 2447 401 --
NM_147150chr933359 1458 1156 1674 ----
NM_147175chrX21400 1364 ------
NM_147223chr2----1995 --
NM_147233chr2----1812 --
NM_152227chr20------1555
NM_152247chr222888 277 ------
NM_152280chr143008 2851 2648 1165 --12232 --
NM_152384chr26586 500 426 399 250 184 1646 ----
NM_152417chr83884 872 352 ------
NM_152429chr10--1325 ----
NM_152437chr1222408 762 ------
NM_152470chr1873722 1179 798 422 318 223 156 12517 23046 1212 11005
NM_152527chr2----11825 --
NM_152529chr283466 3238 3104 1238 530 392 349 200 ----1579
NM_152542chr41783 ----1833
NM_152581chrX----1414 --
NM_152586chr1041018 239 106 62 ----1288
NM_152608chr121684 775 21874 1651 ----
NM_152622chr51893 ------
NM_152625chr52287 280 ------
NM_152641chr12--1134 ----
NM_152658chr19123 ----1374
NM_152705chr1311449 ------
NM_152724chr1022368 1099 --22324 1057 12417
NM_152734chr655202 3642 949 793 38 --14855 --
NM_152744chr722783 90 --13416 --
NM_152756chr5----13042 --
NM_152758chr812711 ------
NM_152787chrX32655 1048 321 ------
NM_152788chr12125 ------
NM_152789chr7------11100
NM_152836chr81641 ------
NM_152837chr81641 ------
NM_152856chrX1204 ------
NM_152896chr91715 ------
NM_152924chr1586331 5562 5426 5384 4719 2406 1022 916 1599 14861 15611
NM_152991chr111653 ------
NM_153035chr153174 3039 2995 2294 596 ------
NM_153040chr151283 189 167 --
NM_153182chr312782 --32100 1286 71 --
NM_153188chr534792 1177 190 ------
NM_153211chr182176 140 ------
NM_153235chr61185 ------
NM_153260chr1521098 66 ----11147
NM_153261chr1611398 ------
NM_153273chr322263 590 ------
NM_153347chr112893 883 2451 194 ----
NM_153350chr1631469 1217 68 1599 1141 --
NM_153365chr422713 166 ------
NM_153499chr1252867 2783 1167 1063 857 ------
NM_153500chr1252867 2783 1167 1063 857 ------
NM_153607chr522375 2102 ------
NM_153616chr151291 ------
NM_153617chr151291 ------
NM_153618chr151291 ------
NM_153619chr151565 ------
NM_153649chr12205 76 --12165 --
NM_153675chr20--177 ----
NM_153687chr1211011 ----11060
NM_153690chr31779 ------
NM_153747chr1135 ------
NM_153748chr12--172 ----
NM_153759chr2------11089
NM_170706chr124140 989 --11305 --
NM_172169chr102718 35 ----21564 614
NM_172170chr102718 35 ----21564 614
NM_172171chr102718 35 ----21564 614
NM_172173chr102718 35 ----21564 614
NM_172216chr1252769 2685 1069 965 759 ------
NM_172226chr1252867 2783 1167 1063 857 ------
NM_172344chr221624 138 ------
NM_172373chr1311030 ------
NM_172375chr14----1472 --
NM_173087chr151515 ------
NM_173088chr151515 ------
NM_173089chr151515 ------
NM_173090chr151515 ------
NM_173156chr11148 ----1331
NM_173201chr161224 ------
NM_173214chr1617638 ------
NM_173463chr4--23458 2978 ----
NM_173468chr434862 4318 1175 ----15179
NM_173576chr1032214 2203 71 ------
NM_173582chr1185275 5140 5097 1634 1463 1416 1283 108 11449 25231 1372 --
NM_173602chr121850 ----199
NM_173647chr2----11043 --
NM_173648chr2170 ------
NM_173683chr81484 ------
NM_173808chr113934 14222 ----
NM_173832chr843604 2873 1384 772 12380 42573 2532 2500 2412 12778
NM_174911chr833319 1421 154 --2714 487 --
NM_175575chr1711251 --1206 --
NM_175629chr2------11089
NM_175852chr152817 2673 947 276 78 ----12579
NM_175854chr1322239 68 ------
NM_175863chr611057 ------
NM_175884chr711349 --183 --
NM_176081chr1055653 5625 4904 1971 753 ------
NM_176083chr1055653 5625 4904 1971 753 ------
NM_176863chr1711792 --1372 --
NM_177424chr131655 1611 26 ------
NM_177452chr14----1784 --
NM_177559chr2011110 ------
NM_177560chr2011110 ------
NM_177974chr1521702 287 --1933 --
NM_177985chr21647 ------
NM_177996chr2011001 ------
NM_177999chr973611 3230 2966 2719 2562 1321 52 --11407 1279
NM_178037chr1213446 1762 1791 13624
NM_178038chr1213446 1762 1791 13624
NM_178123chr21914 ------
NM_178426chr111614 1403 ----
NM_178450chr51729 ------
NM_178565chr8--1244 1493 --
NM_178585chr412966 ------
NM_178815chr103945 939 142 ------
NM_178818chr1622210 83 --11903 --
NM_178832chr102173 22 ----188
NM_181054chr14151 ------
NM_181093chr11447 ------
NM_181351chr1122349 572 ------
NM_181453chr221475 437 ------
NM_181504chr543331 2733 1182 368 ------
NM_181523chr543331 2733 1182 368 ------
NM_181524chr543331 2733 1182 368 ------
NM_181645chr11179 ------
NM_181659chr2023030 172 --1712 --
NM_181659chr2023030 172 --1712 --
NM_181672chrX41512 1490 1460 1329 ------
NM_181673chrX41512 1490 1460 1329 ------
NM_181782chr631708 1489 1445 ------
NM_181876chr442345 729 538 407 1580 21695 1011 --
NM_181886chr411216 ------
NM_181887chr411216 ------
NM_181888chr411216 ------
NM_181889chr411216 ------
NM_181890chr411216 ------
NM_181891chr411216 ------
NM_181892chr411263 ------
NM_181893chr411216 ------
NM_182485chr413350 ------
NM_182487chr954306 1508 819 684 550 14406 2850 845 1809
NM_182493chr1641296 1161 694 428 ----13529
NM_182503chr641944 1770 1661 212 25360 1275 14847 --
NM_182511chr18------11327
NM_182515chr1984772 4590 4180 4136 4052 1461 973 929 ----24229 1023
NM_182643chr812286 12140 --1875
NM_182646chr413350 ------
NM_182663chr142108 1641 329 248 11932 1601 --
NM_182664chr142238 1771 459 378 12062 1731 --
NM_182665chr142108 1641 329 248 11932 1601 --
NM_182666chr31230 ------
NM_182688chr212892 845 --11838 11931
NM_182691chr7----1363 --
NM_182692chr7----1363 --
NM_182758chr15125 ------
NM_182831chr1631526 599 500 --11668 11462
NM_182898chr735797 5515 2333 ----14871
NM_182899chr735797 5515 2333 ----14871
NM_182943chr3--179 ----
NM_182948chr112637 ----171
NM_182970chr2064059 3995 3244 2848 672 380 --13578 --
NM_183004chr141337 ------
NM_183043chr13166 ------
NM_183044chr13166 ------
NM_183243chr71640 ------
NM_183243chr71640 ------
NM_184085chr81598 141 ----
NM_184086chr81598 141 ----
NM_184087chr81598 141 ----
NM_194247chr244109 3349 3184 806 --13334 --
NM_194271chr122738 562 ------
NM_194278chr142459 370 ------
NM_194286chr1244445 4165 1406 1294 --14526 14537
NM_194328chr923109 638 ------
NM_194329chr923109 638 ------
NM_194330chr923109 638 ------
NM_194332chr923109 638 ------
NM_197941chr51142 ----1775
NM_197977chr91321 ----1856
NM_198043chr101414 ----1370
NM_198044chr101414 ----1370
NM_198045chr101414 ----1370
NM_198046chr101414 ----1370
NM_198089chr193688 622 569 ------
NM_198128chr182725 501 --12217 --
NM_198158chr312219 ------
NM_198159chr312219 ------
NM_198177chr312219 ------
NM_198178chr312219 ------
NM_198181chr1522352 1912 ----1896
NM_198225chr101207 ------
NM_198256chr231428 1366 827 ------
NM_198291chr2041929 1467 320 314 2512 400 ----
NM_198320chr1244778 3765 3626 1466 1585 23844 3721 21515 633
NM_198404chr132860 614 ------
NM_198544chr12449 218 ------
NM_198597chr10197 ------
NM_198859chr313825 23560 1358 23521 3307 --
NM_199003chr811091 ------
NM_199051chr11342 ------
NM_199131chr1053519 2294 1412 699 508 1779 ----
NM_199160chr931580 370 243 1117 ----
NM_199262chr17--11941 --1516
NM_199324chr423118 2395 ------
NM_199327chr41810 --1900 --
NM_199334chr172437 75 ------
NM_199342chr1------167
NM_199454chr164700 4076 3177 957 752 341 1317 23782 917 --
NM_199462chr154297 3469 1915 872 738 --31871 828 255 21964 921
NM_199478chrX1806 ------
NM_201266chr242939 2654 2085 1127 ------
NM_201279chr242939 2654 2085 1127 ------
NM_201432chr1765548 5509 5325 991 299 72 34357 2422 1413 14844 --
NM_201433chr1765548 5509 5325 991 299 72 34357 2422 1413 14844 --
NM_201568chr11148 ----1331
NM_201569chr11148 ----1331
NM_201613chr12------1675
NM_203283chr41620 ------
NM_203284chr41620 ------
NM_203301chr1421680 249 11373 ----
NM_203305chr941763 1666 382 340 1868 ----
NM_203342chr113557 1614 22723 1177 --
NM_203343chr113557 1614 22723 1177 --
NM_203349chr151727 --11944 --
NM_203403chr93841 173 117 ------
NM_203437chr21115 ------
NM_203453chr911842 --1284 --
NM_203458chr12549 299 ----21536 1378
NM_203463chr221954 1076 24470 4239 ----
NM_205848chr13822 710 63 ----1278
NM_206814chr641444 1372 1237 1194 ----21421 32
NM_206852chr141504 ------
NM_206857chr141504 ------
NM_206876chr253247 2934 2760 1013 669 ------
NM_206907chr5----1982 --
NM_206944chr9----2798 108 --
NM_206945chr9----2798 108 --
NM_206946chr9----2798 108 --
NM_206947chr9----2798 108 --
NM_207005chr1----2524 411 --
NM_207043chr11339 1136 ----
NM_207044chr11339 1136 ----
NM_207047chr11339 1136 ----
NM_207113chr71232 --11273 --
NM_207303chr1043656 1583 790 705 ------
NM_207304chr131228 ------
NM_207317chr51402 ------
NM_207406chr446131 5810 2125 989 ------
NM_212465chr151515 ------
NM_212543chr31117 --1594 --
NM_213589chr2--14160 --1228
NM_213606chr1031952 1818 278 ------
NM_213662chr1731870 864 733 --32313 2226 690 1104