TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4643
miRNA Sequence: GACACAUGACCAUAAAUGCUAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX96115 5994 5815 5314 5149 1642 1125 571 117 21111 575 ----
NM_000176chr593555 3303 3293 2780 2588 2488 1288 269 145 13674 ----
NM_000216chrX32890 750 120 32970 526 39 12494 11269
NM_000297chr441790 1766 828 21 22039 250 --11779
NM_000337chr555617 4246 1830 1264 145 2120 114 2155 127 --
NM_000793chr1485107 5026 4376 3612 1098 989 476 228 24667 4294 23853 274 --
NM_000814chr1574011 3578 2657 1102 802 402 140 2753 192 --1228
NM_000831chr1114898 2481 2421 2353 2234 2220 2120 2063 1970 1938 1749 12084 22376 1945 24601 2365
NM_000899chr1264090 2732 1299 1209 865 855 44314 4299 4293 3466 ----
NM_000926chr1188271 7019 5772 3302 2796 2784 1945 1503 1127 28664 2995 --
NM_001001664chr263800 2993 2956 2915 2794 1528 12935 32946 2924 2870 --
NM_001003652chr18128619 8361 8071 7717 7440 2738 2201 1704 620 470 383 66 37892 1694 306 ----
NM_001003712chr1282884 2611 2496 1629 1025 926 246 207 ------
NM_001004065chr973999 2633 1323 1288 1260 1250 1168 31334 1302 1275 12823 --
NM_001004317chr634157 393 225 33735 724 263 1232 --
NM_001004329chr123386 294 280 2300 272 ----
NM_001004419chr1284291 3563 3148 1824 1580 1361 571 405 13364 ----
NM_001005473chr575104 4494 4487 4477 2352 1235 808 44500 2004 1985 1934 ----
NM_001007023chr1485107 5026 4376 3612 1098 989 476 228 24667 4294 23853 274 --
NM_001007246chr2151372 591 569 493 318 1585 ----
NM_001008220chr5123830 2907 2802 1565 1464 1453 1414 1358 1312 1279 1256 1197 33358 1433 1221 33125 1485 1237 --
NM_001009899chr365561 5485 4544 1195 97 63 21207 1187 ----
NM_001010888chrX42863 1439 1343 1004 11009 13304 12982
NM_001010891chr596106 2643 2359 2093 1562 1544 673 418 64 16156 --16088
NM_001011722chr15379 367 357 350 343 1422 ----
NM_001011722chr15379 367 357 350 343 1422 ----
NM_001012755chrX54965 3480 3279 3090 1549 14993 12028 14984
NM_001013620chr1268320 6642 6118 5885 1645 453 36124 5893 2643 ----
NM_001018074chr593555 3303 3293 2780 2588 2488 1288 269 145 13674 ----
NM_001018075chr593555 3303 3293 2780 2588 2488 1288 269 145 13674 ----
NM_001018076chr593555 3303 3293 2780 2588 2488 1288 269 145 13674 ----
NM_001018077chr593555 3303 3293 2780 2588 2488 1288 269 145 13674 ----
NM_001024094chr593555 3303 3293 2780 2588 2488 1288 269 145 13674 ----
NM_001024401chr1622869 665 32483 2475 2467 22820 1139 --
NM_001025076chr10106049 5966 5623 2285 1170 1126 1024 930 421 209 16119 12420 --
NM_001025077chr10107407 7324 6981 2528 2484 2382 2288 1779 1567 1276 17477 ----
NM_001025108chr294135 4031 3417 2579 1544 1235 807 194 164 33657 3637 198 1153 --
NM_001033117chr363873 1405 958 365 348 128 43305 905 412 354 ----
NM_001039840chrX75286 5274 5127 4841 3799 1755 1637 25382 1736 1231 12226
NM_001040110chr731502 285 270 3321 291 275 11481 --
NM_001040429chr1383102 2710 2657 2416 2365 1364 1301 1000 11071 ----
NM_001042555chr1263348 3251 1821 947 432 131 23256 3245 ----
NM_001042604chr374654 4005 3352 1098 1091 515 198 21615 110 ----
NM_001106chr3139195 8947 8190 8055 7604 7011 6559 6350 6254 3203 2882 1383 560 --13112 --
NM_001113490chrX73566 3280 3251 1233 421 362 163 1852 23498 2399 --
NM_001315chr662068 2012 770 752 152 135 --2745 162 --
NM_002025chrX129119 9066 8306 8253 8174 7080 6460 5668 3671 3301 2713 2396 19077 28291 7896 --
NM_002126chr1793917 3667 1271 969 701 202 196 164 147 13952 23941 179 --
NM_002136chr12------2675 149
NM_002254chr251925 110 104 94 88 21929 1665 22125 117 --
NM_002285chr294135 4031 3417 2579 1544 1235 807 194 164 33657 3637 198 1153 --
NM_002310chr565597 5095 4791 4107 904 153 24825 2480 36268 4115 4090 1366
NM_002336chr1283792 3734 3461 3450 3437 1414 1316 657 --14036 11681
NM_002397chr552090 1683 771 94 44 --1102 12041
NM_002594chr2021804 226 31936 1930 1877 21864 1813 --
NM_002595chr1241632 713 614 394 ----11495
NM_002737chr1776401 5268 5020 4433 1758 1538 747 56684 6581 1852 1544 781 11766 --
NM_002833chr1551357 580 515 208 133 21501 538 --1560
NM_002843chr1163296 3244 1040 1024 961 519 32632 1387 1048 13099 --
NM_002886chr334438 908 887 1894 --1876
NM_002959chr1114390 4262 4213 4139 4096 3867 1515 979 822 672 349 13873 ----
NM_003034chr1287037 3070 2989 2516 2421 1580 1251 56 13030 17620 --
NM_003043chr343601 3273 1519 145 24146 171 2179 158 --
NM_003144chr652274 2261 243 223 116 1804 --1235
NM_003199chr1865672 5512 4861 4384 2161 1976 14866 25198 4165 1965
NM_003247chr641936 1687 665 252 1351 11904 11357
NM_003298chr396038 4884 2045 1723 1545 1319 998 350 85 54103 4097 1245 442 354 14057 --
NM_003340chr431320 1133 284 ----1277
NM_003629chr193386 3256 3206 2936 2907 2175 1365 1237 1039 12459 12981 --
NM_003909chr853040 3016 2820 1226 31 ----12926
NM_003913chr643972 3689 1218 404 14263 1634 11705
NM_003966chr587833 7227 6098 3060 1631 1521 1055 707 ------
NM_003994chr1264090 2732 1299 1209 865 855 44314 4299 4293 3466 ----
NM_004464chr494331 4239 4113 4048 3943 3131 2955 722 528 2700 694 34340 4074 4066 --
NM_004491chr1994347 4003 3053 2742 1149 1079 1066 1055 1037 ------
NM_004504chr241961 352 155 38 1911 --12081
NM_004788chr1162578 2388 938 863 832 402 12003 --12128
NM_005011chr731502 285 270 3321 291 275 11481 --
NM_005188chr11158080 7350 7040 6774 6706 6242 3302 3275 2539 2376 976 723 567 428 395 21633 526 1368 --
NM_005197chr1475181 5062 4366 4038 3759 1958 1729 24823 1799 25687 5228 --
NM_005359chr1896232 5739 5712 5207 4331 2436 1624 471 128 1653 --11491
NM_005400chr232881 1243 1014 13069 12055 12232
NM_005613chr142159 2047 529 434 41906 623 456 444 1134 --
NM_005665chr144857 975 636 307 24079 236 1995 11281
NM_005840chrX127135 7019 6182 6153 5636 4872 2866 2694 2066 1967 824 423 1813 15891 14854
NM_005901chr18128619 8361 8071 7717 7440 2738 2201 1704 620 470 383 66 37892 1694 306 ----
NM_005935chr495129 4649 4102 2012 1996 1876 1695 1362 998 34662 4654 2001 14679 --
NM_005937chr1773778 3237 3181 2900 1508 762 754 11573 32860 1492 778 --
NM_005955chr183761 3518 1281 1117 426 403 303 276 34730 3737 3633 1716 --
NM_006060chr764420 3961 3558 2747 1475 1177 --11278 13492
NM_006080chr752773 2658 2505 1127 101 ----12387
NM_006154chr1541877 698 583 186 --1412 12186
NM_006203chr585534 5035 4458 4227 2111 1002 985 950 --23679 1300 --
NM_006306chrX95558 5019 3929 2073 1619 1596 363 333 318 1337 1356 --
NM_006544chr1465921 5822 5639 2237 2231 956 --15837 --
NM_006561chr10106049 5966 5623 2285 1170 1126 1024 930 421 209 16119 12420 --
NM_006650chr5123830 2907 2802 1565 1464 1453 1414 1358 1312 1279 1256 1197 33358 1433 1221 33125 1485 1237 --
NM_006654chr1263348 3251 1821 947 432 131 23256 3245 ----
NM_006750chr1667799 7714 7297 5048 3007 2783 18050 26149 2566 --
NM_006827chr1453191 2455 2129 1202 701 1660 --1691
NM_007038chr2176059 5386 5104 4699 1930 1614 1331 --1795 14110
NM_007203chr973999 2633 1323 1288 1260 1250 1168 31334 1302 1275 12823 --
NM_012081chr583355 2527 2501 1298 1281 765 749 365 33449 1045 545 ----
NM_012164chr947435 5712 5454 4853 1879 --16944
NM_012382chr554177 3841 3036 513 377 1554 --14421
NM_013261chr4103534 3418 2705 1313 1037 373 361 336 326 310 1318 22723 299 --
NM_013269chr1284218 3490 3075 1751 1507 1288 498 332 13291 ----
NM_013989chr1485107 5026 4376 3612 1098 989 476 228 24667 4294 23853 274 --
NM_014319chr1251654 1600 1326 695 678 51903 709 699 683 541 ----
NM_014331chr487665 7630 7498 7491 6860 6415 1655 289 47291 5687 1685 1661 15231 --
NM_014423chr585353 4635 3572 2000 1077 953 702 663 25496 3683 1131 --
NM_014702chr632681 367 289 11171 2318 302 --
NM_014725chrX41214 1184 1160 365 21218 1178 ----
NM_014747chr145662 1569 410 161 1192 2181 169 --
NM_014819chr532303 978 67 ----11621
NM_014850chr363873 1405 958 365 348 128 43305 905 412 354 ----
NM_014877chr1796569 6416 6284 4991 1963 1733 752 588 196 ----1879
NM_014936chr652248 810 790 782 767 32877 2848 2363 ----
NM_014992chr143237 150 125 1154 --1136
NM_015026chr1274172 1766 1367 1113 741 645 315 21117 502 ----
NM_015071chr586497 6484 5795 5016 4458 4271 1939 1483 25813 5803 ----
NM_015149chr132222 1596 1390 ----21407 293
NM_015192chr2043005 2502 227 186 12348 32652 1073 180 --
NM_015569chr174207 4138 3377 3308 3234 3056 633 34244 3245 3155 23104 95 --
NM_015576chr382792 2771 2638 2118 1934 1173 1062 759 ----12941
NM_015906chr164771 4223 4047 3395 1447 775 34687 1045 945 ----
NM_016009chr154879 3815 3271 810 96 11336 --14527
NM_016083chr662980 2446 1564 1069 550 465 21092 451 1899 11507
NM_016133chr251647 1331 1320 1283 676 11490 21296 125 --
NM_016206chr399001 8866 8065 7989 7304 6303 5872 3321 389 18324 ----
NM_016248chr1362939 2675 1372 1363 684 232 31389 1377 723 --1226
NM_016260chr2117436 7425 7376 6891 6492 5115 4771 2695 1547 1524 447 27440 7395 27417 6172 --
NM_016531chr443791 2912 2856 2677 1666 --14146
NM_016577chr394356 4256 3984 3976 3928 3783 1819 937 626 ----2861 289
NM_016953chr255661 3901 1354 1120 630 15745 --15757
NM_017633chr653473 1144 1035 303 106 43259 2811 1043 1022 --22917 1014
NM_017637chr988918 7845 3547 3298 3038 1480 1188 94 22963 848 --18634
NM_017644chr374616 4482 3614 3586 1991 314 273 ----12051
NM_017714chr206926 324 246 217 206 198 1231 ----
NM_017740chr1661798 1707 1581 611 592 211 --2630 622 --
NM_017848chrX84421 3160 3027 1034 1013 890 880 838 41038 1026 1018 938 ----
NM_017902chr10124903 4708 2202 2032 1726 1719 912 875 865 853 328 263 23914 301 43510 952 934 336 --
NM_018125chr15379 367 357 350 343 1422 ----
NM_018184chr3111950 1913 1836 1828 1771 1421 1367 1349 534 488 134 ----1248
NM_018374chr774861 4545 4128 3674 1935 1878 140 11995 ----
NM_018394chr311377 --21577 1040 11024
NM_018440chr8108178 7670 7639 7376 6291 6023 5895 3183 2968 2044 27720 957 ----
NM_018638chr1275533 5062 4095 3799 284 218 201 11887 ----
NM_019001chr374654 4005 3352 1098 1091 515 198 21615 110 ----
NM_020337chr422530 338 --1856 11136
NM_020734chr1222428 727 32718 1096 273 --22285 1120
NM_020841chr1282884 2611 2496 1629 1025 926 246 207 ------
NM_020858chr1552098 790 568 359 25 22372 255 2578 530 12075
NM_020935chr244295 2877 439 281 24653 285 24032 2967 13315
NM_021629chr344822 1551 1276 435 2441 259 --11481
NM_021912chr1574011 3578 2657 1102 802 402 140 2753 192 --1228
NM_021914chr1452439 1698 899 708 289 11957 1981 --
NM_021961chr1197303 6711 5868 5267 5249 1632 1311 894 51 21208 1198 26823 179 --
NM_022048chr15116055 5805 5797 5410 5377 5364 5346 4680 2465 1210 655 --35458 5399 1718 --
NM_022114chr1104478 3990 1855 1588 1565 1559 1545 827 481 96 --14110 --
NM_022459chr1374822 1955 1629 1544 1532 1078 272 11946 14867 --
NM_022648chr274321 3915 3897 2910 995 583 576 21774 929 44301 3926 3888 671 --
NM_022781chr992474 2025 1132 567 527 452 325 245 202 22503 532 --1491
NM_024947chr389525 7213 6829 6437 3713 3528 3154 275 13672 --29336 3001
NM_024989chr278061 8014 7740 5707 5474 5142 36 58151 7976 7964 2665 1290 11977 --
NM_025090chr179357 279 241 212 185 159 122 78 64 4378 298 273 82 5392 348 321 145 108 2257 228
NM_025248chr17122834 2683 2660 2645 2595 2579 2545 2526 2388 2359 2337 2147 --22707 2435 12539
NM_030647chr755922 4450 4130 484 472 31217 788 100 45933 2436 2318 625 --
NM_030648chr475488 4496 4360 4065 3984 3587 414 1638 --11222
NM_030806chr1118887 8710 7396 6778 6463 6411 6352 3571 3396 2890 1338 --28258 6385 19405
NM_031157chr12------2675 149
NM_031442chrX63206 2763 2543 2336 641 627 ------
NM_032102chr1173071 2594 2432 1168 521 361 179 23017 2386 ----
NM_032121chrX52261 2211 1995 520 511 32624 471 154 2918 61 --
NM_032189chr1373629 3403 3169 3104 1756 540 313 --14297 13347
NM_032373chr1084997 2231 1484 1474 1442 1055 678 80 1760 ----
NM_032505chr342160 1698 864 525 12732 12312 1744
NM_032810chr1051353 1148 373 356 44 21551 392 11325 --
NM_032826chr7115244 4405 4228 4179 3586 1954 1694 1675 1533 1405 1292 34238 1686 1300 ----
NM_032873chr1174363 3724 3488 3349 194 54 42 14200 13596 --
NM_033020chr164771 4223 4047 3395 1447 775 34687 1045 945 ----
NM_033143chr4104662 4570 4444 4379 4274 3462 3286 1053 859 94 21031 1025 34671 4405 4397 --
NM_033181chr662980 2446 1564 1069 550 465 21092 451 1899 11507
NM_052874chr165585 292 286 280 260 --1708 --
NM_133265chrX73566 3280 3251 1233 421 362 163 1852 23498 2399 --
NM_138426chr762468 2282 1709 917 816 765 11734 1207 1810
NM_138459chr652819 2245 190 174 161 33104 2695 1116 ----
NM_138638chr1452439 1698 899 708 289 11957 1981 --
NM_138731chr1423444 1635 34054 684 493 --12769
NM_139012chr662068 2012 770 752 152 135 --2745 162 --
NM_139014chr662148 2092 850 832 232 215 --2825 242 --
NM_144599chr1565518 1851 1575 1194 969 432 1705 25400 1659 --
NM_144973chr1264988 3430 1992 1575 1010 696 24263 221 23842 209 --
NM_147150chr973999 2633 1323 1288 1260 1250 1168 31334 1302 1275 12823 --
NM_152624chr586801 5509 5133 2216 1877 1299 1278 1066 21575 1288 ----
NM_152695chrX62066 1642 749 489 445 437 --1690 --
NM_152734chr695447 5402 4776 4364 3693 1134 1109 1018 940 11820 22015 132 --
NM_153456chr1386121 5608 5554 4118 3899 2461 2023 108 11477 15964 --
NM_153616chr1552098 790 568 359 25 22372 255 2578 530 12075
NM_153617chr1552098 790 568 359 25 22372 255 2578 530 12075
NM_153618chr1552098 790 568 359 25 22372 255 2578 530 12075
NM_153619chr1543336 2504 2448 1263 13610 --13313
NM_170710chr422875 2814 32828 2779 784 12821 --
NM_173511chr273270 1372 1357 782 688 522 120 --13072 --
NM_180989chr1342144 774 741 253 ----12250
NM_181265chr422875 2814 32828 2779 784 12821 --
NM_181358chr183798 3609 3175 3073 1586 1562 1459 1019 33167 1371 1338 12795 --
NM_181504chr573835 3769 3349 3342 3327 3039 2966 43859 3841 3793 3155 12986 --
NM_181523chr573835 3769 3349 3342 3327 3039 2966 43859 3841 3793 3155 12986 --
NM_181524chr573835 3769 3349 3342 3327 3039 2966 43859 3841 3793 3155 12986 --
NM_181782chr682258 2047 1452 884 723 703 555 529 1731 ----
NM_181787chr863319 1348 1175 887 498 329 23800 3713 11413 --
NM_181886chr431320 1133 284 ----1277
NM_181887chr431320 1133 284 ----1277
NM_181888chr431320 1133 284 ----1277
NM_181889chr431320 1133 284 ----1277
NM_181890chr431320 1133 284 ----1277
NM_181891chr431320 1133 284 ----1277
NM_181892chr441367 1180 331 46 ----1324
NM_181893chr431320 1133 284 ----1277
NM_182485chr443284 1386 1062 48 1621 --1924
NM_182646chr443284 1386 1062 48 1621 --1924
NM_182920chr341432 553 185 105 3189 137 127 --184
NM_194247chr294498 4466 4141 1783 1511 793 646 635 612 13052 11128 --
NM_194317chr282662 2452 2309 2073 1976 1824 902 96 12648 32444 2117 21 --
NM_194328chr992474 2025 1132 567 527 452 325 245 202 22503 532 --1491
NM_194329chr992474 2025 1132 567 527 452 325 245 202 22503 532 --1491
NM_194330chr992474 2025 1132 567 527 452 325 245 202 22503 532 --1491
NM_194332chr992474 2025 1132 567 527 452 325 245 202 22503 532 --1491
NM_198268chr183798 3609 3175 3073 1586 1562 1459 1019 33167 1371 1338 12795 --
NM_198269chr183798 3609 3175 3073 1586 1562 1459 1019 33167 1371 1338 12795 --
NM_198273chr562974 2395 501 235 202 37 --22409 2385 13098
NM_198400chr1541877 698 583 186 --1412 12186
NM_198715chr1115986 5537 5306 4599 4551 4194 1323 259 247 159 24 ------
NM_199454chr1104478 3990 1855 1588 1565 1559 1545 827 481 96 --14110 --
NM_213589chr275332 1835 1360 969 669 341 312 5209 203 177 142 130 --1404