TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4646-3p
miRNA Sequence: AUUGUCCCUCUCCCUUCCCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000176chr523033 2895 12380 --13599
NM_000232chr41363 12240 11233 23123 2830
NM_000337chr556434 5622 4695 1117 813 --35229 1869 1361 14063
NM_000633chr1874508 4492 4354 3557 3288 1578 678 ----13999
NM_000719chr1286115 5233 4412 2481 2426 2278 2236 448 25493 2205 26599 2699 --
NM_000809chr478258 7006 6280 2678 2002 1062 927 47581 7360 3491 2357 1259 --
NM_000831chr1124888 4837 4704 2487 1991 1845 1712 1607 1555 1208 690 483 34267 4219 2000 24963 2104 --
NM_000875chr1586236 5458 5278 5100 2291 2258 921 525 --12579 26692 4548
NM_001001664chr233098 1495 154 33517 1627 1291 --1570
NM_001014797chr1047475 5426 2304 235 27130 6520 57650 6872 6673 6454 647 17961
NM_001018074chr523033 2895 12380 --13599
NM_001018075chr523033 2895 12380 --13599
NM_001018076chr523033 2895 12380 --13599
NM_001018077chr523033 2895 12380 --13599
NM_001024094chr523033 2895 12380 --13599
NM_001025076chr1055647 2297 1943 1869 431 35941 3764 1739 --1653
NM_001030055chr1423716 422 21274 37 --1612
NM_001031695chr2275035 5027 4729 3756 2165 2004 723 --31655 439 30 23509 919
NM_001033087chr2063314 3160 2723 1130 847 530 2496 426 --11996
NM_001037165chr7118733 8657 8047 5597 3153 3046 2675 2624 1952 1755 1626 46258 3295 447 390 38682 2823 857 --
NM_001039937chr1353784 3671 3537 1118 778 23793 3380 --13522
NM_001042603chr1265000 4079 631 429 34 24 23298 1637 ----
NM_001106chr3118041 7932 7809 6984 6509 6200 3580 2217 2129 1186 1068 48789 7731 3533 990 13695 --
NM_001173chr1423716 422 21274 37 --1612
NM_001177chr121662 12244 1172 22020 1630
NM_001204chr237302 7219 2173 25259 2227 --16646
NM_001609chr1042992 2854 2749 1701 13159 14082 --
NM_001616chr233470 2426 1068 23217 1231 11288 12508
NM_002957chr9123875 3700 3396 3004 2903 1545 1251 1100 1065 1013 896 121 13618 32547 576 502 --
NM_003482chr1282737 2228 943 654 645 636 292 150 11796 1190 --
NM_004171chr1179185 9132 6308 3354 1901 1791 338 29046 7543 28838 6814 16375
NM_004397chr1122613 1621 --1277 23021 1403
NM_004748chr1551475 1447 1199 1014 809 12914 23255 1109 --
NM_004932chr521726 254 11151 --2378 187
NM_004992chrX168226 8208 8118 7804 7666 7610 6742 6557 6551 6463 5607 2909 895 799 755 620 12631 38294 964 471 1908
NM_004992chrX168226 8208 8118 7804 7666 7610 6742 6557 6551 6463 5607 2909 895 799 755 620 12631 38294 964 471 1908
NM_005819chr133220 2691 228 22472 519 --1574
NM_005920chr1103720 3642 3296 3180 1532 1518 1510 1031 358 288 --23173 2497 1817
NM_006203chr554868 4520 4377 1915 1628 2724 405 --15002
NM_006306chrX85701 5076 4898 4835 4032 3639 2215 878 24208 472 --21078 821
NM_006546chr17136559 4999 4764 4542 2609 2601 2594 1979 1479 1076 948 99 34 14819 36392 4682 2621 12469
NM_006561chr1055647 2297 1943 1869 431 35941 3764 1739 --1653
NM_007050chr2096937 6246 3247 3166 2615 2036 1884 1482 788 26430 5011 11046 35325 5030 1109
NM_007249chr13138192 8056 7865 7129 6750 6705 6259 6117 3043 1941 1462 1374 711 28850 3735 --22850 2297
NM_012141chr1353784 3671 3537 1118 778 23793 3380 --13522
NM_012252chr733700 934 592 31015 973 505 --11842
NM_012296chr1193951 3386 2955 1563 1338 1263 939 663 484 1700 33854 1321 1026 --
NM_012334chr554167 3913 3802 3672 398 --1495 24563 4027
NM_012405chr122963 333 13313 --32624 238 55
NM_013372chr1562695 1332 707 634 628 401 23117 2835 12302 --
NM_014141chr73944 338 25 14540 11370 2531 64
NM_014283chr12299 213 --1407 1265
NM_014309chr2275025 5017 4719 3746 2155 1994 713 --21645 429 23499 909
NM_014747chr1115461 5197 4787 4645 4563 2262 1886 1731 1558 398 357 22090 1512 24793 4751 14156
NM_014932chr331735 452 369 ----2750 589
NM_015375chr155008 4032 1992 346 162 ----23645 468
NM_016131chr252079 1733 1650 1442 397 1653 --1838
NM_016227chr12299 213 --1407 1265
NM_016946chr133598 3530 3519 1970 13573 22967 2899
NM_017415chr564050 1578 1443 959 544 508 11045 23776 281 1657
NM_017754chr664421 3638 3295 531 341 182 41390 1225 189 68 ----
NM_018085chr1108130 7496 7200 6962 5805 5551 5541 2967 1850 886 ----17337
NM_018440chr841374 893 641 221 12820 28240 8097 28285 3407
NM_020440chr142417 1269 63 31 --32796 825 52 11017
NM_020739chr1551475 1447 1199 1014 809 12914 23255 1109 --
NM_020772chr1788327 5877 2753 1246 673 371 125 61 25363 543 --12803
NM_022648chr294099 3978 3799 3602 3494 3480 2980 1486 488 ----33289 1746 740
NM_023012chr121223 ----2696 282
NM_024345chr945133 4135 2072 1432 35120 4532 3746 --15662
NM_024837chr1541663 1187 547 99 2360 222 11726 1620
NM_024989chr277732 7440 1871 1722 1494 236 85 16283 --16766
NM_025179chr163755 3172 1701 1468 1403 75 13823 24645 286 14274
NM_030806chr1118537 7930 7427 6946 6935 6137 3601 3487 2598 1657 942 19144 27256 2809 13064
NM_030945chr562592 2153 2124 1888 451 160 --1440 --
NM_033224chr787732 6962 5860 5166 4939 344 307 175 --23012 576 --
NM_033505chr265971 5826 5022 2667 1316 121 31769 1332 444 --12676
NM_053023chr1133242 2024 21 164 129 --
NM_080491chr1193951 3386 2955 1563 1338 1263 939 663 484 1700 33854 1321 1026 --
NM_080676chr2063314 3160 2723 1130 847 530 2496 426 --11996
NM_133170chr2096937 6246 3247 3166 2615 2036 1884 1482 788 26430 5011 11046 35325 5030 1109
NM_145912chr2273326 3218 1836 1613 657 103 50 13132 31846 1824 1129 3733 609 563
NM_152263chr185164 4751 4454 3984 1672 1218 1008 782 --12037 14532
NM_153367chr1063369 3276 2802 920 697 501 --23358 2417 23484 263
NM_173595chr12115055 4849 4839 4340 4063 3838 1575 1414 1327 1116 518 --24647 3766 13708
NM_175624chr1277803 5970 5800 5487 2547 2408 795 27205 1842 15788 --
NM_175625chr1277803 5970 5800 5487 2547 2408 795 27205 1842 15788 --
NM_181504chr523553 556 --11572 23584 316
NM_181523chr523553 556 --11572 23584 316
NM_181524chr523553 556 --11572 23584 316
NM_182503chr685121 4873 2032 1913 1610 835 789 46 11757 1689 13928
NM_182830chr1412287 ----21928 162
NM_194286chr12105936 4161 1984 1869 1735 1467 1110 826 600 577 13862 11845 1709
NM_198261chr121223 ----2696 282
NM_198262chr121223 ----2696 282
NM_198465chrX2286 277 32583 2181 2103 32658 2287 376 12481
NM_199462chr155008 4032 1992 346 162 ----23645 468
NM_207406chr466283 5751 5211 4222 2208 1306 24552 1748 1401 26550 1708