TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4646-5p
miRNA Sequence: ACUGGGAAGAGGAGCUGAGGGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1292366 1979 1614 934 910 820 520 328 275 1335 --12060
NM_000046chr5113139 2787 2622 2524 2232 1931 1190 935 290 245 58 ------
NM_000051chr1183229 2752 1434 1341 1161 672 407 257 --31202 1104 566 --
NM_000052chrX53179 2200 877 760 100 --33040 803 206 --
NM_000074chrX4779 677 625 359 ----1917
NM_000084chrX186728 5810 5215 5096 5032 4743 2100 1901 1805 1773 1761 1674 1558 1535 1096 820 130 87 --46549 2539 1752 749 --
NM_000092chr294122 3762 3363 3143 2971 2877 2782 1533 499 2867 648 33617 1800 44 3283 142 63
NM_000109chrX51925 931 914 755 110 ----1851
NM_000112chr594837 4258 4237 4048 3716 2216 1851 1520 842 22026 1659 35253 1264 66 15133
NM_000125chr6134273 3683 3666 3571 3377 3364 3269 1539 1288 876 712 497 269 --21231 902 --
NM_000138chr1552261 552 305 265 202 12426 1194 --
NM_000163chr561942 1886 1870 1611 199 139 12264 ----
NM_000168chr772301 2173 2067 1087 973 502 427 --22205 748 --
NM_000176chr553250 3113 2772 1170 634 33222 1046 248 --13390
NM_000202chrX83810 3596 3463 3256 2875 2523 2461 44 11028 32441 1277 1158 13164
NM_000208chr19144676 4120 3932 3786 3612 3523 1401 729 615 453 223 126 86 37 23351 1576 --14201
NM_000212chr1741941 1900 743 483 31512 415 267 1470 --
NM_000217chr12104919 4401 4302 4189 4178 3662 3455 1998 1769 770 13527 24054 3361 --
NM_000248chr342021 1928 1008 456 --12589 12060
NM_000259chr15106373 5744 5399 5045 4971 4161 2485 2250 1207 1072 25083 2419 54848 4628 2476 1940 65 11471
NM_000264chr933306 3289 2877 11177 --166
NM_000267chr17103292 2945 2863 2827 2393 2314 2194 2142 1053 901 12164 --1954
NM_000297chr461683 1345 824 421 388 194 --31560 357 293 --
NM_000330chrX102270 1799 787 725 553 452 441 401 324 298 --1856 --
NM_000332chr6126913 6885 6093 5561 5453 4894 2535 2326 1796 1064 509 181 --16623 25804 1972
NM_000335chr392197 1816 1568 1528 810 632 455 375 266 1789 --12121
NM_000337chr5155978 5791 5126 4972 4875 4585 4263 2633 2128 1884 1284 1129 876 450 273 ----12317
NM_000351chrX74041 3762 2912 2877 1718 938 828 ----12646
NM_000362chr2263408 2938 2837 353 223 39 23017 390 --2967 72
NM_000368chr954694 1357 886 458 377 --31666 1039 88 1623
NM_000390chrX32225 1271 937 153 22934 260 --
NM_000391chr1171733 1670 493 455 432 390 294 11368 21726 598 11274
NM_000393chr252107 1907 1610 716 599 ------
NM_000408chr252771 1098 950 733 231 22193 667 21156 515 --
NM_000411chr2183196 2972 2455 2111 1316 1310 1218 673 --12031 11198
NM_000428chr1472460 2223 1869 1746 976 143 113 --3944 363 76 --
NM_000430chr1793433 2975 2790 2747 2655 2366 1518 758 667 13725 33364 3098 1313 --
NM_000439chr582167 2060 2018 2012 1905 1642 973 322 1188 2855 770 1816
NM_000448chr1193254 3190 2709 2670 2223 2007 1097 843 72 12345 12140 --
NM_000449chr181408 1358 1046 586 520 459 98 79 --11105 --
NM_000451chrX81860 1811 1355 724 564 517 160 36 22101 393 1711 --
NM_000452chr1351771 1615 1582 1519 194 --1353 1276
NM_000461chr3104362 4010 3630 2913 1792 1141 792 747 526 29 ----13070
NM_000462chr1531806 1687 111 --11295 11271
NM_000480chr1151631 1314 1120 259 251 ------
NM_000533chrX72016 1707 1441 797 750 335 257 11487 ----
NM_000544chr6_cox_hap1113286 3244 3125 2476 2251 2238 1292 1130 746 500 482 12811 130 13307
NM_000555chrX157886 7844 7485 7126 7114 7011 6979 6669 5582 5448 5003 3151 3040 2758 247 12054 15550 15737
NM_000574chr181069 1048 1003 967 862 352 329 249 --151 --
NM_000609chr1073140 3031 2919 2642 1216 709 274 12995 22751 2732 --
NM_000610chr11102656 2344 2118 2099 1090 923 819 444 249 243 1804 1359 11932
NM_000615chr1192959 2953 2811 2616 2442 1073 1064 584 67 11991 21961 720 --
NM_000618chr12115076 4700 4679 2619 2466 2174 2027 1488 1187 820 654 --11987 12577
NM_000618chr12115076 4700 4679 2619 2466 2174 2027 1488 1187 820 654 --11987 12577
NM_000620chr1242041 2012 1524 246 21536 1434 12005 21505 741
NM_000633chr18114056 3194 2035 1964 1826 1671 1541 1264 997 665 377 14207 ----
NM_000719chr12196564 6002 5781 5531 5003 4448 4303 4158 2639 2633 1986 1920 920 612 458 309 254 224 48 15308 25274 792 --
NM_000721chr152309 990 895 872 313 12092 --12464
NM_000726chr251065 1052 977 345 316 --11380 --
NM_000788chr441062 981 259 228 137 ----
NM_000793chr1494280 3858 3214 1422 1114 1085 556 532 441 34318 4028 892 35034 3341 1220 --
NM_000794chr541061 163 151 128 --2918 399 --
NM_000806chr571832 1786 1221 538 351 74 59 ------
NM_000809chr4179141 8410 8215 7978 7945 7829 7803 7779 6435 5621 3418 3230 2588 2069 1433 732 116 26806 2662 38508 8108 377 --
NM_000813chr595020 4752 4555 4494 2133 2081 1907 882 507 14223 2712 204 11057
NM_000814chr1554072 3888 3298 3028 911 23916 1242 33805 3012 151 --
NM_000831chr1166211 6059 5497 5232 5119 5019 4117 2503 1815 1696 1416 974 806 707 267 169 25296 4715 35947 4036 1203 11808
NM_000833chr163968 381 337 ----21546 1014
NM_000834chr1261245 405 268 242 153 99 --11056 --
NM_000868chrX92619 2577 2170 1633 878 842 797 339 25 1831 ----
NM_000870chr571557 1497 1424 1162 289 224 163 2613 403 11340 1242
NM_000872chr1071300 1078 616 399 312 299 205 1237 1182 1491
NM_000875chr15106851 6345 4850 4841 4750 4616 2221 1690 960 814 15959 42680 1407 1138 1011 --
NM_000877chr2103088 2233 1194 1154 1108 917 791 774 393 258 11213 12677 --
NM_000891chr1773633 3601 3568 3197 1451 1141 263 ----23207 2933
NM_000899chr1294050 3773 3507 2848 1670 1434 1253 948 465 1317 14006 --
NM_000902chr3103180 3170 3082 2915 2899 2753 2176 2137 275 218 1164 23205 2863 --
NM_000950chrX73548 3408 2604 2419 1452 1035 872 13324 1775 --
NM_000961chr2083767 3334 3279 1411 1276 995 228 68 2345 135 3708 615 361 --
NM_000962chr972323 2284 1130 1120 1017 727 231 42626 374 184 53 13073 --
NM_000963chr131710 1615 366 1847 11676 --
NM_000965chr341276 1142 196 47 --1989 --
NM_001001323chr1222109 599 ----12687
NM_001001331chr382305 2295 2183 1755 1680 501 253 148 --12417 --
NM_001001389chr11102656 2344 2118 2099 1090 923 819 444 249 243 1804 1359 11932
NM_001001390chr11102656 2344 2118 2099 1090 923 819 444 249 243 1804 1359 11932
NM_001001391chr11102656 2344 2118 2099 1090 923 819 444 249 243 1804 1359 11932
NM_001001392chr11102702 2390 2164 2145 1136 969 865 490 295 289 1850 1405 11978
NM_001001433chr20103223 3017 2829 2810 2601 2389 2235 1229 568 44 12114 1498 --
NM_001001481chr843421 3260 869 23 --11334 --
NM_001001549chr742207 1841 1082 931 12506 1605 1532
NM_001001550chr742207 1841 1082 931 12506 1605 1532
NM_001001555chr742207 1841 1082 931 12506 1605 1532
NM_001001669chr562567 2349 987 673 591 446 12196 42004 1875 1695 755 --
NM_001001684chr1742588 2478 1831 870 1792 --1228
NM_001001701chr431793 1488 492 --22310 194 22230 2011
NM_001001890chr2143001 2765 746 95 34076 3480 1142 --1315
NM_001001938chr9154041 3720 3462 3119 3078 2746 2615 1589 1441 1213 1171 1057 202 130 120 13555 23802 2900 1687
NM_001001995chrX2535 162 --11590 1683
NM_001002233chr841866 1814 1579 196 --12003 22158 542
NM_001002838chrX31170 322 141 --1311 11280
NM_001002860chr1493908 3201 3189 2968 1373 998 717 600 553 --13571 --
NM_001002909chr1782073 1850 1754 1738 1664 1538 594 529 32144 669 647 32121 1390 435 --
NM_001002919chr21524 ----1405
NM_001002926chr762506 2272 1923 1847 952 256 ----22586 2080
NM_001003406chr22103222 3180 2967 2541 2511 2303 1304 1227 431 191 1322 ----
NM_001003652chr18177587 6846 6642 6361 6297 6109 5700 3068 2398 2208 1682 1051 748 742 727 448 160 25292 2335 68695 8042 7342 7201 6317 3012 --
NM_001003665chr183150 3118 3026 2864 2754 2616 2580 2524 13395 2915 170 --
NM_001003674chr18166904 6389 5816 5194 4407 4350 2440 2345 2222 2180 2010 1933 1407 1199 1128 863 --26881 4376 --
NM_001003675chr18166904 6389 5816 5194 4407 4350 2440 2345 2222 2180 2010 1933 1407 1199 1128 863 --26881 4376 --
NM_001003681chr2231848 581 367 --21639 1390 11368
NM_001003712chr1253986 3299 2459 1586 1170 --13155 --
NM_001003792chr3175 --11137 1246
NM_001003793chr3175 --11137 1246
NM_001003800chr982761 2746 1178 1141 776 679 444 182 12517 23372 1165 11116
NM_001003943chr1593555 3195 3020 1518 1189 1171 504 407 267 --1571 1367
NM_001004065chr963983 3645 3388 1571 439 238 11347 ----
NM_001004308chrX51135 619 485 437 40 21458 511 ----
NM_001004330chr1241893 570 558 552 ----11401
NM_001004419chr1274571 4279 4236 3946 2806 1465 1332 ----14073
NM_001005366chr123794 622 122 --1823 1876
NM_001005375chrY51828 1526 1474 153 98 --11184 --
NM_001005386chr252239 2088 715 287 276 1922 ----
NM_001005404chr1784492 4267 4193 3520 2923 1717 1028 62 --11557 13192
NM_001005473chr5186319 6238 6208 5386 5300 4923 4874 4837 4694 4335 4033 4017 2601 2294 564 198 85 21 11147 35700 1668 325 15989
NM_001005502chr12145238 4927 4903 4296 4284 4275 3748 3609 1848 1694 1449 1311 439 143 14324 --1778
NM_001005609chrX113466 2568 2489 2450 2418 2323 1423 1084 976 939 604 21093 62 1808 1178
NM_001005746chr251065 1052 977 345 316 --11380 --
NM_001005747chr251065 1052 977 345 316 --11380 --
NM_001005845chr881712 1702 694 610 326 287 228 41 1218 ----
NM_001006617chr931323 941 488 ----1532
NM_001006619chr931323 941 488 ----1532
NM_001006620chr931323 941 488 ----1532
NM_001006621chr931323 941 488 ----1532
NM_001006623chr232070 1800 177 21912 733 --12058
NM_001006636chr21679 --1822 2223 58
NM_001007023chr1494280 3858 3214 1422 1114 1085 556 532 441 34318 4028 892 35034 3341 1220 --
NM_001007024chr1784361 4281 4166 3388 3042 720 467 301 --22807 848 --
NM_001007025chr1784361 4281 4166 3388 3042 720 467 301 --22807 848 --
NM_001007094chr1084237 3402 3130 3010 1800 1343 1021 94 31761 1393 1052 23050 609 --
NM_001007097chr9204991 4959 4932 4851 4586 4532 4485 4203 3640 3594 3515 3507 3340 3145 1959 1900 1820 1793 219 98 ----13559
NM_001007156chr1581919 1859 1843 1582 1533 1475 1265 434 1580 21835 230 --
NM_001007226chr1751181 948 459 437 287 ----137
NM_001007227chr1751181 948 459 437 287 ----137
NM_001007228chr1751181 948 459 437 287 ----137
NM_001007229chr1751181 948 459 437 287 ----137
NM_001007230chr1751181 948 459 437 287 ----137
NM_001007466chr6144968 4504 4068 3878 3223 1915 1897 1477 1136 1109 997 688 538 28 11967 21592 41 11809
NM_001007559chr1882030 1708 1684 1499 1434 699 607 359 ------
NM_001008220chr5103787 3609 3349 3133 980 911 870 478 365 176 23277 2621 --12544
NM_001008392chr373380 3334 2700 2640 953 388 351 --13532 1457
NM_001008405chr751589 1487 1413 1201 706 --21804 1297 --
NM_001008408chr7196439 6058 5936 5608 5592 4022 2407 2270 1806 1780 1681 1606 1458 1431 1374 1025 942 775 441 66208 5584 3898 1505 1383 162 2641 470 1682
NM_001008410chr251936 1628 880 857 848 ----1757
NM_001008495chr831539 506 362 --12198 1441
NM_001008738chr5102929 2898 2381 2359 2255 1893 1869 1092 755 483 ------
NM_001008801chr1962107 1959 1859 1550 1526 1357 --11443 --
NM_001008925chr453041 2854 2646 1409 734 ------
NM_001009899chr3125373 5201 4983 4579 2305 2268 1418 1394 552 259 244 226 --24150 2438 --
NM_001009909chr1153372 3195 2983 1237 292 1156 22469 370 --
NM_001009959chr221679 25 2887 604 1574 11609
NM_001010000chr18103276 2364 1255 965 816 787 745 706 193 98 32661 1266 243 43172 2564 300 110 21227 1109
NM_001010861chr172716 2703 2664 821 566 496 306 12051 12691 --
NM_001010867chr1176581 6282 6209 5702 5393 5343 4529 4073 2078 2071 1789 1712 815 479 469 121 76 22325 1507 46595 4394 1748 1584 16185
NM_001010888chrX64179 3863 3201 1678 1417 534 1356 23784 3147 --
NM_001010891chr5116935 6552 5774 5723 5658 5637 5171 2612 2310 1621 1598 36310 2333 782 15920 25763 4635
NM_001010895chr951977 699 422 324 183 ------
NM_001010898chr173538 3290 2410 1170 692 207 154 --43218 2656 910 295 21349 889
NM_001010984chr172469 2077 1939 1619 585 395 187 11687 ----
NM_001010986chrX72499 1886 1835 701 428 393 44 --22071 751 --
NM_001011513chr4143980 3949 3797 3590 3523 3120 2803 2739 1530 1168 924 689 554 132 ----13874
NM_001011666chr795957 5590 5127 4515 2358 1264 1241 619 492 1472 25183 2447 14469
NM_001011708chr272887 2735 2695 2681 2305 1138 883 ------
NM_001012267chr961632 1496 1456 1436 1260 514 21716 690 --11208
NM_001012393chr1184921 4576 4339 3587 3366 3218 3131 309 --24542 165 11229
NM_001012420chr1532792 953 845 --1878 12550
NM_001012423chr1532792 953 845 --1878 12550
NM_001012426chr693347 3085 2997 2899 2631 2128 1077 443 143 23283 48 12116 --
NM_001012427chr693347 3085 2997 2899 2631 2128 1077 443 143 23283 48 12116 --
NM_001012755chrX104426 3792 3752 2015 1249 1088 1041 1009 503 138 23076 1274 --1448
NM_001013031chr10122915 2722 2671 2500 1334 1212 1106 987 908 866 668 466 22925 1248 23100 854 --
NM_001013438chr3----1171 1880
NM_001013690chr1272114 2050 1752 1625 1581 1563 218 2938 746 --11792
NM_001014797chr10137182 2914 2908 2782 2481 2327 2043 1462 1147 997 984 784 137 31422 1068 22 37841 5522 5200 17044
NM_001015045chr462214 1839 1561 532 290 151 --1955 --
NM_001015048chr1441303 1264 190 104 --23125 1039 --
NM_001015049chr1441303 1264 190 104 --23125 1039 --
NM_001015880chr1041420 1059 459 89 1289 1352 --
NM_001015881chrX61248 1227 1193 410 363 269 --159 --
NM_001017368chr1742435 2010 886 112 12221 21126 165 22764 288
NM_001017395chr393355 3011 2995 2968 2494 2388 1160 803 532 1427 13640 --
NM_001017440chr7227960 7415 7396 7134 7102 6414 6150 5584 2839 2758 2650 2520 2495 2012 1681 1524 1438 738 657 490 323 258 36424 3302 2928 37049 6110 5886 33244 1353 689
NM_001017923chr1441538 1411 1094 623 151 ----
NM_001018053chr141860 1331 613 425 ----11781
NM_001018065chr9215910 5490 5425 5329 5208 4999 4905 4848 4830 4553 4384 4376 4197 3974 3888 2261 2220 1678 816 654 171 24173 2012 34899 934 374 --
NM_001018066chr9215910 5490 5425 5329 5208 4999 4905 4848 4830 4553 4384 4376 4197 3974 3888 2261 2220 1678 816 654 171 24173 2012 34899 934 374 --
NM_001018067chr1114653 4056 4032 2065 1857 1595 1528 1288 755 581 304 --34864 1940 1894 23455 1190
NM_001018068chr1114653 4056 4032 2065 1857 1595 1528 1288 755 581 304 --34864 1940 1894 23455 1190
NM_001018069chr1114653 4056 4032 2065 1857 1595 1528 1288 755 581 304 --34864 1940 1894 23455 1190
NM_001018074chr553250 3113 2772 1170 634 33222 1046 248 --13390
NM_001018075chr553250 3113 2772 1170 634 33222 1046 248 --13390
NM_001018076chr553250 3113 2772 1170 634 33222 1046 248 --13390
NM_001018077chr553250 3113 2772 1170 634 33222 1046 248 --13390
NM_001020658chr141549 1275 1073 31 ----11531
NM_001020658chr141549 1275 1073 31 ----11531
NM_001024094chr553250 3113 2772 1170 634 33222 1046 248 --13390
NM_001024401chr1672773 1881 1004 963 934 907 853 32508 1823 354 --22553 2186
NM_001024647chr12207597 7412 7239 6063 6049 6002 5964 5687 5604 5590 5298 5164 5097 4854 4788 2889 2117 421 208 84 1623 26502 5982 --
NM_001024649chr522774 62 --21980 1048 21870 695
NM_001024680chr291720 1585 1458 1230 633 601 572 253 25 ----1662
NM_001024847chr372528 2293 2174 1663 1541 974 940 --32535 664 403 --
NM_001024948chr142489 1002 542 459 --12856 --
NM_001025076chr10175354 5190 5004 4923 4695 4658 4599 4185 3944 1956 1899 1818 1691 1670 1513 582 352 1957 22013 396 11114
NM_001025077chr10156712 6548 6362 6281 6053 6016 5957 5543 5302 4777 3028 2871 1940 1710 551 12315 11754 12472
NM_001025079chr383490 3103 2600 1585 1172 623 313 289 ----2844 664
NM_001025108chr284053 4039 954 679 368 251 242 83 13185 1711 13940
NM_001025266chr3124866 4847 4687 4515 4234 3968 3803 3411 1514 1247 741 75 --11958 14472
NM_001025389chr1151631 1314 1120 259 251 ------
NM_001025390chr1151631 1314 1120 259 251 ------
NM_001025580chrX94098 3481 3315 2998 1389 615 365 334 294 --21705 50 --
NM_001025603chr181408 1358 1046 586 520 459 98 79 --11105 --
NM_001029858chr652997 2941 2410 2058 1258 12651 1513 1884
NM_001029859chr1162277 2150 1746 1575 782 36 --2840 285 1545
NM_001029863chr643117 2591 745 207 12377 ----
NM_001029871chr2061714 1635 593 250 124 30 1653 1430 1472
NM_001029875chr572807 2427 2185 2078 2015 1199 988 --22617 2402 11187
NM_001029998chr461188 887 562 389 238 174 ----1916
NM_001030007chr16123836 3742 3678 3501 3088 2756 2623 2546 1186 893 762 138 ------
NM_001030287chr141179 1171 164 109 1260 --11103
NM_001031623chr64661 447 431 325 11457 1255 --
NM_001031679chr12113537 3284 2576 2497 2260 2214 1016 838 704 656 524 32936 2486 2295 22866 2528 --
NM_001031680chr182155 2038 1614 888 677 643 134 123 32439 2098 370 12069 --
NM_001031681chr1782218 2170 2136 1841 1809 1463 699 675 32260 2057 1950 --31662 371 53
NM_001031690chr7112927 2258 2119 2087 1926 1229 1139 436 378 350 126 --11940 --
NM_001031695chr22105171 4608 4215 4004 3923 1563 1286 1125 699 287 43401 1223 753 713 25111 4505 --
NM_001031732chr472998 2972 2895 2446 1181 726 619 1304 ----
NM_001031740chr161747 1576 1441 1273 225 171 --1444 11135
NM_001031804chr1683987 3759 2924 1149 878 582 559 374 ------
NM_001031812chr5----21979 417 1301
NM_001032296chr1362499 2374 966 915 280 217 1190 11841 --
NM_001032999chr20125092 4800 4772 4606 4489 2101 1961 1452 1268 712 670 530 44229 4189 924 562 44481 3424 1261 745 --
NM_001033045chr2164096 4020 3951 3854 3834 3698 3221 3087 2713 1379 1221 1151 1017 513 376 285 ------
NM_001033047chr492631 2295 2032 2021 1950 1775 1674 58 51 ------
NM_001033087chr2072529 2502 2366 1254 917 681 561 11224 --1618
NM_001033117chr374060 4046 3699 3572 3459 1665 1603 41496 1277 753 693 24608 84 --
NM_001033551chr17113849 3714 3645 3366 1584 1436 1242 1184 259 142 115 44060 3945 3824 2590 33879 990 402 --
NM_001033576chr1792743 2563 2505 2298 985 973 924 520 503 --32781 2332 945 1245
NM_001033578chr852071 1778 759 625 467 ----12390
NM_001033602chr1372449 2431 2359 2230 1031 836 125 1850 2655 508 --
NM_001034841chr16115427 4926 4863 4744 4462 4045 3926 2147 2033 542 48 34781 3637 665 23710 1854 --
NM_001034954chr1052953 2486 2455 906 778 --1429 --
NM_001034955chr1052953 2486 2455 906 778 --1429 --
NM_001034956chr1052953 2486 2455 906 778 --1429 --
NM_001034957chr1052953 2486 2455 906 778 --1429 --
NM_001035511chr142014 732 597 430 ----1570
NM_001035512chr152121 839 704 537 30 ----1677
NM_001035513chr152121 839 704 537 30 ----1677
NM_001037174chr281780 1760 406 251 235 198 185 173 1513 ----
NM_001037317chr172716 2703 2664 821 566 496 306 12051 12691 --
NM_001037332chr592559 2154 944 913 743 587 559 335 285 41931 1886 1861 403 ----
NM_001037333chr592559 2154 944 913 743 587 559 335 285 41931 1886 1861 403 ----
NM_001037553chr2165077 2078 1653 648 497 203 14181 14780 --
NM_001037954chr1183239 2831 2690 2419 2357 2351 1186 418 ------
NM_001038707chr172026 2020 2008 1960 1727 748 521 22147 1578 31702 637 51 --
NM_001038707chr172026 2020 2008 1960 1727 748 521 22147 1578 31702 637 51 --
NM_001039199chr20113787 3629 1638 1421 1288 1010 806 769 711 682 235 14246 1366 --
NM_001039395chr942341 2073 658 644 --11966 --
NM_001039538chr292936 2283 1459 1306 1298 1243 1188 749 189 ------
NM_001039570chr22154694 4458 4438 4183 4143 4067 3085 2931 1516 1382 1230 924 789 697 477 --13475 --
NM_001039571chr22154694 4458 4438 4183 4143 4067 3085 2931 1516 1382 1230 924 789 697 477 --13475 --
NM_001039577chr174393 3142 2876 1802 1448 738 499 43158 2815 2740 701 21167 1149 --
NM_001039590chrX84014 3930 3454 2910 1167 1156 1044 104 --33440 3223 2518 --
NM_001039591chrX84014 3930 3454 2910 1167 1156 1044 104 --33440 3223 2518 --
NM_001039618chr1154357 1199 357 308 275 14413 21658 1512 --
NM_001039690chr1681924 955 875 598 450 335 293 194 11816 3687 258 216 11478
NM_001039709chr20125092 4800 4772 4606 4489 2101 1961 1452 1268 712 670 530 44229 4189 924 562 44481 3424 1261 745 --
NM_001039762chr1062053 1981 1937 682 609 68 ------
NM_001039802chr151366 1320 1312 1281 184 ----2956 550
NM_001039840chrX166061 5580 5534 5045 4917 3755 3665 2123 1879 1667 1503 1159 890 868 849 42 24122 808 14296 14137
NM_001039937chr1353877 3572 2710 1022 144 --13198 12973
NM_001039960chr1241384 483 400 303 21169 83 --1312
NM_001040102chr10112455 2094 2009 1954 1721 777 767 473 348 321 256 22078 190 12289 --
NM_001040103chr10112455 2094 2009 1954 1721 777 767 473 348 321 256 22078 190 12289 --
NM_001040142chr262001 1926 1889 883 574 21 --11659 --
NM_001040143chr262001 1926 1889 883 574 21 --11659 --
NM_001040144chr1681924 955 875 598 450 335 293 194 11816 3687 258 216 11478
NM_001040146chr1681924 955 875 598 450 335 293 194 11816 3687 258 216 11478
NM_001040152chr783873 1832 1796 1767 1749 1393 1207 354 11858 21440 652 --
NM_001040157chr452212 2035 1171 532 237 ----11830
NM_001040172chr571557 1497 1424 1162 289 224 163 2613 403 11340 1242
NM_001040173chr571557 1497 1424 1162 289 224 163 2613 403 11340 1242
NM_001040202chr441828 869 653 83 31673 830 759 1885 1589
NM_001040272chr952193 2136 1914 838 732 --11570 1409
NM_001040284chr16105670 4877 4349 3884 3734 3696 3615 1094 967 305 --44127 693 605 133 --
NM_001040409chr23882 334 190 ----1945
NM_001040429chr1343474 2503 2297 160 1367 12283 --
NM_001040441chr1135172 5036 4618 4483 4359 3884 3350 2202 1795 1662 1600 941 627 25383 283 11163 --
NM_001040619chr171629 1621 1141 614 559 161 95 ----21553 1032
NM_001040624chr832060 1854 492 32267 2220 832 12352 11010
NM_001040625chr832060 1854 492 32267 2220 832 12352 11010
NM_001040626chr832060 1854 492 32267 2220 832 12352 11010
NM_001040627chr832060 1854 492 32267 2220 832 12352 11010
NM_001040628chr832060 1854 492 32267 2220 832 12352 11010
NM_001040629chr832060 1854 492 32267 2220 832 12352 11010
NM_001040630chr832060 1854 492 32267 2220 832 12352 11010
NM_001040653chr342574 2413 1791 191 21705 347 12061 --
NM_001040665chr7115035 4943 4776 4323 4167 4121 4047 1827 803 783 502 11114 ----
NM_001040709chr182135 2088 1989 777 181 171 63 25 --1354 --
NM_001040712chr973344 1136 1039 633 431 393 161 --22786 2740 12663
NM_001042361chr1061377 996 619 595 460 257 --2402 267 --
NM_001042364chr1061377 996 619 595 460 257 --2402 267 --
NM_001042365chr1061377 996 619 595 460 257 --2402 267 --
NM_001042383chr392862 2792 2148 1391 1134 960 485 243 199 --11100 --
NM_001042387chr1061377 996 619 595 460 257 --2402 267 --
NM_001042388chr18------2334 231
NM_001042393chr1061377 996 619 595 460 257 --2402 267 --
NM_001042396chr1061377 996 619 595 460 257 --2402 267 --
NM_001042397chr1061377 996 619 595 460 257 --2402 267 --
NM_001042404chr121387 553 ----11261
NM_001042413chr963498 1588 1445 1359 1250 1035 22537 1635 23192 558 --
NM_001042424chr492836 2298 1101 855 747 582 576 419 371 ----12855
NM_001042437chr24764 246 169 155 --3881 841 682 --
NM_001042492chr17103292 2945 2863 2827 2393 2314 2194 2142 1053 901 12164 --1954
NM_001042494chr1573745 3673 3631 2912 2406 1522 1387 1376 ----
NM_001042495chr1573745 3673 3631 2912 2406 1522 1387 1376 ----
NM_001042496chr1573745 3673 3631 2912 2406 1522 1387 1376 ----
NM_001042497chr1573745 3673 3631 2912 2406 1522 1387 1376 ----
NM_001042510chr882104 1819 1552 1522 1468 1428 677 358 151 ----
NM_001042511chr882104 1819 1552 1522 1468 1428 677 358 151 ----
NM_001042550chr951854 786 647 593 371 ------
NM_001042555chr12114344 4146 3803 3211 3191 3128 1493 1333 836 721 223 ------
NM_001042573chr1772054 1506 1447 539 336 119 113 11636 31845 277 53 --
NM_001042599chr2137794 7699 7497 6790 6738 6486 5938 5739 1913 1526 556 468 410 35026 3125 3040 1115 16411
NM_001042601chr362897 2055 1306 434 344 107 12617 12308 --
NM_001042603chr1255337 5117 4864 1378 999 1912 14666 --
NM_001042604chr3114567 4268 4256 4091 3822 3466 3081 1722 1551 1501 39 13784 33759 3510 1150 --
NM_001044385chr2144019 3083 3041 2963 2800 2711 2489 1290 1262 754 635 610 266 258 --1870 12937
NM_001044722chr5----21979 417 1301
NM_001044723chr5----21979 417 1301
NM_001048183chr193773 3631 3025 2681 2657 1333 755 415 290 --188 --
NM_001079874chr122058 378 --21922 441 1273
NM_001083621chr1144483 4402 3863 3733 3394 3044 1545 1502 1322 1068 775 659 622 165 33539 3284 2999 24498 734 --
NM_001100108chr1198330 7493 6720 6213 6081 5575 5441 5384 3307 3007 2155 1840 1749 1520 1192 904 709 338 143 47857 7660 6558 6372 26445 5763 16632
NM_001106chr379045 8658 7478 7103 3188 1277 333 1358 48061 7685 7306 731 18167
NM_001116chr1683026 2897 2610 2292 915 616 378 78 31246 1218 757 22604 973 --
NM_001128chr16123836 3742 3678 3501 3088 2756 2623 2546 1186 893 762 138 ------
NM_001146chr872147 2051 2005 1952 1503 564 109 ------
NM_001148chr472128 1814 1678 1490 768 282 187 1751 ----
NM_001167chrX136175 6042 5943 5897 5835 5425 4892 4606 4563 4182 1666 1353 1339 25456 1167 12369 --
NM_001186chr2162610 894 842 756 442 365 --12919 --
NM_001201chr4143751 3624 3153 3001 2895 2608 2460 1593 1387 1274 1198 955 911 796 13170 ----
NM_001204chr2197131 7036 6925 6894 6716 5597 4986 4853 4791 3018 1970 1846 1798 1748 1670 1188 1145 892 558 --12092 14741
NM_001206chr982349 2089 1933 1219 1201 1043 1033 58 1476 ----
NM_001232chr151110 891 223 132 117 --1838 --
NM_001233chr752275 2205 842 584 359 --190 --
NM_001237chr41413 --1950 1727
NM_001237chr41413 --1950 1727
NM_001248chr34847 809 432 351 1761 --1917
NM_001259chr7126217 6105 6014 5857 4697 4284 4187 1244 1190 1129 579 113 26388 256 45143 4780 4771 2451 --
NM_001264chr67889 820 616 343 247 193 116 2570 371 ----
NM_001265chr132210 34 2194 129 1973 1340
NM_001271chr1593227 3175 2317 2205 2193 1279 739 684 223 --1369 --
NM_001304chr1783618 3604 3113 2956 2946 2363 1462 25 12735 22497 1535 --
NM_001310chr1292998 2986 2672 2488 2194 1233 550 350 49 12004 32747 2346 464 11065
NM_001315chr662020 1779 1772 1726 1427 359 ----1569
NM_001331chr1182021 1749 1739 1146 948 783 510 152 11998 12631 12234
NM_001346chr372838 2754 2554 1916 1864 615 287 31019 498 444 1659 12403
NM_001356chrX1671 ----12149
NM_001364chr11134394 3934 3897 3782 3760 3625 3194 3181 3103 1921 1827 1550 393 23964 3519 22939 1142 11289
NM_001387chr582891 2817 2616 2435 1275 1215 1125 514 22952 1282 22915 2873 --
NM_001399chrX113466 2568 2489 2450 2418 2323 1423 1084 976 939 604 21093 62 1808 1178
NM_001406chr1781520 1452 1255 1247 1149 225 172 129 --21640 1130 --
NM_001408chr161443 1195 602 413 383 363 11365 21232 395 --
NM_001412chrX113709 3393 3207 3065 2998 2957 1437 589 399 299 289 ------
NM_001419chr19114720 4583 4394 4125 3942 3825 3807 3499 3037 529 434 21879 711 1491 1845
NM_001422chr1141169 968 543 139 --11379 1269
NM_001430chr241951 644 448 315 ----11499
NM_001432chr452909 2835 1140 587 61 11297 1311 --
NM_001438chr1123002 2881 2341 854 801 683 508 374 322 301 221 24 12283 22468 295 12679
NM_001448chrX71405 1112 495 337 312 159 72 ----11512
NM_001482chr155773 726 634 613 329 1980 ----
NM_001490chr983294 3248 3038 2754 1159 1121 1052 562 ----33392 3032 798
NM_001497chr982216 2086 1926 1744 1029 984 858 604 22654 1871 1310 21895 143
NM_001527chr6104729 4246 4159 3605 3422 2988 1614 1376 654 303 --24143 1850 --
NM_001543chr5174222 4182 4084 4025 3473 3129 1948 1896 1781 1112 812 782 637 607 560 541 503 22957 896 43424 3084 1924 242 --
NM_001560chrX112484 2419 2290 2230 1875 1812 1659 678 543 210 51 1593 12130 --
NM_001609chr10103636 3467 3399 1779 1177 668 372 363 332 239 --24114 2802 13022
NM_001616chr242338 1225 867 834 23322 2814 13131 --
NM_001621chr772137 2004 1174 839 658 515 441 1469 12429 --
NM_001621chr772137 2004 1174 839 658 515 441 1469 12429 --
NM_001624chr641620 698 332 38 ----11767
NM_001650chr1883472 3409 3019 2979 2948 2851 2592 683 13267 --23169 1656
NM_001655chr1162162 1932 1661 1499 1481 419 ----181
NM_001659chr1292548 2444 2170 2156 2142 1804 1071 1007 798 --11687 --
NM_001663chr1462040 1893 835 659 382 289 --11961 1900
NM_001668chr131655 695 685 --11975 --
NM_001674chr141179 1171 164 109 1260 --11103
NM_001678chr174662 457 193 149 1425 11234 11209
NM_001682chr1221823 313 ----12401
NM_001683chr382305 2295 2183 1755 1680 501 253 148 --12417 --
NM_001717chr1551480 1472 1124 195 136 ----2580 265
NM_001746chr522774 62 --21980 1048 21870 695
NM_001754chr2143001 2765 746 95 34076 3480 1142 --1315
NM_001759chr12114946 4887 3762 3610 3594 2135 1247 1171 1132 989 553 13362 ----
NM_001777chr383490 3103 2600 1585 1172 623 313 289 ----2844 664
NM_001791chr151366 1320 1312 1281 184 ----2956 550
NM_001806chr1952868 2641 2151 299 97 --12726 11177
NM_001810chr202622 547 --1774 2609 209
NM_001830chrX43509 3488 983 228 23882 3163 1590 --
NM_001854chr161225 423 336 261 246 239 ------
NM_001858chr685162 5123 4399 3565 1723 745 195 159 11018 14157 --
NM_001859chr983727 3317 1141 1104 977 675 539 225 12687 --13267
NM_001874chr12145238 4927 4903 4296 4284 4275 3748 3609 1848 1694 1449 1311 439 143 14324 --1778
NM_001904chr31429 1394 --1182
NM_001949chr663008 2180 2134 2098 587 86 11980 52325 1205 1147 1013 759 --
NM_001968chr45798 750 206 113 24 ------
NM_001982chr1281285 1138 819 368 320 208 97 90 1118 1248 --
NM_001987chr12123806 3629 3281 3275 3255 2826 1669 1270 1196 1074 790 396 31516 1355 1258 14276 --
NM_001995chr451484 993 524 223 142 ------
NM_002006chr495708 5487 5019 4960 4876 1680 1129 729 158 12074 14680 --
NM_002009chr1582705 894 871 684 548 355 71 31 ------
NM_002025chrX219203 8899 8534 8380 7965 7956 7454 7390 6995 6162 5879 3537 3406 3316 3224 2848 2521 1923 1468 1382 1233 23452 2183 39154 7819 1053 22265 241
NM_002033chr1184074 3823 3761 3165 3003 2611 401 184 12778 33455 3178 3159 1909
NM_002035chr1863716 3156 927 913 775 32 21481 296 21307 714 --
NM_002040chr2193008 2826 2558 2196 2172 2106 2091 1064 1047 --1449 --
NM_002061chr181864 1730 1641 1581 1388 1256 360 182 ------
NM_002076chr12113210 3183 3142 3043 2696 2406 2201 1989 1276 689 261 --1724 --
NM_002077chr991761 1705 1600 1498 1460 1378 846 258 238 11520 11873 --
NM_002092chr494271 4256 4240 4216 3329 3219 1982 423 85 13660 11169 --
NM_002126chr1763772 3708 1082 1035 433 380 11327 11189 --
NM_002158chr283645 2857 2793 2647 2565 740 664 370 --13697 --
NM_002182chr362687 2612 1847 956 621 341 22386 2100 11700 --
NM_002203chr584058 3952 3152 3088 3006 1261 1052 41 22880 354 12719 --
NM_002210chr263174 2803 2628 2610 1006 815 ------
NM_002223chr1283920 3877 3659 3480 3438 3044 2473 1479 --33225 3053 1371 --
NM_002228chr121138 846 ----11213
NM_002232chr181004 979 964 890 851 552 383 201 ----2995 88
NM_002241chr1122089 2032 1908 1224 1121 791 635 620 497 419 404 191 1912 11211 21115 669
NM_002264chr3104800 4555 4219 3926 1345 1217 1161 903 104 93 34411 4125 3223 ----
NM_002267chr1362418 2147 2049 206 143 27 ------
NM_002270chr5125462 4602 3907 3886 3841 3784 3442 1853 1473 1381 574 493 14756 14212 --
NM_002285chr284053 4039 954 679 368 251 242 83 13185 1711 13940
NM_002293chr162348 2165 2086 1104 976 386 21830 1113 ----
NM_002310chr5115795 5641 5422 5249 5239 2445 1285 890 629 360 253 15724 ----
NM_002312chr131738 ----1772
NM_002333chr191801 ----21227 287
NM_002336chr1254350 4200 4101 3405 2037 1412 11501 11283
NM_002374chr292936 2283 1459 1306 1298 1243 1188 749 189 ------
NM_002387chr5124846 4498 4224 3444 3308 2079 1272 874 758 519 511 361 34446 614 337 --15052
NM_002395chr62496 480 1503 11021 --
NM_002451chr9113917 3533 3207 3191 3111 2940 2888 1479 1345 327 44 --13334 --
NM_002460chr6133519 2643 2488 2476 2373 1472 1443 1321 1165 849 799 111 85 13281 1596 --
NM_002473chr2261356 1236 1105 1033 867 200 ----162
NM_002500chr22491 425 ----1978
NM_002505chr681340 1272 484 396 354 333 51 42 ----11420
NM_002508chr14305 293 285 27 31957 668 623 --11273
NM_002519chr1121459 388 --21369 163 1553
NM_002522chr1783299 3269 2762 2703 1130 880 836 228 --13150 1515
NM_002524chr11142 --1849 2826 181
NM_002545chr1184921 4576 4339 3587 3366 3218 3131 309 --24542 165 11229
NM_002547chrX94085 4015 3922 2779 1645 1266 1259 406 239 1175 31206 118 44 --
NM_002556chr1152138 2035 1858 822 131 --21790 1457 --
NM_002577chr3113715 2850 2592 2552 1613 1068 781 760 467 349 33 --13606 --
NM_002581chr9125570 5554 5208 4672 4139 3627 1339 952 444 435 209 31 1254 33872 1428 1232 14731
NM_002601chr25510 437 413 198 182 ------
NM_002605chr152948 358 ----11205
NM_002610chr243077 3004 2234 992 --12460 --
NM_002646chr152149 2003 1809 1481 30 ----22158 2047
NM_002655chr844943 4080 838 254 --13916 14409
NM_002657chr20123646 3596 3549 2651 2553 2523 1547 1522 925 695 681 122 1178 ----
NM_002709chr263592 3574 2946 2367 1287 289 --13210 --
NM_002716chr1173476 3092 2746 1452 1433 1247 873 1328 13588 --
NM_002719chr1482280 1858 669 644 521 492 443 375 ----1183
NM_002731chr153101 2962 2802 2561 283 --22348 1095 --
NM_002734chr1741690 1485 440 304 --11539 1592
NM_002737chr17165602 5593 5504 5400 4768 4398 4229 2166 1996 1696 1118 923 819 568 394 324 12154 35778 4319 2020 1274
NM_002740chr362348 2324 2053 1820 756 621 1198 --12072
NM_002833chr1551408 1397 1339 493 123 --2374 221 1632
NM_002839chr973344 1136 1039 633 431 393 161 --22786 2740 12663
NM_002843chr1193049 2887 2706 2260 1249 917 751 661 306 ------
NM_002845chr184627 549 174 89 --1473 1251
NM_002868chr1262245 2063 1956 1757 650 565 11853 42315 1938 618 468 11996
NM_002886chr3124825 4804 4235 4210 4090 3660 3454 2059 1614 1229 1093 1068 34927 3585 1105 21133 551 --
NM_002892chr1411126 --2126 24 11612
NM_002906chr1152314 1916 1632 402 385 --21521 429 --
NM_002942chr311063 ----11327
NM_002959chr1104174 3951 3196 3062 2724 1252 1192 1116 679 91 --13300 --
NM_002977chr262850 2452 2288 1205 344 141 ------
NM_002998chr821798 303 1349 --11946
NM_003001chr152121 839 704 537 30 ----1677
NM_003010chr1751960 1920 1848 1520 131 11690 --1791
NM_003012chr893129 2963 2804 2782 2493 2268 688 292 149 22261 666 12176 11070
NM_003026chr951359 1081 958 916 427 --1271 --
NM_003028chr983769 2542 2414 1553 1256 480 408 285 53685 3599 3400 756 464 33159 2375 1536 13334
NM_003029chr161450 1203 1101 1033 1021 46 2392 24 ----
NM_003032chr351805 933 554 356 92 --1337 1251
NM_003034chr1287984 7695 7635 7518 6446 6265 4916 3076 35835 4940 2792 12581 13215
NM_003042chr361882 1759 1390 835 804 542 --2607 472 12033
NM_003043chr3113608 3431 3248 3061 1324 1204 1037 966 948 921 59 14004 13213 --
NM_003045chr1394982 4525 3180 3157 1791 1533 963 424 368 23074 1756 34392 1544 611 --
NM_003048chr232690 1944 1926 --21937 438 --
NM_003071chr341950 1905 642 551 1496 ----
NM_003074chr361885 1791 1478 1465 1447 108 --12201 --
NM_003108chr2146786 6681 6553 6542 6125 5692 5462 5388 5288 4410 1847 1821 1420 335 --35255 4472 2662 12110
NM_003112chr74995 823 277 132 1584 ----
NM_003133chr11756 --1893 1772
NM_003149chr361440 1398 1227 1213 1065 513 1408 1498 --
NM_003155chr862393 2095 1116 1039 192 109 2888 775 12217 --
NM_003161chr1783388 3221 3161 2927 2396 1426 876 251 --33130 2196 443 --
NM_003178chr34846 734 231 138 21729 1520 1707 11804
NM_003199chr18115602 5098 4675 4516 3711 2232 1784 1673 894 307 165 1851 --14995
NM_003202chr561743 1615 1559 1424 321 127 1204 --11765
NM_003211chr1241639 1613 1144 228 1670 11343 --
NM_003215chr441200 1162 517 32 31097 180 26 ----
NM_003216chr22133155 3031 2500 2471 2114 1297 1253 851 719 499 435 272 144 --33216 944 416 --
NM_003221chr683196 2567 1625 1049 996 823 508 249 11491 33640 1593 204 --
NM_003236chr2103573 2869 2592 2497 1232 1209 1119 780 345 108 ------
NM_003242chr372528 2293 2174 1663 1541 974 940 --32535 664 403 --
NM_003244chr183394 349 343 ----128
NM_003246chr1541761 1659 1474 835 21786 142 11433 --
NM_003253chr2161670 1522 1312 1291 399 254 --11554 11463
NM_003262chr3115039 4473 4176 3291 1613 1580 1350 1069 790 585 275 --23874 3679 14353
NM_003274chr2131906 293 205 1190 21193 32 --
NM_003290chr1951208 1044 879 466 254 --1276 --
NM_003298chr3134676 4318 3947 3837 2483 2270 1889 1495 1057 583 265 97 42 1145 54609 4504 2320 1389 1048 --
NM_003320chr11134379 4133 3992 3891 3488 3069 3016 1383 1260 1018 952 725 235 13525 --14243
NM_003326chr172327 2171 2080 1961 828 547 99 22777 2700 1654 --
NM_003339chr571511 1115 1090 1016 609 210 74 ------
NM_003342chr1782789 2479 1203 1018 766 594 473 397 --23126 2571 --
NM_003344chr761762 521 367 206 181 41 ------
NM_003373chr10121762 1753 1523 1499 1441 1355 1251 736 635 472 215 67 1392 11417 --
NM_003387chr22297 290 ----12109
NM_003392chr3104226 3418 3391 2697 1182 1080 593 391 358 33 22835 774 21347 933 --
NM_003410chrX43079 2002 542 412 1799 12255 12435
NM_003412chr332854 2713 872 --1866 22862 965
NM_003421chr1084237 3402 3130 3010 1800 1343 1021 94 31761 1393 1052 23050 609 --
NM_003431chr12556 181 1430 --199
NM_003439chr773375 2407 2271 1399 599 438 241 13323 11410 --
NM_003442chr113551 336 97 1277 --1190
NM_003458chr3132886 2804 2511 1151 1123 886 798 725 535 470 408 370 192 --33395 2495 1528 1267
NM_003463chr662676 986 920 604 407 303 ------
NM_003468chr2124330 3929 3513 3040 3030 2955 2898 1569 1045 700 405 165 ------
NM_003480chr1282123 2111 2066 2044 1982 1583 1325 232 ----1436
NM_003483chr1292538 2465 2196 2128 2071 1086 796 219 100 ------
NM_003489chr2163239 2415 1315 886 706 584 11008 ----
NM_003506chr821277 1127 ----1954
NM_003559chr1793854 3732 3639 3625 3071 2790 1483 1011 436 42620 705 685 489 23050 1203 1779
NM_003563chr1751181 948 459 437 287 ----137
NM_003566chr1253241 2692 2127 1321 212 --11218 12939
NM_003574chr1875599 5220 5189 4958 4750 1592 941 15148 24188 3984 --
NM_003576chr1362499 2374 966 915 280 217 1190 11841 --
NM_003583chr1263821 3177 3026 2447 1046 975 1871 ----
NM_003590chr294093 3798 3704 3376 2725 1617 1113 656 161 21416 1225 24087 447 --
NM_003607chr1103658 3550 3452 3030 2785 2663 1380 1149 1131 941 1161 43365 3304 1412 918 --
NM_003617chr1104390 3437 1832 1552 1520 1513 792 127 85 65 23877 1896 34247 1882 347 --
NM_003633chr532214 1653 360 21582 913 11870 21892 946
NM_003636chr1111830 1817 1742 1510 621 542 347 338 315 297 44 11540 --11876
NM_003663chr322525 2142 12550 22770 2584 --
NM_003671chr953496 2835 992 251 112 --22932 2676 12587
NM_003679chr153229 2462 2277 532 71 22203 500 --13453
NM_003701chr132921 679 ----1236
NM_003722chr342104 616 288 24 --1662 11821
NM_003759chr474196 4175 3925 1269 752 583 235 146 23856 1487 1820
NM_003763chr20103223 3017 2829 2810 2601 2389 2235 1229 568 44 12114 1498 --
NM_003774chr1231234 1188 1058 ----11271
NM_003787chr1851086 627 601 68 46 ------
NM_003799chr18124527 4350 4109 3684 3670 3334 3254 962 839 804 755 315 122 1685 --
NM_003861chr1462877 2355 2199 2116 1954 1087 --22720 2347 1914
NM_003872chr252270 606 479 198 38 12754 1600 32281 976 395
NM_003873chr1021839 1664 --21950 129 12473
NM_003896chr24764 246 169 155 --3881 841 682 --
NM_003899chr1322553 246 1622 1417 2754 300
NM_003901chr1072721 2702 1846 1079 550 389 34 --1861 --
NM_003913chr674214 4000 3994 3623 3111 2959 1571 --54127 3718 1251 832 398 --
NM_003930chr781897 1833 1024 1014 869 796 749 556 1985 ----
NM_003939chr1093896 3715 3281 2696 2679 2615 1181 656 314 1325 13320 1856
NM_003941chr722012 535 --11970 11901
NM_003958chr663684 3536 3263 1321 965 768 33842 990 529 --13866
NM_003983chr1664252 4172 4094 1744 1264 984 --24122 2876 24152 3547
NM_003994chr1294050 3773 3507 2848 1670 1434 1253 948 465 1317 14006 --
NM_004006chrX51925 931 914 755 110 ----1851
NM_004007chrX51925 931 914 755 110 ----1851
NM_004009chrX51925 931 914 755 110 ----1851
NM_004010chrX51925 931 914 755 110 ----1851
NM_004011chrX51925 931 914 755 110 ----1851
NM_004012chrX51925 931 914 755 110 ----1851
NM_004013chrX51925 931 914 755 110 ----1851
NM_004014chrX51925 931 914 755 110 ----1851
NM_004015chrX51925 931 914 755 110 ----1851
NM_004016chrX51839 845 828 669 24 ----1765
NM_004017chrX51925 931 914 755 110 ----1851
NM_004018chrX51839 845 828 669 24 ----1765
NM_004020chrX51925 931 914 755 110 ----1851
NM_004021chrX51839 845 828 669 24 ----1765
NM_004022chrX51839 845 828 669 24 ----1765
NM_004023chrX51839 845 828 669 24 ----1765
NM_004024chr171538 1530 1050 523 468 161 95 1619 --11462
NM_004028chr1883472 3409 3019 2979 2948 2851 2592 683 13267 --23169 1656
NM_004035chr17145013 4648 4395 3749 3599 3548 3431 3210 3181 1877 722 668 602 271 1873 24921 4636 14735
NM_004050chr1442372 1027 905 242 --21789 420 22203 689
NM_004055chr1162261 383 286 155 103 34 3889 667 403 22217 727 --
NM_004056chr821086 779 --1377 1315
NM_004081chrY51828 1526 1474 153 98 --11184 --
NM_004087chr331545 464 30 --1619 1792
NM_004089chrX61248 1227 1193 410 363 269 --159 --
NM_004093chr1333287 2360 891 ----22125 33
NM_004094chr1442844 2743 951 280 165 181 --
NM_004096chr1062034 1846 1719 1678 1445 696 --2299 211 --
NM_004100chr642630 2546 2372 2005 2787 134 1381 --
NM_004112chr17101766 1737 1295 1216 604 340 310 261 70 38 2703 673 ----
NM_004113chr33536 74 55 1722 ----
NM_004117chr681827 1696 875 759 702 417 146 28 ------
NM_004124chr1463374 2429 2255 2216 2187 1369 --22806 2464 --
NM_004161chr261598 1272 992 406 280 23 ------
NM_004171chr11219452 9098 7462 7381 6321 6027 5951 5849 3713 3441 3326 3181 2441 2332 2055 2002 1753 1477 1238 923 218 1980 68251 7368 2520 1862 1182 332 27439 2471
NM_004187chrX1440 1315 --21291 244
NM_004227chr732655 934 316 ----22587 517
NM_004279chr742119 2113 1741 738 --1376 1881
NM_004293chr983794 3676 3466 3003 2358 348 287 178 ----11419
NM_004319chr172991 2895 2767 2009 1194 582 381 --1561 --
NM_004323chr962481 1663 967 569 143 125 1522 2799 269 --
NM_004331chr862483 2029 1670 768 223 130 ----11741
NM_004338chr18166904 6389 5816 5194 4407 4350 2440 2345 2222 2180 2010 1933 1407 1199 1128 863 --26881 4376 --
NM_004350chr182155 2038 1614 888 677 643 134 123 32439 2098 370 12069 --
NM_004384chr5----21979 417 1301
NM_004386chr1971506 1472 819 700 417 253 35 ------
NM_004414chr2141433 1096 501 121 ----1627
NM_004423chr392658 2527 2319 2181 2088 1865 1730 916 654 --1250 11019
NM_004426chr1261900 1715 1692 1618 472 234 11785 ----
NM_004430chr841843 1072 157 46 --11978 22258 1003
NM_004437chr152934 2400 1164 807 324 13609 12562 33474 2592 492
NM_004438chr231153 572 509 ----22551 228
NM_004458chrX72083 2045 1819 1799 1691 1682 381 11870 ----
NM_004464chr464093 3787 3166 1155 571 368 --24164 1357 --
NM_004491chr19133446 3339 2915 2659 1685 1550 1348 1180 924 713 656 447 126 --11575 14154
NM_004501chr183638 3589 3511 3375 3304 3290 721 358 ------
NM_004504chr242485 2327 2137 2067 ----1946
NM_004505chr1741636 1359 734 540 ----11468
NM_004513chr1573911 2459 1347 845 628 382 180 --73528 2668 1505 1426 614 123 70 --
NM_004529chr92565 552 ----11247
NM_004586chrX114434 4296 4150 3636 3379 3327 2145 1647 1511 1331 106 24519 3885 --13816
NM_004588chr11173613 3555 3179 3140 3101 3071 3042 2896 2649 1279 1158 965 944 634 553 470 93 13208 53813 3413 2736 2695 738 --
NM_004598chr583244 3106 2998 2942 2501 556 284 53 22807 710 32317 761 397 1155
NM_004602chr2041377 481 373 285 ----11096
NM_004612chr934343 4138 912 13171 2218 151 24883 417
NM_004663chr1551205 491 433 416 122 --147 --
NM_004670chr1041420 1059 459 89 1289 1352 --
NM_004685chr1332773 2093 2027 --32574 498 185 12142
NM_004690chr65809 717 668 175 136 --1506 --
NM_004709chrX31762 1149 435 1381 1108 11573
NM_004726chrX104630 4259 4171 4093 3806 2262 2240 2225 1786 1572 --14436 --
NM_004730chr531610 260 224 --21526 475 1113
NM_004734chr13103118 2901 2889 2486 2377 1277 1058 1046 878 133 --12428 --
NM_004745chr8206694 6674 6497 5958 5435 5035 4858 4458 4389 4298 2616 2021 1460 1416 1402 1392 1058 921 725 650 46870 5084 2312 2305 34284 1486 1202 31105 292 45
NM_004762chr1741774 1299 1289 775 ----21787 122
NM_004774chr1753131 1955 1095 1061 349 32926 2167 1931 12471 12735
NM_004775chr1851925 1536 865 818 657 11757 1931 --
NM_004781chr141110 1086 376 307 2392 255 ----
NM_004781chr141110 1086 376 307 2392 255 ----
NM_004788chr1162693 1720 827 333 296 175 --21819 1808 --
NM_004797chr363607 2743 1344 1240 651 488 --1184 22720 2462
NM_004798chr2083217 3009 2553 2285 1222 822 169 21 32927 1134 218 ----
NM_004815chr194853 4807 4628 4361 4137 4100 3761 3260 1284 ------
NM_004822chr1763832 3704 3419 2934 2788 448 31403 915 286 31604 965 106 11338
NM_004850chr281672 1538 1343 1133 704 522 255 49 21353 247 ----
NM_004857chr1494698 4151 1150 912 798 663 544 504 128 --1603 --
NM_004859chr1712924 --165 1532
NM_004863chr14154821 4296 3911 3744 3578 3296 1859 1544 1249 1057 935 717 450 340 73 24503 463 35107 3770 3689 --
NM_004871chr1784361 4281 4166 3388 3042 720 467 301 --22807 848 --
NM_004873chr1441303 1264 190 104 --23125 1039 --
NM_004884chr1531639 575 448 --3631 420 50 21523 669
NM_004898chr462918 2549 2176 2168 1087 92 ------
NM_004904chr795957 5590 5127 4515 2358 1264 1241 619 492 1472 25183 2447 14469
NM_004932chr551716 1563 584 269 23 1690 1280 --
NM_004936chr972610 2043 1146 1002 761 269 53 --1241 11918
NM_004937chr17102583 2535 2501 2206 2174 1828 1693 1064 1040 286 32625 2422 2315 --32027 736 418
NM_004976chr1194581 4382 4085 3932 2047 1945 1021 912 490 34728 3208 36 31475 855 569 --
NM_004985chr1274360 4154 3768 3492 2956 829 556 ----1196
NM_004992chrX187888 7406 6537 6009 5926 3248 3099 3011 1538 1493 1311 1154 1002 946 936 862 748 93 37214 3022 2144 37799 3375 1292 --
NM_004992chrX187888 7406 6537 6009 5926 3248 3099 3011 1538 1493 1311 1154 1002 946 936 862 748 93 37214 3022 2144 37799 3375 1292 --
NM_004999chr663859 1663 1283 504 269 216 33737 3425 3226 44259 2847 1335 940 --
NM_005032chrX51029 399 285 190 35 1263 165 --
NM_005056chr1255581 5361 5108 1622 1243 11156 14910 --
NM_005057chr181898 1459 1325 505 440 364 221 29 ------
NM_005063chr1063540 2682 1383 1024 281 120 13604 --1888
NM_005065chr1495344 5118 4875 4580 4381 3725 1195 898 134 21650 101 24541 920 24084 1453
NM_005076chr1104232 3486 3221 3041 1524 1317 1090 980 754 383 23624 1127 12643 --
NM_005093chr20125092 4800 4772 4606 4489 2101 1961 1452 1268 712 670 530 44229 4189 924 562 44481 3424 1261 745 --
NM_005105chr152227 2125 1982 720 633 1762 ----
NM_005116chr2094092 3342 3240 3081 2872 951 905 343 261 23662 523 34171 3390 2901 --
NM_005119chr12322 256 ----11044
NM_005121chr1732706 2350 1456 --31279 265 84 1512
NM_005134chr18------2334 231
NM_005135chr1573745 3673 3631 2912 2406 1522 1387 1376 ----
NM_005156chr9115355 4228 4104 3653 1976 1790 1708 1511 1399 1365 677 14351 11419 14578
NM_005160chr2295745 4750 2734 2716 1974 1786 1119 837 48 15242 56651 2505 1814 1749 1589 --
NM_005188chr11158281 8124 7527 7215 6279 6259 5876 3018 3012 2856 2790 2563 2242 439 235 36042 5523 1819 97497 5790 5776 2905 2742 2140 1756 1145 1035 25278 1865
NM_005197chr1476197 5538 5418 5340 4585 3996 1207 --24549 3789 --
NM_005235chr2137794 7699 7497 6790 6738 6486 5938 5739 1913 1526 556 468 410 35026 3125 3040 1115 16411
NM_005238chr1193292 2686 2538 2506 2453 2435 2349 1182 638 ----32809 254 103
NM_005252chr141619 --1238 1670
NM_005254chr152885 456 ----1331
NM_005257chr184868 553 394 144 2374 255 ----
NM_005259chr24525 519 259 29 ----1217
NM_005277chr44322 241 171 100 --11420 --
NM_005308chr103357 174 162 1505 ----
NM_005311chr742207 1841 1082 931 12506 1605 1532
NM_005329chr1642381 1664 602 387 --31748 1498 1472 11581
NM_005338chr7113943 3607 3472 2867 2685 1132 982 904 605 212 95 12547 24062 438 --
NM_005339chr473943 3524 3419 3385 1616 1519 748 --1852 --
NM_005359chr18146451 6346 5390 5293 5103 4050 3994 3964 2169 2145 1378 397 279 146 11751 1714 --
NM_005385chr362505 2363 2152 2063 1709 538 --1355 --
NM_005433chr1862710 2666 2493 2168 475 443 1129 ----
NM_005436chr1063335 2570 2524 1122 376 205 12594 ----
NM_005440chr17112852 2592 2503 2412 2317 1307 1100 967 752 418 168 --32867 828 775 --
NM_005443chr43228 207 106 --2498 478 --
NM_005455chr161511 1158 561 409 383 83 --11238 --
NM_005458chr972345 2069 1521 951 820 806 122 --1866 21673 1543
NM_005487chr2231848 581 367 --21639 1390 11368
NM_005497chr17115936 5290 5155 4425 4387 4253 2238 1701 1677 1585 1316 23800 245 1190 --
NM_005534chr212494 413 1207 --183
NM_005578chr3134833 4826 4673 3654 3595 3311 3118 1975 1532 1137 889 462 219 --25113 4592 --
NM_005584chr135538 245 233 77 40 1529 ----
NM_005596chr966420 5812 5798 4079 4026 2203 22468 2346 21444 680 14313
NM_005603chr1881671 1602 1574 1471 669 535 236 64 ----11563
NM_005604chr621903 460 --21745 66 12111
NM_005607chr84791 409 357 149 1774 21006 884 --
NM_005613chr162189 2087 1600 1482 220 207 ------
NM_005637chr1882030 1708 1684 1499 1434 699 607 359 ------
NM_005638chrX51612 1559 1300 689 122 11582 11512 --
NM_005639chr1251594 604 456 337 107 --21807 94 --
NM_005647chrX62265 869 823 673 296 234 12118 12681 12911
NM_005664chr1551047 994 967 946 296 ------
NM_005665chr184949 4459 4337 3614 1489 1476 585 427 --11833 11514
NM_005668chr584355 3850 3027 2928 1746 1375 723 206 --11008 --
NM_005722chr252239 2088 715 287 276 1922 ----
NM_005725chr142066 1919 1874 67 1314 --2645 392
NM_005730chr12143499 3259 3165 2960 2844 2595 2373 2209 1121 1038 955 327 47 32 12575 33672 2466 1359 1565
NM_005737chr272907 2810 2719 2545 2373 385 335 1790 --1469
NM_005739chr1572280 1651 1545 463 400 154 53 ------
NM_005748chr1273381 3301 3245 3081 2915 2703 2322 --22629 1074 1188
NM_005759chr2104170 3955 3929 3403 3359 3317 3289 3271 1468 563 24616 1177 21801 329 150
NM_005766chr1341160 937 354 166 --51385 1225 1082 420 119 --
NM_005779chr572606 1266 1135 984 950 855 598 21308 232 1734 --
NM_005789chr1782100 1952 1938 1540 1496 1421 1357 520 --11533 11899
NM_005797chr1171739 1368 586 443 435 106 31 --189 --
NM_005808chr373380 3334 2700 2640 953 388 351 --13532 1457
NM_005813chr252477 2461 851 624 305 12278 12021 --
NM_005819chr173462 3067 2660 2624 469 167 96 12547 1599 --
NM_005822chr682337 2257 2223 1846 1623 724 584 346 12109 22169 469 11898
NM_005826chr11617 ----1492
NM_005828chr17124989 4455 4280 4227 3767 3119 1611 1102 939 856 818 448 13655 34032 912 87 --
NM_005840chrX157344 6899 6825 6278 5843 5538 5447 5208 1387 1304 923 708 541 444 181 27535 6418 32689 1354 890 27641 6672
NM_005868chr772294 2192 1998 1015 524 436 111 --2247 86 11550
NM_005885chr561391 1105 1076 608 420 89 11233 2129 78 --
NM_005895chr12113951 3725 3572 3219 2629 1601 1537 1092 797 638 395 23236 1547 ----
NM_005896chr22558 283 ----1779
NM_005898chr1153168 2886 2796 2659 2420 --1483 22832 2644
NM_005901chr18177587 6846 6642 6361 6297 6109 5700 3068 2398 2208 1682 1051 748 742 727 448 160 25292 2335 68695 8042 7342 7201 6317 3012 --
NM_005902chr15133767 3301 3009 2945 2921 1590 1568 1361 1303 1185 860 818 481 1606 53946 1737 1435 1104 494 13284
NM_005909chr5144012 3699 3465 3351 3256 2845 2807 1605 1450 1322 1155 816 566 200 22916 775 64205 4037 3286 1268 526 163 145
NM_005933chr1183037 2797 2526 2153 1058 759 661 381 2178 92 2556 74 --
NM_005935chr4125186 3853 3721 3699 3232 1588 1564 816 800 694 386 236 --24878 1239 1410
NM_005937chr1793944 3320 2916 2865 1314 1068 901 749 65 11198 43963 2628 1452 466 --
NM_005941chr893607 3547 3435 1487 1265 861 828 650 505 --2732 85 11649
NM_005955chr1124650 4233 4150 3656 1822 1816 1201 1015 1008 422 337 152 1839 74991 4840 4682 4380 4036 3844 1936 14106
NM_005957chr174816 4681 4628 4113 3395 362 159 2879 473 23703 3112 23481 3029
NM_005990chr542325 1967 557 546 --12084 22720 488
NM_005996chr1241199 499 288 30 --21236 1068 --
NM_006007chr9103971 3717 3693 3573 3204 2959 2947 1317 521 283 14472 ----
NM_006011chr15104159 3703 3431 3196 3093 3063 2616 1435 1317 1211 23764 3132 ----
NM_006033chr1842027 1717 587 498 --32186 316 107 --
NM_006037chr2114844 4771 4476 3656 3346 3247 1841 1355 996 645 70 13302 ----
NM_006038chr2072075 1993 1889 1643 1372 687 518 188 --11897
NM_006047chr2063364 3199 2722 2575 1405 125 1402 32984 80 71 --
NM_006055chr283214 2821 2648 969 511 225 215 82 32422 1172 280 --22466 2452
NM_006060chr7104290 4046 3522 3323 3085 3048 2932 1695 1017 783 --54093 3670 2909 1070 418 2291 242
NM_006089chrX1103 --136 1491
NM_006095chr4134031 3645 3521 2842 1776 1619 1129 1025 1019 952 636 603 83 --34360 3960 2805 13018
NM_006108chr1172307 1908 1861 1827 881 416 360 141 ----
NM_006113chr122058 378 --21922 441 1273
NM_006135chr131343 1253 952 11128 21097 328 --
NM_006139chr261906 982 855 541 341 323 12276 ----
NM_006145chr192263 232 ----3391 134 41
NM_006186chr24821 189 133 99 --1289 11026
NM_006203chr575397 5363 4201 3458 2121 1110 53 --23794 1879 1911
NM_006206chr452822 2474 1039 1001 222 12416 32340 2325 124 --
NM_006212chr184660 3699 1632 1586 1493 1430 1186 960 13305 25266 4996 31846 1767 255
NM_006223chrX1459 ----1419
NM_006224chr1782377 2324 2260 1751 1724 560 399 323 12567 22431 1017 --
NM_006246chr1441228 1164 1009 239 ----1212
NM_006251chr593220 3196 2854 938 747 583 455 391 249 ------
NM_006256chr162775 2487 2396 1933 786 649 ------
NM_006275chr2032463 1010 43 --32194 1796 850 --
NM_006283chr8134967 4765 4197 3931 3412 3086 3017 1832 1490 1346 1076 323 236 34649 3825 3176 24609 3246 --
NM_006290chr621817 1735 1441 1187 11712
NM_006300chr1962315 2113 1811 1693 1673 1512 12438 12343 --
NM_006306chrX94728 4582 4351 4340 3650 2298 1269 1064 644 --14613 11896
NM_006313chr12--11096 --11054
NM_006315chr4104453 4242 1670 1447 1365 844 576 539 421 54 21190 209 1326 13703
NM_006330chr861375 1346 1028 521 257 66 ----11222
NM_006371chr383795 1936 1658 1349 514 214 173 65 25132 2006 23220 277 3757 711 671
NM_006380chr1794290 3777 3678 3537 3530 2770 1633 1460 42 --13061 136
NM_006386chr2262269 1987 1651 828 759 459 --1793 --
NM_006393chr1093203 3110 3060 1709 1237 822 608 450 195 --14110 --
NM_006420chr2022476 2361 1114 --1805
NM_006434chr1052953 2486 2455 906 778 --1429 --
NM_006457chr4143980 3949 3797 3590 3523 3120 2803 2739 1530 1168 924 689 554 132 ----13874
NM_006459chr1051909 1246 646 472 322 ----11757
NM_006464chr2124518 4012 3427 3294 2918 1876 1703 1667 1283 964 937 352 12955 14495 --
NM_006482chr1263821 3177 3026 2447 1046 975 1871 ----
NM_006516chr16534 524 442 296 54 34 ----11495
NM_006517chrX91919 1768 1671 918 863 756 718 519 222 1801 2205 32 197
NM_006534chr203443 261 83 12999 33264 3125 2701 --
NM_006537chr153404 107 57 --150 --
NM_006538chr233872 2767 1017 23340 1053 23043 1297 1415
NM_006544chr1455129 4405 2135 1085 389 25207 291 25393 3947 --
NM_006546chr17176622 5966 5780 5686 5652 5505 4990 4415 2441 2186 2173 2095 1083 875 411 174 153 --36071 5753 885 11058
NM_006547chr711746 --21853 471 12113
NM_006549chr12122951 2838 2663 2454 2435 2310 2057 1065 923 654 457 68 22494 487 ----
NM_006557chr991769 1641 1496 1241 661 604 459 386 270 11087 ----
NM_006561chr10175354 5190 5004 4923 4695 4658 4599 4185 3944 1956 1899 1818 1691 1670 1513 582 352 1957 22013 396 11114
NM_006565chr162830 363 ----2343 273
NM_006566chr184905 858 469 75 ----1340
NM_006572chr1752618 897 745 310 261 22209 863 ----
NM_006577chr24343 336 65 52 1887 ----
NM_006599chr16177965 7792 7696 7185 7071 6583 5868 5644 5123 5108 5073 3053 2506 1746 1393 1232 213 27579 6267 46493 6199 281 250 16186
NM_006602chr201276 ----1552
NM_006614chr393675 3428 3420 3223 3070 2774 2686 1239 850 11026 --12639
NM_006618chr161458 1323 403 372 272 73 --1148 21298 1114
NM_006626chr942151 2001 609 226 --22437 1855 --
NM_006628chr1574188 3984 3977 3774 3369 1392 818 --22886 1290 --
NM_006629chr1882340 2184 2045 1855 1771 1035 494 410 --11100 11052
NM_006636chr23882 334 190 ----1945
NM_006650chr5103787 3609 3349 3133 980 911 870 478 365 176 23277 2621 --12544
NM_006654chr12114344 4146 3803 3211 3191 3128 1493 1333 836 721 223 ------
NM_006699chr132141 614 26 ----1877
NM_006717chr953156 2535 2468 2448 2167 --22835 79 --
NM_006722chr342021 1928 1008 456 --12589 12060
NM_006729chrX165055 5030 4825 4815 4668 4643 4451 4172 4035 3592 3492 1165 1054 1043 884 661 ----22201 2020
NM_006738chr15124009 3793 3463 3169 2921 2912 2842 1296 630 596 317 232 1955 23893 802 12865
NM_006750chr16237943 7726 7470 7308 6999 6931 6668 5899 5470 5117 4949 3002 2886 2050 2000 1353 941 760 606 588 236 111 49 27884 474 66257 6073 5763 924 821 432 --
NM_006754chr731129 890 189 ----1164
NM_006766chr882108 1860 1804 1797 1758 752 480 469 1809 21867 91 --
NM_006777chrX52281 2254 1176 843 387 11971 ----
NM_006788chr1852116 1595 1477 740 362 --11789 2226 120
NM_006814chr2062510 2449 2141 401 272 25 --1514 --
NM_006818chr16998 754 649 375 77 66 ------
NM_006827chr1453395 2979 2848 2550 2187 ----11307
NM_006851chr1262709 2596 2509 905 752 153 ------
NM_006852chr1782866 2766 2681 1025 732 233 168 139 --12457 --
NM_006861chr1262017 1862 1503 1450 737 84 --21401 1390 --
NM_006885chr1643385 2574 1423 157 21521 587 43168 1679 997 504 13059
NM_006895chr262137 2068 1869 1811 546 66 ------
NM_006912chr121946 966 1388 1600 1429
NM_006915chrX42176 1906 992 41 --1497 --
NM_006931chr1292121 2097 1860 1736 1654 1542 1408 120 28 11604 ----
NM_006943chr2093331 3278 3224 2875 2851 2692 2399 1275 574 --22951 2903 --
NM_006948chr2161988 1873 1504 734 72 51 --1357 --
NM_006981chr972903 2812 2172 2154 1904 308 38 ------
NM_006996chr11630 11405 --1701
NM_007010chr1751803 1487 701 632 49 128 11182 11472
NM_007011chr15156811 5811 5545 5411 5017 2680 2402 1962 1398 1383 1305 1114 723 636 439 36526 1811 896 34671 2111 493 65079 5042 5002 4964 4924 4885
NM_007030chr574243 4057 3946 3159 1565 380 256 --1690 33219 1347 775
NM_007038chr21165883 5300 4863 4514 4330 4290 4212 2131 2058 2003 1876 1364 1282 1261 1213 670 12280 --25806 516
NM_007039chr1472282 2028 1830 1723 1656 1622 83 ------
NM_007040chr1961106 962 937 424 268 115 125 --1393
NM_007042chr372315 2298 1811 1062 406 397 126 1608 4784 463 447 137 1290
NM_007050chr20128122 7688 6951 6641 5765 5469 5017 3137 3071 1347 1162 883 27034 295 27502 1676 --
NM_007054chr583702 3635 3325 1331 1196 879 642 44 22601 2443 --1904
NM_007078chr1052691 2555 2055 712 304 --1789 12043
NM_007106chr1341783 872 755 151 ----12153
NM_007107chr372184 2154 2070 1658 960 917 524 --1434 --
NM_007114chr353194 2663 2313 1227 21 ------
NM_007137chrX125397 4920 4840 4779 3901 3646 1954 1749 1099 1041 695 276 25072 2088 12138 24440 3596
NM_007172chr2273278 3068 2662 2506 2039 1208 319 --33106 2568 2049 --
NM_007175chr883297 3204 3017 2783 2752 739 387 105 13621 ----
NM_007195chr1863272 3133 2347 1396 1255 1231 1121 ----
NM_007200chr15124009 3793 3463 3169 2921 2912 2842 1296 630 596 317 232 1955 23893 802 12865
NM_007203chr963983 3645 3388 1571 439 238 11347 ----
NM_007214chr621248 312 ----11191
NM_007249chr13169291 9193 8972 8531 8085 7966 7360 7148 6980 6881 6687 6629 5770 3567 1324 1030 39248 9178 6038 37518 6953 1644 39205 6808 6673
NM_007286chr591984 1873 755 665 609 589 529 293 235 ----31944 1468 621
NM_007287chr3103180 3170 3082 2915 2899 2753 2176 2137 275 218 1164 23205 2863 --
NM_007288chr3103180 3170 3082 2915 2899 2753 2176 2137 275 218 1164 23205 2863 --
NM_007289chr3103180 3170 3082 2915 2899 2753 2176 2137 275 218 1164 23205 2863 --
NM_007292chr17145013 4648 4395 3749 3599 3548 3431 3210 3181 1877 722 668 602 271 1873 24921 4636 14735
NM_007315chr251457 1283 1036 478 45 ----11129
NM_007331chr482632 2083 1934 1853 1041 1014 829 472 1432 ----
NM_007345chr1862135 2084 1947 1916 1577 484 ------
NM_007350chr1274397 2895 1779 1482 1447 421 376 --23192 1522 12825
NM_012073chr541477 1302 417 324 ----21116 101
NM_012081chr573055 2967 2330 940 821 695 144 --13638 --
NM_012089chr151218 1070 598 164 125 ------
NM_012095chr1083516 3161 3026 2719 1086 593 249 38 11113 12184 --
NM_012096chr353007 2767 2729 2403 575 --2992 705 1941
NM_012097chr281780 1760 406 251 235 198 185 173 1513 ----
NM_012104chr1152817 1222 1162 671 174 23036 709 33369 3227 2418 --
NM_012104chr1152817 1222 1162 671 174 23036 709 33369 3227 2418 --
NM_012120chr672999 1941 1836 1021 917 429 32 --21897 605 --
NM_012137chr162812 2325 1875 1007 956 267 1752 2982 655 --
NM_012141chr1353877 3572 2710 1022 144 --13198 12973
NM_012154chr81775 1160 1651 1143
NM_012156chr2073174 3066 2907 2435 1329 889 102 --12079 11055
NM_012164chr9137159 6987 6482 6296 6286 6226 6072 5957 4648 1645 800 551 97 36611 5673 1241 37095 6473 2752 --
NM_012193chr1174998 4298 3779 3580 2157 306 94 14839 21765 1267 24721 1118
NM_012199chr164587 3238 1648 1307 1056 43 21562 1331 ----
NM_012210chr971005 520 504 391 353 183 109 ------
NM_012214chr2186243 5768 5630 5236 2506 2400 2391 2364 2343 2320 1994 1838 1702 1422 1288 1208 1083 134 --11574 --
NM_012219chr383188 2891 2781 2621 1200 739 568 187 22718 2462 12949 22770 956
NM_012234chr362887 1276 1184 440 304 227 --13121 1957
NM_012244chr1471641 1498 1209 1165 350 242 212 2737 594 11370 --
NM_012249chr273407 3336 3010 2344 861 431 246 21099 43 ----
NM_012250chr1121108 977 1501 --1175
NM_012252chr7115172 4861 4578 3746 3573 3476 2121 1961 1871 575 390 --13613 --
NM_012262chr1135236 4546 4350 3625 3612 3533 3343 3182 1536 1221 1075 865 653 24583 3645 164 --
NM_012281chr752068 1763 652 509 328 --21910 1879 1803
NM_012288chr6205676 5184 4970 4954 4924 4745 4620 4090 4065 3641 2308 2253 1887 1519 1387 876 769 571 357 197 --44792 3973 3760 1865 --
NM_012296chr11113476 3272 3252 3030 2963 2683 2645 2630 1507 118 55 1431 11311 13418
NM_012297chr452593 2141 2114 1919 919 1651 1553 --
NM_012301chr772254 1885 1683 1414 903 744 562 ------
NM_012306chr12133332 3150 3103 2253 2242 1289 1273 1026 740 659 532 445 377 12320 12992 12382
NM_012308chr1182494 2151 958 839 643 473 395 298 21899 511 1874 --
NM_012309chr11114957 4477 4133 4059 3637 3526 3210 1490 1438 582 339 44242 918 528 464 23134 263 24492 4256
NM_012316chr1165472 5409 5327 5098 4955 4775 4642 3769 3533 3488 2208 2056 1402 849 821 606 34549 3762 465 35481 3465 404 --
NM_012329chr1741200 1058 665 393 --11323 11088
NM_012334chr554237 4104 3697 532 216 11080 23569 3394 13428
NM_012382chr573855 2752 1687 1561 896 814 202 --12847 --
NM_012384chr20132278 2231 2032 1986 1839 1774 1642 973 881 787 514 249 50 --12023 --
NM_012420chr1041968 373 334 310 11494 12159 --
NM_012425chr1072572 2466 2351 649 204 142 30 11738 ----
NM_012464chr462904 2363 2016 1994 574 517 1712 1161 12233
NM_012471chrX61982 1641 1241 658 397 305 21439 61 --11901
NM_012479chr762305 1789 987 721 362 61 1483 32650 445 110 --
NM_013255chr7148753 7837 7571 7494 6973 3514 3078 2576 2409 2399 1878 1163 437 195 --32620 1575 232 26876 966
NM_013257chr852071 1778 759 625 467 ----12390
NM_013261chr473675 3401 3244 1518 1448 1409 846 ------
NM_013262chr651426 1118 903 382 35 11452 ----
NM_013269chr1264498 4206 4163 3873 1392 1259 ----14000
NM_013279chr1172210 2128 1824 1576 1528 642 170 --12199 1279
NM_013281chr2021199 529 ----11153
NM_013282chr19----1213 21329 344
NM_013286chr352713 2631 2543 2353 417 --33459 1129 883 13443
NM_013309chr1572395 2113 1650 1025 828 524 213 ----22434 605
NM_013336chr331939 358 156 --1304 2603 446
NM_013341chr272887 2735 2695 2681 2305 1138 883 ------
NM_013354chr831077 326 158 1165 ----
NM_013357chr82747 151 ----1206
NM_013372chr1562701 1082 1067 1027 547 31 156 1772 --
NM_013374chr372629 2584 2417 2218 944 514 415 ------
NM_013381chr1251823 949 853 516 378 ----12075
NM_013449chr12102994 2931 2171 2118 1132 1123 845 822 558 162 --1765 --
NM_013943chr162563 1234 1105 705 292 57 --12022 --
NM_013989chr1494280 3858 3214 1422 1114 1085 556 532 441 34318 4028 892 35034 3341 1220 --
NM_014000chr10121762 1753 1523 1499 1441 1355 1251 736 635 472 215 67 1392 11417 --
NM_014005chr542798 2411 941 830 22633 2237 --12269
NM_014034chr651552 1330 1042 528 450 1336 ----
NM_014048chr1655285 4186 3441 1053 633 11711 23480 1634 1461
NM_014056chr352171 2078 1733 758 487 --12321 --
NM_014106chr1552827 2018 958 940 666 1660 12131 --
NM_014112chr874979 4765 4458 4328 3831 3324 1030 13403 ----
NM_014117chr1692185 2033 1973 1904 950 749 417 306 207 ------
NM_014155chr11137556 7049 6335 6245 6073 5511 5418 5027 4843 2783 990 970 444 36653 1507 1476 16610 36881 6383 2748
NM_014157chr1683498 2810 2692 1288 1089 832 278 107 1927 41251 795 662 413 --
NM_014181chr272827 2045 1913 1884 1160 780 74 12600 ----
NM_014231chr12112225 2110 2072 2029 1908 1806 1605 1547 831 690 105 1697 ----
NM_014233chr1741811 1782 1519 645 21613 846 11363 1420
NM_014243chr462024 1938 1928 525 427 59 11886 ----
NM_014250chr2231848 581 367 --21639 1390 11368
NM_014253chrX1813 1515 --32115 1665 458
NM_014268chr1841275 306 160 103 ----1292
NM_014299chr1981594 1469 1403 738 682 672 594 580 2516 43 21502 54 --
NM_014309chr22105161 4598 4205 3994 3913 1553 1276 1115 689 277 43391 1213 743 703 25101 4495 --
NM_014319chr123656 445 413 21588 130 11575 --
NM_014331chr4206720 6378 6170 5905 5798 5716 5040 4938 2939 2745 2687 2468 2315 2219 2139 1984 1508 1375 1219 1187 25368 2390 27467 2146 27123 6258
NM_014333chr1182736 2366 2332 1022 1005 858 386 239 ------
NM_014352chr1131523 1024 227 21450 1017 ----
NM_014372chr152053 766 663 508 354 ------
NM_014376chr592559 2154 944 913 743 587 559 335 285 41931 1886 1861 403 ----
NM_014388chr1145520 5428 4869 4704 4392 3966 3927 2279 1488 1477 1303 1211 1027 795 36036 4812 342 24696 4032 11510
NM_014421chr481912 1756 1707 1393 810 590 311 205 1424 ----
NM_014423chr585415 3871 3608 3419 2036 2018 270 185 14773 24063 3805 1330
NM_014432chr661460 1084 394 362 146 64 --21072 100 --
NM_014445chr372401 2152 2138 1551 626 121 25 ------
NM_014494chr1672234 1850 1736 732 712 448 121 --1942 --
NM_014504chr751904 1677 1515 1337 266 --21505 152 --
NM_014517chr321887 1226 11462 --21269 297
NM_014571chr1112710 2699 2361 2090 1877 651 539 438 238 179 167 32645 790 219 42622 2505 2050 1226 --
NM_014572chr1341399 1239 517 38 152 11745 --
NM_014586chr21104243 4149 3552 3022 1839 1475 688 619 274 222 11779 14138 14506
NM_014591chr1041238 893 512 208 1393 182 1431
NM_014606chr44395 363 347 333 --11323 --
NM_014613chr5122488 2454 2168 2022 1887 1149 1082 1019 351 341 321 280 ----1718
NM_014614chr23589 407 184 2311 260 1166 1207
NM_014615chr1683656 3349 2920 2880 2738 2556 558 138 12895 ----
NM_014616chr373520 3275 2575 1177 579 99 44 12787 ----
NM_014630chr1593966 3770 3133 2817 2685 2678 1020 900 356 ----1976
NM_014634chr22123251 3114 2667 2429 1390 1290 1251 1225 1195 729 440 256 23103 2842 33263 918 700 --
NM_014636chr9114392 4004 3463 3276 2739 1746 1145 1138 887 757 724 23583 154 2852 317 --
NM_014646chr1852963 2946 2462 372 366 --1150 13021
NM_014660chr72850 253 142 --1956
NM_014676chr141549 1275 1073 31 ----11531
NM_014677chr831166 953 437 ----1148
NM_014683chr1741863 1739 1412 251 --1809 1699
NM_014690chr7112927 2258 2119 2087 1926 1229 1139 436 378 350 126 --11940 --
NM_014702chr663517 1100 861 338 216 120 12637 ----
NM_014707chr762295 1856 1691 533 348 44 ------
NM_014720chr1041746 1221 375 57 179 ----
NM_014721chr6147361 7157 7070 5363 5118 4894 4688 2849 2802 2733 2176 1941 1346 1155 --46736 5152 5034 779 11512
NM_014723chr20113123 2964 2947 2080 1286 1109 813 806 699 690 563 --21236 1054 --
NM_014729chr84613 495 330 24 21560 439 ----
NM_014730chr12135051 4870 4602 4310 3879 3479 2029 1904 1836 1621 1379 1184 229 24046 188 54329 3522 1513 1024 761 --
NM_014730chr12135051 4870 4602 4310 3879 3479 2029 1904 1836 1621 1379 1184 229 24046 188 54329 3522 1513 1024 761 --
NM_014732chr1695402 4255 4239 4034 3712 2194 1666 493 53 35262 1484 926 24402 4279 25633 4492
NM_014735chrX52091 1344 767 605 123 1757 11957 --
NM_014739chr663896 3470 3340 1688 834 731 14065 ----
NM_014743chr463205 2424 2306 2280 2257 1056 --32879 539 196 --
NM_014746chr2133682 3368 3202 2874 1576 1537 1530 1452 1202 828 699 503 417 13676 ----
NM_014747chr1185676 5556 4935 4745 4708 4612 4541 4418 3701 1931 1767 1586 1327 1303 753 729 487 137 14279 15694 11110
NM_014755chr273213 2863 2839 1566 1437 421 49 --11598 --
NM_014757chr532047 1646 1543 --1704 155
NM_014758chr11102536 2201 1961 956 870 597 526 492 457 182 1537 2444 25 1663
NM_014765chr142233 2204 480 30 12080 1175 --
NM_014766chr7173516 3509 3477 3355 2591 2327 1374 1293 1043 1010 990 923 778 635 628 596 40 --33196 2738 843 --
NM_014774chr183216 3122 2561 2290 2145 775 721 212 ----12244
NM_014776chr1292937 2866 2609 2526 2161 2038 1245 970 309 --22318 579 12991
NM_014787chr142539 1801 185 144 12640 ----
NM_014795chr251194 1001 504 106 26 --139 --
NM_014797chr683291 3265 2909 2733 2600 2445 2245 293 13091 1525 --
NM_014803chr1082910 2577 2563 2098 1147 868 440 299 --21042 606 --
NM_014810chr143631 2337 1287 821 2795 275 --11203
NM_014812chr121387 553 ----11261
NM_014826chr1103658 3550 3452 3030 2785 2663 1380 1149 1131 941 1161 43365 3304 1412 918 --
NM_014830chr1273202 2999 2616 2525 1068 743 508 ----13371
NM_014838chr2252655 1084 928 625 117 12755 22743 1947 12241
NM_014839chr172458 1982 1972 1830 1656 1602 71 ----11790
NM_014840chr1252632 2443 2234 1045 1012 1249 --13073
NM_014844chr1483742 3515 3287 3171 2605 1612 909 223 52912 1646 1453 345 168 34167 3922 1175 --
NM_014848chr15112657 2323 2254 2015 1936 1758 803 733 609 601 502 --1246 --
NM_014850chr374060 4046 3699 3572 3459 1665 1603 41496 1277 753 693 24608 84 --
NM_014870chr1144483 4402 3863 3733 3394 3044 1545 1502 1322 1068 775 659 622 165 33539 3284 2999 24498 734 --
NM_014873chr1134850 4313 3590 3266 1681 1457 1291 1267 1189 1063 925 680 419 1290 --14130
NM_014877chr17167716 7696 7166 7057 6779 5993 5331 5222 2667 2581 2459 2446 2051 1748 866 122 25421 2858 36995 6292 5343 12836
NM_014883chr462214 1839 1561 532 290 151 --1955 --
NM_014893chrY52252 2084 315 162 149 --1176 --
NM_014901chr572102 2028 1590 717 627 598 584 --1701 1124
NM_014904chr1072821 2500 2453 1458 1028 641 227 13797 13055 1378
NM_014906chr1753157 817 800 296 258 --1678 23691 584
NM_014918chr151452 ----21428 514
NM_014920chr693549 3485 3438 3224 2835 1504 1372 1344 997 33606 714 348 21009 31 --
NM_014932chr331377 1219 679 ----11316
NM_014934chr13103260 3124 2980 2811 2539 1330 1263 1034 546 107 127 --13808
NM_014946chr242637 2224 534 340 --1896 12769
NM_014951chr1072495 2147 991 908 591 512 55 12603 22552 923 --
NM_014952chr1531803 481 215 2684 536 --41986 715 558 475
NM_014959chr19152803 2779 2467 2324 2184 1442 1347 1325 1149 877 608 406 375 234 45 --43367 3155 914 442 11286
NM_014982chr1453520 1846 1760 1659 290 1871 --2809 599
NM_014988chr472500 2383 2329 2186 1763 1753 777 --195 --
NM_015008chr393355 3011 2995 2968 2494 2388 1160 803 532 1427 13640 --
NM_015012chr112380 44 ----1111
NM_015020chr1653300 2387 1252 613 219 23706 743 53558 3240 2860 1192 545 13600
NM_015025chr251965 1921 1038 859 208 ------
NM_015026chr1253765 3352 3130 1423 1073 --23296 1221 --
NM_015033chr952677 2446 1053 742 62 23237 478 1901 13044
NM_015035chr2096718 5935 5640 5430 5295 4115 1713 213 97 24176 132 14469 26616 1488
NM_015039chr1104133 3522 2885 2833 2683 1027 401 362 323 284 --1440 33574 1451 859
NM_015042chr15124068 3868 3262 3204 2985 2709 1681 1504 918 541 243 124 11291 34111 3216 882 --
NM_015044chr1692865 2828 2676 2339 2136 1220 720 432 268 --42556 775 601 446 12653
NM_015051chr952225 1369 1184 808 413 13114 22888 2526 --
NM_015055chr1152886 954 776 257 119 22084 599 ----
NM_015056chr2182297 2215 2060 836 669 379 261 102 --21973 700 11822
NM_015059chr15153794 3588 3350 3295 3080 3020 2661 2594 1555 796 555 421 245 140 109 11111 --23380 312
NM_015064chr12103564 3257 3026 2710 2677 2651 2452 923 507 166 23430 331 12218 --
NM_015068chr772725 684 648 619 601 245 59 1710 1292 --
NM_015071chr5136551 5274 5204 4965 4535 2332 2268 661 622 473 268 177 61 24716 4218 32089 1272 1198 --
NM_015072chr14------2533 407
NM_015074chr174005 3870 3387 1564 1235 928 599 14157 11824 --
NM_015076chr684260 4251 2826 1694 1329 396 319 265 --23813 716 --
NM_015077chr1784361 4228 3299 3052 2897 1615 1138 42 23182 577 33835 3420 1064 --
NM_015087chr13112638 2485 2234 2054 990 794 519 471 232 216 117 ------
NM_015090chr1105971 5931 5893 5679 4821 4612 2471 2409 567 355 14957 55913 4262 1376 1368 1155 32229 2190 1533
NM_015092chr1664371 3946 3911 3157 1678 1542 ----1882
NM_015094chr2263899 1722 1471 873 594 205 13537 24100 2990 34474 3945 3396
NM_015097chr342158 915 294 78 22378 2230 21868 112 --
NM_015107chrX42450 2038 2000 656 1875 1242 1603
NM_015110chr972352 1989 1865 498 405 254 164 --1897 --
NM_015129chrX51443 1192 324 174 56 --1285 21593 722
NM_015132chr741475 1228 160 154 --11757 --
NM_015138chr1592470 2413 1144 989 940 823 813 800 541 ------
NM_015143chr42239 25 --1328 11279
NM_015144chr1641559 456 334 315 23366 781 33410 3265 824 1127
NM_015154chr1573345 3089 2962 2847 1098 278 82 --42824 2784 2509 1288 --
NM_015156chr1444006 1384 642 136 11304 1325 1197
NM_015161chr1611462 --1516 11033
NM_015191chr1152026 1097 291 64 52 --12658 --
NM_015192chr2052745 2528 247 162 94 2730 141 ----
NM_015194chr1791979 1872 1822 1549 1480 1360 1329 506 55 1115 22084 620 --
NM_015199chr352199 2089 1832 694 25 12009 --22331 861
NM_015200chr451934 1611 433 347 300 12319 11944 --
NM_015205chr1343353 832 134 66 13701 --13566
NM_015206chr1563741 2751 1298 440 321 240 --11074 --
NM_015208chr1893969 3832 3263 2844 1610 1505 1201 782 401 12835 33720 3584 2896 --
NM_015215chr162796 2672 2606 543 464 336 --2494 315 --
NM_015216chr541293 1247 484 443 ----11569
NM_015225chr972896 2707 2339 564 359 191 95 32527 2516 2033 ----
NM_015227chr2173396 3303 3182 3115 982 150 72 2436 124 43440 2302 890 160 --
NM_015231chr111323 ----1676
NM_015233chr1372449 2431 2359 2230 1031 836 125 1850 2655 508 --
NM_015265chr272598 2498 2141 2067 667 614 587 ------
NM_015267chr1261759 1727 1383 558 368 153 21641 601 --21976 879
NM_015270chr123604 257 131 ----22012 1820
NM_015271chr4103947 2926 1560 1333 1291 933 610 555 122 61 ------
NM_015272chr1661932 1734 329 246 194 59 12098 ----
NM_015277chr1851466 634 601 193 172 11569 ----
NM_015282chr242014 975 657 143 22059 54 11022 12584
NM_015284chr1172129 2075 2039 1981 1898 1783 1723 1714 1573 1537 1346 794 598 534 470 441 414 ----12031
NM_015285chr1862309 2264 1694 1582 931 350 --52278 1804 565 157 91 1665
NM_015288chr562806 2484 1173 1016 568 22 23821 97 53784 2693 2590 942 77 33144 3026 699
NM_015299chr14123555 3496 3422 3367 3246 2450 902 894 789 679 538 222 --11573 11287
NM_015310chr8177036 6990 6814 6642 6442 6191 5813 5361 5341 3161 3110 1606 1425 1318 1189 989 324 37026 6620 2435 17706 --
NM_015313chr1164825 4799 3636 3394 2946 1287 13528 13553 --
NM_015314chr74757 710 482 212 1745 22146 1653 12539
NM_015315chr563220 2312 747 560 231 76 --13392 --
NM_015326chr1122811 2785 2678 1818 1100 891 864 742 613 326 185 66 ------
NM_015328chr742818 802 477 260 1834 42011 1024 930 407 --
NM_015329chr1972940 2648 2187 2075 522 176 155 --1534 1445
NM_015335chr1221725 519 1730 1139 11850
NM_015336chr1241685 428 279 69 --42482 2423 927 887 --
NM_015344chr862120 1767 1617 809 680 132 --11396 --
NM_015347chr1262141 2082 1857 715 245 190 12476 12198 --
NM_015349chr662285 2211 2131 2116 2024 1226 --12099 --
NM_015358chr2141291 1066 1039 843 1898 ----
NM_015365chrX94098 3481 3315 2998 1389 615 365 334 294 --21705 50 --
NM_015382chr143771 586 116 ----1291
NM_015385chr1052953 2486 2455 906 778 --1429 --
NM_015397chr971959 1778 1650 1498 1388 739 78 1386 146 --
NM_015455chr573733 3201 3138 1311 1080 959 257 13294 ----
NM_015458chr8105009 4454 4068 3934 1955 1325 1223 973 561 142 14370 33754 1864 490 14232
NM_015460chr351535 1325 622 218 93 21935 174 --11470
NM_015526chr1941130 1070 935 283 11079 192 1269
NM_015535chr2114120 4044 3744 3612 3599 3415 3013 1679 1350 1309 1280 12795 --31527 1491 1342
NM_015550chr772911 2261 1140 882 821 380 306 22986 749 1406 --
NM_015555chr64661 447 431 325 11457 1255 --
NM_015557chr173499 2868 1256 1186 833 588 335 1431 42506 1426 1092 41 22782 284
NM_015560chr352667 2633 2385 954 689 --12495 2491 369
NM_015564chr593523 3405 3323 3252 2645 2342 1366 1157 108 1555 12547 --
NM_015568chr20154287 3917 3651 3542 3087 2951 1679 1526 1461 1324 1304 1236 1119 449 283 43688 2853 1686 890 21737 1009 --
NM_015569chr174706 4549 4328 3398 3025 1826 402 ----21349 562
NM_015571chr652345 2301 1927 1057 142 12642 1199 --
NM_015575chr282822 2809 2371 2347 2310 805 525 128 32622 313 193 ----
NM_015584chr177931 502 484 457 414 359 226 1352 --11314
NM_015605chr1061377 996 619 595 460 257 --2402 267 --
NM_015609chr1122817 2505 2491 2319 2172 1904 1086 873 752 663 482 198 12653 12579 --
NM_015640chr1114653 4056 4032 2065 1857 1595 1528 1288 755 581 304 --34864 1940 1894 23455 1190
NM_015657chr2124 ----1427
NM_015678chr1321151 1077 --1381 11299
NM_015713chr873175 3106 2896 1006 826 610 532 --12312 --
NM_015723chr73745 627 22 ----1682
NM_015726chr161852 1786 1527 579 135 72 1515 11705 11677
NM_015878chr852099 1771 1685 1367 63 ------
NM_015879chr18188278 7634 7124 7032 6653 6471 5966 5754 5250 3081 2656 2343 1489 1389 1345 1222 1066 884 37754 3433 943 16826 25641 5334
NM_015886chr8105051 4549 4449 1514 1188 940 782 659 471 306 11661 24560 4537 --
NM_015888chr153088 2970 2667 2499 1279 ------
NM_015906chr164488 1157 1063 793 762 543 --1876 1734
NM_015981chr572228 2064 1940 703 611 429 79 2720 414 32456 2037 1225 1873
NM_015995chr15115296 5216 5183 4574 4201 4173 3911 3881 3692 824 473 15012 35420 3614 251 11190
NM_016009chr164919 3995 3519 3385 1052 528 34729 3100 1322 ----
NM_016018chr842796 2778 2708 550 12816 1467 1286
NM_016025chr1641898 1812 1385 1273 --11492 1312
NM_016059chr61359 1793 1331 1725
NM_016061chr251595 1585 1062 667 180 11112 31626 589 30 --
NM_016072chr1242183 1992 867 284 --1416 --
NM_016075chr1383148 2938 2645 2149 890 845 631 141 12688 12957 --
NM_016083chr683609 3565 3252 3039 2863 971 963 159 12910 ----
NM_016096chr882104 1819 1552 1522 1468 1428 677 358 151 ----
NM_016132chr1563336 2809 660 590 51 27 --1680 12430
NM_016133chr221206 1066 11551 --11347
NM_016152chr341276 1142 196 47 --1989 --
NM_016169chr1082763 2333 2316 1020 891 835 344 59 22354 1251 2732 418 --
NM_016201chr3102175 1431 759 724 587 474 392 143 125 63 --1815 --
NM_016206chr3168699 8419 7717 7476 7247 5675 3596 2647 2507 2357 2286 2235 1722 1395 672 77 31522 509 175 38054 6927 2267 16126
NM_016217chr663402 1270 957 840 470 170 13691 ----
NM_016248chr1394003 3447 3295 3249 2758 2445 1169 897 365 ------
NM_016255chr692540 2534 2353 2194 1296 1091 661 502 24 --3928 919 881 32296 1288 1136
NM_016257chr1103064 2814 1405 1391 997 680 623 608 468 81 13051 --12699
NM_016260chr287549 6458 6109 4948 2354 1430 1083 701 16188 32876 2555 1877 17590
NM_016272chr2242530 2003 376 110 22780 1022 32460 1826 1794 --
NM_016282chr93334 75 47 1471 21408 432 --
NM_016298chr372762 2685 2518 2329 2046 977 174 22256 1001 12037 --
NM_016376chr17104384 3710 3375 3242 2987 2688 1109 403 371 330 33648 3278 351 24152 3205 13435
NM_016396chr1572984 2518 2172 2158 1038 819 420 1176 12755 --
NM_016422chr1163013 1108 974 731 219 165 1299 22389 2269 --
NM_016507chr1732197 627 37 ----11096
NM_016513chr693549 3485 3438 3224 2835 1504 1372 1344 997 33606 714 348 21009 31 --
NM_016530chr1584096 3923 3307 1327 967 747 155 94 ----23387 627
NM_016531chr453997 1643 1370 1339 905 12813 --1815
NM_016544chr2103619 3558 3518 3101 3086 2882 1332 1174 840 257 12408 --190
NM_016559chr341398 1076 602 277 1547 ----
NM_016569chr1241199 499 288 30 --21236 1068 --
NM_016577chr3104546 4248 3901 2943 1355 597 384 71 56 25 --24034 3358 11598
NM_016578chr11----1218 189
NM_016603chr53571 555 362 1623 --1494
NM_016621chr1144432 3809 1365 34 1123 23964 1295 11644
NM_016626chr1861791 1259 1170 1089 419 83 ------
NM_016652chr2041689 1220 1157 212 --1384 11635
NM_016654chr152885 456 ----1331
NM_016929chr684580 4015 3779 3672 1825 1616 1458 1287 23500 1737 73358 3345 1846 1765 1587 1066 604 1340
NM_016946chr152873 2790 851 528 196 32727 1361 733 31291 1270 1225 --
NM_016952chr1174021 3263 3000 2730 2718 1637 527 12888 --1432
NM_017412chr82971 464 ----1433
NM_017415chr5114564 4012 3856 3478 3146 2859 1488 1330 1237 989 773 1927 31732 954 678 --
NM_017420chr1453533 2533 792 557 80 13706 ----
NM_017447chr2123687 585 148 13147 1219
NM_017452chr2041377 481 373 285 ----11096
NM_017453chr2041377 481 373 285 ----11096
NM_017454chr2041377 481 373 285 ----11096
NM_017456chr1741774 1299 1289 775 ----21787 122
NM_017563chr3136154 5856 5722 5356 5312 4473 4241 3881 1697 1635 1225 775 490 44563 2283 1806 805 64853 4817 4414 2471 2153 1260 --
NM_017596chr1114085 3951 3864 3612 3347 1564 988 764 727 400 192 24233 4099 23383 896 14654
NM_017628chr4105144 4929 4739 4320 3534 3276 3268 918 631 118 --35287 4055 3561 11388
NM_017634chr81179 ----2758 412
NM_017637chr9169211 9079 8683 8232 8220 7968 7109 6182 5961 3424 3273 3180 2600 2158 2015 1309 39038 8067 7123 16089 11013
NM_017643chr1762970 2217 1897 968 741 253 1126 11981 --
NM_017644chr3114564 4019 3755 3731 1672 1527 1351 1253 1197 698 176 14299 24377 1049 13139
NM_017650chr7114747 4663 4323 4208 4091 3713 2346 1409 1247 1153 1136 24622 3826 31503 1014 516 --
NM_017658chr1424116 800 13632 --13062
NM_017666chrX61696 687 607 526 82 55 21714 295 ----
NM_017709chr1134094 3598 3370 2822 2646 1274 1076 967 908 375 255 55 22 --21433 420 --
NM_017714chr201106 130 --1941
NM_017736chr1682933 2383 1033 943 710 262 122 32 12054 22814 1948 --
NM_017737chr15632 582 353 222 162 --21565 206 --
NM_017742chr1861365 1336 1322 1245 1227 415 --1406 1106
NM_017744chr132476 1643 946 --42044 882 734 162 --
NM_017752chrX3605 470 251 1847 --11620
NM_017754chr6114339 1975 1924 1842 1765 1313 1099 437 298 206 153 1429 3922 866 630 --
NM_017770chr672825 2816 2279 2070 1070 576 331 11975 ----
NM_017772chr651704 1594 1564 1143 593 --21582 452 11344
NM_017791chr1451264 1189 600 292 220 1149 21692 396 --
NM_017811chr982522 2169 1047 969 748 571 152 40 42734 2440 2359 2002 ----
NM_017824chr101416 22244 616 32453 2061 929 1381
NM_017847chr111971 11722 1891 2846 206
NM_017848chrX44455 3949 3686 237 24463 1113 21806 1721 44165 2850 1271 1134
NM_017866chr8------2740 131
NM_017902chr10205468 5451 5254 5127 4534 4442 4414 4182 4155 4001 3981 3632 3589 2253 1828 1650 1427 811 406 273 --23831 1021 --
NM_017919chr9135695 5410 5119 4854 4791 4390 2036 1932 1918 1174 1159 979 855 13789 14106 --
NM_018013chr673031 2968 2611 2472 2177 2164 1965 1151 1786 --
NM_018036chr14124355 4345 4070 4041 3945 3027 2859 1748 1632 1107 524 106 ------
NM_018048chr1251860 1665 1564 1502 395 --2776 291 --
NM_018084chr242398 788 690 681 --162 --
NM_018085chr1248158 7960 7684 7317 6660 6534 6480 6264 6129 6049 6004 5882 5057 2982 2690 1756 1621 1567 1334 1198 936 641 205 89 17281 47415 2627 532 492 1277
NM_018133chr342163 1993 1950 1732 1846 ----
NM_018137chr121181 950 --3927 469 431 --
NM_018155chr373186 3071 2667 2631 1121 582 408 --1915 --
NM_018182chr1761726 1599 749 699 537 49 1687 2453 277 --
NM_018184chr361414 807 319 130 93 22 145 12002 178
NM_018191chr1331849 1825 119 ----1205
NM_018200chr15112376 1963 1783 1019 803 778 640 272 263 248 199 --22340 2183 --
NM_018211chr121842 198 ----2450 118
NM_018221chr22423 384 ----1411
NM_018227chr442709 2062 1967 991 --13085 2999 916
NM_018234chr251936 1628 880 857 848 ----1757
NM_018243chr4123610 3563 3464 3266 2736 2601 1424 1388 949 899 356 26 --1864 --
NM_018247chr652249 1924 1129 1093 999 1968 ----
NM_018254chr151684 1621 1526 697 461 12001 11663 --
NM_018263chr262547 1938 1892 1781 818 283 11680 1401 --
NM_018293chr322193 1938 ----31912 583 222
NM_018299chr843421 3260 869 23 --11334 --
NM_018318chr122656 96 --3967 800 119 --
NM_018322chr62841 268 --21052 321 1426
NM_018325chr931387 143 108 --11106 1201
NM_018327chr2031676 1639 490 21218 195 --1114
NM_018351chr12114324 4024 3852 3792 3686 3372 1655 1437 1302 902 410 13654 23982 3470 13239
NM_018362chr1153849 3326 2709 1478 450 21466 167 12506 1887
NM_018364chr132763 822 529 11063 12969 --
NM_018370chr1232007 1724 145 --11589 1177
NM_018373chr1496034 6009 5482 3986 1850 1441 1308 1175 754 13924 15850 26259 3903
NM_018374chr7104337 2068 1813 1805 1387 871 810 455 75 49 14160 ----
NM_018403chr3103566 3442 3269 3263 2912 2831 2718 2594 1573 145 12604 53920 1059 1040 318 159 --
NM_018409chr442661 2341 2270 859 22127 1069 ----
NM_018416chr12112218 1988 1959 1867 1612 1052 965 952 667 615 445 --1214 --
NM_018440chr8208450 8160 8087 7937 7650 7644 7372 6721 6684 6166 3224 3033 1907 1741 1562 1103 964 810 275 148 27985 3444 15659 --
NM_018452chr6_random93728 3423 2723 2635 1533 1072 751 196 94 ------
NM_018482chr872482 2136 1885 1759 941 384 367 1986 22616 436 --
NM_018490chr1161762 1211 483 445 145 68 ------
NM_018566chr184833 4795 4285 4057 3842 3444 3193 63 21956 1373 44644 4265 1289 971 11272
NM_018638chr1245247 4991 4890 3999 23864 3442 --11529
NM_018660chr862921 2699 2558 1920 1903 294 1399 12450 --
NM_018685chr71390 ----1255
NM_018689chr1532410 2158 2061 1645 --12358
NM_018715chr172163 2034 1854 1464 255 191 53 12092 1354 --
NM_018718chr771987 1787 1610 1530 498 471 64 ----182
NM_018841chr1103086 2597 2563 2535 1567 986 848 215 152 33 1546 53361 3189 1345 539 117 13479
NM_018844chr751831 1729 1655 1443 195 --22046 1539 --
NM_018945chr6103553 3455 2937 2804 2246 1040 1028 820 687 349 11326 11062 --
NM_018958chr1593913 3405 3360 3243 1452 1218 1167 1148 329 12882 13801 13481
NM_018963chr2151524 1208 465 149 76 ----1273
NM_018979chr1232425 1868 811 --22525 881 --
NM_018999chr1094841 4420 4140 1873 1337 929 707 592 328 --24203 4125 --
NM_019001chr3114567 4268 4256 4091 3822 3466 3081 1722 1551 1501 39 13784 33759 3510 1150 --
NM_019008chr2293806 3109 2979 2600 1443 1283 1204 361 188 12946 ----
NM_019027chr462373 1907 1781 1682 796 210 ------
NM_019063chr242113 1984 797 115 1688 11486 --
NM_019072chr583539 3313 3285 3193 2756 2748 1582 424 ------
NM_019080chr1351485 1479 1273 970 345 ----151
NM_019094chr1283750 3718 3605 3491 1325 791 375 277 --13175 1502
NM_019106chr22123372 3337 2993 2842 2521 2460 2403 2322 2251 2236 2133 848 22782 880 11067 --
NM_019590chr1041486 1431 1320 960 1331 11198 --
NM_019592chr94812 564 248 139 --1296 1852
NM_019593chr2053031 2926 2882 990 567 --1101 --
NM_019610chr151615 819 297 267 31 --2478 312 --
NM_019859chr1071331 1109 647 430 343 330 236 1268 1213 1522
NM_019860chr1061379 1157 478 391 378 284 1316 1261 1570
NM_020116chr441194 1144 99 85 ------
NM_020122chr2105512 5036 4730 4620 3654 1616 1376 917 476 165 24430 3814 15211 11005
NM_020123chr105969 540 260 170 160 1438 ----
NM_020132chr2165077 2078 1653 648 497 203 14181 14780 --
NM_020148chr1893121 3073 2465 2400 2322 2245 1178 654 415 ------
NM_020182chr20103454 3224 2251 1418 1325 1267 1019 965 944 782 13246 12848 33087 2874 2213
NM_020184chr292056 2004 1982 1710 1653 843 428 387 353 1496 22037 414 --
NM_020198chr1741534 1022 1001 83 ----1215
NM_020200chr1061104 1097 1038 1010 477 180 131 1324 --
NM_020239chr172026 2020 2008 1960 1727 748 521 22147 1578 31702 637 51 --
NM_020245chr6134874 4410 3974 3784 3129 1821 1803 1383 1042 1015 903 594 444 11873 11498 11715
NM_020309chr193369 171 159 1937 41033 873 133 32 --
NM_020319chr75672 248 207 172 61 --1274 1830
NM_020336chr2063514 3265 1343 1248 624 312 41475 997 416 194 --23383 2800
NM_020337chr452793 2746 976 672 174 --32853 827 658 --
NM_020340chr6102200 2061 1826 1400 888 815 589 393 150 132 1117 31630 687 282 --
NM_020342chr252613 2427 1984 1925 891 ------
NM_020390chr3134078 3764 3356 3233 3203 3121 1967 1733 1330 1223 905 858 216 11657 23280 777 11564
NM_020416chr452694 660 642 635 607 2533 445 32185 1706 176 1837
NM_020420chrY51828 1526 1474 153 98 --11184 --
NM_020429chr7112943 2863 2819 2451 2381 2258 2173 2147 2108 529 498 32294 485 103 21233 1121 12238
NM_020432chr721694 99 ----137
NM_020438chr961303 1223 1181 1037 458 345 21257 1105 1470 --
NM_020440chr192638 2529 2381 1260 875 643 237 197 117 --23163 2428 --
NM_020443chr1246980 6597 5848 5824 5557 5448 5429 5160 5134 5050 4908 4822 4724 2789 2731 1988 1485 1326 972 911 457 444 373 362 25332 4921 35232 952 181 --
NM_020456chr1321938 820 12001 11720 11952
NM_020463chr231408 1240 87 --2264 173 --
NM_020465chr1631845 661 248 11248 11978 11565
NM_020466chr674403 4134 3748 3212 462 326 202 11805 ----
NM_020474chr1862032 1770 1636 1583 1301 392 ------
NM_020526chr181771 1597 1518 1341 674 402 339 116 ----1247
NM_020648chr1862785 2202 1979 1842 652 95 22614 2224 12160 --
NM_020654chr341660 1602 1428 608 ----11158
NM_020666chr51675 ----1917
NM_020699chr174500 3439 3423 1540 1318 896 526 --23976 1607 --
NM_020711chr221679 25 2887 604 1574 11609
NM_020718chr16105558 4984 4811 4542 2512 2381 2319 1927 767 714 15754 46026 5468 4714 571 16383
NM_020727chr2193897 3805 3556 3529 3330 2452 1604 1079 645 21033 978 ----
NM_020728chr752774 2634 2575 2364 217 12311 41145 1131 907 488 --
NM_020742chrX82600 2303 2120 1677 885 333 167 22 --22323 194 --
NM_020752chr1052510 1039 1023 239 78 1556 22708 1911 22444 2157
NM_020766chrX63522 2899 2891 1097 522 119 13709 21774 987 --
NM_020772chr1787975 6908 6248 5378 5292 3454 1969 649 21864 82 11021 --
NM_020774chr1866004 1892 1414 1058 979 952 22054 489 24347 2349 --
NM_020781chr733088 2921 904 22479 812 --31143 985 324
NM_020792chr392684 2480 2082 1886 1717 1710 560 517 352 12331 --1215
NM_020794chr141249 1160 419 282 1508 11359 21373 1086
NM_020796chr542825 2676 2544 73 11028 12152 12451
NM_020810chr1483211 3110 2473 2240 1126 750 499 265 --13310 --
NM_020825chr16103283 3149 2502 1379 1237 1221 1155 1043 898 813 --13810 --
NM_020830chr292648 2294 2160 1205 1098 1078 790 391 343 13224 2728 624 --
NM_020834chr1471901 1879 746 722 557 546 405 --11710 21308 531
NM_020841chr1253986 3299 2459 1586 1170 --13155 --
NM_020858chr1562067 1515 859 707 370 21 --21903 915 --
NM_020860chr41400 --2281 120 1470
NM_020861chr631351 142 134 ----1369
NM_020870chr431717 1564 539 192 --1728
NM_020872chr361650 1640 1570 1341 1303 375 ------
NM_020899chr1751844 1756 1627 209 172 22197 946 3724 440 429 --
NM_020917chr1953853 3719 2605 1240 175 21250 1067 1592 --
NM_020918chr1042727 2297 2287 911 12256 1170 11374
NM_020921chr1473333 2268 1374 1236 205 120 68 23597 2595 23408 3153 12861
NM_020922chrX31170 322 141 --1311 11280
NM_020935chr234423 4199 2993 ----11492
NM_020948chr1123561 3480 3328 3257 3068 2498 1306 1133 618 473 330 252 ----22901 662
NM_020951chr1962410 2079 1723 502 407 242 11700 --12025
NM_020956chr195962 746 689 541 231 91878 1839 1761 1683 1605 1590 1375 403 339 ----
NM_020962chr15102421 2163 2094 1712 1623 696 679 521 446 122 2784 723 12522 --
NM_020964chr18114665 4374 3697 1705 1537 1173 1043 624 476 344 301 33628 1523 376 --1520
NM_020975chr1031703 1298 194 --21760 115 1662
NM_020977chr472128 1814 1678 1490 768 282 187 1751 ----
NM_020980chr1571747 1621 1603 1389 1299 499 493 ------
NM_020983chr123604 257 131 ----22012 1820
NM_021007chr262001 1926 1889 883 574 21 --11659 --
NM_021020chr8103548 3028 3019 2552 2495 2308 2274 548 367 175 11240 31273 852 233 --
NM_021032chr33536 74 55 1722 ----
NM_021033chr1332373 911 424 --13057 13352
NM_021061chr8114539 4175 4040 1526 1502 1287 1242 1095 549 384 29 14298 13894 --
NM_021079chr1792563 2397 2336 2073 2045 1261 1176 1103 863 12852 23294 222 --
NM_021090chr22154825 4529 4292 4099 4032 3458 3053 1699 1652 1608 1540 969 797 198 43 34866 3449 954 11767 14061
NM_021096chr22103222 3180 2967 2541 2511 2303 1304 1227 431 191 1322 ----
NM_021097chr273049 2574 1951 1016 938 916 797 --31968 728 175 --
NM_021101chr371737 1016 984 790 348 242 223 --11551 --
NM_021105chr3--1535 --1740
NM_021110chr83769 701 641 ----1263
NM_021116chr7198928 8861 8617 8150 8137 8076 8027 7027 6407 6141 2449 2429 2415 2159 1982 1754 802 358 233 15886 57700 6110 1949 710 299 --
NM_021191chr1282133 1770 1758 313 268 172 161 47 --22554 813 --
NM_021202chr2072577 2554 2189 1904 1226 809 353 --22627 459 --
NM_021215chr204733 561 548 275 11686 1464 1720
NM_021255chr1453622 2699 2686 1614 683 11286 23840 3193 12672
NM_021629chr374795 4338 3218 1879 1744 1213 563 13986 1894 --
NM_021633chr13472 206 91 --1453 177
NM_021635chr671879 1748 1439 1369 679 246 189 11521 --131
NM_021638chr4124907 4848 4125 3741 1967 1946 1849 1799 1379 1020 863 218 44450 3489 3266 1275 11136 13198
NM_021648chr682657 2256 2187 1844 936 915 828 545 1524 11710 --
NM_021705chr681340 1272 484 396 354 333 51 42 ----11420
NM_021813chr6155027 4861 4855 4655 4085 3749 1660 1412 1156 1036 687 535 509 347 21 35301 4199 1252 35378 3590 320 --
NM_021911chr595020 4752 4555 4494 2133 2081 1907 882 507 14223 2712 204 11057
NM_021912chr1554072 3888 3298 3028 911 23916 1242 33805 3012 151 --
NM_021914chr1462312 1856 1731 659 583 106 ------
NM_021942chr41210 ----1702
NM_021954chr13103409 3283 3019 2962 2493 1176 385 126 101 74 12589 --13559
NM_021959chr67748 630 390 379 358 265 246 1159 --1841
NM_021960chr142617 2576 2348 572 12126 1507 193
NM_021961chr11207036 6858 6281 6038 5639 5408 5022 4707 4647 2865 2776 2602 2291 2146 2002 1690 1597 1478 1366 415 32627 2202 1494 --12753
NM_021964chr3156559 6470 5218 5102 5071 5048 2658 2651 1885 1733 1621 1239 955 833 305 --14331 16553
NM_021970chr42707 119 ----1572
NM_021977chr693267 2729 2501 2382 923 657 634 436 337 --12622 --
NM_022037chr21325 ----2659 238
NM_022048chr15265643 5518 5294 5233 5133 4877 4813 4770 4529 4520 4229 4187 4093 4067 3891 2432 1790 1734 1573 1531 1445 1176 557 501 275 73 66063 5083 4385 1590 1135 220 66079 5056 2300 1624 1010 899 35475 4290 4136
NM_022073chr1421594 1433 --21237 601 21408 467
NM_022114chr184752 4541 3982 3733 3666 1353 1123 147 ----13858
NM_022133chr831877 1262 708 ----11516
NM_022138chr6--1363 --2515 30
NM_022166chr16145585 5316 2252 2243 2230 2104 1707 1697 1496 1414 1115 688 650 284 26104 5380 15566 12267
NM_022173chr21325 ----2659 238
NM_022351chr8103362 3288 3268 3248 3176 2867 1349 1343 1293 206 --13276 --
NM_022456chr12207597 7412 7239 6063 6049 6002 5964 5687 5604 5590 5298 5164 5097 4854 4788 2889 2117 421 208 84 1623 26502 5982 --
NM_022459chr1386277 6013 5864 5123 4209 4108 3860 399 15714 34323 4199 1927 25962 1909
NM_022462chr19133294 3252 3193 3146 2725 1522 1512 1402 1004 712 269 249 200 53113 2421 2382 1458 760 22573 368 --
NM_022465chr12112949 2835 2493 2457 1138 1033 726 378 344 237 78 12287 31162 1025 875 12642
NM_022469chr142750 2485 401 340 --23067 634 13229
NM_022473chr1531435 1306 973 --11238 24171 1063
NM_022475chr41670 ----1135
NM_022482chr20102377 1989 1959 1594 959 953 653 404 386 207 12333 --1938
NM_022491chr1283059 2997 2455 2425 1266 1107 806 500 32826 2195 209 --22693 540
NM_022497chr3103824 3747 2973 2865 2640 2555 1126 992 256 227 --11453 --
NM_022648chr294415 4395 4245 4061 3522 3147 1756 1716 1064 33809 1108 526 ----
NM_022719chr2293917 3368 2395 1417 1089 671 657 640 333 21464 778 13522 --
NM_022739chr1731002 937 275 ----2867 285
NM_022745chr142528 2360 503 208 --22615 433 21948 813
NM_022755chr962545 2330 2070 729 284 209 1879 --12445
NM_022781chr963120 1261 1126 860 685 89 --1956 --
NM_022817chr232146 514 84 32172 384 323 1394 --
NM_022828chr541670 1557 1250 685 11117 ----
NM_022831chr121758 1532 --11420 1642
NM_022893chr252673 2201 890 850 249 --1436 --
NM_022894chr21451 ----1585
NM_022898chr1474366 3945 3932 3507 1620 1309 1124 13998 11288 --
NM_022910chr1631845 661 248 11248 11978 11565
NM_022912chr232286 803 322 32903 1979 629 22833 875 12264
NM_022977chrX72083 2045 1819 1799 1691 1682 381 11870 ----
NM_023000chr1411126 --2126 24 11612
NM_023001chr1411126 --2126 24 11612
NM_023016chr252393 1838 1135 822 688 --12554 --
NM_023112chr14113005 2988 2915 2806 2595 2479 1950 1026 942 670 557 22153 831 --11993
NM_023923chr193773 3631 3025 2681 2657 1333 755 415 290 --188 --
NM_024052chr1752881 2853 2578 2336 712 2689 352 22447 2004 --
NM_024117chr931323 941 488 ----1532
NM_024295chr881810 1527 1499 401 350 307 186 48 --1585 --
NM_024423chr1874169 3924 2826 1581 382 320 263 11318 1919 --
NM_024430chr1851388 1364 1189 492 403 --2553 238 11251
NM_024551chr1242325 1825 1006 877 12518 32576 1705 788 --
NM_024551chr1242325 1825 1006 877 12518 32576 1705 788 --
NM_024567chr84293 235 194 181 1613 1516 --
NM_024582chr431088 1003 848 --2738 342 --
NM_024590chr441924 1328 1272 599 --161 --
NM_024624chr241497 1363 1283 447 --11243 1399
NM_024638chr362506 2166 800 738 603 462 12271 ----
NM_024639chr662902 2091 2009 1955 1870 828 179 ----
NM_024646chr183280 3089 2896 2763 2677 2528 1576 236 21307 331 ----
NM_024659chr21679 --1822 2223 58
NM_024665chr354327 3898 3131 3059 3053 1630 ----
NM_024674chr193167 2594 2460 2340 2049 805 428 350 114 --2787 285 --
NM_024689chrX61632 1389 1354 1297 587 244 148 21829 335 --
NM_024735chr1681569 1502 1430 759 637 550 305 29 21946 1878 --11477
NM_024751chr451565 824 593 298 240 --12021 --
NM_024761chr9154726 4358 4287 3894 3888 3494 3460 3381 2075 1827 1711 1355 1191 377 103 34945 3912 1207 --1822
NM_024770chr2206641 6136 5203 5118 5112 5065 5007 4581 4392 2078 1943 1505 1481 1055 807 672 573 400 379 74 16309 24260 441 --
NM_024817chr15134933 4253 2042 1972 1828 1213 1098 1056 946 914 885 506 302 64632 4333 4182 2034 1442 621 55286 4946 4782 1793 45 1832
NM_024834chr1051656 1374 1261 647 555 11541 1423 2612 529
NM_024837chr1561735 1625 1339 687 596 445 ------
NM_024881chr1983334 3000 2740 2555 1352 1213 1080 302 1357 23838 3268 --
NM_024889chr10151228 1213 1162 1117 1102 731 702 687 672 658 644 617 602 556 410 --198 1589
NM_024915chr872243 2031 2022 1154 382 246 37 --1553 --
NM_024923chr33403 336 33 --31131 1008 311 11160
NM_024930chr552722 2144 2048 1782 1758 1163 12069 11008
NM_024947chr3148713 8140 7390 7366 6728 6591 6548 5836 3360 2803 2345 1290 635 44 47190 6479 1928 1096 28677 669 19185
NM_024949chr4134949 4828 4435 4394 4362 4222 4176 4129 4040 3958 3085 1608 457 24047 3653 ----
NM_024953chr1282720 2289 2253 2058 1957 677 652 279 --2498 59 --
NM_024963chr7175478 5412 5178 5040 4841 4756 4622 4122 2125 2016 1947 1796 1080 947 142 107 29 45294 2191 2065 1446 --12365
NM_024989chr2137900 7796 7542 7308 6969 6076 5926 2516 2267 2144 1474 882 480 13039 21542 1361 16928
NM_024991chr1052953 2486 2455 906 778 --1429 --
NM_024993chr241586 1415 632 454 21573 417 ----
NM_025054chr843365 3351 2840 302 ----11427
NM_025073chr1101531 1382 1127 1121 862 591 430 217 142 59 14190 33685 1230 914 23292 170
NM_025074chr473054 2942 2761 2364 2233 935 760 22864 358 --1569
NM_025133chr2----1759 11146
NM_025134chr1652094 2061 1683 557 515 2996 840 1860 --
NM_025151chr841866 1814 1579 196 --12003 22158 542
NM_025160chr143556 3301 2762 1016 --11230 --
NM_025164chr1162186 2143 1806 1620 894 673 1330 ----
NM_025179chr1124419 4190 4154 3894 3487 1910 1783 1418 791 678 504 183 3963 705 64 23977 1940 --
NM_025180chr392862 2792 2148 1391 1134 960 485 243 199 --11100 --
NM_025191chr133561 3213 2809 --2874 653 --
NM_025208chr1172057 1774 1677 1625 596 139 77 11851 11718 2893 566
NM_025222chr373036 2825 2416 2282 1935 1168 130 --1735 11990
NM_025235chr1041989 1792 653 227 1563 ----
NM_025237chr1751483 970 543 158 141 11567 --11303
NM_025263chr681637 1349 1275 747 740 526 384 273 --2679 651 --
NM_030621chr1453831 3653 1271 948 516 --21604 545 13691
NM_030623chr251438 1340 642 515 86 11621 ----
NM_030625chr1052625 2486 2409 1619 1008 --1984 --
NM_030627chr553988 3887 2554 1280 510 --13813 --
NM_030634chr1102467 2053 1950 1792 982 943 884 581 521 103 ------
NM_030647chr7166188 6044 5445 4645 4497 4403 4179 1991 1949 1527 1495 1444 988 933 847 818 14247 --14547
NM_030648chr484967 4721 4258 4142 1832 1628 376 360 --24699 4519 11713
NM_030650chr284171 4037 3236 3127 2945 2741 1197 539 12984 1603 --
NM_030674chr12125429 5114 4491 4065 3879 3799 3698 1970 1612 1274 644 379 13775 63908 3763 1692 675 303 249 15066
NM_030758chr22101482 1219 1138 949 922 453 354 125 113 93 --2401 104 --
NM_030762chr1241997 1948 629 489 --1763 11904
NM_030767chr972859 2572 2060 679 671 502 162 11094 32524 1017 208 --
NM_030782chr52336 144 ----2127 81
NM_030786chr161402 647 567 450 428 281 ------
NM_030796chr762213 2038 1918 364 155 79 1500 1888 12105
NM_030806chr1128429 8350 7706 7147 5881 2441 2145 1918 1251 1222 1079 481 12079 57920 6977 6525 3459 3012 38063 7843 2094
NM_030809chr1262390 2377 2327 1986 1683 1673 ------
NM_030816chr143334 2407 884 844 --22777 2737 --
NM_030881chr2262269 1987 1651 828 759 459 --1793 --
NM_030885chr361848 753 747 642 340 52 1631 ----
NM_030918chr1164990 4746 4713 4515 4496 4433 4233 4213 4144 3913 3612 2077 1564 742 384 42 24684 3620 15241 34765 1706 781
NM_030938chr1751107 394 335 315 93 ------
NM_030953chr561359 1118 463 299 232 105 --2599 449 11311
NM_030964chr563583 3277 2842 2555 573 397 23001 821 32594 1329 347 --
NM_031271chr83503 208 45 ----1613
NM_031418chr1152470 2051 1866 344 257 11856 12497 1246
NM_031427chr14125767 5589 5211 4297 4161 2223 1552 1052 690 602 251 133 25800 565 14604 22252 832
NM_031435chr1253336 2407 856 778 756 --11073 --
NM_031442chrX52448 2422 2181 1258 634 --12354 --
NM_031445chr293205 3029 2606 1242 1226 1168 675 479 212 ----1893
NM_031453chr10112344 2276 2058 1733 910 806 687 184 142 68 61 ----11993
NM_031468chr7227960 7415 7396 7134 7102 6414 6150 5584 2839 2758 2650 2520 2495 2012 1681 1524 1438 738 657 490 323 258 36424 3302 2928 37049 6110 5886 33244 1353 689
NM_031469chr653458 2597 1107 937 516 23221 2992 13603 1615
NM_031483chr2093556 3131 2980 1339 1250 768 393 153 135 ----1177
NM_031844chr183638 3589 3511 3375 3304 3290 721 358 ------
NM_031845chr292936 2283 1459 1306 1298 1243 1188 749 189 ------
NM_031847chr292936 2283 1459 1306 1298 1243 1188 749 189 ------
NM_031890chr2262286 2240 2073 452 425 299 12019 2709 617 --
NM_031904chr1152122 1934 1621 506 260 --11304 1132
NM_031911chr441055 1010 980 855 152 --11736
NM_032012chr9135201 4532 3685 3548 3374 1801 1449 1383 901 797 774 295 83 1979 45138 5052 3359 1239 --
NM_032041chr832060 1854 492 32267 2220 832 12352 11010
NM_032042chr592914 2889 2883 1902 1148 819 455 352 82 22326 442 --2956 110
NM_032102chr1152790 2180 2045 1124 753 ----22896 1022
NM_032121chrX62410 1109 761 730 608 402 12514 1229 --
NM_032160chr1862692 2673 1747 1728 1519 1438 11646 33297 2703 1375 --
NM_032174chr151441 530 496 428 370 2513 377 --1453
NM_032199chr10143837 3785 3692 3616 3213 2605 2507 2416 1349 1334 746 721 609 124 ------
NM_032208chr282899 2799 2280 1389 1216 940 625 619 2254 32 165 21431 916
NM_032226chr93837 631 259 ----1139
NM_032228chr1173272 3218 3018 2721 2253 776 558 --1943 --
NM_032239chr421193 395 ----1911
NM_032242chr3103298 2595 2391 2202 970 957 810 467 432 162 23182 722 1425 --
NM_032307chr95902 786 306 173 121 --2463 140 --
NM_032373chr1074839 4603 4054 3920 2124 1046 705 --34864 4201 1496 24463 1879
NM_032410chr861281 1064 980 849 452 128 ------
NM_032439chr1071655 1595 1184 1080 174 141 90 ------
NM_032440chr1022784 609 12295 --12677
NM_032445chr1582629 2129 1913 1785 1721 1608 670 185 --2712 356 --
NM_032446chr543811 2745 1134 212 ----22687 41
NM_032457chr443663 3471 2739 233 --21505 719 --
NM_032486chr16112319 2204 2169 1920 1707 1678 1641 604 583 284 143 22047 684 12090 --
NM_032505chr342550 2472 598 591 22289 565 --11082
NM_032510chr18102046 1910 1672 1636 1554 979 650 517 396 26 1824 ----
NM_032582chr1741659 1378 757 551 ----11491
NM_032590chr125966 794 294 132 78 --1995 11048
NM_032622chr43577 519 217 ----11160
NM_032682chr373603 3588 3456 3364 3091 2975 517 --32905 2656 2523 --
NM_032737chr1982675 2013 1788 1678 1047 897 654 593 1587 --1987
NM_032800chr192320 1944 1936 1677 897 354 219 87 44 11880 3586 499 282 --
NM_032804chr1051956 1030 935 584 385 12260 11645 --
NM_032833chr14943 642 426 21 1914 1773 1891
NM_032859chr1363278 3270 1088 968 948 677 12483 ----
NM_032867chr112431 165 2244 178 --1493
NM_032869chr831818 741 710 ----21550 1373
NM_032873chr1164330 3454 3357 3035 1216 245 1323 44583 4160 2954 442 --
NM_032876chr1472030 1746 1536 1374 482 262 221 --1861 --
NM_032905chr1041239 1090 1068 285 ----11031
NM_032932chr17196431 6129 5553 5494 5442 5181 4938 4717 4514 4218 3940 2345 2185 1246 1048 1005 895 880 407 45719 4798 2393 2371 31685 1080 446 --
NM_032982chr772562 2343 1909 1672 1622 853 338 2448 124 32020 1955 907 11636
NM_033012chr132921 679 ----1236
NM_033020chr164488 1157 1063 793 762 543 --1876 1734
NM_033036chr1161122 473 438 404 333 45 1482 31468 1299 238 --
NM_033103chr1961358 1161 900 487 115 99 --1363 --
NM_033119chr164941 792 739 362 --1592 1314
NM_033121chr1231423 1315 252 --11182 11471
NM_033132chr132871 640 ----2903 448
NM_033133chr1783679 3598 3528 2750 1251 545 435 304 --1849 --
NM_033135chr1172057 1774 1677 1625 596 139 77 11851 11718 2893 566
NM_033143chr464424 4118 3497 1486 902 699 --24495 1688 --
NM_033181chr683609 3565 3252 3039 2863 971 963 159 12910 ----
NM_033207chr10112455 2094 2009 1954 1721 777 767 473 348 321 256 22078 190 12289 --
NM_033211chr51752 ----1743
NM_033222chr931167 1006 362 --11149 1251
NM_033224chr7217148 6850 6683 6659 6547 6260 5758 5699 5238 5117 4905 3198 3090 2938 2228 2071 1651 1616 1214 279 263 --25550 715 27186 1563
NM_033225chr843030 2505 2421 2293 --1612 1813
NM_033285chr8124083 3367 3271 3011 2999 2965 2830 2769 1572 924 805 318 --1397 --
NM_033326chr1131645 535 375 1956 --1682
NM_033331chr953496 2835 992 251 112 --22932 2676 12587
NM_033360chr1274481 4275 3889 3613 3077 950 677 ----1317
NM_033364chr341895 1705 687 325 1417 ----
NM_033389chr17114456 4141 3438 3367 3322 3207 1554 987 639 489 314 21485 573 24266 4200 1438
NM_033425chr1183239 2831 2690 2419 2357 2351 1186 418 ------
NM_033429chr15113044 2632 2251 1999 587 581 481 471 361 301 280 ------
NM_033449chr582074 1752 1560 1411 573 186 152 116 ----11708
NM_033484chr54567 252 188 125 ----1211
NM_033505chr2116579 6277 6240 6230 5176 5039 2374 791 542 251 105 24437 2330 25842 4179 14110
NM_033515chr61328 --21046 407 11238
NM_033551chr563220 2312 747 560 231 76 --13392 --
NM_033631chr153331 2420 1038 828 364 --43531 2946 404 44 --
NM_033637chr1093896 3715 3281 2696 2679 2615 1181 656 314 1325 13320 1856
NM_033656chr21145869 5863 4935 4730 4317 4149 4101 3866 2352 2278 1600 1273 806 595 25338 4902 35085 3967 1947 11773
NM_052832chr862739 856 759 582 572 177 ------
NM_052834chr1862309 2264 1694 1582 931 350 --52278 1804 565 157 91 1665
NM_052845chr1263219 3086 3019 2088 2019 128 12433 1790 22678 2062
NM_052847chr19113706 2888 2482 2441 1468 1396 1167 288 248 176 72 22583 1335 23621 2803 13103
NM_052874chr161692 127 --2767 610
NM_052879chr1253783 3522 3103 2592 39 --11350 --
NM_052885chr12164816 4750 4523 3015 1899 1686 1644 1505 1388 1375 1203 1114 456 312 177 98 13457 13099 --
NM_052898chr83547 466 355 182 31790 1393 110 --
NM_052904chr631307 1094 909 1958 1180 --
NM_052905chr251718 1592 1387 1244 734 --1562 --
NM_052906chr22124304 3996 3825 3543 3471 1356 1166 1136 965 951 941 443 1612 23099 595 1734
NM_052917chr273328 3294 2956 2395 1153 738 48 22419 772 22646 2619 --
NM_052918chr10133114 2921 2870 2699 1411 1305 1186 1107 1065 867 665 146 125 23124 1447 23299 1053 --
NM_052936chrX1342 --1262 1155
NM_052978chr1461899 1395 1308 1268 1202 58 1729 1393 11353
NM_053016chr9147278 7158 6839 6754 6611 6255 5834 5740 5387 3154 2343 2042 1191 408 47698 7124 1284 559 37726 4945 1343 --
NM_053023chr11153066 3059 2714 2701 2625 2576 2351 2162 785 642 634 327 285 272 121 ------
NM_053043chr7196439 6058 5936 5608 5592 4022 2407 2270 1806 1780 1681 1606 1458 1431 1374 1025 942 775 441 66208 5584 3898 1505 1383 162 2641 470 1682
NM_053064chr1462973 2200 2154 933 877 672 ----32181 1225 973
NM_057169chr1292937 2866 2609 2526 2161 2038 1245 970 309 --22318 579 12991
NM_057170chr1292937 2866 2609 2526 2161 2038 1245 970 309 --22318 579 12991
NM_057175chr452152 1844 1760 1002 618 1382 ----
NM_057178chr1742435 2010 886 112 12221 21126 165 22764 288
NM_057749chr84429 420 238 184 11034 ----
NM_058237chr142823 407 ----1674
NM_078470chr1092691 2524 2308 2282 989 860 711 669 110 --22366 695 --
NM_078483chr584006 3563 2907 2900 490 479 453 286 --22678 257 33291 3275 2848
NM_080491chr11113476 3272 3252 3030 2963 2683 2645 2630 1507 118 55 1431 11311 13418
NM_080591chr972323 2284 1130 1120 1017 727 231 42626 374 184 53 13073 --
NM_080629chr161225 423 336 261 246 239 ------
NM_080630chr161225 423 336 261 246 239 ------
NM_080669chr17144917 4131 3611 3466 3430 3280 3258 1288 1218 1165 908 674 406 375 --14712 --
NM_080676chr2072529 2502 2366 1254 917 681 561 11224 --1618
NM_080867chr14115112 4421 3659 3652 3541 3330 1916 1591 978 797 397 21244 1045 ----
NM_130385chr1183235 2691 2594 2406 1228 1086 490 483 --12060 1573
NM_130391chr973344 1136 1039 633 431 393 161 --22786 2740 12663
NM_130392chr973344 1136 1039 633 431 393 161 --22786 2740 12663
NM_130393chr973344 1136 1039 633 431 393 161 --22786 2740 12663
NM_130446chr353894 3029 686 548 454 33670 2698 473 ----
NM_130459chr93502 436 158 1166 21589 21 11597
NM_130807chr1982092 2022 1667 1625 878 341 312 107 22045 1881 22238 293 11651
NM_130830chr373822 3625 3498 2846 757 191 96 --12875 11074
NM_130831chr352667 2633 2385 954 689 --12495 2491 369
NM_130832chr352667 2633 2385 954 689 --12495 2491 369
NM_130833chr352667 2633 2385 954 689 --12495 2491 369
NM_130834chr352667 2633 2385 954 689 --12495 2491 369
NM_130835chr352667 2633 2385 954 689 --12495 2491 369
NM_130836chr352667 2633 2385 954 689 --12495 2491 369
NM_130837chr352667 2633 2385 954 689 --12495 2491 369
NM_130838chr1531806 1687 111 --11295 11271
NM_130839chr1531806 1687 111 --11295 11271
NM_130847chr1184649 4554 3846 2099 2086 1104 1026 801 13944 25638 1564 11115
NM_133170chr20128122 7688 6951 6641 5765 5469 5017 3137 3071 1347 1162 883 27034 295 27502 1676 --
NM_133264chr1773733 3702 3407 3330 3194 574 145 --11167 155
NM_133329chr281669 763 653 573 424 337 325 251 1210 2562 134 --
NM_133330chr492836 2298 1101 855 747 582 576 419 371 ----12855
NM_133331chr492836 2298 1101 855 747 582 576 419 371 ----12855
NM_133334chr4106292 5884 4370 3968 2464 1681 1326 493 446 234 26240 1824 1867 15042
NM_133335chr492836 2298 1101 855 747 582 576 419 371 ----12855
NM_133367chr653145 3106 719 676 331 --21070 576 --
NM_133370chr472998 2972 2895 2446 1181 726 619 1304 ----
NM_133372chr5102929 2898 2381 2359 2255 1893 1869 1092 755 483 ------
NM_133445chr953775 3220 3035 1268 466 --33290 1221 26 --
NM_133468chr772293 2150 2025 1956 1877 594 475 1853 ----
NM_133478chr272543 2485 2086 891 756 698 580 21805 220 11740 11888
NM_133493chr664676 3787 740 497 437 149 32827 833 681 140 14136
NM_133496chr1144413 4304 4183 3927 3015 2991 2967 2852 1556 1313 1083 741 443 361 --1765 --
NM_133646chr295494 5355 4359 3815 3619 3504 1194 1004 66 24702 559 21038 839 25081 1312
NM_133647chr1573745 3673 3631 2912 2406 1522 1387 1376 ----
NM_138286chr1984283 3740 3644 3311 3218 2976 1198 840 --13773 --
NM_138292chr1183229 2752 1434 1341 1161 672 407 257 --31202 1104 566 --
NM_138333chr9102543 2483 2339 2240 2142 2021 1862 1813 441 98 1965 ----
NM_138350chr151174 1018 571 505 441 --11385 11036
NM_138357chr105658 570 517 438 233 ----11217
NM_138426chr742212 1957 1777 686 1289 --12316
NM_138444chr1354342 3078 1686 696 424 --14588 --
NM_138457chr693347 3085 2997 2899 2631 2128 1077 443 143 23283 48 12116 --
NM_138459chr643083 2936 2395 961 11415 12389 --
NM_138468chr2146373 5690 5446 4938 4480 3883 2349 2214 1941 1521 1387 1335 1289 735 14293 --12049
NM_138473chr12154765 4638 4495 4385 4123 4073 3153 1972 1394 1296 1251 816 596 343 163 23789 3240 34573 3205 311 --
NM_138576chr1474366 3945 3932 3507 1620 1309 1124 13998 11288 --
NM_138621chr233872 2767 1017 23340 1053 23043 1297 1415
NM_138638chr1462312 1856 1731 659 583 106 ------
NM_138694chr653302 2889 1205 655 215 33194 2383 1171 22698 46 --
NM_138713chr16177965 7792 7696 7185 7071 6583 5868 5644 5123 5108 5073 3053 2506 1746 1393 1232 213 27579 6267 46493 6199 281 250 16186
NM_138714chr16177965 7792 7696 7185 7071 6583 5868 5644 5123 5108 5073 3053 2506 1746 1393 1232 213 27579 6267 46493 6199 281 250 16186
NM_138727chr132476 1643 946 --42044 882 734 162 --
NM_138728chr132476 1643 946 --42044 882 734 162 --
NM_138736chr1694249 4046 3427 3152 2775 1468 1203 1137 568 2613 82 43308 3107 1027 812 --
NM_138782chr552133 614 557 370 68 --3837 287 243 --
NM_138799chr291993 1858 1807 1664 551 415 401 367 218 1690 ----
NM_138959chr1146664 6099 5920 5450 5378 5074 5003 2178 1004 799 788 607 378 231 --65276 4973 2114 1884 1485 678 --
NM_138969chr851279 1196 528 253 221 --11030 --
NM_138971chr1152817 1222 1162 671 174 23036 709 33369 3227 2418 --
NM_138971chr1152817 1222 1162 671 174 23036 709 33369 3227 2418 --
NM_138972chr1152817 1222 1162 671 174 23036 709 33369 3227 2418 --
NM_138972chr1152817 1222 1162 671 174 23036 709 33369 3227 2418 --
NM_138973chr1152817 1222 1162 671 174 23036 709 33369 3227 2418 --
NM_138973chr1152817 1222 1162 671 174 23036 709 33369 3227 2418 --
NM_139012chr662020 1779 1772 1726 1427 359 ----1569
NM_139057chr15102960 2781 2683 2228 2204 1829 947 910 821 588 --1350 --
NM_139279chr272647 1325 1293 1139 978 655 89 1916 11073 1787
NM_139283chr1272486 2297 2115 1722 843 358 256 1974 12526 --
NM_139321chr2083578 3338 3061 2937 945 861 514 184 31573 1499 1355 11222 --
NM_144567chr182755 2593 2451 2065 905 837 260 32 ----1403
NM_144571chr4116910 6355 6139 4292 4267 2246 1491 1193 1000 432 322 15361 25305 4751 --
NM_144578chr1465331 5103 3858 3430 3370 876 1131 --11497
NM_144579chr262927 2887 2167 1164 1117 859 22248 672 --12656
NM_144590chr1063009 2864 2393 771 542 292 --1474 --
NM_144628chr2062097 1967 919 825 349 228 22719 1900 21926 616 --
NM_144632chr251607 1475 825 81 61 1164 --11791
NM_144633chr341495 1271 1254 1248 2486 293 11087 --
NM_144642chr331151 1057 548 ----11272
NM_144721chr472382 2128 2113 1725 1073 916 613 ----12397
NM_144732chr1961106 962 937 424 268 115 125 --1393
NM_144767chr15124009 3793 3463 3169 2921 2912 2842 1296 630 596 317 232 1955 23893 802 12865
NM_144778chr1321876 309 ----12207
NM_144973chr12105223 4692 4581 3983 3763 3314 2015 1661 1395 23 --44329 1407 1258 579 --
NM_145000chr51507 ----1410
NM_145117chr1193196 3153 2729 2507 2385 2295 2219 2041 169 21309 477 12992 1395
NM_145175chr261093 1028 505 388 181 88 1976 --11281
NM_145246chr1041144 1008 810 283 2252 146 11211 --
NM_145259chr264866 2261 1730 915 772 47 35752 5476 889 15705 --
NM_145305chrX61214 1100 1088 918 458 200 ------
NM_145307chr10104582 1477 1421 1176 1160 1005 989 746 480 378 14552 21866 913 --
NM_145320chr772911 2261 1140 882 821 380 306 22986 749 1406 --
NM_145321chr772911 2261 1140 882 821 380 306 22986 749 1406 --
NM_145322chr772911 2261 1140 882 821 380 306 22986 749 1406 --
NM_145733chr2291161 1126 782 310 249 192 111 40 25 ------
NM_145799chrX102774 2523 1118 1085 671 470 374 356 271 259 --1593 22924 2053
NM_145808chr773081 3069 3035 2744 2055 1263 727 22447 967 --11083
NM_147150chr963983 3645 3388 1571 439 238 11347 ----
NM_147189chr851757 1665 1644 745 424 --12173 12299
NM_148174chr852099 1771 1685 1367 63 ------
NM_152253chr22103940 3932 3858 3806 3290 3241 1673 1437 1425 226 63715 3538 2736 2632 1046 82 --2624 303
NM_152261chr123711 202 188 --22006 807 --
NM_152263chr1114593 4257 4038 2201 2049 1927 1209 1124 988 949 492 --36073 1354 460 --
NM_152275chr251786 1621 452 415 208 12186 ----
NM_152277chr541858 1585 665 67 --11468 1406
NM_152280chr133175 1359 825 1450 --23037 2675
NM_152289chr1961567 1503 1277 1154 616 244 --21590 1147 --
NM_152300chr1751803 1487 701 632 49 128 11182 11472
NM_152308chr162347 319 1292 1617 1114
NM_152332chr1492826 2814 2624 2509 2106 1971 1160 890 479 --32090 1120 956 --
NM_152352chr1853098 1208 1177 957 849 11128 12134 --
NM_152375chr172461 2279 2082 2056 1971 744 437 ----2828 475
NM_152388chr2144019 3083 3041 2963 2800 2711 2489 1290 1262 754 635 610 266 258 --1870 12937
NM_152409chr542653 2259 1377 104 ----11268
NM_152422chr981688 1682 1296 755 734 685 336 95 ----1370
NM_152424chrX94555 4295 3062 1306 1198 1170 668 304 153 --14099 34129 2997 1833
NM_152437chr1292045 1784 1623 1600 609 501 256 228 221 22318 357 22307 862 1564
NM_152455chr1552865 1992 782 491 252 22790 2671 1515 --
NM_152519chr231696 1580 578 11941 22095 1951 12085
NM_152529chr2164096 4020 3951 3854 3834 3698 3221 3087 2713 1379 1221 1151 1017 513 376 285 ------
NM_152594chr1512333 --2566 42 11972
NM_152608chr161969 819 519 430 422 22 1736 ----
NM_152622chr563325 3229 2510 2192 1103 99 13504 ----
NM_152624chr586511 5775 4651 2911 1747 1100 836 29 26294 1756 22318 84 --
NM_152629chr963498 1588 1445 1359 1250 1035 22537 1635 23192 558 --
NM_152636chr1183067 2830 2717 2337 1994 946 613 508 --1107 --
NM_152638chr121513 ----31152 1114 843
NM_152641chr1252471 2433 2419 2246 1883 2687 484 ----
NM_152699chr322840 2772 22519 374 --1851
NM_152722chr1151603 1484 1418 384 111 --21556 365 1492
NM_152724chr1072572 2466 2351 649 204 142 30 11738 ----
NM_152733chr6176264 6221 5921 5833 5759 5722 5554 5028 4998 4700 4305 4005 1622 1408 1143 1137 190 12235 35810 2455 109 14333
NM_152734chr675334 5118 5034 3722 1449 574 497 34438 3688 33 --25073 739
NM_152737chr642140 753 417 271 ----21757 249
NM_152749chr74820 751 285 259 21005 46 11147 --
NM_152754chr763235 2899 1361 418 188 94 --1502 13568
NM_152756chr5113653 3453 3111 2804 1562 1436 818 767 649 166 60 24025 3354 13671 --
NM_152758chr862618 2446 2199 2098 837 274 ------
NM_152774chr71131 ----2228 191
NM_152793chr785010 4720 4281 3969 3334 1573 1437 116 13168 13417 --
NM_152835chr132005 563 344 ----12565
NM_152836chr831877 1262 708 ----11516
NM_152837chr831877 1262 708 ----11516
NM_152838chr2063364 3199 2722 2575 1405 125 1402 32984 80 71 --
NM_152860chr125429 406 360 225 209 ----1267
NM_152903chr1362765 2600 1804 688 556 96 ------
NM_152924chr15156811 5811 5545 5411 5017 2680 2402 1962 1398 1383 1305 1114 723 636 439 36526 1811 896 34671 2111 493 65079 5042 5002 4964 4924 4885
NM_152996chr15853 684 554 526 415 31342 354 135 11616 --
NM_152999chr7115035 4943 4776 4323 4167 4121 4047 1827 803 783 502 11114 ----
NM_153029chr16124118 3839 3792 3680 3629 3440 3319 3066 2828 1310 989 469 53588 3086 1493 1380 1043 33943 2928 106 22870 1117
NM_153035chr173157 3022 2862 1130 666 481 116 22116 448 --1524
NM_153038chr21675 --1736 1131
NM_153050chr22154825 4529 4292 4099 4032 3458 3053 1699 1652 1608 1540 969 797 198 43 34866 3449 954 11767 14061
NM_153051chr22154825 4529 4292 4099 4032 3458 3053 1699 1652 1608 1540 969 797 198 43 34866 3449 954 11767 14061
NM_153188chr5125462 4602 3907 3886 3841 3784 3442 1853 1473 1381 574 493 14756 14212 --
NM_153234chr572501 2444 1934 1916 221 211 62 12545 1269 --
NM_153262chr143199 2815 2093 46 --11074 12242
NM_153350chr1681577 1240 1206 1121 442 424 182 81 ----11329
NM_153365chr462765 2625 2072 1886 1722 148 1326 32222 410 270 --
NM_153367chr10123689 2895 2648 2621 1465 1439 1324 1253 1239 1090 837 250 21421 461 ----
NM_153456chr13116301 5465 5263 4965 4430 4226 2335 2264 1196 1156 23 --22251 1564 36038 5649 2000
NM_153499chr12123049 2936 2761 2552 2533 2408 2155 1163 1021 752 555 166 22592 585 ----
NM_153500chr12123049 2936 2761 2552 2533 2408 2155 1163 1021 752 555 166 22592 585 ----
NM_153616chr1562067 1515 859 707 370 21 --21903 915 --
NM_153617chr1562067 1515 859 707 370 21 --21903 915 --
NM_153618chr1562067 1515 859 707 370 21 --21903 915 --
NM_153619chr1553305 2753 1259 542 333 2927 644 23141 1132 --
NM_153634chr1231210 285 157 --31020 617 103 --
NM_153645chr2273278 3068 2662 2506 2039 1208 319 --33106 2568 2049 --
NM_153686chr462298 1989 1950 1559 881 521 --22062 1724 --
NM_153689chr251765 642 562 536 133 ----11534
NM_153712chr252704 2447 999 769 202 ----21264 190
NM_153757chr41133 --1395 164
NM_153810chr1084625 4252 3733 1779 1365 1262 1123 824 2815 272 14908 --
NM_153831chr84791 409 357 149 1774 21006 884 --
NM_170686chr733088 2921 904 22479 812 --31143 985 324
NM_170695chr183394 349 343 ----128
NM_170706chr1104133 3522 2885 2833 2683 1027 401 362 323 284 --1440 33574 1451 859
NM_170709chr852071 1778 759 625 467 ----12390
NM_171825chr572228 2064 1940 703 611 429 79 2720 414 32456 2037 1225 1873
NM_172071chr1127244 7203 6888 6878 5356 5248 5120 4530 2591 2284 2061 445 --36315 2941 1914 26097 567
NM_172103chr642630 2546 2372 2005 2787 134 1381 --
NM_172105chr642630 2546 2372 2005 2787 134 1381 --
NM_172127chr461430 1411 1286 758 208 80 --11384 --
NM_172128chr451386 1367 714 164 36 --11340 --
NM_172130chr1111830 1817 1742 1510 621 542 347 338 315 297 44 11540 --11876
NM_172216chr12122951 2838 2663 2454 2435 2310 2057 1065 923 654 457 68 22494 487 ----
NM_172217chr1573911 2459 1347 845 628 382 180 --73528 2668 1505 1426 614 123 70 --
NM_172226chr12123049 2936 2761 2552 2533 2408 2155 1163 1021 752 555 166 22592 585 ----
NM_172344chr281669 763 653 573 424 337 325 251 1210 2562 134 --
NM_173075chr441516 1284 1206 314 ----11721
NM_173076chr2124 ----1427
NM_173167chr1792743 2563 2505 2298 985 973 924 520 503 --32781 2332 945 1245
NM_173171chr24821 189 133 99 --1289 11026
NM_173172chr241129 497 441 407 1193 1597 11334
NM_173173chr24821 189 133 99 --1289 11026
NM_173191chr1041238 893 512 208 1393 182 1431
NM_173192chr1041238 893 512 208 1393 182 1431
NM_173193chr1041238 893 512 208 1393 182 1431
NM_173194chr1041238 893 512 208 1393 182 1431
NM_173195chr1041238 893 512 208 1393 182 1431
NM_173198chr972903 2812 2172 2154 1904 308 38 ------
NM_173200chr972903 2812 2172 2154 1904 308 38 ------
NM_173207chr183394 349 343 ----128
NM_173208chr183394 349 343 ----128
NM_173209chr183394 349 343 ----128
NM_173210chr183394 349 343 ----128
NM_173211chr183394 349 343 ----128
NM_173214chr16177965 7792 7696 7185 7071 6583 5868 5644 5123 5108 5073 3053 2506 1746 1393 1232 213 27579 6267 46493 6199 281 250 16186
NM_173216chr351805 933 554 356 92 --1337 1251
NM_173217chr351805 933 554 356 92 --1337 1251
NM_173454chr152948 358 ----11205
NM_173468chr4145554 5271 5022 4974 4790 4102 2347 2148 2107 1425 1261 1157 673 101 --35007 827 535 --
NM_173470chrX52901 2047 2009 1884 1050 --22776 954 --
NM_173473chr10102222 2084 1921 1786 1708 985 742 660 503 61 ------
NM_173495chrX52478 1925 1829 1793 1619 1446 ----
NM_173511chr253880 3043 1491 828 370 --42886 578 533 111 --
NM_173519chr861528 1415 812 553 484 392 ------
NM_173582chr1196201 5258 5124 4783 4007 3998 2146 1399 1266 --34095 713 702 11816
NM_173595chr12124968 4302 3651 3618 3607 3597 3324 2130 1886 1738 1397 736 13966 11231 11794
NM_173602chr1253031 2921 2851 1087 859 --22973 1009 23025 806
NM_173642chr1278985 8759 8658 8401 7997 7913 7497 7224 7180 6977 6878 6705 5960 5710 3686 3448 3222 3063 2848 2735 2678 2384 2150 2076 1676 1221 1067 23390 2241 38461 6760 2271 38728 7210 3049
NM_173694chrX72565 1952 1901 767 494 459 110 --22137 817 --
NM_173808chr164301 4197 3916 3677 3056 1145 ------
NM_173822chr251470 711 408 250 184 --21863 835 --
NM_173825chr383138 3063 2816 2494 2409 1895 1246 353 ------
NM_173826chr331581 380 205 ----11734
NM_173829chr5116058 5278 4805 4673 4559 4532 4455 4054 2350 2210 111 --13745 --
NM_173851chr843664 3558 3093 24 --13704 13142
NM_174886chr183394 349 343 ----128
NM_174916chr1561961 1942 1914 747 693 618 1802 1233 --
NM_175056chr32787 750 1407 1445 1873
NM_175607chr331652 1339 572 ----11374
NM_175612chr331652 1339 572 ----11374
NM_175623chr12207597 7412 7239 6063 6049 6002 5964 5687 5604 5590 5298 5164 5097 4854 4788 2889 2117 421 208 84 1623 26502 5982 --
NM_175624chr12207692 7507 7334 6158 6144 6097 6059 5782 5699 5685 5393 5259 5192 4949 4883 2984 2212 516 303 179 1718 26597 6077 --
NM_175625chr12207692 7507 7334 6158 6144 6097 6059 5782 5699 5685 5393 5259 5192 4949 4883 2984 2212 516 303 179 1718 26597 6077 --
NM_175630chr25930 764 738 219 33 ----1917
NM_175733chr1131483 801 77 11835 22222 833 1152
NM_175736chr12227798 7784 7645 7414 7250 6441 5971 5890 5576 5126 5031 4986 4850 3005 2954 2370 1947 1901 1710 759 443 190 46767 6300 5522 5204 35785 4904 276 26950 2982
NM_175854chr1362503 2405 2368 2099 1960 277 --1857 --
NM_175907chr1862743 2637 2120 1049 373 281 2267 57 22656 806 --
NM_175921chr574282 3685 2938 1577 1546 1409 921 13163 13892 --
NM_176863chr1782100 1952 1938 1540 1496 1421 1357 520 --11533 11899
NM_176871chr892559 2417 2345 2288 2254 2072 1264 1235 248 22941 428 1491 12924
NM_177438chr1453831 3653 1271 948 516 --21604 545 13691
NM_177452chr1441664 1613 988 779 --12142 11566
NM_177972chr11134379 4133 3992 3891 3488 3069 3016 1383 1260 1018 952 725 235 13525 --14243
NM_177985chr281780 1760 406 251 235 198 185 173 1513 ----
NM_177995chr981688 1682 1296 755 734 685 336 95 ----1370
NM_177996chr2073174 3066 2907 2435 1329 889 102 --12079 11055
NM_177999chr983284 3009 2897 2608 1485 1015 573 226 33495 756 312 13220 --
NM_178011chr1073093 3067 2784 2690 2532 2200 2026 23141 584 12741 1704
NM_178013chr14112695 2610 2602 2311 2287 2165 1071 1045 516 460 428 22678 974 22626 155 --
NM_178026chr204489 400 80 68 1143 1420 151
NM_178037chr12103564 3257 3026 2710 2677 2651 2452 923 507 166 23430 331 12218 --
NM_178038chr12103564 3257 3026 2710 2677 2651 2452 923 507 166 23430 331 12218 --
NM_178140chr572561 2553 2375 1773 1092 928 233 --125 --
NM_178151chrX157886 7844 7485 7126 7114 7011 6979 6669 5582 5448 5003 3151 3040 2758 247 12054 15550 15737
NM_178152chrX157886 7844 7485 7126 7114 7011 6979 6669 5582 5448 5003 3151 3040 2758 247 12054 15550 15737
NM_178153chrX157886 7844 7485 7126 7114 7011 6979 6669 5582 5448 5003 3151 3040 2758 247 12054 15550 15737
NM_178270chrX1342 --1262 1155
NM_178426chr131755 795 785 --12075 --
NM_178427chr131655 695 685 --11975 --
NM_178498chr1163312 2718 2562 1361 586 577 --1787 13362
NM_178539chr1241957 1919 1445 129 --11535 --
NM_178554chr373552 3272 2531 2393 1437 1404 1086 1526 53303 3033 2936 2693 2517 --
NM_178566chr931329 752 228 ----11597
NM_178578chr2062510 2449 2141 401 272 25 --1514 --
NM_178583chr41191 --1644 1338
NM_178586chr1482280 1858 669 644 521 492 443 375 ----1183
NM_178818chr1642456 2034 850 763 31706 1595 238 11752 1591
NM_178831chr752837 2693 2543 1870 577 22876 2390 --32073 525 279
NM_181332chrX82600 2303 2120 1677 885 333 167 22 --22323 194 --
NM_181349chr7112943 2863 2819 2451 2381 2258 2173 2147 2108 529 498 32294 485 103 21233 1121 12238
NM_181351chr1192959 2953 2811 2616 2442 1073 1064 584 67 11991 21961 720 --
NM_181358chr173913 3717 3688 3440 3336 198 170 23322 1396 13134 --
NM_181481chr18166904 6389 5816 5194 4407 4350 2440 2345 2222 2180 2010 1933 1407 1199 1128 863 --26881 4376 --
NM_181482chr18166904 6389 5816 5194 4407 4350 2440 2345 2222 2180 2010 1933 1407 1199 1128 863 --26881 4376 --
NM_181483chr18166904 6389 5816 5194 4407 4350 2440 2345 2222 2180 2010 1933 1407 1199 1128 863 --26881 4376 --
NM_181491chr993166 2919 2890 2707 2695 1972 1943 617 194 11003 22642 1012 --
NM_181521chr16137237 6815 5631 5544 4708 4653 1654 1128 597 558 143 83 48 36487 6376 5019 76533 4391 2620 2024 773 709 401 15372
NM_181581chr74739 321 244 218 1834 --1681
NM_181643chr11541 --21556 304 1500
NM_181659chr203443 261 83 12999 33264 3125 2701 --
NM_181659chr203443 261 83 12999 33264 3125 2701 --
NM_181672chrX51508 1450 743 652 199 --11927 --
NM_181673chrX51508 1450 743 652 199 --11927 --
NM_181705chr5135474 4845 4789 4691 3978 3844 3553 2004 1867 1599 1031 766 650 --1948 13761
NM_181714chr66764 593 551 372 349 319 --11667 --
NM_181723chr831977 1817 1426 ----12226
NM_181784chr2102131 2060 994 980 614 519 409 348 150 121 --42286 1805 1688 1630 --
NM_181809chr183910 3799 1413 1117 949 635 472 37 13466 2446 396 21480 562
NM_181832chr2293263 2424 2350 1198 1091 1060 994 587 563 12935 22398 24 --
NM_181836chr542177 1072 538 145 --1884 12206
NM_181838chr571511 1115 1090 1016 609 210 74 ------
NM_181876chr452694 660 642 635 607 2533 445 32185 1706 176 1837
NM_182485chr443631 3499 2511 190 --13390 --
NM_182493chr16134785 4320 4228 4157 3743 3465 3359 3275 2135 1699 1516 1144 180 ----1401
NM_182503chr684778 4672 3982 3803 2149 1469 452 218 --14144 1206
NM_182507chr1282197 1906 1640 1577 1500 721 675 535 --22100 889 --
NM_182526chr1483152 3023 2515 2251 2039 1951 1928 628 --22149 930 --
NM_182646chr443631 3499 2511 190 --13390 --
NM_182664chr151697 1651 642 256 115 22288 1794 22355 213 --
NM_182697chr761762 521 367 206 181 41 ------
NM_182703chr155599 529 511 267 123 --1960 --
NM_182715chr731129 890 189 ----1164
NM_182728chr1471641 1498 1209 1165 350 242 212 2737 594 11370 --
NM_182758chr1563826 3508 3163 2909 1475 280 --13177 23870 782
NM_182762chr785873 5350 5199 5122 4801 2142 2008 520 1163 25396 455 --
NM_182763chr142606 2565 2337 561 12115 1496 182
NM_182896chr31657 ----1534
NM_182898chr795957 5590 5127 4515 2358 1264 1241 619 492 1472 25183 2447 14469
NM_182899chr795957 5590 5127 4515 2358 1264 1241 619 492 1472 25183 2447 14469
NM_182915chr251936 1628 880 857 848 ----1757
NM_182948chr153101 2962 2802 2561 283 --22348 1095 --
NM_182964chr1193196 3153 2729 2507 2385 2295 2219 2041 169 21309 477 12992 1395
NM_182970chr2072736 1726 1436 1400 900 497 307 --21168 1143 1803
NM_183078chr663590 3442 3169 1227 871 674 33748 896 435 --13772
NM_183397chr20165062 4948 4344 4259 3171 1873 1738 1550 1474 914 680 445 380 337 299 56 41346 785 648 187 14984 --
NM_194247chr2114248 4200 3574 3368 3298 3167 1326 1281 1274 812 582 13773 --23990 1725
NM_194286chr12166253 6237 5998 5194 4859 4595 4464 4212 4131 3803 2065 1633 1504 1089 850 725 24219 567 16181 11956
NM_194291chr842358 2039 1007 397 12619 1721 --
NM_194301chr1421186 203 ----1267
NM_194314chr175555 4636 4364 3806 1259 539 107 --21305 361 --
NM_194328chr963120 1261 1126 860 685 89 --1956 --
NM_194329chr963120 1261 1126 860 685 89 --1956 --
NM_194330chr963120 1261 1126 860 685 89 --1956 --
NM_194332chr963120 1261 1126 860 685 89 --1956 --
NM_194356chr126836 805 574 550 123 106 1213 --12323
NM_194434chr1875599 5220 5189 4958 4750 1592 941 15148 24188 3984 --
NM_197941chr552954 2761 2553 1894 781 21911 1072 ----
NM_198056chr392197 1816 1568 1528 810 632 455 375 266 1789 --12121
NM_198057chrX61248 1227 1193 410 363 269 --159 --
NM_198086chr1472030 1746 1536 1374 482 262 221 --1861 --
NM_198158chr342021 1928 1008 456 --12589 12060
NM_198159chr342021 1928 1008 456 --12589 12060
NM_198177chr342021 1928 1008 456 --12589 12060
NM_198178chr342021 1928 1008 456 --12589 12060
NM_198212chr762237 2167 934 804 546 321 --152 --
NM_198268chr173913 3717 3688 3440 3336 198 170 23322 1396 13134 --
NM_198269chr173913 3717 3688 3440 3336 198 170 23322 1396 13134 --
NM_198270chrX32200 873 190 --12346 1319
NM_198320chr12145238 4927 4903 4296 4284 4275 3748 3609 1848 1694 1449 1311 439 143 14324 --1778
NM_198381chr1141169 968 543 139 --11379 1269
NM_198391chr2021199 529 ----11153
NM_198404chr132866 189 ----1641
NM_198468chr6154264 3743 3613 3547 3446 3345 3300 2800 1796 1669 1297 1000 964 897 70 23043 1278 11073 --
NM_198485chr392539 2439 1940 744 579 527 463 457 58 ------
NM_198503chr142103 888 463 29 ------
NM_198513chr861671 587 313 261 246 33 --11797 --
NM_198560chr393478 2691 1419 1115 1094 572 458 337 114 1103 13536 --
NM_198581chr2127485 7154 6501 6298 5226 4929 4761 4677 2295 2287 669 46 --12745 --
NM_198595chr4124907 4848 4125 3741 1967 1946 1849 1799 1379 1020 863 218 44450 3489 3266 1275 11136 13198
NM_198715chr1116202 6119 4833 4502 4490 4342 4054 1738 1029 918 321 ------
NM_198793chr383486 3099 2596 1581 1168 619 309 285 ----2840 660
NM_198859chr394779 4417 4409 3801 3682 3257 1656 1412 258 21770 1281 ----
NM_198900chr12227798 7784 7645 7414 7250 6441 5971 5890 5576 5126 5031 4986 4850 3005 2954 2370 1947 1901 1710 759 443 190 46767 6300 5522 5204 35785 4904 276 26950 2982
NM_198935chr20103095 3089 2710 2430 2185 1300 960 921 373 276 1610 ----
NM_198968chr13103260 3124 2980 2811 2539 1330 1263 1034 546 107 127 --13808
NM_198990chr773077 2171 1257 1245 1196 506 56 13228 --1455
NM_199040chr1283750 3718 3605 3491 1325 791 375 277 --13175 1502
NM_199044chr162712 2350 2249 1221 503 197 22008 892 --1737
NM_199053chr41232 ----1724
NM_199132chr1962107 1959 1859 1550 1526 1357 --11443 --
NM_199169chr20103454 3224 2251 1418 1325 1267 1019 965 944 782 13246 12848 33087 2874 2213
NM_199170chr20103454 3224 2251 1418 1325 1267 1019 965 944 782 13246 12848 33087 2874 2213
NM_199171chr20103454 3224 2251 1418 1325 1267 1019 965 944 782 13246 12848 33087 2874 2213
NM_199188chr1253783 3522 3103 2592 39 --11350 --
NM_199190chr1253783 3522 3103 2592 39 --11350 --
NM_199245chr1292631 2516 2478 2435 2314 2212 2011 1953 511 ------
NM_199320chr41339 1903 --2927 144
NM_199320chr41339 1903 --2927 144
NM_199324chr463224 3170 2633 1213 1162 741 13007 1507 12830
NM_199421chr14115112 4421 3659 3652 3541 3330 1916 1591 978 797 397 21244 1045 ----
NM_199436chr242637 2224 534 340 --1896 12769
NM_199454chr184752 4541 3982 3733 3666 1353 1123 147 ----13858
NM_199461chr10112940 2402 2274 1271 1182 1010 896 861 738 637 528 23574 3064 42574 990 589 496 --
NM_199478chrX72016 1707 1441 797 750 335 257 11487 ----
NM_201266chr252270 606 479 198 38 12754 1600 32281 976 395
NM_201279chr252270 606 479 198 38 12754 1600 32281 976 395
NM_201548chr221276 580 21164 1009 --11264
NM_201591chr44322 241 171 100 --11420 --
NM_201592chr44322 241 171 100 --11420 --
NM_201628chr183103 2741 2397 2092 1256 1220 1163 79 --11104 --
NM_201632chr561743 1615 1559 1424 321 127 1204 --11765
NM_201634chr561842 1714 1658 1523 420 226 1303 --11864
NM_203327chr2094092 3342 3240 3081 2872 951 905 343 261 23662 523 34171 3390 2901 --
NM_203342chr152934 2400 1164 807 324 13609 12562 33474 2592 492
NM_203343chr152934 2400 1164 807 324 13609 12562 33474 2592 492
NM_203350chr141406 456 304 278 --11133 --
NM_203364chr1131217 932 237 ----2222 86
NM_203417chr2141433 1096 501 121 ----1627
NM_203418chr2141433 1096 501 121 ----1627
NM_203446chr2172655 2198 1157 995 246 229 133 ------
NM_203463chr294689 4410 3426 3291 3060 3017 1649 1300 93 --24401 1201 --
NM_203504chr452593 2141 2114 1919 919 1651 1553 --
NM_203505chr452593 2141 2114 1919 919 1651 1553 --
NM_205836chr52631 191 --121 1608
NM_206594chr1123002 2881 2341 854 801 683 508 374 322 301 221 24 12283 22468 295 12679
NM_206595chr1123002 2881 2341 854 801 683 508 374 322 301 221 24 12283 22468 295 12679
NM_206854chr685312 4910 3591 1325 1249 807 665 603 ----1568
NM_206855chr6136277 5875 4556 4206 4026 3949 2290 2214 1772 1630 1568 734 318 ----11533
NM_206866chr2162610 894 842 756 442 365 --12919 --
NM_206876chr263592 3574 2946 2367 1287 289 --13210 --
NM_206907chr593220 3196 2854 938 747 583 455 391 249 ------
NM_206909chr8177036 6990 6814 6642 6442 6191 5813 5361 5341 3161 3110 1606 1425 1318 1189 989 324 37026 6620 2435 17706 --
NM_206914chr1291991 1983 1717 1705 1485 1452 1418 393 291 1570 12151 2626 444
NM_206937chr131738 ----1772
NM_207012chr1083516 3161 3026 2719 1086 593 249 38 11113 12184 --
NM_207015chr362047 1948 672 618 327 300 ----1902
NM_207043chr172257 2044 1959 736 720 647 472 --191 --
NM_207044chr172257 2044 1959 736 720 647 472 --191 --
NM_207047chr172257 2044 1959 736 720 647 472 --191 --
NM_207111chr742210 998 646 133 --2932 688 1146
NM_207116chr742210 998 646 133 --2932 688 1146
NM_207303chr1073948 3740 2910 2783 2718 1082 925 --13546 --
NM_207304chr1321763 196 ----12094
NM_207306chr1104496 4010 3416 3351 3261 3214 2836 1708 1621 404 21675 1492 191 --
NM_207372chr10102476 2286 2184 926 871 451 413 333 182 70 --1596 --
NM_207406chr4136051 5391 5230 3988 2500 2324 2261 1924 1174 1024 753 448 283 35729 4040 1491 25659 119 --
NM_207435chr124881 854 151 68 --1193 1736
NM_207577chr11102914 2593 2236 1090 876 715 613 319 133 108 1358 ----
NM_207645chr113529 328 81 --21247 37 21316 405
NM_207647chr962541 2273 1968 1797 828 590 ------
NM_212467chr1552257 2207 430 340 191 ----11048
NM_212471chr1741690 1485 440 304 --11539 1592
NM_212472chr1741690 1485 440 304 --11539 1592
NM_212558chr994225 3975 3689 3549 3464 3024 2753 1637 907 12869 ----
NM_213589chr285475 3682 3586 2155 2022 1547 930 608 11508 ----
NM_213606chr10111935 1801 1668 879 762 748 606 503 359 353 197 11092 ----
NM_213648chr561743 1615 1559 1424 321 127 1204 --11765