TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4648
miRNA Sequence: UGUGGGACUGCAAAUGGGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr143829 750 23 21051 907 1966 --
NM_000052chrX42992 2293 761 753 ------
NM_000084chrX106729 5868 5399 5216 2605 2322 1806 1536 1322 896 34535 1676 132 25383 1470 11597
NM_000089chr71692 ----1718
NM_000092chr243761 3142 1255 982 14124 ----
NM_000093chr9112534 2182 2094 1836 1557 652 462 435 339 117 70 1971 22039 659 --
NM_000104chr242728 2689 863 691 1404 ----
NM_000125chr663862 3624 3270 875 730 711 24026 1290 13922 --
NM_000165chr631301 267 29 ------
NM_000168chr751066 974 962 773 115 2624 504 ----
NM_000176chr543129 1171 1102 834 12514 ----
NM_000202chrX43811 3709 2698 2427 --12711 --
NM_000208chr1973931 3611 3349 614 452 87 38 24678 225 24437 3464 --
NM_000210chr242242 1798 701 564 ----1610
NM_000217chr1285198 5176 4576 4179 3852 3663 771 737 ------
NM_000227chr182310 271 ------
NM_000237chr82729 169 ----11836
NM_000259chr1546180 5081 4487 1335 14163 12120 --
NM_000267chr1762826 2668 2427 2143 1384 418 1399 ----
NM_000276chrX3785 356 301 1167 ----
NM_000291chrX4887 730 717 206 ----1876
NM_000314chr1043294 2496 2202 407 --11179 --
NM_000332chr676129 4895 1187 510 348 326 182 26713 4763 12750 --
NM_000337chr5136281 5894 5808 5597 5420 4864 4669 1883 1285 950 877 323 279 56521 5980 2413 2173 726 ----
NM_000351chrX64126 3273 2911 1719 1147 862 --1546 --
NM_000358chr5--164 --1465
NM_000390chrX53228 3218 2224 938 51 13054 2965 775 --
NM_000461chr352912 2889 793 564 292 34364 4012 31 ----
NM_000486chr12103059 2764 2753 2649 2229 1262 1194 1162 957 520 183 --23052 2697
NM_000489chrX53380 3285 3138 2721 2333 1780 ----
NM_000539chr361515 1178 1059 315 76 42 --1224 --
NM_000544chr6_cox_hap1103126 2840 2809 2477 2401 1129 966 927 862 501 --21144 410 --
NM_000555chrX77484 6980 6670 4855 2759 2629 2188 15584 25758 2177 --
NM_000575chr21935 1794 123 1953
NM_000599chr293563 3472 3248 3191 3164 1615 1310 832 37 14526 11398 --
NM_000610chr1172345 2100 2079 820 445 250 242 ------
NM_000612chr1153808 2846 844 635 80 --1103 --
NM_000615chr1172960 2810 2441 2422 1074 836 585 --1929 --
NM_000618chr1245509 4701 2333 2028 35837 5116 656 ----
NM_000618chr1245509 4701 2333 2028 35837 5116 656 ----
NM_000621chr1321344 959 ----11071
NM_000633chr1894528 4479 3931 2036 1963 1540 1112 996 666 --1276 --
NM_000719chr12116565 6533 5532 5258 4449 4157 2638 2147 921 310 223 --14523 24394 1389
NM_000721chr162310 2122 2085 2046 871 314 138 ----
NM_000767chr1931427 1277 1144 11006 --1249
NM_000811chr52663 170 1780 ----
NM_000813chr535106 4556 508 12083 ----
NM_000829chr1131944 1763 129 ----1793
NM_000831chr1116044 5926 5635 5233 5120 4713 2502 1628 1415 903 546 66061 5021 808 494 396 377 46006 1639 1091 878 --
NM_000836chr194940 743 637 314 1954 1321 --
NM_000838chr652252 1095 1017 859 198 149 --12164
NM_000872chr1061374 1079 615 313 298 235 21325 1302 ----
NM_000875chr1585376 4849 2671 2222 1860 1691 1487 757 24618 2399 35515 4602 2374 --
NM_000899chr1294339 3160 3104 2849 949 668 638 315 271 11672 1937 --
NM_000902chr383210 2953 2900 2825 2752 2281 219 162 ------
NM_000903chr1611240 21043 107 11141 --
NM_000926chr11159283 8317 8255 8191 8170 7384 7082 6762 2858 2548 2282 1443 1430 1386 839 23569 1591 27716 3279 --
NM_000944chr441727 1694 1557 321 11645 ----
NM_000966chr127979 816 757 433 291 222 202 2713 329 ----
NM_001001323chr1232742 2110 1041 1142 ----
NM_001001331chr382613 2350 2043 1679 782 500 277 149 42528 2297 2221 1933 11809 --
NM_001001344chrX42397 2185 1961 1886 11692 11828 --
NM_001001389chr1172345 2100 2079 820 445 250 242 ------
NM_001001390chr1172345 2100 2079 820 445 250 242 ------
NM_001001391chr1172345 2100 2079 820 445 250 242 ------
NM_001001392chr1172391 2146 2125 866 491 296 288 ------
NM_001001481chr8----139 11219
NM_001001549chr742504 2252 1842 1072 22011 933 11988 22270 802
NM_001001550chr742504 2252 1842 1072 22011 933 11988 22270 802
NM_001001555chr742504 2252 1842 1072 22011 933 11988 22270 802
NM_001001669chr542519 2194 988 672 1448 11938 11822
NM_001001694chr2292224 2188 2021 1947 1888 1446 587 406 160 1325 22150 343 12315
NM_001001890chr2153898 3720 2766 1140 1096 23331 748 23168 1419 --
NM_001001928chr22188147 7995 7494 6511 6239 5810 5685 5318 5307 5072 2646 2224 2214 2176 2103 1857 1017 365 --28290 1804 --
NM_001001974chr1011672 12001 1951 --
NM_001002032chr173685 508 176 ----1615
NM_001002033chr173785 608 276 ----1715
NM_001002860chr14104437 3190 1374 1276 1110 1084 997 599 554 45 34687 3203 719 11425 --
NM_001002909chr1762074 1919 1911 1739 1594 861 1596 21711 550 --
NM_001002926chr721924 233 1954 ----
NM_001003407chr1044565 3932 1892 1433 1741 2933 926 --
NM_001003408chr1044565 3932 1892 1433 1741 2933 926 --
NM_001003652chr18158497 7586 5276 3250 3069 2397 2366 2305 2209 940 749 449 273 208 127 11004 122 13023
NM_001003674chr18146905 6467 5817 5025 4915 4408 2666 2441 2346 2179 1908 1797 1129 862 25335 1409 15828 --
NM_001003675chr18146905 6467 5817 5025 4915 4408 2666 2441 2346 2179 1908 1797 1129 862 25335 1409 15828 --
NM_001003681chr2232090 603 582 136 ----
NM_001003794chr342901 2412 323 233 32223 314 247 12924 --
NM_001003800chr952745 1109 879 443 183 21303 1143 ----
NM_001003940chr153894 501 429 --33112 719 409 --
NM_001003942chr153894 501 429 --33112 719 409 --
NM_001003943chr153898 505 433 --33116 723 413 --
NM_001004303chr1149 ----1562
NM_001004303chr1149 ----1562
NM_001004304chr1262549 2039 1226 1111 1061 968 22415 312 2104 78 12348
NM_001004342chr1145886 4738 4707 3988 1913 1884 1702 1250 611 519 465 417 239 67 45063 2228 2001 858 25904 4944 --
NM_001004360chr211413 ----2648 382
NM_001005404chr1732922 131 93 --11241 11611
NM_001005463chr1052497 1973 1049 717 705 ------
NM_001005473chr585372 4987 4016 2631 2406 339 199 91 25395 4696 ----
NM_001005609chrX53354 3215 2451 605 249 12420 --13333
NM_001006641chr951637 1509 1105 464 205 1483 ----
NM_001006642chr951637 1509 1105 464 205 1483 ----
NM_001006643chr951637 1509 1105 464 205 1483 ----
NM_001006684chrX------1456
NM_001007214chr13372 254 148 ------
NM_001007246chr2121365 658 11404 ----
NM_001007471chr91857 ----1558
NM_001007559chr1832031 1435 537 1361 ----
NM_001008220chr563630 3153 2619 981 477 81 13789 13655 13564
NM_001008239chr1832815 427 40 23007 596 ----
NM_001008392chr373371 3335 3211 2917 2898 2641 24 2834 390 11125 --
NM_001008495chr831540 614 363 --1781 --
NM_001008701chr19122947 2745 2551 2443 2385 2274 2141 2099 1902 1247 326 203 ------
NM_001009899chr356251 6018 5849 5374 5202 ----16350
NM_001009992chr131600 1352 550 --1376 --
NM_001010000chr1823489 900 33278 100 52 11079 --
NM_001010861chr132665 838 822 3890 568 308 ----
NM_001010867chr1156210 5943 5394 5344 4643 2634 2196 2077 1798 1711 816 620 584 478 269 --35927 5168 82 --
NM_001010891chr532611 2311 1179 15340 16676 --
NM_001010895chr931414 397 184 1436 ----
NM_001010984chr181938 1888 1796 1774 1685 863 379 115 --12324 --
NM_001011666chr796257 5189 5126 5047 1967 1567 1556 1438 620 31766 1266 494 11359 14884
NM_001012393chr1174332 3243 1017 859 628 550 441 44923 4341 3133 1098 ----
NM_001012755chrX53793 1583 1042 1010 497 --1519 --
NM_001013031chr1063047 2421 1335 1107 735 669 21342 1214 1460 --
NM_001013406chr711753 ----11359
NM_001013620chr1267692 6243 5995 5967 2727 1132 57979 7606 7544 3212 1560 ----
NM_001013624chr1751132 999 984 287 229 180 --11074
NM_001013690chr1272404 1747 1665 1626 1582 1562 381 ------
NM_001013693chr172776 2446 2437 2158 891 690 114 --12488 --
NM_001013693chr172776 2446 2437 2158 891 690 114 --12488 --
NM_001013703chr15------1430
NM_001014797chr10147886 7609 7181 2783 2328 1834 1792 1478 1420 1148 1066 966 785 101 17689 27706 2812 --
NM_001015045chr412215 21719 534 ----
NM_001015508chr84750 605 569 173 1632 ----
NM_001015877chrX42052 1141 874 572 ------
NM_001015881chrX41226 1194 136 90 --11088 --
NM_001017395chr363264 3012 2994 1079 533 450 13357 22469 652 --
NM_001017396chr241736 1507 468 445 1818 21949 1547 --
NM_001017440chr7137981 7961 7414 6716 6608 6518 2945 2757 2651 2097 1480 496 448 2890 701 15892 --
NM_001017970chr1452562 2058 1710 748 233 ----1632
NM_001017995chr5124358 4056 4046 3320 1929 1626 761 691 649 537 341 139 11153 1591 11380
NM_001018067chr144654 979 756 168 21530 1225 ----
NM_001018068chr144654 979 756 168 21530 1225 ----
NM_001018069chr144654 979 756 168 21530 1225 ----
NM_001018074chr543129 1171 1102 834 12514 ----
NM_001018075chr543129 1171 1102 834 12514 ----
NM_001018076chr543129 1171 1102 834 12514 ----
NM_001018077chr543129 1171 1102 834 12514 ----
NM_001018111chr772841 1258 930 632 588 561 447 1714 11365 --
NM_001020658chr151386 1276 1229 1074 32 ------
NM_001020658chr151386 1276 1229 1074 32 ------
NM_001024094chr543129 1171 1102 834 12514 ----
NM_001024401chr1682772 2506 1821 1096 933 906 852 461 11957 1432 --
NM_001024649chr552434 2157 860 754 61 ------
NM_001024680chr241478 1380 1157 602 ------
NM_001024808chr1262654 2322 2184 1148 385 32 12585 ----
NM_001024847chr382529 2422 2175 2058 1928 1540 975 48 --11716 1549
NM_001025076chr1075191 4074 1817 1611 170 120 99 34660 4187 1641 25399 1331 --
NM_001025077chr1086549 5432 2969 1528 1478 1457 552 71 36018 5545 2999 36757 2689 55 --
NM_001025252chr822868 1105 22789 2332 ----
NM_001025253chr822868 1105 22789 2332 ----
NM_001025266chr364402 3334 3287 764 742 662 44868 4489 4236 1249 1439 14444
NM_001025580chrX63405 3314 2985 1390 616 293 14125 ----
NM_001029858chr632942 2649 758 12999 23066 1220 --
NM_001029863chr643230 2058 931 746 32665 2593 2319 ----
NM_001029871chr2051749 251 194 125 29 2595 344 ----
NM_001029875chr582924 2808 2628 2597 2186 2079 1200 956 --12271 12549
NM_001030007chr1673732 3500 3250 3089 2473 894 32 22839 269 23487 3025 --
NM_001031679chr1273285 2545 2368 1290 1015 837 525 22505 2216 ----
NM_001031680chr1102156 2091 2037 887 840 676 247 133 122 23 21616 254 ----
NM_001031690chr792928 2733 2406 2110 1925 1190 748 34 28 22853 2089 ----
NM_001031695chr2264997 4024 1287 1275 1124 220 11387 --11553
NM_001032280chr641586 1102 571 28 1240 ----
NM_001032288chr2061331 586 401 394 285 127 168 ----
NM_001032394chr652342 1781 1135 880 582 1849 ----
NM_001032395chr652209 1648 1002 747 449 1716 ----
NM_001033045chr273835 3220 2961 1493 1378 284 147 1704 ----
NM_001033047chr442031 1794 768 687 ----12303
NM_001033117chr3114829 3573 3460 1664 1604 1275 815 666 546 188 73 1295 --14088
NM_001033507chr131968 1467 315 135 --11557
NM_001033551chr17103943 3646 3367 1437 1281 1185 1091 578 228 151 178 33597 2546 495 --
NM_001034841chr1655341 4261 4044 543 49 13756 ----
NM_001035511chr142129 1369 731 429 1795 12086 --
NM_001035512chr142236 1476 838 536 2902 32 12193 --
NM_001035513chr142236 1476 838 536 2902 32 12193 --
NM_001037317chr132665 838 822 3890 568 308 ----
NM_001037332chr5112085 2003 1929 1859 1769 523 401 365 315 307 172 2946 915 ----
NM_001037333chr5112085 2003 1929 1859 1769 523 401 365 315 307 172 2946 915 ----
NM_001037339chr141532 1403 373 181 21807 1268 ----
NM_001037340chr141532 1403 373 181 21807 1268 ----
NM_001037341chr141532 1403 373 181 21807 1268 ----
NM_001037341chr141532 1403 373 181 21807 1268 ----
NM_001037553chr2184865 4576 4179 3384 647 456 254 202 2845 189 14834 --
NM_001038707chr162025 1878 1796 1576 749 522 --11622 --
NM_001038707chr162025 1878 1796 1576 749 522 --11622 --
NM_001039348chr221002 355 1803 ----
NM_001039349chr221002 355 1803 ----
NM_001039459chr72752 228 ----1913
NM_001039547chr3157404 6356 6283 6073 5836 5757 5642 3003 2829 2330 2004 1857 1264 1194 385 ------
NM_001039585chr153494 3448 2990 1500 189 23932 3648 ----
NM_001039590chrX43455 1204 1155 24 ----13697
NM_001039591chrX43455 1204 1155 24 ----13697
NM_001039618chr1154358 4185 1131 580 276 14390 1853 --
NM_001039690chr1641923 954 462 310 1877 21470 526 11840
NM_001039693chr2103905 3225 3142 3074 2959 1366 1098 812 549 501 ------
NM_001039802chr131373 1313 542 1536 1376 --
NM_001039840chrX43920 1878 1668 43 24165 892 1931 14779
NM_001040142chr241890 882 720 685 22020 83 ----
NM_001040143chr241890 882 720 685 22020 83 ----
NM_001040144chr1641923 954 462 310 1877 21470 526 11840
NM_001040146chr1641923 954 462 310 1877 21470 526 11840
NM_001040151chr11113999 3596 3445 3384 3241 3078 3013 3001 2980 2910 56 13234 11026 --
NM_001040152chr765025 4404 4093 1394 477 353 24385 1972 ----
NM_001040284chr1652212 1802 1299 1197 1010 ----35335 4646 1041
NM_001040441chr144393 4360 1910 1056 14957 ----
NM_001040446chr532726 1765 749 --2758 561 --
NM_001040665chr764587 1828 1415 1151 966 804 11613 ----
NM_001040712chr943586 2698 1137 432 1395 ----
NM_001042357chr102966 23 3590 566 228 ----
NM_001042358chr102966 23 3590 566 228 ----
NM_001042360chr102966 23 3590 566 228 ----
NM_001042361chr102997 54 3621 597 259 ----
NM_001042363chr102966 23 3590 566 228 ----
NM_001042364chr102997 54 3621 597 259 ----
NM_001042365chr102997 54 3621 597 259 ----
NM_001042387chr102997 54 3621 597 259 ----
NM_001042389chr102966 23 3590 566 228 ----
NM_001042390chr102966 23 3590 566 228 ----
NM_001042392chr102966 23 3590 566 228 ----
NM_001042393chr102997 54 3621 597 259 ----
NM_001042395chr102966 23 3590 566 228 ----
NM_001042396chr102997 54 3621 597 259 ----
NM_001042397chr102997 54 3621 597 259 ----
NM_001042413chr962982 1446 1389 1358 1249 495 2822 73 --11608
NM_001042425chr641586 1102 571 28 1240 ----
NM_001042492chr1762826 2668 2427 2143 1384 418 1399 ----
NM_001042494chr1563672 3482 3278 2438 170 86 23633 2408 ----
NM_001042495chr1563672 3482 3278 2438 170 86 23633 2408 ----
NM_001042496chr1563672 3482 3278 2438 170 86 23633 2408 ----
NM_001042497chr1563672 3482 3278 2438 170 86 23633 2408 ----
NM_001042555chr1254147 3804 3776 1485 720 ----14572
NM_001042599chr246791 5740 2092 555 15594 15200 --
NM_001042603chr1265338 3971 3956 2060 1332 464 1621 11476 13808
NM_001042604chr343467 1723 950 72 ------
NM_001042646chr341495 357 263 59 21523 232 11649 --
NM_001042681chr12945 626 --11619 1716
NM_001042682chr12945 626 --11619 1716
NM_001042682chr12945 626 --11619 1716
NM_001042724chr193549 301 31 1823 --125
NM_001042728chr127979 816 757 433 291 222 202 2713 329 ----
NM_001042749chrX41831 1719 696 680 ------
NM_001042750chrX41831 1719 696 680 ------
NM_001042751chrX41831 1719 696 680 ------
NM_001045556chr841535 1295 1284 47 21606 311 ----
NM_001045557chr841535 1295 1284 47 21606 311 ----
NM_001046chr542321 2154 835 432 1746 ----
NM_001048183chr193774 3531 3282 3044 2806 2700 1447 1332 289 11088 12963 --
NM_001083621chr1114477 4401 4184 4033 3732 3584 3395 3282 3170 540 531 61504 1395 1334 1290 992 777 34569 1409 133 --
NM_001099678chr3115884 5556 5309 4898 4669 4011 3930 3902 2470 1790 1036 --1181 --
NM_001100108chr1107494 6556 5687 5574 3306 3008 2202 1072 597 144 78332 6821 6434 1212 1194 906 508 38038 7030 5122 --
NM_001106chr368072 7656 7102 3325 356 334 39047 8660 84 --18544
NM_001113490chrX63615 2814 2701 2612 1178 947 22461 2366 ----
NM_001116chr1652609 1239 769 755 379 11209 1386 --
NM_001121chr1031569 1251 775 --1424 --
NM_001128chr1673732 3500 3250 3089 2473 894 32 22839 269 23487 3025 --
NM_001135chr154671 271 115 66 1142 ----
NM_001140chr172467 101 --2108 90 --
NM_001148chr432129 1457 283 21816 189 ----
NM_001167chrX86174 5942 5454 4893 4607 4297 1165 445 11668 15536 --
NM_001198chr632229 830 312 12193 ----
NM_001204chr2157035 6924 5379 5337 4985 4792 3019 1971 1749 1669 1189 927 893 287 112 1611 ----
NM_001206chr943074 2090 1934 1213 11203 ----
NM_001219chr721605 380 11745 ----
NM_001232chr14892 224 193 133 1953 ----
NM_001259chr7116386 6310 6218 6151 6013 4997 4387 4188 4156 1243 1191 25859 5036 --12179
NM_001271chr1553174 2523 740 242 218 63229 2932 2207 686 650 66 ----
NM_001286chr172791 2438 2321 2075 1075 245 223 ------
NM_001289chrX31300 1268 349 21634 1333 ----
NM_001304chr1733349 3151 589 ------
NM_001315chr642165 1879 1428 29 22022 433 ----
NM_001329chr1031299 1213 1056 1558 11605 --
NM_001331chr1172022 2014 1750 1740 1139 1104 191 ------
NM_001346chr352839 2418 1863 908 442 1289 12004 --
NM_001364chr1173783 3761 3195 3030 1551 625 394 33899 1923 939 ----
NM_001386chr842190 1918 767 176 ------
NM_001387chr582950 2434 2337 2178 1280 1274 918 676 12819 11208 --
NM_001399chrX53354 3215 2451 605 249 12420 --13333
NM_001402chr661908 1665 1403 1310 1272 57 ------
NM_001412chrX53710 3394 3206 2880 290 ----148
NM_001417chr1241931 1478 1470 459 --11831 --
NM_001419chr19104804 4787 4306 4126 4011 3943 3608 1826 528 501 21869 184 ----
NM_001432chr442910 1295 586 62 1648 ----
NM_001438chr153682 3190 1177 302 25 22907 223 ----
NM_001461chr11194 2490 151 ----
NM_001560chrX62420 2291 1660 1653 591 52 ------
NM_001587chrX3785 356 301 1167 ----
NM_001616chr243307 3294 2337 835 --22848 602 --
NM_001635chr74965 702 276 207 ------
NM_001650chr1841537 1080 1064 61 12950 ----
NM_001655chr1142003 1772 1587 1500 11934 1381 --
NM_001659chr1292573 2445 2250 2171 2157 1803 1700 1058 280 --171 --
NM_001683chr382613 2350 2043 1679 782 500 277 149 42528 2297 2221 1933 11809 --
NM_001690chr342422 1654 525 299 12476 ----
NM_001699chr1961751 1152 130 121 83 75 21731 1374 1440 --
NM_001746chr552434 2157 860 754 61 ------
NM_001754chr2153898 3720 2766 1140 1096 23331 748 23168 1419 --
NM_001759chr1273955 3450 3437 3360 1248 1172 1133 15051 1165 --
NM_001773chr141155 123 87 65 --1949 1136
NM_001791chr131373 1313 542 1536 1376 --
NM_001830chrX43292 2923 1333 1090 1745 ----
NM_001844chr121123 1132 --1357
NM_001859chr953842 2685 1103 978 226 11458 ----
NM_001895chr202371 365 ----1394
NM_001918chr1148710 8598 8144 7315 6868 6682 6032 3678 3140 2388 1955 1900 1785 1589 48767 8508 8413 2329 16925 12907
NM_001942chr1851478 1349 1332 536 54 ------
NM_001949chr663009 1978 726 586 292 87 12100 1996 --
NM_001969chr1483604 3544 3465 3119 2591 2544 2499 620 ------
NM_001975chr123818 219 38 ----1838
NM_001987chr12103807 3630 3427 3256 2878 1514 1353 1269 652 292 23283 441 ----
NM_001995chr4--2526 479 --140
NM_002006chr495488 4100 2191 2072 1681 1673 1557 833 157 35272 3729 528 ----
NM_002025chrX118981 8486 8379 7966 5880 5694 1922 1893 1467 1383 247 37392 2224 477 ----
NM_002035chr1843412 1207 914 889 1656 ----
NM_002039chr42894 83 ----1248
NM_002069chr72719 678 ------
NM_002074chr151664 1391 692 350 180 ------
NM_002076chr1263143 3042 2695 2682 981 262 --11238 --
NM_002077chr921704 1497 21763 240 --11815
NM_002086chr1781919 1854 1713 1453 904 790 325 136 ------
NM_002092chr484059 3934 3658 3314 3220 3197 778 84 34039 3337 913 ----
NM_002107chr1------1446
NM_002126chr1753707 1083 315 258 127 23343 615 ----
NM_002128chr1331013 971 847 1884 12500 --
NM_002131chr681281 1152 1000 940 291 191 138 74 1410 ----
NM_002158chr263644 2858 2478 2396 2322 207 ------
NM_002203chr552878 1053 953 772 443 43954 1359 621 87 12609 --
NM_002204chr1771374 1251 1220 1002 531 492 205 1363 ----
NM_002214chr724485 3550 25073 4310 ----
NM_002223chr1223767 3481 43879 3046 1538 617 ----
NM_002264chr354123 3664 3614 3608 1937 1488 ----
NM_002270chr531783 1382 26 21475 495 15087 --
NM_002293chr182347 2074 1828 975 488 385 356 279 12500 ----
NM_002313chr1044565 3932 1892 1433 1741 2933 926 --
NM_002355chr124572 148 97 77 ------
NM_002359chr17103828 3809 3670 3137 3051 2953 2916 2908 674 375 11516 13302 13661
NM_002373chr155935 549 491 317 191 11091 ----
NM_002382chr1461225 1178 1066 1054 191 49 ------
NM_002402chr741028 970 203 61 1114 ----
NM_002444chrX81825 1367 742 500 328 290 264 236 21316 58 11701 --
NM_002473chr2261357 1269 1235 1034 519 513 ------
NM_002505chr641273 397 50 43 1440 ----
NM_002515chr1421747 757 1691 1702 --
NM_002522chr17103857 3758 3659 3648 2910 2704 1560 881 837 179 ------
NM_002524chr11704 1266 --1111
NM_002545chr1174332 3243 1017 859 628 550 441 44923 4341 3133 1098 ----
NM_002577chr3113716 3024 2851 1614 1069 1011 990 853 782 761 323 13523 22681 2514 --
NM_002581chr984757 4140 4027 2101 1482 1043 252 210 45610 5572 4745 911 --14622
NM_002586chr621488 353 31106 331 38 11403 --
NM_002588chr551705 1398 1218 699 348 --11728 --
NM_002594chr2062053 928 708 393 222 23 11597 ----
NM_002595chr12--1666 21788 1310 --
NM_002600chr141532 1403 373 181 21807 1268 ----
NM_002645chr1112061 31965 873 755 ----
NM_002646chr142150 1810 1500 390 ------
NM_002649chr771734 1619 1142 641 445 376 131 ------
NM_002655chr864495 3897 2090 1339 839 297 35302 4082 959 11192 --
NM_002657chr20143597 3405 3167 3150 2909 2494 1548 1362 1302 1257 1231 1150 682 407 1927 ----
NM_002698chr1952717 2608 2527 320 133 11187 ----
NM_002719chr1432435 522 444 1879 ----
NM_002731chr182963 2884 2803 2790 2697 1167 776 728 ------
NM_002760chrY74130 3778 1258 1095 951 777 67 45657 4198 1291 387 ----
NM_002814chrX2300 109 ----156
NM_002822chr1231590 1411 315 1255 ----
NM_002839chr943586 2698 1137 432 1395 ----
NM_002869chr1141783 675 401 394 12071 ----
NM_002886chr374925 4234 4186 1613 1094 1067 466 13662 ----
NM_002892chr1421125 608 ----11287
NM_002906chr1161917 956 472 415 228 89 1404 ----
NM_002959chr154175 3063 1117 560 92 34335 681 402 1520 --
NM_002998chr83545 347 133 --11619 --
NM_003001chr142236 1476 838 536 2902 32 12193 --
NM_003026chr941336 959 917 328 1157 ----
NM_003028chr983770 3398 3087 2413 1554 481 462 374 51498 1427 1361 1293 410 ----
NM_003032chr362625 1839 997 934 303 273 21807 358 ----
NM_003042chr361699 1595 1536 297 254 33 --21708 820 --
NM_003045chr13104983 4526 3676 3158 3072 1754 1164 925 694 425 --23474 1418 --
NM_003047chr12960 46 --1383 1499
NM_003048chr222689 2360 --21118 818 1194
NM_003071chr311362 1553 1739 --
NM_003076chr1251658 613 223 190 100 11527 --1149
NM_003108chr296554 5938 5771 5693 5463 5064 2907 1848 293 16699 16184 --
NM_003112chr733017 557 278 13123 11068 --
NM_003144chr631876 678 108 12053 ----
NM_003155chr842096 1731 881 193 22395 2088 11997 --
NM_003161chr1743162 2397 2202 875 11264 --1859
NM_003168chr175836 757 711 245 97 1903 ----
NM_003199chr1854517 2038 1838 1785 1446 1309 ----
NM_003200chr1951852 1668 1655 1545 657 --21539 273 11679
NM_003216chr22122808 2604 2268 2052 1252 1119 980 852 500 436 271 143 21299 646 1817 --
NM_003220chr641586 1102 571 28 1240 ----
NM_003221chr673563 3222 3197 3135 1626 479 250 33401 1051 856 ----
NM_003242chr382529 2422 2175 2058 1928 1540 975 48 --11716 1549
NM_003262chr335040 4108 241 33293 1615 277 24435 1586 --
NM_003274chr2172729 2467 2382 2146 997 294 206 12537 ----
NM_003286chr203787 447 179 21178 1100 ----
NM_003342chr1743330 2944 2480 1019 --12661 --
NM_003349chr2061331 586 401 394 285 127 168 ----
NM_003392chr344225 919 620 390 13214 ----
NM_003404chr2011641 1706 --11612
NM_003406chr831280 387 141 11610 --174
NM_003410chrX22003 74 21231 414 ----
NM_003439chr753494 3063 1400 1093 633 2243 189 ----
NM_003458chr373439 2885 2805 1508 1344 817 662 3472 372 194 ----
NM_003463chr632677 614 304 2922 517 ----
NM_003468chr274183 3952 701 503 384 164 113 12957 1351 --
NM_003482chr1231112 582 381 12047 --1455
NM_003483chr1252967 2537 2016 218 101 1798 ----
NM_003498chr1652681 2415 2256 2029 1912 ------
NM_003559chr1763843 3072 2738 2608 1484 861 23641 2759 33269 2515 1368 --
NM_003574chr1855511 5060 1232 743 407 12214 1565 11989
NM_003583chr1222678 983 --13947 12599
NM_003607chr192817 2803 2707 2664 1130 942 374 363 57 ------
NM_003612chr15------2532 61
NM_003615chr343813 3005 2866 807 ----11349
NM_003617chr174504 3046 1204 960 891 415 66 24886 87 ----
NM_003624chr1951042 915 549 384 290 --11210 11059
NM_003629chr122943 616 --12555 12284
NM_003631chr103292 36 29 2961 143 ----
NM_003633chr542215 2167 1580 1034 11655 12198 12233
NM_003644chr17136381 6326 6069 5618 5399 4870 1486 1194 884 794 514 243 54 --21178 683 25953 1002
NM_003671chr953095 1019 557 250 113 22777 1075 ----
NM_003684chr16741 715 445 320 232 149 ------
NM_003714chr552490 2312 1152 1022 190 ------
NM_003716chr321052 747 ----1869
NM_003735chr551705 1398 1218 699 348 --11728 --
NM_003736chr551705 1398 1218 699 348 --11728 --
NM_003749chr1312315 --1456 1500
NM_003768chr161316 749 735 497 304 116 1371 ----
NM_003774chr1253183 2750 2262 963 380 ------
NM_003800chr642100 1976 1829 1737 1483 ----
NM_003829chr931107 820 47 11129 ----
NM_003861chr1452878 1088 868 419 355 ------
NM_003873chr1012024 11841 11857 --
NM_003877chr121802 ----130
NM_003885chr1752558 2375 1799 730 235 21710 118 ----
NM_003895chr213678 580 348 ----1708
NM_003899chr1342552 2275 620 354 --2584 439 --
NM_003913chr663999 3728 3564 2958 1572 1053 33113 2758 1482 ----
NM_003930chr752393 2057 1896 1834 868 --12554 --
NM_003939chr1062680 2614 1352 657 323 315 33283 1397 742 ----
NM_003948chr442369 1001 781 223 22708 1045 ----
NM_003949chr1761836 1573 1265 720 424 251 21920 1386 ----
NM_003958chr673537 3370 3262 3091 1114 1008 161 ----22898 539
NM_003966chr5117853 7819 7693 6338 5796 5557 2529 2286 1849 1231 574 21428 411 1137 --
NM_003983chr1633436 1745 1263 13845 13754 --
NM_003994chr1294339 3160 3104 2849 949 668 638 315 271 11672 1937 --
NM_004028chr1841537 1080 1064 61 12950 ----
NM_004035chr17115014 4869 3732 3618 3450 3233 3211 1991 1876 1449 1014 14877 23227 1391 --
NM_004050chr1452556 1074 1026 875 241 ----11016
NM_004089chrX41226 1194 136 90 --11088 --
NM_004090chr1763021 2353 1057 518 134 61 32823 581 493 ----
NM_004096chr1072162 2078 2033 1679 697 466 346 ------
NM_004100chr642631 2547 991 465 12374 ----
NM_004105chr221002 355 1803 ----
NM_004112chr173671 341 82 2312 263 21327 122 --
NM_004117chr651931 1826 1479 531 27 1419 11749 1549
NM_004171chr1157820 3714 2054 978 219 23370 3328 --18859
NM_004227chr722559 823 23038 386 11173 --
NM_004229chrX41565 1558 1445 1380 ------
NM_004274chr1482761 1260 342 276 262 105 83 36 --12870 --
NM_004311chr1052694 2215 910 676 254 1814 ----
NM_004319chr162902 2881 2641 1200 1111 277 --22105 473 --
NM_004323chr942204 2060 1662 126 22483 133 --1404
NM_004338chr18146905 6467 5817 5025 4915 4408 2666 2441 2346 2179 1908 1797 1129 862 25335 1409 15828 --
NM_004350chr1102156 2091 2037 887 840 676 247 133 122 23 21616 254 ----
NM_004397chr1144279 4187 3135 1254 13042 24103 196 1961
NM_004411chr74754 223 176 44 --2639 164 1613
NM_004423chr352224 1975 1100 745 35 12529 ----
NM_004426chr1281875 1777 1549 719 703 656 235 100 21717 1354 11391 --
NM_004430chr841844 1073 980 946 --1658 --
NM_004457chr221145 73 11087 ----
NM_004459chr1721972 1262 --11466 1372
NM_004491chr1964312 3330 2916 1349 766 448 --2883 641 --
NM_004494chr171186 1175 346 325 192 137 101 ------
NM_004501chr133590 3098 3007 3851 360 95 ----
NM_004504chr252434 2326 2126 2066 846 ------
NM_004505chr1731637 218 179 --11652 --
NM_004514chr1773004 2996 2813 2609 868 273 66 22420 2290 ----
NM_004580chr1541627 1616 720 113 11637 ----
NM_004586chrX84435 4277 3883 3380 1761 1008 608 105 23329 1333 ----
NM_004588chr11113756 3614 3554 3141 3102 2895 1598 966 247 153 33 13044 11059 --
NM_004598chr543334 3245 2943 2082 1962 12819 --
NM_004612chr944293 3619 3320 832 24753 914 11316 --
NM_004635chr341158 923 761 349 1357 ----
NM_004650chrX31586 765 325 ----2632 581
NM_004673chr1------11094
NM_004687chr172441 217 --11928 11566
NM_004711chr2232489 940 676 13378 2860 116 1927
NM_004717chr7----11245 1239
NM_004719chr1262760 2579 2313 2277 2254 1049 ----11807
NM_004726chrX75632 5575 5106 4518 4260 4094 3807 44173 3904 1574 1201 ----
NM_004736chr141744 1624 1409 39 1882 --1740
NM_004745chr8156675 6498 5564 4857 4388 2517 2303 1688 1461 1401 1119 726 412 116 95 17058 ----
NM_004748chr1564038 3984 1560 1167 708 231 11257 1403 --
NM_004775chr182658 169 11538 ----
NM_004808chr1032845 992 876 --22689 2101 --
NM_004822chr1753705 3418 2933 2509 2440 11036 33679 2527 689 --
NM_004845chrX104142 3207 3179 1101 1013 879 558 415 325 164 ------
NM_004897chr102659 267 1286 ----
NM_004898chr442781 2550 2177 91 12170 12525 --
NM_004904chr796257 5189 5126 5047 1967 1567 1556 1438 620 31766 1266 494 11359 14884
NM_004912chr711753 ----11359
NM_004926chr1431646 1623 84 31327 534 60 --1277
NM_004929chr82528 303 ----1423
NM_004938chr951095 789 499 485 176 1970 ----
NM_004956chr733518 3281 1642 ----1294
NM_004976chr1175134 4580 4381 3206 2046 833 491 ----13659
NM_004978chr151220 1091 1047 571 488 ----1581
NM_004985chr1264161 3599 2785 1146 557 494 ------
NM_004992chrX207889 7742 7212 7060 6538 6182 6010 5873 5797 3249 2524 2492 2419 2332 1982 1539 1155 1003 551 329 --37363 5193 2166 --
NM_004992chrX207889 7742 7212 7060 6538 6182 6010 5873 5797 3249 2524 2492 2419 2332 1982 1539 1155 1003 551 329 --37363 5193 2166 --
NM_005036chr22188147 7995 7494 6511 6239 5810 5685 5318 5307 5072 2646 2224 2214 2176 2103 1857 1017 365 --28290 1804 --
NM_005056chr1255582 4215 4200 1576 708 1865 23484 1720 14052
NM_005065chr1455317 4579 4380 4033 1196 13711 ----
NM_005079chr822868 1105 22789 2332 ----
NM_005105chr141409 507 184 146 1635 11516 --
NM_005116chr2054142 3580 1434 322 260 12874 11294 --
NM_005121chr1731457 1386 1308 --13323 --
NM_005135chr1563672 3482 3278 2438 170 86 23633 2408 ----
NM_005156chr994349 4227 3654 3521 1789 1718 1398 838 676 14600 14181 --
NM_005188chr11188125 8004 7526 7428 7073 6590 6278 6258 5956 5521 3313 3081 2926 2823 1965 1398 236 142 16641 15626 --
NM_005197chr1485341 5001 4584 4249 3951 3815 778 455 25084 1209 14240 --
NM_005207chr222788 46 ----21414 388
NM_005235chr246791 5740 2092 555 15594 15200 --
NM_005238chr1151141 1111 1048 744 637 12351 ----
NM_005254chr1521436 233 21145 887 ----
NM_005311chr742504 2252 1842 1072 22011 933 11988 22270 802
NM_005329chr1611729 22383 1666 32029 744 326 --
NM_005336chr241947 412 336 67 11449 --1132
NM_005338chr7103942 3869 3143 2868 2799 2684 1236 606 213 94 --11188 13459
NM_005359chr1836450 4652 3993 14052 1897 --
NM_005370chr196998 836 516 430 410 87 1885 --11082
NM_005397chr772841 1258 930 632 588 561 447 1714 11365 --
NM_005399chr184100 4082 3837 3384 2782 2733 1587 869 43069 2904 1101 603 ----
NM_005400chr252443 2409 931 750 173 22510 2365 3286 209 117 --
NM_005430chr126902 758 647 154 144 135 ------
NM_005440chr1762853 2601 2502 2051 1099 401 1420 ----
NM_005443chr41208 1230 ----
NM_005455chr141512 562 299 72 ------
NM_005477chr1561850 838 824 812 658 256 12524 --12012
NM_005477chr1561850 838 824 812 658 256 12524 --12012
NM_005487chr2232090 603 582 136 ----
NM_005501chr1761187 1064 1033 815 344 305 1176 ----
NM_005509chr52757 394 2327 300 ----
NM_005554chr124460 379 368 111 ----128
NM_005578chr384839 4827 4212 4029 3864 3310 463 259 43499 1611 1460 231 2883 304 1785
NM_005584chr133539 152 86 1235 ----
NM_005596chr954027 2373 2344 2204 510 24640 1685 --14464
NM_005637chr1832031 1435 537 1361 ----
NM_005638chrX51763 1580 690 142 123 ----11379
NM_005647chrX92270 2116 894 824 782 751 674 297 235 1464 ----
NM_005650chr22--1182 1103 1549
NM_005668chr573851 3040 1747 1078 874 222 205 ------
NM_005688chr331026 911 82 21184 970 1847 11107
NM_005715chr642450 2429 1135 619 32212 1064 124 ----
NM_005725chr142401 2100 2027 1567 11899 ----
NM_005730chr12133500 3441 3164 2845 2612 2596 2374 2323 1120 1048 1037 1010 704 149 ----
NM_005737chr232885 2544 386 12721 12205 12310
NM_005739chr1542330 1546 859 399 12203 ----
NM_005748chr1243382 3082 2180 894 23303 2457 139 --
NM_005759chr2113956 3930 3865 3404 3318 3224 1851 1658 1467 454 76 24810 4172 ----
NM_005779chr512577 23253 2421 1113 12947
NM_005785chr1271900 1755 1685 1439 775 289 48 1634 21411 77 --
NM_005789chr1782175 1994 1474 1422 1358 681 536 521 1490 22030 1563 --
NM_005808chr373371 3335 3211 2917 2898 2641 24 2834 390 11125 --
NM_005814chr171305 982 587 560 518 337 52 11233 11326 --
NM_005819chr183441 3068 3058 2625 2545 2494 2351 470 12938 1419 --
NM_005822chr642338 2107 552 345 --1441 --
NM_005828chr17124456 3768 3653 3233 3118 1748 1612 1520 1439 1414 967 819 24162 3341 13643 --
NM_005840chrX117609 6191 5669 5102 4899 2620 1388 954 848 542 196 25382 183 ----
NM_005877chr2241988 1649 1609 53 ----1300
NM_005895chr12103573 3485 2630 1602 1545 1290 1116 494 408 396 23960 3727 13052 --
NM_005898chr1173006 2797 2419 2363 1999 536 212 23182 134 ----
NM_005901chr18158497 7586 5276 3250 3069 2397 2366 2305 2209 940 749 449 273 208 127 11004 122 13023
NM_005909chr532959 1592 1131 44014 1698 1607 202 --14304
NM_005910chr1793645 3534 3313 3224 2868 1352 1224 1127 1108 13721 44000 3847 1626 1364 --
NM_005920chr162734 2515 1261 389 86 53 13159 21240 1124 --
NM_005933chr1162798 760 704 518 176 145 --22463 1053 --
NM_005955chr185318 4651 4321 2086 1202 1014 1007 837 13658 13758 11517
NM_005957chr194928 4815 4112 4052 3405 3096 877 465 103 --143 --
NM_006007chr943692 1538 1316 284 23575 2961 --13503
NM_006011chr15103795 3755 3704 3531 3086 3062 2773 1413 1281 1212 11319 43333 927 575 316 11488
NM_006037chr274845 4110 3345 3300 3248 1840 928 23658 998 189 1287
NM_006040chr1651396 1247 545 375 175 1552 ----
NM_006054chr1151349 1198 1124 1036 143 ------
NM_006060chr7114405 4045 4009 3322 3079 3047 1694 1617 974 877 76 1828 ----
NM_006085chr12991 296 --1414 --
NM_006094chr862226 1934 1928 674 422 27 ------
NM_006095chr432851 1026 1018 24033 3523 --12754
NM_006166chr1262621 2311 2048 1896 1785 764 ------
NM_006187chr1262994 2181 459 403 309 202 --124 --
NM_006194chr1441112 932 83 46 ----177
NM_006203chr545440 3983 3457 1111 15399 ----
NM_006206chr472589 2475 2359 2345 1787 991 27 ------
NM_006224chr1752515 2077 1969 1725 657 1519 ----
NM_006237chr1342206 1945 744 705 --22072 1793 --
NM_006241chr331527 907 824 1835 ----
NM_006251chr563197 2855 2165 939 602 248 13251 ----
NM_006283chr864766 4755 4149 3087 1831 1491 1514 1146 --
NM_006366chr61872 ----1222
NM_006375chrX21282 603 ----11547
NM_006390chr1231342 313 260 ----11605
NM_006393chr1031710 1008 630 23112 197 14267 1675
NM_006403chr611166 11175 11583 --
NM_006408chr73750 412 394 1956 ----
NM_006411chr64932 739 240 26 1950 ----
NM_006420chr2053454 1273 1210 308 149 21024 824 ----
NM_006464chr294000 3540 3426 1729 1712 1704 1472 1385 731 24520 966 1791 13028
NM_006465chr1531943 1884 22 21733 81 1439 --
NM_006482chr1222678 983 --13947 12599
NM_006489chr1421747 757 1691 1702 --
NM_006517chrX102104 1985 1767 1672 862 855 773 717 160 51 12161 1747 --
NM_006538chr273714 3175 2926 1242 1236 1051 1018 --32942 2828 654 --
NM_006546chr1796522 5165 4354 2187 2054 1358 978 876 152 25344 1042 25901 5492 --
NM_006547chr7------1292
NM_006549chr1252652 2473 2455 2436 499 12953 184 --
NM_006561chr1075191 4074 1817 1611 170 120 99 34660 4187 1641 25399 1331 --
NM_006572chr1753294 3164 2207 861 390 --1984 --
NM_006593chr23747 309 242 1274 ----
NM_006599chr1697479 7186 6584 6403 5107 2507 1428 1394 62 21234 777 ----
NM_006603chrX41831 1719 696 680 ------
NM_006609chr232109 918 39 --12075 --
NM_006614chr353205 3071 2685 2610 1052 11241 ----
NM_006621chr151610 1495 1325 610 492 11835 ----
NM_006626chr942002 225 200 158 ------
NM_006628chr1544283 3978 1874 1009 53776 1744 1098 820 750 13464 --
NM_006629chr1842341 979 409 170 21857 1773 ----
NM_006650chr563630 3153 2619 981 477 81 13789 13655 13564
NM_006654chr1254147 3804 3776 1485 720 ----14572
NM_006691chr115459 270 258 232 216 ------
NM_006699chr1127 32468 672 403 ----
NM_006703chr63426 81 66 189 ----
NM_006717chr912447 ----1867
NM_006720chr1044565 3932 1892 1433 1741 2933 926 --
NM_006729chrX85054 4669 4642 3493 2167 1695 1044 221 22112 174 13973 24650 3517
NM_006734chr6299 40 131 ----
NM_006748chr841535 1295 1284 47 21606 311 ----
NM_006750chr16127882 7471 6669 5898 5471 3154 3001 1832 607 561 520 50 37728 4951 3110 ----
NM_006766chr841798 789 753 470 22110 1789 ----
NM_006775chr621193 300 22003 274 12084 --
NM_006788chr1841594 1476 741 169 32144 1877 467 ----
NM_006790chr5------1423
NM_006826chr231234 945 68 21143 383 ----
NM_006852chr1752544 1026 298 232 140 ----12251
NM_006854chr751853 714 528 436 285 --1649 --
NM_006861chr1262016 1504 1318 762 622 83 --11952 1644
NM_006873chr23604 366 195 ----1675
NM_006885chr16103386 3328 3041 1129 1118 1107 1087 1060 729 585 1159 ----
NM_006906chr114920 811 290 171 --1784 --
NM_006914chr941444 1099 384 22 ------
NM_006924chr1743905 3663 2701 937 --1983 --
NM_006930chr541994 1979 1423 736 11787 12033 12022
NM_006931chr1252098 1974 1655 1374 126 11544 12091 --
NM_007011chr1586186 5972 4395 2401 1833 894 831 78 26049 4585 ----
NM_007042chr372470 2299 2110 1810 1061 606 127 ------
NM_007050chr20127689 7147 6668 6212 6080 5737 3241 2253 1981 1698 1474 1036 13139 1144 --
NM_007068chr222941 288 1102 1410 --
NM_007107chr32961 377 12156 2665 640 1772
NM_007144chr174340 101 73 50 --1867 --
NM_007175chr833203 2784 388 12473 22375 762 --
NM_007195chr1883134 3043 2276 1395 1046 902 421 119 13320 11193 --
NM_007249chr13189246 7967 7482 7274 7149 6981 6657 6630 6316 5892 3566 2200 2057 1511 1122 405 397 111 21326 1032 1525 18836
NM_007283chr342901 2412 323 233 32223 314 247 12924 --
NM_007287chr383210 2953 2900 2825 2752 2281 219 162 ------
NM_007288chr383210 2953 2900 2825 2752 2281 219 162 ------
NM_007289chr383210 2953 2900 2825 2752 2281 219 162 ------
NM_007292chr17115014 4869 3732 3618 3450 3233 3211 1991 1876 1449 1014 14877 23227 1391 --
NM_012081chr542985 2968 2361 696 13057 13647 --
NM_012095chr1052856 2830 594 434 341 23307 551 ----
NM_012098chr931142 552 192 21479 623 ----
NM_012102chr12945 626 --11619 1716
NM_012104chr1173034 2816 2370 1223 703 670 173 --1840 --
NM_012104chr1173034 2816 2370 1223 703 670 173 --1840 --
NM_012134chr131717 1259 176 --11742 1344
NM_012153chr1152455 2363 1967 476 198 ------
NM_012164chr9157158 6326 6315 6295 6287 6255 6227 4649 2845 1239 1037 799 517 492 98 36664 2075 2050 25661 2400 --
NM_012193chr1144762 4472 3778 147 24808 2159 13593 --
NM_012199chr173070 1649 1308 1095 1088 1057 304 13240 ----
NM_012214chr275631 3955 1701 1536 1207 1123 135 1156 16077 14231
NM_012219chr352800 2728 2380 569 188 --22941 2162 --
NM_012234chr321498 650 --13084 --
NM_012262chr175237 4898 3643 3355 1220 866 480 ------
NM_012266chr941080 987 902 261 ------
NM_012288chr6155677 5185 4925 4746 4279 4091 4064 1650 1348 1043 875 770 704 688 107 34972 3650 186 ----
NM_012296chr1183475 3411 3379 2964 429 117 89 56 22537 361 23152 444 --
NM_012300chr531859 1819 169 11954 ----
NM_012304chr531958 1853 928 2488 242 22440 359 --
NM_012306chr1293149 2923 2664 2591 2318 2254 2243 830 531 --11240 --
NM_012307chr183962 327 275 1178 ----
NM_012308chr1141815 823 644 509 ----12416
NM_012309chr1174633 4172 4115 3623 3211 1197 414 44580 4405 786 584 ----
NM_012316chr195410 5326 5203 2131 1401 1208 850 822 766 1842 12070 --
NM_012334chr534236 3958 719 23699 3595 23002 1504 13769
NM_012384chr2032000 1643 974 1516 1210 --
NM_012399chr221588 21532 557 --1540
NM_012420chr1051755 1545 1429 703 335 --12094 11446
NM_012464chr462950 2905 2110 2017 710 575 12365 ----
NM_012479chr761788 988 915 510 361 62 11850 ----
NM_013227chr154671 271 115 66 1142 ----
NM_013231chr1443594 2966 1376 708 11157 11403 --
NM_013261chr453676 918 725 435 103 11450 ----
NM_013262chr641427 1125 1119 383 ------
NM_013372chr1553304 2702 1073 54 30 11084 ----
NM_013374chr352793 2583 945 710 548 ----1164
NM_013382chr1452069 1735 1606 775 628 1567 --12285
NM_013399chr1651589 1207 621 88 82 ----11356
NM_013411chr132559 750 377 1658 12024 1462
NM_013444chrX2204 166 11004 --2741 418
NM_013446chr741357 1193 1093 119 1935 ----
NM_013449chr1282995 2807 2380 2170 1133 1124 566 559 1164 --12627
NM_013960chr82737 259 174 ----
NM_014023chr1052809 2718 2110 664 251 11881 21147 947 --
NM_014048chr1665308 4961 1892 1480 1182 1054 14188 23887 853 --
NM_014112chr864717 3830 3325 1363 875 413 ----14631
NM_014155chr1165417 5028 2552 2403 2323 1275 35574 4645 1575 11444 --
NM_014157chr1641090 866 538 81 1280 23141 901 --
NM_014181chr252046 1883 1161 575 73 12389 ----
NM_014231chr1262226 2159 2073 1959 1909 1771 22031 1607 1708 --
NM_014240chr383951 3599 3367 2870 2805 2766 2668 858 11160 23117 2828 --
NM_014250chr2232090 603 582 136 ----
NM_014292chr2281545 1445 1369 463 293 160 112 66 1287 ----
NM_014293chr22113863 3755 3473 3283 3103 1582 1338 615 497 213 127 12946 12770 --
NM_014309chr2264987 4014 1277 1265 1114 210 11377 --11543
NM_014319chr1231586 145 128 1415 --1357
NM_014331chr486171 5906 5797 5717 5366 5214 2388 1188 25314 1221 --25020 941
NM_014333chr1192737 2365 2331 2255 1023 982 498 397 240 ------
NM_014345chr62416 277 ----1915
NM_014376chr5112085 2003 1929 1859 1769 523 401 365 315 307 172 2946 915 ----
NM_014396chr742092 2069 1636 423 ------
NM_014399chr72390 346 1922 ----
NM_014415chr331625 1471 1157 --11076 --
NM_014421chr421690 1679 11758 ----
NM_014423chr554771 4586 3870 3418 1704 25417 3610 ----
NM_014494chr1671851 1522 920 733 447 420 122 ------
NM_014504chr71239 21906 382 1566 --
NM_014571chr1142952 2711 2643 2609 2297 2091 673 640 540 439 239 231 217 168 ------
NM_014573chr1741837 1623 1326 1173 --2596 200 --
NM_014613chr592659 2543 2169 1888 1081 709 342 320 27 12456 12224 --
NM_014614chr22309 258 3591 157 48 ----
NM_014630chr1593967 3941 2686 2679 1021 958 901 357 52 23398 2495 1995 --
NM_014636chr944005 2693 1013 888 --14200 --
NM_014646chr1842717 2553 373 365 12834 1129 2710 602
NM_014670chr241048 423 87 60 1299 ----
NM_014676chr151386 1276 1229 1074 32 ------
NM_014690chr792928 2733 2406 2110 1925 1190 748 34 28 22853 2089 ----
NM_014707chr71532 11693 --1635
NM_014721chr697156 6908 5699 5092 4895 4689 2573 2177 1156 15692 ----
NM_014730chr1295243 5052 4603 3706 2035 1835 1185 829 186 34965 4858 1906 25232 592 --
NM_014730chr1295243 5052 4603 3706 2035 1835 1185 829 186 34965 4858 1906 25232 592 --
NM_014739chr643832 3793 3541 3261 ------
NM_014746chr273674 1536 1529 1250 1135 1086 864 14005 ----
NM_014747chr194707 3984 3971 3700 1587 1414 1304 1044 752 11329 1472 --
NM_014751chr83849 770 73 12154 ----
NM_014765chr112535 ----12338
NM_014766chr793515 3508 2389 2326 1292 777 677 629 41 43212 1226 598 164 32333 900 151 --
NM_014774chr132548 2146 910 32358 968 214 ----
NM_014797chr642846 2444 1141 252 11011 11060 12529
NM_014800chr72752 228 ----1913
NM_014803chr1052895 869 732 366 300 1442 ----
NM_014810chr143632 2528 881 273 21289 244 ----
NM_014824chr112215 157 21781 600 ----
NM_014826chr192817 2803 2707 2664 1130 942 374 363 57 ------
NM_014839chr132226 1831 70 21658 166 189 --
NM_014840chr1232175 1337 1046 --1126 --
NM_014848chr1572814 2665 2324 2263 1759 802 503 1735 ----
NM_014849chr151224 971 323 314 234 21189 477 --1843
NM_014850chr3114829 3573 3460 1664 1604 1275 815 666 546 188 73 1295 --14088
NM_014864chr173666 3559 2933 971 779 277 217 24068 1066 23100 1204 1463
NM_014870chr1114477 4401 4184 4033 3732 3584 3395 3282 3170 540 531 61504 1395 1334 1290 992 777 34569 1409 133 --
NM_014877chr17127715 7660 6964 6849 6780 5838 5593 5419 2052 1747 867 123 17698 ----
NM_014880chr252411 2045 2038 1828 1101 22057 402 12220 --
NM_014883chr412215 21719 534 ----
NM_014891chr72553 365 ----21530 1228
NM_014906chr1754028 3013 801 297 259 ------
NM_014909chr1483739 3397 3361 2895 2550 741 163 132 ------
NM_014918chr1531601 451 296 1388 1607 --
NM_014921chr19122947 2745 2551 2443 2385 2274 2141 2099 1902 1247 326 203 ------
NM_014925chr122758 241 ----1646
NM_014926chr33800 120 92 11038 ----
NM_014932chr341972 1877 1470 685 11938 ----
NM_014934chr1333188 1264 1233 23174 109 ----
NM_014947chr142501 2399 2334 2091 1788 ----
NM_014951chr1062601 2148 2079 992 513 54 ------
NM_014961chr432071 1595 782 12038 11985 --
NM_014964chr1782379 1957 1881 1756 1707 1691 1547 206 ------
NM_014982chr1431761 1660 1242 11682 ----
NM_014989chr641744 505 337 143 11871 --11506
NM_014990chr1431120 515 31 2377 61 ----
NM_014997chr752219 991 342 181 173 11876 ----
NM_015002chr1241520 446 363 141 ----1299
NM_015008chr363264 3012 2994 1079 533 450 13357 22469 652 --
NM_015020chr1643727 3301 2881 218 --1585 --
NM_015026chr1254785 3766 3351 3019 1422 ------
NM_015027chr1621572 634 11787 1215 --
NM_015033chr9103288 3235 2615 2586 2447 1312 1172 1052 476 171 164 ----
NM_015035chr2085936 5544 4149 1888 1807 1781 1154 98 34944 485 231 16364 --
NM_015044chr1673055 2866 2827 2277 1221 382 104 12979 12811 --
NM_015059chr1583887 3871 3544 3372 3021 556 244 153 53851 2596 1557 1161 142 31430 890 200 --
NM_015068chr743877 3256 2945 246 33237 954 824 ----
NM_015071chr584966 4534 4325 4216 4035 1102 1082 567 11479 ----
NM_015075chrX10845 782 736 730 472 454 417 407 338 198 ------
NM_015079chr1552792 2633 657 245 217 22685 715 13129 --
NM_015082chr521852 1794 22401 724 32191 1963 1620 --
NM_015090chr155805 5119 4879 4820 2408 36021 5933 5202 1293 --
NM_015092chr1664704 4372 3936 3667 1677 358 23913 163 ----
NM_015094chr2274336 4249 4040 3449 595 227 204 --23195 1728 --
NM_015097chr33916 458 295 --11667 --
NM_015100chr121834 1568 11340 1593 --
NM_015101chr172520 2501 2009 1862 1776 1065 836 1301 ----
NM_015129chrX21444 325 11194 ----
NM_015138chr1562414 990 941 814 801 188 --22531 52 --
NM_015144chr1663790 3492 3364 959 855 779 --1394 --
NM_015147chr262178 2062 1288 1068 327 293 ------
NM_015192chr2032990 163 139 11107 ----
NM_015199chr332620 2090 1154 2110 27 ----
NM_015200chr442567 434 348 299 ------
NM_015208chr1853968 2833 629 402 30 21507 925 --12786
NM_015267chr1242101 1760 1639 760 21657 560 1807 --
NM_015271chr453814 3197 3172 1561 1290 ------
NM_015272chr1631733 330 28 161 1412 --
NM_015284chr192130 1724 1715 1347 1313 568 463 442 415 --21524 649 --
NM_015288chr593298 2807 1294 1172 567 419 208 95 21 --23420 241 --
NM_015299chr1483556 3497 3437 3403 2619 790 678 537 ------
NM_015313chr1174800 4379 3637 3395 1741 688 141 22948 1289 160 --
NM_015315chr573221 2912 1240 990 561 466 75 --23265 2618 --
NM_015331chr14551 488 198 108 1678 159 --
NM_015347chr123246 189 146 ------
NM_015349chr642278 2023 1227 442 11015 12894 --
NM_015365chrX63405 3314 2985 1390 616 293 14125 ----
NM_015397chr941437 1389 740 699 11780 ----
NM_015455chr563734 2936 2564 1081 960 928 ------
NM_015460chr351933 703 623 172 94 21327 461 ----
NM_015484chr11118 1180 --1727
NM_015508chr311330 21372 981 1974 --
NM_015550chr763545 3511 3193 2756 881 822 22734 912 ----
NM_015553chr693374 3287 1516 747 612 604 405 246 123 14744 ----
NM_015569chr164707 4518 4329 1825 1734 968 1404 11386 --
NM_015570chr731438 226 217 1572 ----
NM_015576chr352518 2262 1976 1938 24 11987 ----
NM_015605chr102997 54 3621 597 259 ----
NM_015609chr1102923 2506 2095 1905 1087 751 664 448 230 199 1875 11838 --
NM_015640chr144654 979 756 168 21530 1225 ----
NM_015687chr62238 152 ----1385
NM_015695chr681898 724 612 464 430 360 354 209 3540 482 45 1499 --
NM_015726chr161526 1301 1159 655 580 71 1560 --11582
NM_015852chr712964 33095 1016 892 ----
NM_015879chr18138598 6654 6376 6036 5535 5195 2621 2612 2344 1715 1390 1223 494 37294 3063 906 ----
NM_015886chr855163 2136 1659 783 683 14451 14693 15534
NM_015906chr123088 794 --11500 13368
NM_015913chr13227 139 115 ------
NM_015986chr1721420 290 --1584 --
NM_015995chr15105496 5217 5182 4903 4270 3880 2206 823 703 31 13412 ----
NM_016021chr641208 915 525 348 12177 1219 --
NM_016072chr1231640 813 696 1286 12372 --
NM_016083chr622908 247 13254 --13023
NM_016132chr1532363 850 122 129 ----
NM_016185chr173785 608 276 ----1715
NM_016201chr392182 2176 1788 725 588 473 393 142 126 ------
NM_016206chr3118144 6294 5464 3202 2903 2768 2646 2287 1916 1597 173 17249 ----
NM_016221chr562147 1878 1685 825 350 192 11889 --11527
NM_016255chr673357 3192 2747 2541 1295 1092 497 126 ----
NM_016260chr236496 2355 74 25139 5079 ----
NM_016261chr174772 325 289 174 ------
NM_016272chr2252778 2124 1958 692 111 22005 1878 ----
NM_016297chr272686 2391 1286 1000 350 307 33 ------
NM_016352chr771181 1162 1133 1066 434 252 81 ------
NM_016376chr1794383 3376 3276 2779 1108 1042 704 372 153 12690 22751 220 13029
NM_016396chr1522894 2519 12174 --12290
NM_016507chr1732400 2283 2198 1568 ----
NM_016522chr1121664 1475 ----1556
NM_016526chr1142231 1673 675 144 32483 2255 60 1358 --
NM_016530chr1543937 1249 968 748 ------
NM_016544chr253400 2406 839 639 97 --21518 895 --
NM_016559chr351525 1423 1281 1170 513 1279 ----
NM_016577chr374539 4183 2807 1761 1356 692 26 1386 ----
NM_016592chr2031327 1264 544 1567 ----
NM_016598chr331110 419 126 21484 1300 160 --
NM_016654chr1521436 233 21145 887 ----
NM_016824chr1031569 1251 775 --1424 --
NM_016830chr124588 521 435 133 1393 ----
NM_016834chr1793645 3534 3313 3224 2868 1352 1224 1127 1108 13721 44000 3847 1626 1364 --
NM_016835chr1793645 3534 3313 3224 2868 1352 1224 1127 1108 13721 44000 3847 1626 1364 --
NM_016841chr1793645 3534 3313 3224 2868 1352 1224 1127 1108 13721 44000 3847 1626 1364 --
NM_016952chr1163047 2769 2711 546 330 28 24023 826 23831 1002 --
NM_017413chrX62362 949 942 319 143 101 1205 --11639
NM_017420chr1453704 2534 546 531 81 ------
NM_017519chr62475 313 ----11335
NM_017551chr1031750 986 33 22185 1688 12171 1421
NM_017563chr3116153 5971 5313 4781 2281 1804 1665 1214 1120 1056 101 --1667 15508
NM_017586chr941882 1666 1418 468 21628 277 21736 1598 --
NM_017594chr952277 2070 1132 553 131 12660 ----
NM_017610chr1531605 1442 40 1726 ----
NM_017612chr124458 190 131 100 1418 ----
NM_017628chr485145 4321 3955 3269 1738 1667 1340 632 13670 14307 --
NM_017633chr633048 1117 220 33150 1333 338 1424 --
NM_017637chr978502 8260 8239 6183 3425 3353 34 17111 ----
NM_017643chr1732660 2335 124 22014 1899 ----
NM_017644chr354814 4425 1254 1114 1006 ------
NM_017650chr755692 4808 4322 3824 1520 ------
NM_017666chrX41712 688 608 174 2625 84 ----
NM_017700chr4125 ----183
NM_017709chr13968 376 282 22883 24 ----
NM_017754chr674340 3304 1974 1925 1022 427 154 1439 ----
NM_017769chr1422597 2178 11313 --11285
NM_017778chr821369 1221 31206 1195 1155 ----
NM_017787chr1062844 2679 2511 2370 2323 284 11119 11040 --
NM_017811chr982902 2521 2438 2357 2223 2163 970 281 12039 ----
NM_017813chr865523 5379 3534 1434 1376 195 ----15005
NM_017848chrX114456 4183 3732 3185 3010 1145 1111 337 242 236 128 11344 ----
NM_017893chr1071324 1290 1141 1069 932 325 49 --11152 --
NM_017896chr2042642 2530 2517 341 ------
NM_017902chr1095452 4441 4385 4209 3982 2254 1671 660 272 --34758 2089 1117 15408
NM_017919chr985411 5120 4849 4790 3528 1931 1160 978 11176 ----
NM_017987chr1011898 1715 --1535
NM_018014chr211306 1504 --1240
NM_018128chr174405 304 177 154 1525 ----
NM_018182chr1782217 1964 1958 1709 1585 750 685 288 22147 576 ----
NM_018200chr1572619 804 777 641 566 264 30 ------
NM_018227chr473135 2710 2526 2063 992 815 550 22437 698 ----
NM_018243chr473609 3564 2735 2528 1161 477 357 3951 728 28 13632 13546
NM_018247chr643097 2464 1014 50 ------
NM_018293chr332949 968 693 22383 1940 ----
NM_018299chr8----139 11219
NM_018325chr921388 558 2470 145 --11506
NM_018327chr2031640 1307 489 21860 660 1443 --
NM_018348chr163848 197 129 11166 --11140
NM_018351chr1263896 3853 3687 3411 3373 1436 1412 ----
NM_018362chr1152767 2450 1464 473 165 --1228 --
NM_018374chr754158 2069 1861 870 456 13689 24666 2087 --
NM_018400chr11113999 3596 3445 3384 3241 3078 3013 3001 2980 2910 56 13234 11026 --
NM_018416chr12112229 2135 1989 1974 1868 1818 1016 966 953 446 415 ----12601
NM_018429chr532498 2044 970 --1523 --
NM_018440chr8118451 8159 7643 6722 6683 6303 5539 3204 2030 965 290 22205 1743 ----
NM_018452chr6_random73729 2722 2688 1073 829 750 523 43601 923 913 198 ----
NM_018553chr173515 369 229 ----11536
NM_018566chr133192 1512 685 24006 1449 ----
NM_018638chr1255246 4511 2248 2149 369 ------
NM_018660chr852977 2698 2363 2297 161 1296 ----
NM_018689chr1512062 ----12257
NM_018841chr163943 3828 2564 985 544 216 ------
NM_018912chr551705 1398 1218 699 348 --11728 --
NM_018913chr551705 1398 1218 699 348 --11728 --
NM_018914chr551705 1398 1218 699 348 --11728 --
NM_018915chr551705 1398 1218 699 348 --11728 --
NM_018916chr551705 1398 1218 699 348 --11728 --
NM_018917chr551705 1398 1218 699 348 --11728 --
NM_018918chr551705 1398 1218 699 348 --11728 --
NM_018919chr551705 1398 1218 699 348 --11728 --
NM_018920chr551705 1398 1218 699 348 --11728 --
NM_018921chr551705 1398 1218 699 348 --11728 --
NM_018922chr551705 1398 1218 699 348 --11728 --
NM_018923chr551705 1398 1218 699 348 --11728 --
NM_018924chr551705 1398 1218 699 348 --11728 --
NM_018925chr551705 1398 1218 699 348 --11728 --
NM_018926chr551705 1398 1218 699 348 --11728 --
NM_018927chr551705 1398 1218 699 348 --11728 --
NM_018928chr551705 1398 1218 699 348 --11728 --
NM_018929chr551705 1398 1218 699 348 --11728 --
NM_018945chr693542 3050 2247 1376 1324 1041 821 246 140 23457 3074 ----
NM_018958chr1553912 3244 2880 1166 878 53810 3701 3407 3297 1220 2856 199 --
NM_018970chr733118 1272 582 22409 957 ----
NM_018979chr1242076 1759 750 449 12427 ----
NM_018999chr1074842 4171 3862 1065 822 417 327 ----11621
NM_019001chr343467 1723 950 72 ------
NM_019027chr431683 803 770 1762 ----
NM_019063chr232284 2112 479 ----1249
NM_019094chr12123709 3437 3275 3146 2826 2607 1450 1133 1013 792 39 25 23122 279 ----
NM_019106chr2293336 3013 2994 2780 2459 2237 2176 812 300 ----196
NM_019117chrX63367 3234 3042 2974 2497 1400 33427 2793 247 ----
NM_019556chrX1291 ----1556
NM_019557chr13694 313 29 --1671 1356
NM_019859chr1061405 1110 646 344 329 266 21356 1333 ----
NM_019860chr1051453 1158 392 377 314 21404 1381 ----
NM_019885chr272273 2167 1859 1851 1830 694 544 ------
NM_019903chr1031569 1251 775 --1424 --
NM_020116chr421232 1195 11146 ----
NM_020122chr275511 4619 4428 3771 1375 555 166 25038 911 ----
NM_020132chr2184865 4576 4179 3384 647 456 254 202 2845 189 14834 --
NM_020148chr1862399 1177 976 653 416 347 12247 --22504 147
NM_020150chr1032146 2004 656 --22194 303 --
NM_020151chr251530 347 276 249 46 --1146 --
NM_020177chr553281 2225 1325 1224 427 12521 12728 --
NM_020178chr174993 503 307 25 21169 183 ----
NM_020200chr1051098 1077 888 217 29 21106 479 ----
NM_020239chr162025 1878 1796 1576 749 522 --11622 --
NM_020342chr212196 ----12148
NM_020348chr1072425 1974 1715 1017 649 626 68 2253 95 ----
NM_020357chr321575 1129 11286 ----
NM_020390chr323512 1699 23205 1969 1946 --
NM_020416chr45855 641 531 476 443 ----12641
NM_020429chr792944 2450 2174 2148 2107 1927 833 213 180 ------
NM_020432chr7198 21908 822 ----
NM_020440chr152530 908 874 285 198 ----12576
NM_020455chr652342 1781 1135 880 582 1849 ----
NM_020466chr664837 4723 4235 1848 461 201 23750 1033 ----
NM_020640chr311953 1282 --2728 679
NM_020682chr1051068 987 874 387 272 ------
NM_020699chr1105307 5006 4501 4388 3431 3422 1453 1319 1028 525 14752 --11052
NM_020708chr2082461 1616 1544 864 778 609 374 368 12045 ----
NM_020717chrX115034 4960 4845 3238 3069 1661 1031 681 160 135 110 33987 437 250 1696 --
NM_020718chr1696163 5559 5233 4983 2320 1235 766 661 66 24865 4133 ----
NM_020728chr733073 2888 2773 32040 219 68 ----
NM_020732chr62475 313 ----11335
NM_020739chr1564038 3984 1560 1167 708 231 11257 1403 --
NM_020742chrX22599 162 12122 1124 1911
NM_020746chr2061109 1055 1042 940 457 22 ------
NM_020750chr65449 312 242 230 101 1301 ----
NM_020752chr1042867 1024 923 539 --1907 --
NM_020769chrX7783 638 272 252 148 136 120 ------
NM_020772chr1746979 5867 1862 1759 27956 3456 12605 12351
NM_020776chr1872494 2484 1957 1080 567 472 379 31945 1160 600 21048 115 --
NM_020792chr352685 1957 1887 1711 96 146 ----
NM_020795chr1761750 1677 425 317 277 165 1298 11413 --
NM_020796chr552826 2545 2313 1157 447 12678 ----
NM_020804chr672581 2262 920 503 323 90 58 --2347 274 11007
NM_020830chr262717 2647 2420 2042 907 63 11068 ----
NM_020845chr1282381 2255 2029 997 930 388 251 111 --22351 2249 --
NM_020850chr1653058 2929 2472 2413 865 --22621 1320 --
NM_020858chr1531502 371 22 1709 ----
NM_020868chr211413 ----2648 382
NM_020872chr331571 1304 376 1301 ----
NM_020899chr1751775 1757 1610 384 173 11846 ----
NM_020935chr274198 3985 3685 3514 2992 1863 691 14425 11750 2734 193
NM_020940chr1042306 1909 1040 702 12139 170 --
NM_020947chr1652394 1963 1700 1526 569 183 --2824 134
NM_020948chr152716 2499 2240 1134 474 13482 ----
NM_020952chr91857 ----1558
NM_020956chr1984031 3101 1373 961 745 700 549 67 13189 1557 --
NM_020962chr1552318 2164 1713 630 445 1773 ----
NM_020964chr18114086 3698 3398 3317 3067 1536 1521 1174 374 345 300 34667 4376 311 1263 14748
NM_020977chr432129 1457 283 21816 189 ----
NM_020993chr1262654 2322 2184 1148 385 32 12585 ----
NM_021007chr241890 882 720 685 22020 83 ----
NM_021061chr864296 4078 1652 1096 1088 882 131 ----
NM_021079chr1783345 2452 2335 2072 2044 1177 864 372 ------
NM_021088chr241736 1507 468 445 1818 21949 1547 --
NM_021090chr2274928 4031 3788 1539 952 798 715 11701 --11055
NM_021097chr262575 2496 1160 1015 937 169 --1944 --
NM_021116chr7158978 8847 8250 8136 8084 8077 7010 6989 6739 6406 5958 5560 2416 2158 631 18152 ----
NM_021155chr1962268 1010 950 492 349 233 --1114 --
NM_021159chr441145 491 276 29 ------
NM_021202chr2072553 2404 2148 1208 1201 414 390 ----22889 405
NM_021238chr1221970 1470 21786 387 ----
NM_021622chr1011672 12001 1951 --
NM_021633chr141411 503 257 92 1962 ----
NM_021638chr461968 1947 1850 1651 1378 355 1865 13420 --
NM_021705chr641273 397 50 43 1440 ----
NM_021813chr6105299 5095 4963 4575 4197 4011 1183 552 86 39 25029 4657 32204 1856 1292 --
NM_021911chr535106 4556 508 12083 ----
NM_021913chr1961751 1152 130 121 83 75 21731 1374 1440 --
NM_021949chrX72692 2480 2256 2181 310 260 104 11987 12123 --
NM_021954chr135816 213 125 100 75 13021 ----
NM_021959chr66747 631 378 357 266 245 ------
NM_021961chr1176859 6414 5638 2200 1759 1691 640 27038 2867 16275 --
NM_021964chr356469 5054 867 485 253 ------
NM_021988chr2061331 586 401 394 285 127 168 ----
NM_021998chrX166 1165 178 --
NM_022048chr15115517 5293 5081 4530 4230 4186 2074 1305 1177 276 218 15645 ----
NM_022090chr5------1496
NM_022114chr153665 3611 1751 1068 1061 11355 23422 195 --
NM_022166chr16186102 6061 5173 5062 4304 4248 4083 2105 1947 1832 1708 1698 1489 1415 1349 651 482 85 14269 44519 4091 1389 233 1261
NM_022337chr111545 ----147
NM_022442chr2061331 586 401 394 285 127 168 ----
NM_022459chr13105889 5863 5712 5569 5424 4975 4172 3859 1458 80 36279 6015 760 ----
NM_022462chr1993295 3194 3147 2419 1521 1456 758 693 199 23549 1433 ----
NM_022465chr1252440 2164 681 574 345 ------
NM_022474chr1432244 1890 756 ----1358
NM_022482chr2032283 1958 387 1961 1754 --
NM_022491chr1252591 2426 1301 1127 499 22999 1109 ----
NM_022497chr383537 2974 2864 2554 1441 1238 1125 255 ------
NM_022648chr2104396 4232 4186 4060 3807 3701 3663 3644 3039 1057 --33657 3638 667 --
NM_022719chr2272560 2394 1462 1088 761 694 332 23370 1149 13229 --
NM_022781chr921091 755 --21076 1066 --
NM_022802chr1031299 1213 1056 1558 11605 --
NM_022842chr3102944 2555 2124 1150 751 743 736 711 394 359 21337 1121 ----
NM_022893chr242028 889 250 31 1852 1110 --
NM_022898chr1484371 3996 3946 3933 3210 1260 706 161 13089 14461 --
NM_022912chr231977 627 206 1324 ----
NM_023000chr1421125 608 ----11287
NM_023001chr1421125 608 ----11287
NM_023074chr1941162 973 491 232 2466 161 161 --
NM_023923chr193774 3531 3282 3044 2806 2700 1447 1332 289 11088 12963 --
NM_023929chr852725 2589 1937 916 292 ------
NM_024052chr1772854 2709 2663 2337 2162 1948 383 --1322 --
NM_024086chr1762885 2511 913 819 167 78 1488 ----
NM_024332chrX31539 722 674 ----11408
NM_024528chrX------160
NM_024590chr411329 21274 601 1275 --
NM_024629chr43917 255 44 1458 ----
NM_024646chr143010 2678 2529 1058 1238 ----
NM_024665chr323060 3052 13033 187 14589
NM_024721chr842537 2504 746 79 2249 140 ----
NM_024742chr1651410 642 572 544 507 --2593 467 --
NM_024744chr242330 2125 1670 156 12399 ----
NM_024761chr995230 3910 3606 3292 2076 1826 1636 842 378 24018 291 14154 --
NM_024770chr2116307 5674 5644 5111 4580 2582 2294 1640 1224 806 401 14394 ----
NM_024875chr1041716 711 74 64 --11635 --
NM_024900chr432019 913 215 11453 11928 11642
NM_024900chr432019 913 215 11453 11928 11642
NM_024913chr71425 ----1578
NM_024947chr3118970 8740 8159 7835 6592 3548 3058 2804 1926 1291 1057 146 28080 2863 --
NM_024949chr474013 3771 3651 3310 3084 1617 498 14951 24348 786 --
NM_024953chr1232721 2059 280 1514 ----
NM_024963chr7135411 5374 5292 5177 4870 4755 4543 4004 2189 1879 734 563 28 14170 25857 5833 11609
NM_024971chr91857 ----1558
NM_024989chr287543 5872 2557 2517 2393 2011 1628 1370 11338 32206 1840 351 --
NM_025073chr174188 3383 1365 1126 824 590 60 1456 ----
NM_025146chr342300 2125 1984 276 ----12182
NM_025179chr1114848 4659 4488 4153 1903 1419 1380 1065 474 182 62 24421 1630 23742 3256 --
NM_025191chr153114 1256 989 927 788 12811 1198 --
NM_025208chr1131624 138 78 --11583 1779
NM_025219chr2051897 860 517 396 253 --11877 --
NM_025237chr1731484 1416 544 --2284 202 --
NM_025248chr1762711 2122 1993 1297 610 372 22945 2774 ----
NM_030576chr1731785 682 352 22538 178 --22360 2352
NM_030579chr1653514 3420 3277 3242 2306 ------
NM_030621chr1463832 2835 1594 1514 949 517 ------
NM_030623chr241433 614 516 215 11342 ----
NM_030625chr1092531 2487 2015 1618 1065 975 736 466 99 1804 ----
NM_030647chr766045 4245 934 904 704 421 35307 1993 1529 ----
NM_030648chr464968 4720 2215 2189 684 115 --1210 --
NM_030674chr12115287 4555 4374 3880 1746 1504 1335 1273 645 380 70 ----11770
NM_030755chr1442357 2258 1894 445 1420 ----
NM_030762chr1231282 630 329 1200 --1523
NM_030806chr188989 8351 7482 6709 2077 787 482 122 11920 13393 11432
NM_030809chr1252326 2235 1682 428 101 52392 833 659 562 285 ----
NM_030885chr322352 748 1342 --12052
NM_030925chr13136 21336 628 --11811
NM_030964chr563584 3536 3276 2843 1111 514 1415 --13494
NM_031244chr621121 108 31083 998 76 ----
NM_031427chr1495709 5590 5556 4411 3745 1996 1686 522 250 35213 4094 1087 ----
NM_031442chrX52180 1257 542 428 397 ------
NM_031445chr253030 2921 1227 669 147 12413 125 --
NM_031453chr1072386 2246 2065 1734 911 692 143 12346 ----
NM_031468chr7137981 7961 7414 6716 6608 6518 2945 2757 2651 2097 1480 496 448 2890 701 15892 --
NM_031483chr2021340 261 23558 2777 1309 --
NM_031844chr133590 3098 3007 3851 360 95 ----
NM_031890chr22102920 2450 2241 1901 1156 1071 673 426 300 231 --21180 394 --
NM_032012chr994533 4124 4108 3684 1982 1707 1291 902 296 25203 513 ----
NM_032042chr522658 351 --1802 1527
NM_032088chr551705 1398 1218 699 348 --11728 --
NM_032092chr551705 1398 1218 699 348 --11728 --
NM_032145chr611784 31752 1316 600 ----
NM_032199chr1053392 2417 720 598 123 1748 --33333 3269 1025
NM_032208chr262900 2281 1412 1217 296 252 11391 ----
NM_032221chr2031633 691 309 151 21269 172 --
NM_032228chr1143017 2849 2449 80 22255 778 ----
NM_032239chr4----21114 46 11145
NM_032268chr1632219 641 632 11200 23071 2456 --
NM_032283chr141812 1659 1162 128 21357 194 11579 --
NM_032291chr111329 ----1180
NM_032373chr1064292 2311 1697 1002 310 231 14605 ----
NM_032403chr551705 1398 1218 699 348 --11728 --
NM_032449chr182756 2506 2432 2346 2170 1072 772 501 11954 ----
NM_032582chr1751660 1396 686 230 191 ------
NM_032594chr143688 356 248 --1148 --
NM_032682chr343475 2375 973 853 1887 ----
NM_032711chr17103828 3809 3670 3137 3051 2953 2916 2908 674 375 11516 13302 13661
NM_032727chr1051674 1483 1047 446 123 ------
NM_032741chr64932 739 240 26 1950 ----
NM_032781chr114920 811 290 171 --1784 --
NM_032788chr231626 1511 1103 1391 --1121
NM_032871chr1131330 654 571 --11204 21713 1364
NM_032873chr1123358 532 --11637 --
NM_032876chr1471747 1537 1407 381 331 261 222 12032 --1713
NM_032900chr1063779 2719 1405 999 381 318 13266 ----
NM_032947chr531282 1010 364 ----1852
NM_032968chrX24139 1691 ----12814
NM_032969chrX24139 1691 ----12814
NM_032971chrY4881 766 170 130 --1955 --
NM_032972chrY4881 766 170 130 --1955 --
NM_032982chr7102569 2563 2424 2281 1673 1623 854 689 446 337 ------
NM_033020chr123088 794 --11500 13368
NM_033030chr21147 ----11486
NM_033103chr1931162 943 472 --11133 --
NM_033121chr1231726 1422 1139 21317 563 ----
NM_033129chr2061981 1414 770 692 617 301 2680 182 ----
NM_033132chr132706 641 11428 ----
NM_033133chr1753592 3148 706 695 625 12752 23513 1046 11333
NM_033135chr1131624 138 78 --11583 1779
NM_033150chr121123 1132 --1357
NM_033181chr622908 247 13254 --13023
NM_033221chr982589 2431 1981 763 692 637 532 369 --1580 --
NM_033224chr7117942 7825 6546 6442 5352 5237 4923 2939 1541 262 199 ------
NM_033225chr833071 2420 91 12295 12867 --
NM_033274chr563257 2545 589 436 410 109 33425 2214 917 ----
NM_033290chrX73574 922 441 426 415 115 102 13341 ----
NM_033326chr1142359 1646 877 376 ------
NM_033331chr953095 1019 557 250 113 22777 1075 ----
NM_033360chr1264282 3720 2906 1267 678 615 ------
NM_033389chr1744742 3826 1433 571 --14781 --
NM_033429chr1562500 1998 1124 362 302 279 13046 ----
NM_033503chr153894 501 429 --33112 719 409 --
NM_033512chr842902 2707 2661 301 1161 ----
NM_033551chr573221 2912 1240 990 561 466 75 --23265 2618 --
NM_033624chr1241520 446 363 141 ----1299
NM_033631chr143717 3026 829 53 22422 1040 12849 --
NM_033637chr1062680 2614 1352 657 323 315 33283 1397 742 ----
NM_033644chr531859 1819 169 11954 ----
NM_033645chr531859 1819 169 11954 ----
NM_052840chr1531639 560 458 ----11205
NM_052845chr1253218 3012 2931 396 127 23088 2330 12448 12790
NM_052847chr1983167 3003 2481 1397 1333 1284 177 71 --11177 --
NM_052849chr153767 713 159 ----1284
NM_052879chr12140 ----11537
NM_052885chr1233455 1504 795 64752 1377 541 458 179 100 1922 --
NM_052901chr951637 1509 1105 464 205 1483 ----
NM_052905chr221698 1388 11594 1321 --
NM_052910chr1341987 1816 1589 619 ------
NM_052918chr1053246 2620 1306 934 868 11413 1659 --
NM_052954chr21------1897
NM_052978chr1451396 1203 727 294 163 1151 ----
NM_053016chr9147769 7696 7279 7122 6868 6826 6753 6170 5835 5599 2731 2033 992 409 15285 12662 11531
NM_053023chr1153060 2702 784 436 284 12205 ----
NM_053025chr321297 549 11388 ----
NM_053026chr321297 549 11388 ----
NM_053027chr321297 549 11388 ----
NM_053028chr321297 549 11388 ----
NM_053031chr321297 549 11388 ----
NM_053032chr321297 549 11388 ----
NM_053056chr112817 399 22298 1222 1811 --
NM_057175chr432342 1843 694 21754 1004 11941 --
NM_058170chr121627 435 11370 ----
NM_080491chr1183475 3411 3379 2964 429 117 89 56 22537 361 23152 444 --
NM_080725chr2071766 1683 1443 794 531 194 143 1414 ----
NM_080738chr162058 1332 704 656 571 416 ----1268
NM_080867chr1484701 4400 3671 3658 3329 1840 1706 979 2953 399 ----
NM_080872chr874014 3724 3207 2956 2880 2788 795 23230 2586 ----
NM_080927chr351203 1061 844 746 646 --1662 --
NM_130391chr943586 2698 1137 432 1395 ----
NM_130392chr943586 2698 1137 432 1395 ----
NM_130393chr943586 2698 1137 432 1395 ----
NM_130442chr72752 228 ----1913
NM_130446chr394068 3826 3668 3511 3448 1108 1027 455 60 --176 --
NM_130847chr1194679 4555 3942 3847 2100 1122 1103 802 482 24209 1513 --11912
NM_133170chr20127689 7147 6668 6212 6080 5737 3241 2253 1981 1698 1474 1036 13139 1144 --
NM_133264chr1753943 2926 2381 1345 575 --22951 2712 --
NM_133265chrX63615 2814 2701 2612 1178 947 22461 2366 ----
NM_133443chr1641759 1646 1381 847 22219 1460 1805 --
NM_133459chr1861989 1634 1614 1512 1240 226 21584 310 ----
NM_133496chr133904 3014 2966 24306 445 ----
NM_133646chr265391 5158 4360 3417 676 557 14375 13548 --
NM_133647chr1563672 3482 3278 2438 170 86 23633 2408 ----
NM_138270chrX53380 3285 3138 2721 2333 1780 ----
NM_138426chr741778 364 287 33 32343 909 655 ----
NM_138444chr1341215 783 695 106 13807 2471 78 --
NM_138468chr2105771 5637 4923 4291 3996 2081 1635 1520 1062 736 15692 25663 1805 --
NM_138473chr1275084 4384 4124 815 728 597 162 24650 4497 14288 --
NM_138479chr162072 1827 555 501 486 198 ------
NM_138559chr211296 1494 --1230
NM_138576chr1484371 3996 3946 3933 3210 1260 706 161 13089 14461 --
NM_138621chr273714 3175 2926 1242 1236 1051 1018 --32942 2828 654 --
NM_138713chr1697479 7186 6584 6403 5107 2507 1428 1394 62 21234 777 ----
NM_138714chr1697479 7186 6584 6403 5107 2507 1428 1394 62 21234 777 ----
NM_138795chr161522 1465 1291 582 571 214 11228 1238 --
NM_138971chr1173034 2816 2370 1223 703 670 173 --1840 --
NM_138971chr1173034 2816 2370 1223 703 670 173 --1840 --
NM_138972chr1173034 2816 2370 1223 703 670 173 --1840 --
NM_138972chr1173034 2816 2370 1223 703 670 173 --1840 --
NM_138973chr1173034 2816 2370 1223 703 670 173 --1840 --
NM_138973chr1173034 2816 2370 1223 703 670 173 --1840 --
NM_139012chr642165 1879 1428 29 22022 433 ----
NM_139071chr1251658 613 223 190 100 11527 --1149
NM_139279chr261399 979 914 829 744 718 31190 1141 524 --42392 2194 944 327
NM_139316chr74965 702 276 207 ------
NM_139321chr2083062 1264 946 741 339 183 173 24 2863 756 ----
NM_139323chr2011641 1706 --11612
NM_144567chr112598 22453 2067 11747 --
NM_144571chr446140 4293 2247 1456 14269 11539 14839
NM_144578chr1435501 3859 3849 25333 878 23635 3415 11984
NM_144583chr251691 1198 406 193 26 11734 ----
NM_144590chr1062865 2418 2392 2092 410 375 11149 11067 --
NM_144628chr2062372 2073 1056 977 920 580 22585 1997 143 --
NM_144633chr321496 291 11343 1323 --
NM_144721chr432405 1089 612 --22502 23 --
NM_145055chr1832815 427 40 23007 596 ----
NM_145112chr1461225 1178 1066 1054 191 49 ------
NM_145113chr1461497 1450 1338 1326 463 321 ------
NM_145166chr352720 2443 1903 854 203 22027 972 12627 --
NM_145176chr652505 2384 1374 312 203 22664 665 ----
NM_145206chr1053209 2930 2859 1062 980 2714 485 ----
NM_145259chr256350 5531 5284 4511 773 11658 22797 559 --
NM_145320chr763545 3511 3193 2756 881 822 22734 912 ----
NM_145321chr763545 3511 3193 2756 881 822 22734 912 ----
NM_145322chr763545 3511 3193 2756 881 822 22734 912 ----
NM_145690chr831280 387 141 11610 --174
NM_145733chr2251125 802 783 248 26 ------
NM_145800chrX4670 279 128 118 ------
NM_145802chrX4619 228 77 67 ------
NM_145861chr162058 1332 704 656 571 416 ----1268
NM_145891chr1641592 1413 1197 667 11209 ----
NM_145892chr1641592 1413 1197 667 11209 ----
NM_145893chr1631714 1535 1319 11331 ----
NM_145899chr681281 1152 1000 940 291 191 138 74 1410 ----
NM_145901chr681281 1152 1000 940 291 191 138 74 1410 ----
NM_145902chr681281 1152 1000 940 291 191 138 74 1410 ----
NM_145903chr681281 1152 1000 940 291 191 138 74 1410 ----
NM_145904chr681281 1152 1000 940 291 191 138 74 1410 ----
NM_145905chr681281 1152 1000 940 291 191 138 74 1410 ----
NM_148921chr1782379 1957 1881 1756 1707 1691 1547 206 ------
NM_152222chr1131330 654 571 --11204 21713 1364
NM_152253chr2293242 3125 3079 3048 2918 2734 1490 1424 1338 33841 3808 3188 --13508
NM_152263chr186119 4994 4286 4171 2244 1928 950 155 ------
NM_152280chr163282 2993 2953 2470 826 765 1133 ----
NM_152376chr171835 1738 1509 1362 1321 634 208 21798 1522 ----
NM_152407chr563027 2218 915 819 221 174 --12354 1569
NM_152409chr542787 2652 1174 270 --11279 --
NM_152424chrX64662 3228 1660 1241 540 154 ----1709
NM_152437chr1242316 610 440 227 22059 1625 --1171
NM_152450chr1552093 1577 435 98 22 ------
NM_152470chr1843294 3033 2595 2588 13157 14098 1944
NM_152475chr19102293 2188 1992 1678 1066 938 474 242 160 44 22456 501 11804 --
NM_152529chr273835 3220 2961 1493 1378 284 147 1704 ----
NM_152557chr731338 1008 367 ----11132
NM_152605chr1921315 497 1983 ----
NM_152613chr221319 21229 291 1119 --
NM_152624chr585463 5415 4761 2574 2559 1746 928 28 --11409 15067
NM_152629chr962982 1446 1389 1358 1249 495 2822 73 --11608
NM_152636chr1142716 2569 1932 838 23069 510 ----
NM_152641chr1272891 2472 2418 2337 1981 685 124 ------
NM_152678chr331707 1053 434 --1203 1481
NM_152716chr1181514 1498 1417 1165 1150 1085 1075 552 --1248 --
NM_152723chr1131070 263 86 1427 ----
NM_152756chr5103652 3645 3352 3342 3112 1586 1561 1437 802 768 ------
NM_152787chrX53100 1550 1495 466 456 ----12504
NM_152924chr1586186 5972 4395 2401 1833 894 831 78 26049 4585 ----
NM_152999chr764587 1828 1415 1151 966 804 11613 ----
NM_153029chr16134119 3840 3581 3441 3320 3067 2914 2829 2753 2652 2641 1623 684 13516 2666 439 1622
NM_153035chr131197 412 117 1631 ----
NM_153050chr2274928 4031 3788 1539 952 798 715 11701 --11055
NM_153051chr2274928 4031 3788 1539 952 798 715 11701 --11055
NM_153188chr531783 1382 26 21475 495 15087 --
NM_153207chr1252988 2924 2759 2482 1591 --11609 --
NM_153234chr552543 2443 1935 556 220 --1510 12761
NM_153235chr652028 948 582 400 335 1899 ----
NM_153256chr1041452 654 413 364 ----11154
NM_153333chrX------1456
NM_153367chr1093688 3267 1325 1240 836 773 708 510 249 12623 ----
NM_153371chr134768 575 502 206 --1496 --
NM_153499chr1252750 2571 2553 2534 597 13051 1182 --
NM_153500chr1252750 2571 2553 2534 597 13051 1182 --
NM_153607chr533174 717 441 1427 ----
NM_153616chr1531502 371 22 1709 ----
NM_153617chr1531502 371 22 1709 ----
NM_153618chr1531502 371 22 1709 ----
NM_153619chr1562740 2300 1260 878 751 334 1599 1774 --
NM_153685chr1251106 1094 1035 780 63 2802 375 --1353
NM_153686chr452381 2281 1560 882 522 11693 ----
NM_153689chr221766 641 ----12319
NM_153810chr1034626 1687 1109 ------
NM_153825chr431606 513 170 2650 629 ----
NM_170665chr1221276 687 23120 2880 11247 --
NM_170679chr531299 1284 41 11092 11338 11327
NM_170750chrX2255 46 ----1202
NM_171998chrX42430 2146 308 34 --1683 --
NM_172071chr187369 7204 6211 4529 2908 2124 2062 446 15250 24588 2873 12819
NM_172103chr642631 2547 991 465 12374 ----
NM_172105chr642631 2547 991 465 12374 ----
NM_172127chr431620 1410 830 ----2245 163
NM_172128chr431576 1366 786 ----2201 119
NM_172216chr1252652 2473 2455 2436 499 12953 184 --
NM_172226chr1252750 2571 2553 2534 597 13051 1182 --
NM_173075chr411623 11518 --1408
NM_173156chr171978 1862 1503 624 283 255 136 ----1845
NM_173214chr1697479 7186 6584 6403 5107 2507 1428 1394 62 21234 777 ----
NM_173216chr362625 1839 997 934 303 273 21807 358 ----
NM_173217chr362625 1839 997 934 303 273 21807 358 ----
NM_173468chr485023 3683 2348 2108 1426 1262 674 100 ------
NM_173531chr1923236 1470 12725 13337 --
NM_173562chr673247 2416 2375 999 592 538 40 --182 --
NM_173582chr1155536 4784 4086 3897 1398 14000 15710 11805
NM_173595chr12145240 4969 4856 4476 4331 4222 3730 3652 3608 3325 2131 1737 730 248 13620 ----
NM_173602chr1243614 2920 2762 2464 ------
NM_173642chr1188887 8489 7996 7223 7179 6704 6697 5711 3223 2962 2847 2679 2151 2077 1840 212 112 37 22655 2386 26685 6149 --
NM_173694chrX11951 ----140
NM_173808chr133037 1776 1030 14303 12725 --
NM_173822chr211469 31555 186 78 1305 --
NM_173851chr82490 145 23666 3095 ----
NM_174890chr10--2774 596 1705 --
NM_174911chr862686 2529 1576 1378 1138 1034 13739 ----
NM_174916chr1551960 1913 694 619 262 --11864 --
NM_174934chr11113358 3351 3328 3273 2355 2269 1426 1142 969 940 390 --22557 2300 --
NM_175624chr1266060 5781 5193 4944 2983 2058 25105 2590 ----
NM_175625chr1266060 5781 5193 4944 2983 2058 25105 2590 ----
NM_175736chr12167695 7646 7251 6765 6298 6267 6103 5202 4987 4797 4745 2948 2155 1709 442 311 46372 5128 2305 1350 27126 1941 144
NM_175856chr5------1603
NM_175858chr21----1348 1329
NM_175863chr62475 313 ----11335
NM_175907chr1872742 2534 2119 1050 280 265 55 --1913 11113
NM_176823chr183852 1444 1210 976 684 430 292 57 1233 13309 --
NM_176863chr1782175 1994 1474 1422 1358 681 536 521 1490 22030 1563 --
NM_176871chr893057 2970 2939 2616 2558 2435 951 426 80 23105 1255 21344 622 --
NM_177398chr131968 1467 315 135 --11557
NM_177399chr131968 1467 315 135 --11557
NM_177402chr14885 876 658 229 --1931 --
NM_177438chr1463832 2835 1594 1514 949 517 ------
NM_177524chr741028 970 203 61 1114 ----
NM_177525chr741028 970 203 61 1114 ----
NM_177559chr202371 365 ----1394
NM_177560chr202371 365 ----1394
NM_177968chr242173 739 674 145 ------
NM_177977chr1761836 1573 1265 720 424 251 21920 1386 ----
NM_177999chr973289 3008 2654 2644 1486 572 227 12610 12725 --
NM_178011chr1053094 2759 2355 582 276 13278 ----
NM_178013chr1422312 1079 21073 518 12104 12636
NM_178140chr531694 232 196 22563 2377 12411 --
NM_178151chrX77484 6980 6670 4855 2759 2629 2188 15584 25758 2177 --
NM_178152chrX77484 6980 6670 4855 2759 2629 2188 15584 25758 2177 --
NM_178153chrX77484 6980 6670 4855 2759 2629 2188 15584 25758 2177 --
NM_178539chr1231918 1707 413 11684 ----
NM_178554chr332530 2394 1436 --33122 1182 137 --
NM_178586chr1432435 522 444 1879 ----
NM_178842chr155756 256 125 107 23 11723 ----
NM_181332chrX22599 162 12122 1124 1911
NM_181349chr792944 2450 2174 2148 2107 1927 833 213 180 ------
NM_181351chr1172960 2810 2441 2422 1074 836 585 --1929 --
NM_181358chr143914 3829 2958 169 ------
NM_181481chr18146905 6467 5817 5025 4915 4408 2666 2441 2346 2179 1908 1797 1129 862 25335 1409 15828 --
NM_181482chr18146905 6467 5817 5025 4915 4408 2666 2441 2346 2179 1908 1797 1129 862 25335 1409 15828 --
NM_181483chr18146905 6467 5817 5025 4915 4408 2666 2441 2346 2179 1908 1797 1129 862 25335 1409 15828 --
NM_181491chr983021 2708 2582 2238 1971 1001 775 616 21143 196 12778 --
NM_181492chr22--1120 141 1487
NM_181504chr553590 2849 2761 1405 909 12579 13424 13575
NM_181521chr16116660 6475 6228 5209 4709 4611 2312 1653 1523 1034 598 11735 ----
NM_181523chr553590 2849 2761 1405 909 12579 13424 13575
NM_181524chr553590 2849 2761 1405 909 12579 13424 13575
NM_181714chr64552 508 373 350 1749 ----
NM_181782chr662073 1984 1472 422 237 103 1908 ----
NM_181784chr262132 993 981 615 304 88 ------
NM_181809chr163986 3800 3019 1412 1118 280 22575 922 23101 573 --
NM_181836chr51539 ----1917
NM_181876chr45855 641 531 476 443 ----12641
NM_182314chrX21282 603 ----11547
NM_182493chr16104698 4592 4321 4283 4229 3287 2136 1393 963 110 --24799 1748 --
NM_182503chr653514 2251 2014 721 219 14647 24153 1083 --
NM_182507chr1232198 1591 662 1222 42040 939 844 229 --
NM_182515chr1965795 5245 5136 4820 1930 120 --12361 --
NM_182526chr1473151 2942 2681 2423 2241 629 418 12105 12330 --
NM_182557chr1162044 1545 1438 860 528 218 ------
NM_182607chrX31716 1617 132 11502 --1652
NM_182641chr1721972 1262 --11466 1372
NM_182643chr862226 1934 1928 674 422 27 ------
NM_182760chr3299 84 1652 1297 --
NM_182762chr766042 5874 5229 4802 2248 2141 45994 4213 1641 522 ----
NM_182848chr1331068 1027 67 182 11390 --
NM_182898chr796257 5189 5126 5047 1967 1567 1556 1438 620 31766 1266 494 11359 14884
NM_182899chr796257 5189 5126 5047 1967 1567 1556 1438 620 31766 1266 494 11359 14884
NM_182907chr632229 830 312 12193 ----
NM_182948chr182963 2884 2803 2790 2697 1167 776 728 ------
NM_183004chr1483604 3544 3465 3119 2591 2544 2499 620 ------
NM_183078chr673443 3276 3168 2997 1020 914 67 ----22804 445
NM_183234chr1541627 1616 720 113 11637 ----
NM_183235chr1541627 1616 720 113 11637 ----
NM_183236chr1541627 1616 720 113 11637 ----
NM_183393chr321052 747 ----1869
NM_183394chr321052 747 ----1869
NM_194071chr7125327 5030 4966 4949 4508 3574 3455 1879 1803 1772 1146 289 21112 669 ----
NM_194247chr2104247 4199 4127 3958 3771 3297 1275 948 811 89 11283 --12887
NM_194286chr12146238 5283 4596 4463 4408 4217 4211 3804 2385 1634 1562 1503 892 565 14513 --15470
NM_194314chr175416 4627 3807 3448 2171 859 339 14638 --15336
NM_194328chr921091 755 --21076 1066 --
NM_194329chr921091 755 --21076 1066 --
NM_194330chr921091 755 --21076 1066 --
NM_194332chr921091 755 --21076 1066 --
NM_194358chr1271900 1755 1685 1439 775 289 48 1634 21411 77 --
NM_194359chr1271900 1755 1685 1439 775 289 48 1634 21411 77 --
NM_194434chr1855511 5060 1232 743 407 12214 1565 11989
NM_194454chr711753 ----11359
NM_194455chr711753 ----11359
NM_194456chr711753 ----11359
NM_197941chr543033 1070 588 481 --12700 12968
NM_197970chr21147 ----11486
NM_198057chrX41226 1194 136 90 --11088 --
NM_198076chr131467 707 366 21817 121 ----
NM_198081chr682747 2381 2358 2305 1889 986 279 74 22629 730 ----
NM_198086chr1471747 1537 1407 381 331 261 222 12032 --1713
NM_198129chr182310 271 ------
NM_198212chr731513 1486 322 2689 548 1946 --
NM_198268chr143914 3829 2958 169 ------
NM_198269chr143914 3829 2958 169 ------
NM_198273chr522967 2552 1554 ----
NM_198392chr6112198 2160 1947 1570 1453 781 506 366 119 106 45 --12390 --
NM_198404chr133890 207 190 1868 ----
NM_198468chr693145 3090 1668 1291 1276 1024 999 649 71 23496 3273 159 --
NM_198560chr373108 2692 1114 777 459 336 115 --2841 497 --
NM_198569chr652209 1648 1002 747 449 1716 ----
NM_198595chr461968 1947 1850 1651 1378 355 1865 13420 --
NM_198715chr146118 5983 5440 4336 11031 ----
NM_198834chr1712234 22105 1855 --1821
NM_198836chr1712234 22105 1855 --1821
NM_198837chr1712234 22105 1855 --1821
NM_198838chr1712234 22105 1855 --1821
NM_198839chr1712234 22105 1855 --1821
NM_198859chr373957 3683 3258 1768 727 695 259 14450 ----
NM_198896chr1141783 675 401 394 12071 ----
NM_198900chr12167695 7646 7251 6765 6298 6267 6103 5202 4987 4797 4745 2948 2155 1709 442 311 46372 5128 2305 1350 27126 1941 144
NM_198935chr2042186 1118 581 393 11186 ----
NM_198968chr1333188 1264 1233 23174 109 ----
NM_198990chr762300 2172 2140 1256 1155 775 --12319 --
NM_199000chr7------11966
NM_199040chr12123709 3437 3275 3146 2826 2607 1450 1133 1013 792 39 25 23122 279 ----
NM_199144chr2061331 586 401 394 285 127 168 ----
NM_199188chr12140 ----11537
NM_199190chr12140 ----11537
NM_199203chr2061331 586 401 394 285 127 168 ----
NM_199245chr1262632 2565 2479 2365 2315 2177 22437 2013 ----
NM_199262chr173930 472 338 ----1865
NM_199324chr443283 3218 3171 742 1136 ----
NM_199421chr1484701 4400 3671 3658 3329 1840 1706 979 2953 399 ----
NM_199454chr153665 3611 1751 1068 1061 11355 23422 195 --
NM_199461chr1091292 1189 1183 862 847 739 636 347 260 12942 11091 13240
NM_201428chr1151349 1198 1124 1036 143 ------
NM_201429chr1151349 1198 1124 1036 143 ------
NM_201432chr17136381 6326 6069 5618 5399 4870 1486 1194 884 794 514 243 54 --21178 683 25953 1002
NM_201433chr17136381 6326 6069 5618 5399 4870 1486 1194 884 794 514 243 54 --21178 683 25953 1002
NM_201520chr1731413 1301 1142 1708 2593 458 11701
NM_201545chr171162 1116 1069 990 584 241 77 --11449 --
NM_201568chr171978 1862 1503 624 283 255 136 ----1845
NM_201569chr171978 1862 1503 624 283 255 136 ----1845
NM_203327chr2054142 3580 1434 322 260 12874 11294 --
NM_203346chr241947 412 336 67 11449 --1132
NM_203372chr221145 73 11087 ----
NM_203382chr5--11357 21648 499 --
NM_203394chr124819 364 134 49 11868 22325 2049 --
NM_203458chr183534 3376 3059 2651 2480 2349 440 192 33726 2384 1401 ----
NM_203506chr1781919 1854 1713 1453 904 790 325 136 ------
NM_205848chr132791 2247 664 12363 --11871
NM_206594chr153682 3190 1177 302 25 22907 223 ----
NM_206595chr153682 3190 1177 302 25 22907 223 ----
NM_206832chr171257 --169 1324
NM_206853chr654052 3650 3231 1067 63 13005 ----
NM_206854chr685313 4911 4492 3592 3409 1324 664 548 24266 1102 ----
NM_206855chr6116278 5876 5457 4557 4374 4050 2289 1629 1513 823 733 45231 4028 2067 348 1281 --
NM_206907chr563197 2855 2165 939 602 248 13251 ----
NM_206944chr91857 ----1558
NM_206945chr91857 ----1558
NM_206946chr91857 ----1558
NM_206947chr91857 ----1558
NM_207012chr1052856 2830 594 434 341 23307 551 ----
NM_207043chr141958 735 721 322 32259 1623 198 12185 --
NM_207044chr141958 735 721 322 32259 1623 198 12185 --
NM_207047chr141958 735 721 322 32259 1623 198 12185 --
NM_207123chr42894 83 ----1248
NM_207170chr11118 1180 --1727
NM_207171chr121834 1568 11340 1593 --
NM_207352chr472677 2282 2169 1705 627 418 129 --1225 --
NM_207372chr1042340 2173 452 176 1711 11777 1961
NM_207406chr486050 2501 2284 2260 1489 1139 1025 47 13990 --15650
NM_207435chr123882 438 69 ------
NM_207577chr1152672 2594 2421 2237 132 --12523 22466 2186
NM_207647chr932497 829 798 ------
NM_212467chr1551946 895 728 341 185 --22532 1829 --
NM_213606chr1052474 1934 761 358 352 1771 ----
NM_213609chr32885 747 2164 73 ----