TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4649-3p
miRNA Sequence: UCUGAGGCCUGCCUCUCCCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51438 ------
NM_000016chr11616 ------
NM_000024chr5----1497 --
NM_000037chr862231 2175 1728 1550 928 227 ------
NM_000038chr521385 806 ------
NM_000052chrX62992 2854 2556 1236 877 528 --11118 --
NM_000053chr1341527 626 466 214 ----1820
NM_000082chr53702 287 274 ------
NM_000084chrX177007 6695 6513 6424 5769 5399 5377 5244 4614 4586 2539 2531 2322 1832 1595 1484 1322 34857 2398 1222 26720 4218 --
NM_000087chr4136 ------
NM_000089chr71692 1665 ----
NM_000090chr21240 ------
NM_000092chr253952 3599 3552 2998 967 1283 13143 --
NM_000093chr92447 44 --3653 340 138 --
NM_000094chr3----153 --
NM_000109chrX42633 2584 1994 51 ------
NM_000110chr12861 166 ------
NM_000112chr595253 4837 4268 4237 2011 1985 1962 1730 581 25133 3951 12017 --
NM_000125chr634066 3705 917 --22949 864 --
NM_000129chr631331 1007 356 1375 ----
NM_000134chr421270 559 --2578 429 --
NM_000135chr164994 948 374 358 11037 ----
NM_000138chr1542458 847 552 194 22628 2426 1783 --
NM_000141chr1041279 1097 1007 981 ------
NM_000163chr521870 1446 --11619 12264
NM_000165chr621644 114 ------
NM_000167chrX--1610 ----
NM_000168chr742873 2682 2205 748 13222 11168 --
NM_000176chr543239 3129 2828 26 13088 1797 --
NM_000192chr1231552 348 213 11182 ----
NM_000202chrX73709 3256 3243 2441 1566 1324 1158 --13315 --
NM_000208chr1964460 4019 3463 1561 1046 484 34133 4109 4029 34566 823 374 --
NM_000210chr252242 1535 905 571 210 12254 11799 --
NM_000212chr17122341 2294 2146 1988 1912 824 774 555 483 470 343 254 22241 765 11637 --
NM_000214chr2021315 660 ------
NM_000217chr1295198 4971 4731 4401 4293 2033 1595 821 737 13603 ----
NM_000222chr421824 1398 21375 374 ----
NM_000232chr462610 2503 1221 1148 637 536 1158 12401 --
NM_000237chr841834 1348 729 169 11266 ----
NM_000242chr1032038 866 557 ------
NM_000244chr113510 102 49 1311 ----
NM_000245chr721407 748 12106 ----
NM_000248chr343064 2215 1127 491 ------
NM_000254chr131112 1022 67 12639 21939 874 --
NM_000259chr15185544 4904 4871 4848 4641 4487 3885 2476 2434 2031 1940 1862 1801 1661 1107 980 330 303 21948 1471 12401 15083
NM_000264chr932551 932 324 --1882 --
NM_000267chr1722687 1357 --1547 --
NM_000271chr182517 234 ------
NM_000278chr1062226 1704 829 807 213 128 --128 1446
NM_000280chr11--1702 1118 --
NM_000284chrX21716 30 ----11337
NM_000314chr1053294 3203 3087 2905 1031 13108 ----
NM_000321chr1321240 112 31662 694 432 11376 11698
NM_000330chrX2787 507 1480 31594 324 298 --
NM_000332chr676151 5732 4991 2326 940 450 273 56602 6335 5804 5525 1776 25983 542 --
NM_000333chr321087 122 11141 ----
NM_000334chr174609 535 469 437 22036 1910 11837 12007
NM_000337chr5105800 5653 5627 5606 5462 5420 4463 1410 779 450 --15028 --
NM_000340chr31979 ----11054
NM_000346chr1741505 755 736 707 1308 ----
NM_000353chr167953 938 835 458 452 103 69 1392 ----
NM_000358chr52463 365 156 ----
NM_000376chr1292586 2563 2502 1002 805 633 489 366 209 1846 ----
NM_000378chr113860 829 101 ------
NM_000382chr1711889 21952 1816 --1310
NM_000386chr17--1148 1665 --
NM_000393chr221858 1400 1164 ----
NM_000399chr101913 1781 ----
NM_000404chr31169 ------
NM_000406chr462342 1961 539 321 181 159 1153 22016 987 --
NM_000408chr262599 1156 753 733 642 515 --12701 --
NM_000430chr1753478 2366 1179 667 385 23725 2706 ----
NM_000434chr6249 35 ------
NM_000441chr721920 1570 175 ----
NM_000448chr1133059 2891 101 33013 2476 674 --12698
NM_000451chrX32129 1990 1497 1366 21515 1379 --
NM_000458chr171167 1153 --1907
NM_000461chr394137 3940 3235 2897 1478 1374 1123 982 353 --33191 3156 2913 13137
NM_000480chr1121422 420 11103 ----
NM_000484chr213403 320 49 ------
NM_000489chrX43285 3049 853 660 13323 ----
NM_000494chr102202 37 ------
NM_000495chrX2172 74 ------
NM_000503chr841811 1545 613 447 --1311 --
NM_000516chr20132 ------
NM_000522chr7--11267 --146
NM_000523chr22962 475 1331 --11149
NM_000525chr11----41491 1243 165 96 --
NM_000527chr1941942 1614 826 398 ------
NM_000530chr13958 831 148 ------
NM_000533chrX2705 208 ------
NM_000540chr19142 ------
NM_000555chrX147126 5844 5550 5255 5170 5151 3048 2283 2188 2176 2142 1714 992 503 17325 15027 11844
NM_000572chr11889 ------
NM_000582chr42172 95 --1202 --
NM_000599chr253548 3212 1672 1330 1155 34168 3686 149 11300 --
NM_000609chr1042919 709 654 258 22625 2371 ----
NM_000610chr1132079 717 272 1804 1963 --
NM_000611chr11187079 6802 6589 6475 6315 6180 5628 5604 5459 5058 4833 4811 4535 2729 2322 1901 1727 435 1318 36255 5487 2440 --
NM_000615chr1131961 1097 53 22327 2061 12442 --
NM_000618chr1256280 5509 2466 2321 1488 45846 4663 2222 1080 35540 5406 1272 15206
NM_000618chr1256280 5509 2466 2321 1488 45846 4663 2222 1080 35540 5406 1272 15206
NM_000619chr122461 193 ------
NM_000637chr82588 573 --1472 --
NM_000665chr7----1158 --
NM_000671chr441104 558 100 90 1381 1411 --
NM_000693chr1541491 1212 647 425 ------
NM_000701chr1177 ------
NM_000719chr12136547 6071 5888 5274 4315 4233 2383 2177 2086 1515 999 398 73 15206 26619 5941 --
NM_000720chr33426 146 69 --134 --
NM_000724chr1031708 1643 496 21822 1531 ----
NM_000725chr1241006 957 318 302 --1137 --
NM_000726chr221329 1065 ----11436
NM_000738chr113997 101 77 --1774 --
NM_000743chr1551255 1121 1038 940 514 --1946 --
NM_000759chr172832 62 --1607 --
NM_000767chr1931270 469 247 --31252 1145 334 --
NM_000788chr431188 334 45 --1561 --
NM_000795chr11162 ----1958
NM_000801chr2041087 1000 977 22 --1934 --
NM_000806chr511861 ------
NM_000807chr4------1677
NM_000809chr4119133 8687 8508 8312 8108 7840 7812 7786 5733 3537 974 38031 6687 2662 16080 --
NM_000810chr15--1172 ----
NM_000813chr565353 4724 4626 4494 1942 117 11057 11478 --
NM_000814chr1563981 3012 1667 1378 792 151 --1911 --
NM_000816chr52568 45 ------
NM_000817chr21322 11152 ----
NM_000818chr10149 1219 ----
NM_000824chr42803 278 ------
NM_000826chr422195 194 ------
NM_000827chr582130 2040 2033 2004 1850 1806 467 66 1827 ----
NM_000828chrX62144 2066 1967 173 166 60 21544 1504 ----
NM_000829chr1142019 1862 791 27 ------
NM_000831chr1104427 4259 4076 1673 1014 437 267 188 169 24 25450 199 45940 5743 5737 1921 25395 4715
NM_000833chr161157 11546 ----
NM_000838chr672033 1979 978 765 593 157 103 ------
NM_000840chr71457 ------
NM_000859chr521399 1302 2566 185 1160 --
NM_000868chrX72501 2029 932 902 878 787 339 ------
NM_000875chr15116262 5942 2680 2160 2046 1713 1323 814 757 347 106 1118 ----
NM_000876chr651329 1084 1003 922 913 --11061 --
NM_000879chr5190 1115 ----
NM_000883chr74718 630 518 251 --1269 --
NM_000883chr74718 630 518 251 --1269 --
NM_000891chr1763499 2632 1241 817 494 374 11383 11451 --
NM_000899chr1254175 3148 3104 271 63 1387 --1317
NM_000901chr441977 972 252 30 ------
NM_000917chr102386 335 --1842 --
NM_000919chr51547 ------
NM_000922chr111125 ------
NM_000924chr1251136 547 419 257 226 1883 ----
NM_000933chr2021627 1576 --1329 --
NM_000944chr431727 1666 645 --11972 --
NM_000945chr241783 824 774 141 ------
NM_000949chr54854 782 771 46 ------
NM_000950chrX23444 1011 ------
NM_000958chr52414 394 ------
NM_000963chr132027 1988 1676 ----22447 1572
NM_000965chr3141 ------
NM_000966chr122688 272 --142 --
NM_000984chr17--1472 ----
NM_000990chr1173485 3251 3112 2833 1150 405 69 --1543 --
NM_001001132chr2141390 1230 181 27 ------
NM_001001323chr1253032 1995 1253 599 96 ------
NM_001001331chr312417 12164 21680 501 --
NM_001001389chr1132079 717 272 1804 1963 --
NM_001001390chr1132079 717 272 1804 1963 --
NM_001001391chr1132079 717 272 1804 1963 --
NM_001001392chr1132125 763 318 1850 11009 --
NM_001001395chr1242385 2238 1974 1857 ----11968
NM_001001396chr133688 1796 56 --11706 13557
NM_001001419chr575121 4059 3382 1793 1573 1211 625 ------
NM_001001420chr575121 4059 3382 1793 1573 1211 625 ------
NM_001001433chr2042543 2349 663 97 ------
NM_001001438chr212128 107 --1388 --
NM_001001481chr832193 1334 1217 13221 ----
NM_001001484chr1052345 2311 1900 1734 832 11649 12443 --
NM_001001521chr21281 ------
NM_001001522chr11298 74 ------
NM_001001549chr792763 2229 1866 1072 1016 967 941 918 824 --12549 --
NM_001001550chr792763 2229 1866 1072 1016 967 941 918 824 --12549 --
NM_001001555chr792763 2229 1866 1072 1016 967 941 918 824 --12549 --
NM_001001556chr151165 ------
NM_001001664chr254035 3929 538 210 173 33587 1580 1174 ----
NM_001001669chr572637 2519 1875 1695 979 755 162 1961 11984 12196
NM_001001701chr422310 778 12230 ----
NM_001001890chr2154049 3537 2609 1361 1096 --11390 --
NM_001001924chr82810 326 ------
NM_001001925chr82810 326 ------
NM_001001928chr22198341 7946 7937 7600 6928 6905 6511 6156 6033 5654 5307 5092 5065 2936 2800 2577 1542 1017 222 46283 5527 3217 111 12647 17509
NM_001001931chr82810 326 ------
NM_001001936chr1021064 474 --1142 --
NM_001001974chr104838 676 222 41 ------
NM_001001995chrX31938 763 127 ------
NM_001002000chr142376 119 ------
NM_001002002chr142376 119 ------
NM_001002032chr173729 685 239 ------
NM_001002033chr173829 785 339 ------
NM_001002243chr21361 ------
NM_001002257chr223302 2449 --33524 3147 2469 33382 3326 1409
NM_001002811chr131507 1224 184 31094 381 297 ----
NM_001002812chr131507 1224 184 31094 381 297 ----
NM_001002812chr131507 1224 184 31094 381 297 ----
NM_001002838chrX11350 11280 1700 --
NM_001002843chr1521182 261 1850 ----
NM_001002860chr1474495 4184 3571 3342 3248 1110 613 34319 4035 3369 11271 --
NM_001002909chr1751664 1623 1529 549 435 ------
NM_001003407chr1064042 3965 3932 3215 1446 363 13719 ----
NM_001003408chr1064042 3965 3932 3215 1446 363 13719 ----
NM_001003652chr18128318 8187 7615 7474 7342 6629 6317 5763 3457 2197 2177 127 15292 11928 --
NM_001003665chr1103456 3197 3157 3026 2539 1203 1027 1021 441 170 --32524 2378 568 --
NM_001003674chr18135697 4930 4855 4376 2821 2562 2525 2499 2222 1810 1118 996 22 ------
NM_001003675chr18135697 4930 4855 4376 2821 2562 2525 2499 2222 1810 1118 996 22 ------
NM_001003676chr112981 269 ------
NM_001003681chr2281639 1418 1306 640 603 410 281 80 ------
NM_001003682chr131374 540 255 --2274 243 --
NM_001003694chr3----1120 --
NM_001003698chr681993 1566 1554 1259 558 224 176 72 --1656 --
NM_001003699chr681993 1566 1554 1259 558 224 176 72 --1656 --
NM_001003712chr1233743 1562 1210 ------
NM_001003800chr983512 3195 1165 803 353 218 201 41 1469 ----
NM_001003810chr4------1229
NM_001003895chrY------126
NM_001003937chr221452 1108 ------
NM_001004051chrX132 ------
NM_001004065chr922638 2500 --11404 11011
NM_001004127chr1311006 ----1896
NM_001004196chr33862 205 129 ------
NM_001004304chr1252346 2067 523 407 169 22787 2461 12743 --
NM_001004308chrX41015 553 528 45 11458 ----
NM_001004317chr624146 1351 3979 522 515 11716 --
NM_001004330chr1231387 570 156 11552 ----
NM_001004342chr1115432 5231 4956 4943 4495 4063 3680 2022 2015 1847 301 31350 1051 459 25468 4576 --
NM_001004360chr221522 646 ------
NM_001004439chr151284 --11238 --
NM_001005207chr17------2100 54
NM_001005217chr41904 167 ----
NM_001005266chr15--1465 ----
NM_001005267chr15--1465 ----
NM_001005268chr15--1465 ----
NM_001005269chr15--1465 ----
NM_001005354chr123526 126 32 --1580 161
NM_001005366chr121644 ------
NM_001005375chrY298 33 11549 ----
NM_001005386chr222166 1874 ----11699
NM_001005404chr1774070 3638 2902 2783 1609 1557 723 13192 24000 2923 --
NM_001005408chr17--1149 --1490
NM_001005463chr1042497 1695 247 51 12017 ----
NM_001005473chr576406 5203 4567 4169 2462 1722 153 15989 14017 --
NM_001005474chr32417 83 --31059 462 428 --
NM_001005505chr331395 708 92 --1362 186
NM_001005609chrX73521 3392 2944 2489 1456 1275 1218 23188 2462 13542 --
NM_001005732chr212474 165 ------
NM_001005733chr212431 165 ------
NM_001005746chr221329 1065 ----11436
NM_001005747chr221329 1065 ----11436
NM_001005781chr21101 ------
NM_001005782chr21742 --1195 --
NM_001005785chrY298 33 11549 ----
NM_001005786chrY298 33 11549 ----
NM_001005845chr84763 419 326 278 1113 ----
NM_001005920chr162926 308 21069 334 195 --
NM_001006115chr35910 559 505 210 197 12023 31771 765 247 --
NM_001006610chr16142 ------
NM_001006634chr162600 122 2531 474 ----
NM_001006636chr21252 ----1173
NM_001006658chr13230 101 27 ------
NM_001006665chr12769 564 --1588 --
NM_001006684chrX1454 ------
NM_001006932chr663204 2639 2390 990 580 189 ----167
NM_001006944chr111511 --1676 --
NM_001007067chr81194 ------
NM_001007068chr81194 ------
NM_001007069chr81194 ------
NM_001007070chr81194 ------
NM_001007075chr421072 906 ------
NM_001007094chr1033402 2971 609 21761 1052 13130 --
NM_001007098chr12882 637 ------
NM_001007102chr631199 1089 288 ------
NM_001007233chr53702 287 274 ------
NM_001007246chr2121380 1247 11899 11734 --
NM_001007250chr13862 95 23 --1101 --
NM_001007257chr111153 1293 ----
NM_001007466chr694909 4880 4439 3906 3878 3679 1592 89 41 1407 --1428
NM_001007527chr51671 ----1232
NM_001007538chr1351576 1383 633 502 117 --3666 534 213 --
NM_001007553chr11235 --1413 --
NM_001007559chr1851990 1849 1684 537 56 --21867 1732 --
NM_001007563chr9170 ------
NM_001007794chr11691 ------
NM_001008220chr583865 3133 2656 404 259 148 103 81 12497 --12433
NM_001008222chrX2462 339 2931 893 31129 1070 268 --
NM_001008225chr72726 711 ------
NM_001008239chr1832725 2394 220 23300 2743 21139 86 193
NM_001008393chr41869 1740 ----
NM_001008407chr721725 454 ------
NM_001008408chr7145637 4723 4679 4014 2318 1722 1374 1162 748 722 470 418 214 26 25584 1693 35679 4087 912 --
NM_001008410chr242173 1666 1527 864 ------
NM_001008495chr812189 1757 ----
NM_001008564chr134899 890 785 222 --11580 1842
NM_001008566chr222517 444 ------
NM_001008660chr1111211 ------
NM_001008701chr1932757 149 125 --11903 12584
NM_001008707chr142138 108 1459 ----
NM_001008711chr831656 127 35 ------
NM_001008738chr532050 1869 354 --11916 --
NM_001008777chr172665 189 ------
NM_001008801chr1921526 568 --11574 --
NM_001008860chr153696 584 194 --1636 --
NM_001008892chr153696 584 194 --1636 --
NM_001008894chr153696 584 194 --1636 --
NM_001008895chr1321460 411 150 ----
NM_001008925chr453556 3041 2592 1270 872 ------
NM_001008938chr11----176 --
NM_001009185chr52729 23 1520 ----
NM_001009554chr4124137 3953 3850 3603 3289 2903 2884 1442 1277 435 110 88 24489 552 ----
NM_001009554chr4124137 3953 3850 3603 3289 2903 2884 1442 1277 435 110 88 24489 552 ----
NM_001009555chr421724 486 1512 ----
NM_001009880chr2294334 4284 4176 3172 3085 1794 1035 714 475 31914 941 47 44352 1691 1359 765 14391
NM_001009881chr1164 ----1403
NM_001009882chr1164 ----1403
NM_001009899chr3105742 5574 5384 4482 2542 2224 1983 1394 1149 976 1692 32089 1576 1442 --
NM_001009958chr71223 ------
NM_001009993chr244245 4179 3977 1523 ------
NM_001010000chr1863215 2895 2436 1078 126 110 11227 ----
NM_001010853chr641139 739 535 353 12367 31049 757 622 --
NM_001010854chr141691 ----140
NM_001010861chr132716 2691 838 --12128 --
NM_001010867chr1176595 6581 5926 5399 5219 5167 4994 4643 4099 2315 2196 1901 1892 1695 1453 1370 372 22325 647 45790 5252 2095 479 11030
NM_001010887chr931503 1215 455 ------
NM_001010888chrX73679 3311 3256 1467 1270 642 628 --1526 --
NM_001010895chr951414 678 474 397 53 11489 ----
NM_001010908chr102558 105 1524 ----
NM_001010971chr1----11020 --
NM_001010980chr1113507 3436 3149 2734 1366 1279 1133 978 614 416 83 ------
NM_001010983chr3283 34 ------
NM_001010984chr111774 137 21964 1939 11687
NM_001010986chrX144 --11886 --
NM_001011513chr463997 1024 971 839 394 168 13874 ----
NM_001011515chr4195 ------
NM_001011516chr4195 ------
NM_001011537chr332400 1678 1516 ------
NM_001011538chr441084 717 409 265 ------
NM_001011546chr204676 523 330 90 1816 ----
NM_001011553chr72653 258 ------
NM_001011657chrX31155 417 117 --11002 --
NM_001011658chrX5829 696 279 166 110 11815 21400 365 --
NM_001011666chr7106030 5722 5189 4882 4496 4433 1556 1358 768 103 --15776 --
NM_001011713chr1451054 1048 496 203 127 --1439 --
NM_001011885chr1541720 1656 1559 1182 ------
NM_001012393chr1174447 4332 1979 1758 1480 1399 370 --11954 --
NM_001012398chr162898 448 ------
NM_001012426chr6103154 3085 2775 2528 1307 937 910 744 340 94 1251 32793 2655 2520 23283 2493
NM_001012427chr6103154 3085 2775 2528 1307 937 910 744 340 94 1251 32793 2655 2520 23283 2493
NM_001012751chr1011813 ------
NM_001012754chr1321664 1484 ------
NM_001012755chrX53379 1713 1434 1249 184 23573 448 11297 1234
NM_001012756chr1962693 2566 2423 2129 690 113 22808 984 12450 --
NM_001012989chrX1123 ------
NM_001013031chr1022984 854 22149 118 13329 --
NM_001013406chr741739 1694 1613 1436 ------
NM_001013415chr441351 235 218 108 ------
NM_001013437chr182382 28 ------
NM_001013438chr31916 ------
NM_001013439chr31762 ------
NM_001013620chr12128105 7692 6417 6243 5981 5967 5754 3073 3056 1973 325 200 1355 12938 --
NM_001013624chr1731072 402 264 2913 840 1107 --
NM_001013635chr123962 854 94 ----11005
NM_001013642chr141149 913 748 221 1161 ----
NM_001013659chr1934072 488 359 24586 3802 2520 151 --
NM_001013690chr1232050 1752 296 32500 2020 849 21563 992 11972
NM_001013693chr142487 2395 216 166 11955 21005 691 --
NM_001013693chr142487 2395 216 166 11955 21005 691 --
NM_001013839chr1732097 1604 637 12297 22103 664 --
NM_001013843chr15----1330 --
NM_001014283chr1331953 746 189 11879 11627 --
NM_001014380chr13105397 5151 4531 4176 4017 2209 1540 1407 1339 978 --22360 874 --
NM_001014764chr17--1167 ----
NM_001014797chr1047681 7267 5522 2150 --17182 21422 1068
NM_001014812chr151310 ------
NM_001015045chr472427 955 659 648 635 584 577 ----1165
NM_001015053chr1761029 642 402 169 108 29 --3578 432 141 --
NM_001015508chr82750 556 129 186 --
NM_001015877chrX62551 2294 2194 1970 1230 874 1789 ----
NM_001015880chr1031604 1113 527 ------
NM_001015882chr911099 ------
NM_001015887chr321448 1372 11407 ----
NM_001015892chr51165 ------
NM_001017368chr1772265 2208 2196 807 554 29 22 12764 ----
NM_001017371chr22884 147 ------
NM_001017395chr353682 3640 3449 2518 803 ------
NM_001017415chr11190 ----1541
NM_001017416chr11190 ----1541
NM_001017424chr12480 22 ----1301
NM_001017425chr12480 22 ----1301
NM_001017440chr7147015 6414 6020 5165 2738 2294 1998 657 583 463 443 271 210 170 46424 5376 2732 1179 26562 1791 --
NM_001017523chr1231790 1531 1433 11760 2722 404 --
NM_001017535chr1292586 2563 2502 1002 805 633 489 366 209 1846 ----
NM_001017924chr10138 11376 ----
NM_001017930chrX41430 484 320 226 ----1419
NM_001017962chr102386 335 --1842 --
NM_001017973chr52273 36 ------
NM_001017974chr52273 36 ------
NM_001017979chr43248 148 131 ------
NM_001017995chr584863 3589 1334 1113 1032 877 261 168 14121 1567 --
NM_001018050chr2293308 2790 2666 2655 1374 1284 1241 801 364 23157 2480 13315 --
NM_001018052chr2293308 2790 2666 2655 1374 1284 1241 801 364 23157 2480 13315 --
NM_001018054chr13982 975 27 ------
NM_001018056chr91197 ------
NM_001018057chr112478 185 ------
NM_001018064chr92363 291 143 ----
NM_001018065chr985759 5425 4973 4767 4659 1678 1292 134 11264 25490 3974 --
NM_001018066chr985759 5425 4973 4767 4659 1678 1292 134 11264 25490 3974 --
NM_001018067chr144032 3279 1940 1595 --14077 --
NM_001018068chr144032 3279 1940 1595 --14077 --
NM_001018069chr144032 3279 1940 1595 --14077 --
NM_001018072chr1231790 1531 1433 11760 2722 404 --
NM_001018074chr543239 3129 2828 26 13088 1797 --
NM_001018075chr543239 3129 2828 26 13088 1797 --
NM_001018076chr543239 3129 2828 26 13088 1797 --
NM_001018077chr543239 3129 2828 26 13088 1797 --
NM_001018089chr1562485 1601 1483 1002 895 848 ------
NM_001018100chr154752 631 593 59 ------
NM_001018108chr1562148 1750 1585 887 600 163 --11484 --
NM_001018111chr753791 1458 835 571 140 11086 --23457 2433
NM_001020658chr111229 --1604 --
NM_001020658chr111229 --1604 --
NM_001020818chr19----1690 --
NM_001020819chr19----1690 --
NM_001020820chr19----1690 --
NM_001020821chr19----1690 --
NM_001020825chr51303 1563 ----
NM_001022chr19132 ------
NM_001023567chr1522367 1778 ------
NM_001023587chr361097 910 853 410 121 92 ------
NM_001024094chr543239 3129 2828 26 13088 1797 --
NM_001024218chr142577 525 ------
NM_001024380chr841984 1638 441 323 ------
NM_001024381chr841984 1638 441 323 ------
NM_001024401chr1642331 2300 1911 869 --21905 853 11823
NM_001024460chr63989 202 148 ------
NM_001024463chr151446 191 ----
NM_001024649chr542316 1915 727 84 1898 ----
NM_001024666chrX2477 104 --1461 --
NM_001024680chr251620 720 633 572 25 ------
NM_001024688chr8155 1336 1581 --
NM_001024808chr1262515 1838 1148 1109 624 591 1166 ----
NM_001024847chr362422 2359 1993 1928 547 230 --11541 --
NM_001024858chr1442623 2586 661 531 ------
NM_001024912chr1931176 304 77 11296 ----
NM_001024934chr61530 ------
NM_001024935chr61530 ------
NM_001024936chr61530 ------
NM_001024947chr51952 ------
NM_001024948chr152638 2393 2169 1249 276 1344 12298 --
NM_001025068chr31166 11642 ----
NM_001025069chr31166 11642 ----
NM_001025076chr1034198 1717 99 --35140 2245 1121 --
NM_001025077chr1035556 1457 71 --26498 2479 1888
NM_001025081chr1841393 282 53 32 ------
NM_001025090chr1841393 282 53 32 ------
NM_001025092chr1841393 282 53 32 ------
NM_001025101chr1841393 282 53 32 ------
NM_001025108chr264079 2940 2917 2799 1016 121 24013 217 22973 2832 --
NM_001025205chr31419 1349 1386 --
NM_001025232chr122278 46 ------
NM_001025242chrX41250 889 875 81 11175 11008 --
NM_001025243chrX41250 889 875 81 11175 11008 --
NM_001025252chr812489 23178 2314 12876 --
NM_001025253chr812489 23178 2314 12876 --
NM_001025266chr373961 3871 1825 1514 1095 662 261 11329 43827 1694 680 538 129
NM_001025389chr1121422 420 11103 ----
NM_001025390chr1121422 420 11103 ----
NM_001025579chr174828 156 148 79 ----1778
NM_001025580chrX43465 2683 739 466 --1294 --
NM_001025595chr421585 665 ------
NM_001025596chr111120 1391 ----
NM_001025616chr431276 730 345 21787 761 ----
NM_001025777chr221239 388 31049 1004 207 ----
NM_001025780chr911496 --11027 --
NM_001029858chr642795 1258 1219 893 --11306 --
NM_001029863chr663230 2457 2058 617 452 151 12654 11136 --
NM_001029875chr592617 2574 2547 2270 2191 2066 2015 956 577 --12197 --
NM_001029998chr441410 1387 145 92 11464 ----
NM_001030006chr1752197 2159 1645 880 555 --1204 --
NM_001030007chr1663586 2953 1599 1287 1014 466 --12442 --
NM_001030055chr1434553 4382 3100 11524 12966 --
NM_001030272chr11--2170 130 ----
NM_001030273chr11--2170 130 ----
NM_001030287chr13357 233 213 11103 ----
NM_001031679chr1263225 2820 2576 2461 2417 2362 12609 --13457
NM_001031681chr1721895 710 2851 371 12148 2582 461
NM_001031690chr772119 2110 1157 1129 1068 493 350 --23060 575 --
NM_001031694chr14730 228 111 90 ------
NM_001031694chr14730 228 111 90 ------
NM_001031695chr2233301 1956 1896 31880 753 713 15417 11061
NM_001031702chr3----1675 1147
NM_001031716chr21981 ------
NM_001031717chr34896 681 316 174 --1802 --
NM_001031723chr41414 ------
NM_001031732chr443392 3284 2264 546 13528 ----
NM_001031738chr2----1385 --
NM_001031740chr131690 520 265 11324 ----
NM_001031801chr222384 158 ------
NM_001031804chr1631097 452 374 13630 ----
NM_001031806chr1711945 22008 1872 --1366
NM_001031812chr531979 1482 417 ------
NM_001032221chr951749 1532 603 558 508 11598 21620 74 --
NM_001032280chr65585 467 431 219 34 ------
NM_001032282chr8----141 --
NM_001032283chr121111 ------
NM_001032284chr121111 ------
NM_001032290chr1129 1487 ----
NM_001032291chr1129 1487 ----
NM_001032293chr17191 ------
NM_001032296chr1342499 2068 807 362 32018 1047 190 12428 --
NM_001032363chr161909 1469 1416 635 380 55 1859 31927 1796 662 --
NM_001032363chr161909 1469 1416 635 380 55 1859 31927 1796 662 --
NM_001032394chr642136 1108 338 114 22046 720 ----
NM_001032999chr20115071 4751 4181 3445 1593 1389 1057 486 464 426 406 64517 4456 3579 1095 924 562 24244 1476 --
NM_001033044chr111186 ------
NM_001033045chr274160 3546 2961 2844 2827 1493 1221 --1109 --
NM_001033047chr432021 1674 633 ------
NM_001033056chr111186 ------
NM_001033059chr612064 --1397 --
NM_001033081chr121673 1350 ----21553 677
NM_001033082chr121673 1350 ----21553 677
NM_001033087chr2043009 2234 970 553 ----1505
NM_001033117chr344105 4046 3809 3241 24561 522 --14661
NM_001033503chr52456 28 ------
NM_001033518chr772344 2075 1078 1033 490 187 47 11131 32683 2014 1067 22358 2058
NM_001033519chr772344 2075 1078 1033 490 187 47 11131 32683 2014 1067 22358 2058
NM_001033520chr772344 2075 1078 1033 490 187 47 11131 32683 2014 1067 22358 2058
NM_001033557chr221081 467 ------
NM_001033578chr81101 12390 ----
NM_001033602chr1321089 655 1850 11790 12484
NM_001033677chr12170 1398 1383 --
NM_001033723chr852600 2185 1846 850 683 --12582 --
NM_001033925chr1031842 1487 829 ------
NM_001034841chr1654915 4630 4266 3530 163 23637 1571 44648 4486 4131 4045 --
NM_001034850chr521499 1212 11261 ----
NM_001034915chr871456 1340 1163 987 964 411 168 128 ----
NM_001035chr11469 1888 ----
NM_001035254chr922109 970 31638 608 85 1544 --
NM_001035260chr1021634 1312 ------
NM_001035521chr22812 229 1145 ----
NM_001037132chr71388 31774 843 233 ----
NM_001037133chr71388 31774 843 233 ----
NM_001037317chr132716 2691 838 --12128 --
NM_001037334chr1842404 2270 1891 432 ------
NM_001037553chr2153609 1653 1067 818 180 24853 4563 13616 24181 902
NM_001037582chr45574 436 421 230 42 --3622 454 317 --
NM_001037738chr52294 257 ------
NM_001037954chr114529 393 281 54 --12177 --
NM_001038493chr22480 140 1313 --1408
NM_001038640chr152805 342 ------
NM_001038707chr182177 2078 2020 1796 1702 547 273 139 ------
NM_001038707chr182177 2078 2020 1796 1702 547 273 139 ------
NM_001039091chrX--2960 381 ----
NM_001039111chr31306 --1108 --
NM_001039140chr202476 33 --2393 215 --
NM_001039199chr2064942 4884 4592 3274 1535 430 13888 34739 1737 699 --
NM_001039457chr1279 29 ------
NM_001039459chr72202 130 --1216 --
NM_001039465chr141372 ------
NM_001039479chr1441989 1660 1528 288 ------
NM_001039490chr111138 1128 ----
NM_001039577chr153505 3142 1167 1149 57 24352 1818 --13243
NM_001039590chrX63511 1287 1204 663 378 48 ------
NM_001039591chrX63511 1287 1204 663 378 48 ------
NM_001039618chr1175263 1263 1090 852 357 280 71 --14828 --
NM_001039619chr142254 137 --141 --
NM_001039690chr1641899 816 239 221 ------
NM_001039693chr293652 3436 3225 3074 1595 1568 1065 549 543 ------
NM_001039709chr20115071 4751 4181 3445 1593 1389 1057 486 464 426 406 64517 4456 3579 1095 924 562 24244 1476 --
NM_001039711chr121139 1128 ------
NM_001039712chr121139 1128 ------
NM_001039762chr1031981 609 415 ------
NM_001039802chr121373 1067 ------
NM_001039840chrX116061 5333 5315 5018 4924 4258 1904 1503 930 321 49 64137 4122 2027 2000 1020 808 ----
NM_001039888chr11686 --1591 --
NM_001039937chr1353877 2685 1367 960 291 23584 2973 ----
NM_001039960chr1241109 1059 650 383 31484 1169 83 144 11069
NM_001040001chr611665 ------
NM_001040057chr731285 1086 581 ------
NM_001040058chr42172 95 --1202 --
NM_001040060chr42172 95 --1202 --
NM_001040092chr81395 ------
NM_001040110chr731868 1366 699 11315 --11243
NM_001040142chr231818 1620 685 ------
NM_001040143chr231818 1620 685 ------
NM_001040144chr1641899 816 239 221 ------
NM_001040146chr1641899 816 239 221 ------
NM_001040151chr1164269 4223 3533 1738 1247 1025 54365 3910 3815 3686 1826 21112 944 --
NM_001040152chr751832 1653 1249 1168 56 33135 1858 1720 ----
NM_001040158chr5145 1434 ----
NM_001040179chr62360 242 1404 ----
NM_001040202chr421023 322 1525 --1962
NM_001040214chr631747 1587 562 ------
NM_001040284chr16115609 5416 4673 4349 4165 4127 1270 1010 693 605 92 ------
NM_001040402chr432909 2803 2683 ------
NM_001040429chr1312253 1367 --11236
NM_001040446chr562178 2035 1967 1059 757 99 1350 1317 21767 588
NM_001040455chr1141048 1003 258 23 21306 947 1959 --
NM_001040619chr11663 21553 1032 122 --
NM_001040624chr842431 2135 363 149 ------
NM_001040625chr842431 2135 363 149 ------
NM_001040626chr842431 2135 363 149 ------
NM_001040627chr842431 2135 363 149 ------
NM_001040628chr842431 2135 363 149 ------
NM_001040629chr842431 2135 363 149 ------
NM_001040630chr842431 2135 363 149 ------
NM_001040633chr73673 359 66 ------
NM_001040665chr744956 4664 4367 3453 ------
NM_001040666chr72658 69 ------
NM_001040708chr82724 331 ------
NM_001040709chr1112264 2187 2120 2022 1682 1617 841 691 478 386 171 1624 ----
NM_001040712chr92777 540 12276 ----
NM_001042355chr1645331 4474 1748 1025 34588 2021 125 --14948
NM_001042388chr181257 1231 ----
NM_001042412chr1645331 4474 1748 1025 34588 2021 125 --14948
NM_001042413chr953827 558 495 414 260 --12509 --
NM_001042424chr4122990 2729 2694 2572 2520 1224 1101 419 244 236 168 133 22046 561 ----
NM_001042425chr65585 467 431 219 34 ------
NM_001042440chr541983 1242 444 46 --11618 --
NM_001042441chr541983 1242 444 46 --11618 --
NM_001042442chr541983 1242 444 46 --11618 --
NM_001042443chr541983 1242 444 46 --11618 --
NM_001042444chr541983 1242 444 46 --11618 --
NM_001042445chr541983 1242 444 46 --11618 --
NM_001042446chr541983 1242 444 46 --11618 --
NM_001042453chrX1393 ------
NM_001042486chr2011519 1474 1521 --
NM_001042492chr1722687 1357 --1547 --
NM_001042494chr1583216 2746 2340 1354 1188 476 427 145 1376 23036 2620 13459
NM_001042495chr1583216 2746 2340 1354 1188 476 427 145 1376 23036 2620 13459
NM_001042496chr1583216 2746 2340 1354 1188 476 427 145 1376 23036 2620 13459
NM_001042497chr1583216 2746 2340 1354 1188 476 427 145 1376 23036 2620 13459
NM_001042510chr851819 453 372 156 57 --21442 546 151
NM_001042511chr851819 453 372 156 57 --21442 546 151
NM_001042537chrX----1273 --
NM_001042555chr1284626 3155 3110 1281 889 847 562 66 --1721 --
NM_001042599chr267774 6486 5257 5199 2946 1704 ------
NM_001042601chr322067 128 22679 2326 ----
NM_001042603chr1284237 3833 2060 1475 1059 567 132 55 24824 118 24935 925 --
NM_001042604chr3104793 3510 1783 1750 1629 1447 1150 888 327 72 ------
NM_001042632chr2042345 624 600 285 ------
NM_001042633chr2042345 624 600 285 ------
NM_001042635chr141121 ------
NM_001042669chr431276 730 345 21787 761 ----
NM_001042681chr142472 1949 1890 315 ------
NM_001042682chr142472 1949 1890 315 ------
NM_001042682chr142472 1949 1890 315 ------
NM_001042683chr651769 1370 1197 412 394 11169 ----
NM_001042723chr19142 ------
NM_001042724chr194642 315 46 23 1288 1550 --
NM_001042728chr122688 272 --142 --
NM_001042749chrX31410 1373 680 11440 ----
NM_001042750chrX31410 1373 680 11440 ----
NM_001042751chrX31410 1373 680 11440 ----
NM_001043318chr1493402 2844 2632 1599 1396 1141 822 731 104 --53589 3516 2862 2719 494 --
NM_001043351chr141831 1627 1588 454 --21645 1508 --
NM_001044305chr631500 1326 445 ------
NM_001044385chr243009 2711 1348 941 1919 ----
NM_001044722chr531979 1482 417 ------
NM_001044723chr531979 1482 417 ------
NM_001048183chr1113531 3049 2962 2839 2821 2806 2705 2657 1467 1447 365 --11163 --
NM_001049chr1442209 2137 457 392 ------
NM_001068chr3------168
NM_001071775chr1311294 ------
NM_001079874chr131797 499 132 21557 558 ----
NM_001083620chr422193 194 ------
NM_001083621chr1104477 3421 2869 1439 1408 1062 983 526 491 132 --13429 33284 1663 296
NM_001094chr172843 757 ------
NM_001095chr12101712 1618 1477 1259 1242 1214 539 488 474 246 11843 ----
NM_001096chr174833 615 190 171 ------
NM_001100108chr196403 5687 3145 2994 2677 1708 1531 1430 338 67660 7363 7064 6925 6632 129 25288 5217 16558
NM_001106chr3118361 8128 6647 3662 3257 2430 2272 1990 1858 1106 731 88488 8167 7364 2557 2402 1950 1464 465 46947 2949 2524 300 1358
NM_001109977chr43717 578 207 --1598 --
NM_001113490chrX52974 2729 2220 947 476 ------
NM_001116chr1662604 2550 2371 2336 935 258 11246 32504 747 270 1757
NM_001117chr1842341 2026 685 574 1678 ----
NM_001121chr102365 289 ------
NM_001122679chr51438 ------
NM_001124chr111193 --1587 --
NM_001128chr1663586 2953 1599 1287 1014 466 --12442 --
NM_001144chr1631344 1103 331 1205 ----
NM_001146chr831865 1746 283 183 ----
NM_001148chr421837 1457 1742 ----
NM_001149chr1021136 416 ------
NM_001153chr21759 189 ----
NM_001155chr53565 254 140 ------
NM_001160chr1231102 1065 225 12229 41121 985 687 384 1954
NM_001167chrX85936 5835 5595 5535 4666 4297 2229 1632 14709 35853 2621 1966 25456 1167
NM_001172chr141103 ------
NM_001173chr1434553 4382 3100 11524 12966 --
NM_001174chrX31784 711 662 --22189 459 --
NM_001178chr11--2170 130 ----
NM_001186chr2132919 842 650 --1721 --
NM_001191chr2051148 1109 953 324 199 ----2427 215
NM_001196chr22------1904
NM_001198chr632029 540 170 ------
NM_001201chr453991 3617 3153 1387 1058 13147 12919 1426
NM_001204chr267179 5374 5337 5301 5159 287 67386 6130 5952 5347 2985 1099 26925 5311 --
NM_001206chr921219 436 1476 1518 --
NM_001219chr732024 1992 1620 ------
NM_001222chr1021763 1505 --1628 --
NM_001226chr43516 448 51 ------
NM_001231chr12485 444 ------
NM_001241chr241875 743 403 212 1838 ----
NM_001241chr241875 743 403 212 1838 ----
NM_001248chr33365 338 87 1201 ----
NM_001256chr1752276 2149 1885 910 678 ----11059
NM_001259chr796246 6086 5917 4771 2177 1654 1263 607 67 34449 862 736 36014 4852 1244 16388
NM_001265chr133259 175 74 1129 ----
NM_001270chr5173 ------
NM_001271chr1572795 2317 2147 659 588 377 290 1332 --12691
NM_001278chr101293 190 ----
NM_001282chr1752197 2159 1645 880 555 --1204 --
NM_001298chr231284 948 26 --1180 --
NM_001304chr1732624 2341 1510 --13682 --
NM_001308chr10--128 ----
NM_001310chr1242986 2747 983 464 --12254 --
NM_001315chr641930 1614 611 492 1569 --1474
NM_001326chr112411 51 ------
NM_001331chr1142631 1139 681 191 ------
NM_001332chr521369 596 11286 1433 --
NM_001343chr51132 1545 152 1487
NM_001345chr121213 ------
NM_001349chr2155 1235 ----
NM_001356chrX186 12149 ----
NM_001358chr4----1410 --
NM_001363chrX4631 260 145 39 1268 ----
NM_001364chr1123044 1673 ------
NM_001386chr81658 11547 --12192
NM_001389chr211421 ------
NM_001390chr1842222 1387 1080 136 23311 235 11153 --
NM_001391chr18----171 --
NM_001394chr8--1575 ----
NM_001396chr2141752 1731 837 567 12649 ----
NM_001399chrX73521 3392 2944 2489 1456 1275 1218 23188 2462 13542 --
NM_001406chr1761723 1137 606 584 539 164 --21509 225 --
NM_001407chr31641 ------
NM_001408chr171502 1310 578 522 512 406 314 ----1545
NM_001412chrX33642 2998 1387 --23213 3207 --
NM_001415chrX41476 534 515 118 --21359 402 --
NM_001419chr1983655 3186 3101 1886 1826 1456 1321 443 14504 13214 --
NM_001422chr113968 139 81 ------
NM_001423chr1211938 11457 ----
NM_001424chr162596 255 --1632 --
NM_001427chr721760 676 --128 --
NM_001430chr241891 1711 383 53 ------
NM_001431chr631190 844 241 ------
NM_001433chr172847 229 ----3663 311 261
NM_001438chr133467 2881 2468 12283 --22791 1421
NM_001447chr531333 321 116 --1542 --
NM_001448chrX31632 1143 522 11522 ----
NM_001449chrX11252 1868 1370 --
NM_001482chr151227 ----133
NM_001490chr943038 2662 788 562 13392 ----
NM_001494chr103729 676 661 ------
NM_001497chr942580 2096 1805 1054 11871 ----
NM_001498chr62498 60 --11230 --
NM_001521chr22812 229 1145 ----
NM_001523chr19236 25 --1102 --
NM_001543chr574230 4084 3770 3581 1195 1170 369 2896 176 43346 2940 1112 818 --
NM_001554chr12248 220 ------
NM_001569chrX41250 889 875 81 11175 11008 --
NM_001604chr11--1702 1118 --
NM_001616chr253294 3114 2832 1098 596 23322 3259 ----
NM_001620chr111241 --1104 --
NM_001621chr74805 720 551 515 1469 ----
NM_001621chr74805 720 551 515 1469 ----
NM_001634chr612064 --1397 --
NM_001650chr1823851 2885 33169 50 38 ----
NM_001654chrX133 --1100 --
NM_001659chr1252277 2271 2216 1819 824 22048 902 ----
NM_001663chr1421961 670 ------
NM_001664chr33877 790 398 ------
NM_001665chr113500 367 83 --173 --
NM_001674chr13357 233 213 11103 ----
NM_001678chr172404 127 21472 214 ----
NM_001682chr1232746 967 313 ------
NM_001683chr312417 12164 21680 501 --
NM_001686chr12155 1147 ----
NM_001695chr893594 3332 3067 2989 2950 2636 1700 1277 450 23982 949 23274 3123 --
NM_001699chr195661 482 439 94 30 ------
NM_001701chr91559 ------
NM_001703chr12227 206 1196 ----
NM_001706chr32952 409 142 1680 --
NM_001707chr72772 636 ------
NM_001717chr153978 555 536 1580 ----
NM_001730chr1321445 265 1446 ----
NM_001730chr1321445 265 1446 ----
NM_001731chr121636 ------
NM_001743chr21556 ------
NM_001744chr5158 ------
NM_001746chr542316 1915 727 84 1898 ----
NM_001748chr11932 ------
NM_001750chr541983 1242 444 46 --11618 --
NM_001753chr741455 655 584 142 ------
NM_001754chr2154049 3537 2609 1361 1096 --11390 --
NM_001755chr1632238 476 173 --1775 --
NM_001759chr1284946 4735 3816 3771 3328 2135 1990 553 34921 3982 1188 13787 --
NM_001761chr162489 282 --41755 1350 440 301 --
NM_001762chr7184 ------
NM_001773chr121205 134 1495 11268 --
NM_001788chr72653 258 ------
NM_001789chr361420 1181 560 503 301 132 11698 ----
NM_001791chr121373 1067 ------
NM_001792chr181372 1755 ----
NM_001797chr162780 25 ------
NM_001800chr19----1395 --
NM_001802chr162252 111 ------
NM_001804chr52793 601 --192 --
NM_001806chr1922868 1890 --12797 --
NM_001829chr41316 1876 ----
NM_001830chrX53488 2544 983 818 590 12459 --11599
NM_001839chr12731 133 ------
NM_001842chr91204 1121 ----
NM_001843chr121239 ------
NM_001844chr122325 67 ------
NM_001845chr1331132 158 125 ------
NM_001851chr62125 100 ------
NM_001854chr11944 ------
NM_001858chr645162 4750 4708 3361 1949 24399 888 --
NM_001859chr973887 3842 3217 2774 1245 425 25 ----12687
NM_001894chr222235 186 ----1457
NM_001895chr2031054 453 327 198 ----
NM_001901chr62897 718 ------
NM_001903chr53679 359 32 ------
NM_001904chr311049 3394 182 74 ----
NM_001918chr1118920 8710 8137 6924 6411 5707 5664 3193 3140 1104 879 16792 27316 3243 11902
NM_001923chr112219 159 1243 ----
NM_001927chr2----2655 100 --
NM_001931chr1111115 1397 ----
NM_001932chr171623 1672 ----
NM_001933chr145250 230 212 204 117 ------
NM_001945chr51905 ----11017
NM_001946chr124955 914 810 44 ------
NM_001949chr621205 523 1133 --12564
NM_001962chr51161 ------
NM_001964chr52843 216 2381 119 ----
NM_001967chr31102 ------
NM_001968chr41146 ------
NM_001969chr1443472 3119 894 613 23932 310 ----
NM_001981chr151817 1748 930 708 639 ----1603
NM_001982chr1241138 939 320 261 ------
NM_001986chr17------1210
NM_001987chr1254276 2669 1656 1567 22 21317 170 21270 956 21516 1355
NM_001991chr1762189 2114 1999 1360 647 171 --22040 327 1256
NM_001995chr44993 288 235 175 ------
NM_001999chr511124 ------
NM_002006chr485501 5242 4680 4417 3534 2191 1673 1527 ----12074
NM_002015chr1321208 441 22229 37 ----
NM_002024chrX2341 239 ------
NM_002025chrX119154 8620 8589 7401 3526 3255 2848 2679 2285 1316 491 27338 241 21923 827 --
NM_002028chr1431137 817 424 --2106 100 --
NM_002033chr1123976 1651 22778 1173 34074 2769 2635 --
NM_002035chr1843813 3412 2603 132 12470 ----
NM_002040chr2132301 2016 449 32942 2676 2502 ----
NM_002041chr15197 ------
NM_002044chr151165 ------
NM_002047chr71122 ------
NM_002048chr921252 61 --1378 11005
NM_002056chr21655 1582 1573 --
NM_002065chr111186 ------
NM_002070chr33926 154 136 ------
NM_002073chr2231009 627 563 ------
NM_002074chr131359 1090 692 1117 ----
NM_002077chr961939 1900 1839 1492 665 174 ------
NM_002080chr164952 413 64 43 1153 ----
NM_002081chr26533 339 255 205 166 80 ------
NM_002083chr14294 74 --156 --
NM_002092chr464059 3314 1169 1079 835 778 14003 24638 4399 24265 3660
NM_002099chr4156 ------
NM_002105chr1131034 812 171 --2365 224 1102
NM_002112chr15139 ------
NM_002114chr6--1486 ----
NM_002126chr17103854 3202 3149 2840 2738 1212 1007 433 355 345 11327 13708 --
NM_002129chr4----199 --
NM_002130chr521235 27 ------
NM_002131chr61440 1857 1226 --
NM_002134chr16187 ----1459
NM_002137chr73772 116 27 21877 1728 2924 77 --
NM_002138chr4------1229
NM_002140chr91138 ------
NM_002143chr12774 245 ------
NM_002156chr2--179 ----
NM_002158chr243697 3304 2611 2420 1699 ----
NM_002184chr52215 29 ------
NM_002187chr51891 ------
NM_002193chr22588 164 11826 ----
NM_002199chr4------1319
NM_002202chr511077 ------
NM_002214chr774964 4905 3582 1411 1393 953 841 24111 1520 11276 11499
NM_002221chr142729 1064 413 170 --32258 1795 566 --
NM_002223chr1243549 3292 3053 1371 --1962 --
NM_002224chr62762 79 --1250 2504 177
NM_002228chr11846 ------
NM_002232chr131383 201 156 1356 ----
NM_002234chr122684 108 ------
NM_002240chr213538 419 172 ------
NM_002246chr21874 2777 313 ----
NM_002253chr431345 475 275 1134 ----
NM_002254chr242031 1518 623 308 ----1550
NM_002264chr354912 4555 3664 631 624 3716 589 464 14754 --
NM_002265chr1721161 461 ------
NM_002267chr1321884 746 --1143 1646
NM_002268chr321522 630 ------
NM_002270chr545073 4145 3784 44 14392 ----
NM_002282chr121221 --1214 --
NM_002285chr264079 2940 2917 2799 1016 121 24013 217 22973 2832 --
NM_002293chr142687 1079 380 356 --22348 386 --
NM_002294chrX163 ------
NM_002306chr141151 ------
NM_002309chr2272949 2481 2255 1241 646 428 40 --11013 22994 2905
NM_002310chr552614 1844 1369 1254 22 --1629 14310
NM_002313chr1064042 3965 3932 3215 1446 363 13719 ----
NM_002314chr721074 81 2833 114 11033 --
NM_002336chr1264764 4228 4200 1501 455 286 21283 412 ----
NM_002346chr81599 --1438 --
NM_002350chr83927 223 42 ------
NM_002353chr13624 493 86 --1171 --
NM_002355chr12277 32 --11247 --
NM_002356chr6--11044 ----
NM_002373chr151191 ----1319
NM_002376chr141599 ------
NM_002382chr1431158 219 49 182 11226 --
NM_002385chr1841393 282 53 32 ------
NM_002387chr594972 4224 1910 1272 768 758 525 432 267 14120 ----
NM_002397chr5----1158 --
NM_002399chr1531321 932 72 ------
NM_002401chr1752115 1769 1601 595 296 11541 32182 969 186 --
NM_002406chr531026 862 712 1719 ----
NM_002419chr11----4487 338 95 38 --
NM_002430chr2242238 2025 985 700 32167 1830 1596 ----
NM_002442chr12183 --11094 --
NM_002451chr953724 2853 2706 2507 2463 13755 ----
NM_002460chr673711 3582 3529 1301 626 596 111 13281 22488 159 --
NM_002467chr81146 ------
NM_002473chr221278 1371 11304 --
NM_002480chr12----1352 1331
NM_002481chr1217742 6829 6286 5891 5871 5460 5358 5331 5040 3181 3165 2889 2512 2085 1610 975 767 675 562 378 134 26850 2730 ----
NM_002485chr8155 1336 1581 --
NM_002488chr51214 ------
NM_002500chr22512 120 ------
NM_002501chr1973908 3877 3673 3409 1539 841 543 21450 233 ----
NM_002509chr202789 592 --174 --
NM_002515chr14--1711 ----
NM_002519chr1121369 434 ------
NM_002522chr1763659 2895 2762 1560 478 228 2846 515 1908 --
NM_002524chr13704 142 104 1181 ----
NM_002527chr122221 118 ------
NM_002539chr21243 1218 ----
NM_002541chr72413 322 --183 --
NM_002544chr171264 ------
NM_002545chr1174447 4332 1979 1758 1480 1399 370 --11954 --
NM_002546chr82302 69 ------
NM_002556chr1122124 759 --21677 183 --
NM_002558chr1761083 859 821 810 432 110 --2224 44 --
NM_002568chr8137 ------
NM_002577chr363606 2785 2680 2552 2513 814 --22600 237 --
NM_002581chr931240 931 113 24731 4712 23655 1380 --
NM_002587chr5177 --170 --
NM_002588chr511727 --21268 1219 180
NM_002590chr131103 ------
NM_002595chr1221787 1240 ------
NM_002608chr2221542 405 ----1480
NM_002623chr201232 ------
NM_002644chr161396 1302 1089 246 153 71 2131 46 31320 1176 653 --
NM_002645chr1142838 2397 928 622 12921 ----
NM_002651chr12906 714 1338 1793 --
NM_002655chr844495 3897 1890 480 24409 803 14370 --
NM_002657chr2083583 2755 2532 2523 1538 1522 1516 230 1597 53362 2691 880 836 50 1637
NM_002670chr321306 46 ------
NM_002673chr34536 503 414 186 --2151 33 --
NM_002687chr142286 93 ------
NM_002697chr11248 ------
NM_002698chr1932037 944 629 1398 22575 134 --
NM_002707chr22332 126 --186 --
NM_002709chr242946 2896 2583 560 ------
NM_002710chr121909 ------
NM_002711chr73346 286 261 ----1828
NM_002714chr64761 258 125 49 ------
NM_002715chr51849 1839 1959 11205
NM_002718chr34986 929 596 193 2495 219 ----
NM_002721chr91456 ------
NM_002731chr162884 2697 2561 2176 1173 728 --12567 --
NM_002734chr172893 49 --1761 --
NM_002736chr711567 ------
NM_002737chr1745322 4319 1789 483 22073 633 24925 4792 14367
NM_002738chr161152 ----11015
NM_002742chr14----1557 1626
NM_002745chr2251762 1538 832 251 182 24124 3897 --14468
NM_002747chr183721 368 165 11802 ----
NM_002753chr42638 166 1826 1105 --
NM_002755chr151597 ------
NM_002765chrX--2960 381 ----
NM_002814chrX1289 ------
NM_002819chr1971344 1044 1007 957 336 254 89 --1908 --
NM_002822chr121315 --1665 --
NM_002823chr2------176
NM_002827chr2031770 530 172 ------
NM_002828chr182161 86 ------
NM_002829chr921028 244 ------
NM_002830chr21133 ------
NM_002833chr1531382 1261 245 ------
NM_002835chr72214 151 ------
NM_002837chr1283274 3112 1652 1216 1090 897 360 68 14538 13157 14363
NM_002839chr92777 540 12276 ----
NM_002840chr121123 256 21194 607 ----
NM_002843chr1143196 2695 1082 644 --11380 --
NM_002847chr71114 --122 --
NM_002849chr1221017 897 ------
NM_002857chr142701 2505 2415 2004 1514 21748 588 --
NM_002858chr13421 361 278 --129 11194
NM_002868chr1231920 650 73 --42208 1950 935 163 --
NM_002869chr1141748 1463 163 103 21435 30 --1795
NM_002873chr53389 66 39 1419 ----
NM_002874chr941882 895 505 181 ------
NM_002880chr34645 636 144 22 ------
NM_002886chr355205 5183 4186 1990 1267 34917 4327 1578 23379 1614 11805
NM_002890chr5160 ------
NM_002895chr202929 828 ------
NM_002897chr21612 ------
NM_002901chr111801 2326 120 ----
NM_002904chr62154 28 --150 --
NM_002918chr193904 885 218 --195 --
NM_002924chr12404 167 ------
NM_002930chr182266 75 ------
NM_002938chr461785 1403 1354 1316 1265 751 21308 687 ----
NM_002941chr31632 --1281 --
NM_002945chr172594 262 1150 ----
NM_002953chr12769 564 --1588 --
NM_002955chr681993 1566 1554 1259 558 224 176 72 --1656 --
NM_002956chr122541 85 ------
NM_002957chr9123696 3377 2712 2699 1414 1285 1272 1193 1054 542 277 69 11006 43854 3388 1484 551 --
NM_002959chr134244 3969 76 --22763 1692 --
NM_002968chr161834 --1394 --
NM_002971chr32896 329 2970 79 ----
NM_002977chr253301 2840 2826 2694 1306 12491 12725 --
NM_002998chr821933 1618 11946 1738 1349
NM_003009chr19258 47 --1304 --
NM_003010chr1732290 1802 1558 21690 791 ----
NM_003012chr832176 2085 2049 --134 32261 2197 666
NM_003013chr4171 --1112 --
NM_003016chr17--22045 1474 ----
NM_003022chrX2400 80 ------
NM_003026chr92836 271 ------
NM_003028chr9103811 2872 2542 1536 1407 1341 1273 839 697 374 12392 43189 2414 935 826 13400
NM_003031chr16142 ------
NM_003038chr232673 2097 428 12694 22104 639 --
NM_003042chr331699 1595 1536 22033 1440 1813 --
NM_003045chr1394591 4392 4227 3331 3180 1432 752 611 165 --1314 13074
NM_003048chr222521 351 --22690 949 --
NM_003051chr14653 429 317 285 --11892 --
NM_003053chr82611 97 --136 --
NM_003060chr551245 1009 923 475 84 1895 ----
NM_003068chr821079 446 ------
NM_003070chr92219 53 ------
NM_003071chr321715 1641 ------
NM_003074chr362201 1977 1665 850 627 187 ------
NM_003076chr1271336 1171 1099 1050 620 147 66 1367 1320 11091
NM_003088chr741139 867 319 206 1304 1841 --
NM_003104chr152163 44 ------
NM_003107chr611733 ------
NM_003108chr286183 5356 5255 2589 2029 937 894 293 24856 1254 12690 --
NM_003111chr22884 147 ------
NM_003112chr73713 469 318 22365 584 --1763
NM_003113chr21314 1168 ----
NM_003118chr53779 325 306 11990 ----
NM_003127chr9--1232 ----
NM_003128chr232355 873 256 ------
NM_003131chr662115 1589 835 532 474 194 ------
NM_003133chr111048 1772 ----
NM_003137chr641785 1397 712 652 ------
NM_003139chr11197 1620 ----
NM_003140chrY1125 ------
NM_003145chr12311 150 1377 ----
NM_003149chr331504 584 57 11108 ----
NM_003150chr1762167 1939 945 903 874 326 --22076 1772 --
NM_003155chr822238 229 --12031 --
NM_003156chr113557 281 254 ----1452
NM_003157chr31266 ------
NM_003161chr1753515 3507 3388 1411 953 1128 ----
NM_003162chr2------1979
NM_003164chr112475 194 ------
NM_003165chr951848 1631 702 657 607 11697 21719 173 --
NM_003173chrX21139 98 1240 1948 --
NM_003178chr352203 2065 1669 846 563 ------
NM_003181chr6----2121 97 --
NM_003182chr7131 ------
NM_003182chr7131 ------
NM_003185chr201140 ------
NM_003186chr11298 74 ------
NM_003187chr51165 ------
NM_003189chr182433 1190 1096 1049 824 558 543 260 --22558 64 --
NM_003194chr6--1557 ----
NM_003199chr1885386 4950 4398 2259 2038 1437 589 27 14995 ----
NM_003202chr541324 1316 321 127 21765 204 ----
NM_003204chr1721439 358 1123 ----
NM_003211chr1231144 460 68 --1450 --
NM_003214chr631011 307 269 2521 281 1111 --
NM_003216chr2293255 2604 2533 2339 1320 1241 1092 416 344 22545 42 31107 250 144 --
NM_003217chr1271258 681 641 483 336 311 193 --21481 1382 --
NM_003220chr65585 467 431 219 34 ------
NM_003221chr633741 2898 204 13098 ----
NM_003238chr11214 ------
NM_003239chr1421078 63 2392 235 ----
NM_003242chr362422 2359 1993 1928 547 230 --11541 --
NM_003243chr141202 1188 936 85 ------
NM_003246chr154835 779 432 159 11786 1275 --
NM_003247chr6160 1171 ----
NM_003262chr364473 4434 2039 1277 976 241 25084 4388 44658 4522 3636 894 --
NM_003269chr63120 88 71 1532 ----
NM_003281chr1114188 3977 2060 2013 1950 1825 1444 1310 827 252 39 25084 3845 ----
NM_003284chr2132 ------
NM_003288chr2031136 986 526 --21250 48 --
NM_003289chr92172 26 ------
NM_003291chr132581 214 ------
NM_003292chr121532 715 11852 ----
NM_003298chr376101 5236 5190 4962 4210 4001 3837 ------
NM_003319chr21355 --1385 --
NM_003320chr1193273 3149 3016 1137 725 698 547 317 122 23635 539 11501 --
NM_003330chr1251490 1421 1378 1261 262 --11220 --
NM_003337chr53421 325 129 --11499 --
NM_003338chr102615 263 ------
NM_003340chr41914 ------
NM_003342chr17113330 3157 3126 2671 2571 2315 1203 969 859 503 239 --12106 --
NM_003345chr16----1375 1461
NM_003347chr2262108 1996 1986 932 605 239 12360 ----
NM_003348chr1221293 123 11600 ----
NM_003352chr21742 --1195 --
NM_003360chr42281 243 ------
NM_003368chr11190 ----1541
NM_003369chr1142177 2149 1971 364 42623 717 320 121 ----
NM_003370chr192634 528 ------
NM_003373chr1021614 614 --1754 --
NM_003374chr5--157 ----
NM_003375chr10149 ------
NM_003380chr101302 ------
NM_003383chr91197 ------
NM_003385chr221040 36 ------
NM_003387chr232619 976 95 --1216 --
NM_003389chr92462 29 ------
NM_003391chr71365 ----1705
NM_003392chr353316 2650 1718 933 620 --14226 --
NM_003404chr2031610 1391 748 --1128 --
NM_003406chr841813 1654 291 27 ------
NM_003409chr181178 2924 446 ----
NM_003410chrX31943 736 74 11031 ----
NM_003411chrY21605 1327 ------
NM_003413chrX21682 183 --1387 --
NM_003416chr8148 ------
NM_003417chr19179366 8624 8101 7898 7883 7732 7691 6224 3370 2491 1481 1448 1437 182 159 141 74 22505 1916 79779 9395 8484 8321 8188 7916 7781 17170
NM_003421chr1033402 2971 609 21761 1052 13130 --
NM_003430chr192328 163 ------
NM_003453chr132669 540 ------
NM_003457chr17191 ------
NM_003458chr3113992 3702 3256 2668 2643 2495 1528 1344 876 817 662 23537 2544 22886 170 --
NM_003459chr22735 56 --2254 148 --
NM_003463chr663167 2760 2683 2460 702 137 1689 ----
NM_003468chr254183 3004 2898 2830 384 14213 42793 1638 877 644 --
NM_003469chr22153 67 ------
NM_003470chr164580 533 424 96 ------
NM_003472chr621088 1006 ------
NM_003478chr1142972 1004 753 126 22512 386 11027 --
NM_003483chr1222016 29 --12205 1844
NM_003485chr1441395 1306 877 45 --159 --
NM_003488chr171240 --1965 --
NM_003489chr2111315 21120 1008 11372 12159
NM_003498chr1672681 1752 1730 1097 809 595 181 ------
NM_003507chr211266 11683 ----
NM_003557chr131266 431 398 1637 1200 1209
NM_003558chr92592 160 ------
NM_003566chr1243304 3008 1011 933 ------
NM_003567chr1150 ------
NM_003575chr741579 442 248 81 21467 519 21178 1075 --
NM_003576chr1342499 2068 807 362 32018 1047 190 12428 --
NM_003583chr12112978 2947 2802 2678 2597 2447 1046 857 717 242 53 1535 ----
NM_003589chr1321460 411 150 ----
NM_003595chr222517 444 ------
NM_003601chr41223 ------
NM_003603chr442110 1832 349 95 --11849 --
NM_003607chr194221 3550 3452 1380 1273 1264 866 689 363 1161 ----
NM_003612chr15159 --127 --
NM_003613chr151259 ------
NM_003618chr22989 104 ------
NM_003621chr113486 373 355 1493 1399 --
NM_003624chr1911057 11191 11364 --
NM_003626chr112997 893 ------
NM_003629chr122903 912 --33078 1176 608 23088 2773
NM_003630chr61505 ----1628
NM_003632chr175780 595 579 266 189 --1566 --
NM_003633chr522197 1765 1946 --11582
NM_003654chr11177 1507 ----
NM_003659chr2----1958 --
NM_003663chr31627 22131 492 ----
NM_003670chr32382 354 ------
NM_003671chr962638 2435 1197 992 748 638 2707 349 2251 100 --
NM_003672chr121421 1337 ------
NM_003679chr172787 2499 875 856 842 766 679 23453 1097 1297 --
NM_003680chr13693 92 56 ------
NM_003681chr21115938 5830 5488 5156 4852 4445 4334 1630 979 679 335 14830 36150 5666 4367 183
NM_003685chr192933 195 ------
NM_003692chr9190 ------
NM_003709chr23311 97 78 ------
NM_003714chr552925 1034 1006 706 381 22997 2462 1191 --
NM_003716chr35987 832 747 308 57 ------
NM_003722chr322223 662 --22651 2381 --
NM_003732chr52213 99 ------
NM_003735chr511727 --21268 1219 180
NM_003736chr511727 --21268 1219 180
NM_003740chr641778 602 329 155 --2718 375 21385 107
NM_003743chr241917 1896 543 108 ------
NM_003750chr104971 930 292 76 ------
NM_003758chr1521527 361 1512 ----
NM_003758chr1521527 361 1512 ----
NM_003760chr12554 198 ----1565
NM_003763chr2042543 2349 663 97 ------
NM_003766chr17129 ------
NM_003768chr121533 1497 ----11318
NM_003774chr1253183 2232 2184 205 59 1710 169 --
NM_003787chr1831322 1086 167 ------
NM_003794chr32738 438 ------
NM_003795chr61108 ------
NM_003800chr672283 2213 2086 827 330 239 184 ------
NM_003816chr82377 33 ------
NM_003818chr20197 ------
NM_003822chr122895 227 --22546 2177 --
NM_003825chr1541262 430 417 277 ------
NM_003829chr91432 --1362 --
NM_003835chr171261 ------
NM_003845chr12--179 ----
NM_003850chr132637 442 1506 ----
NM_003858chr143705 537 206 ------
NM_003861chr1452866 2235 537 355 41 11056 ----
NM_003873chr1062446 2335 2092 1856 137 129 12473 21692 540 --
NM_003877chr122644 28 ------
NM_003884chr321474 1235 ------
NM_003885chr1742558 1994 1830 107 11725 11800 --
NM_003893chr101378 --1124 --
NM_003899chr1382107 2060 1979 1660 1047 972 578 246 1754 11016 --
NM_003901chr1081944 1846 1716 719 550 423 389 22 142 42421 743 598 142 --
NM_003902chr1130 ------
NM_003913chr693963 3718 3564 2845 1670 1324 1251 750 340 ------
NM_003916chrX1129 ------
NM_003921chr131471 688 339 ------
NM_003924chr44666 416 327 256 ------
NM_003927chr181810 ------
NM_003930chr722393 1014 1985 ----
NM_003931chr61530 ------
NM_003933chr163958 932 776 ------
NM_003938chr192781 80 1964 1312 --
NM_003939chr1043320 1584 701 457 22957 856 32615 1650 215 13340
NM_003941chr732012 1912 434 ------
NM_003942chr111511 --1676 --
NM_003948chr421001 983 ------
NM_003953chr172857 2550 1044 988 604 335 25 --12623 --
NM_003958chr693897 3515 1309 1114 965 748 537 251 146 1331 1228 --
NM_003966chr5107819 7662 6864 6551 6424 6291 5858 5557 2568 1949 16217 17507 185
NM_003971chr171213 ------
NM_003972chr1021243 430 ------
NM_003983chr1663189 2876 1565 1360 1340 984 24152 2792 11264 1201
NM_003987chr1062226 1704 829 807 213 128 --128 1446
NM_003988chr1062303 1781 906 884 290 205 --1105 1523
NM_003994chr1254175 3148 3104 271 63 1387 --1317
NM_003996chr6128 ------
NM_004006chrX42633 2584 1994 51 ------
NM_004007chrX42633 2584 1994 51 ------
NM_004009chrX42633 2584 1994 51 ------
NM_004010chrX42633 2584 1994 51 ------
NM_004011chrX42633 2584 1994 51 ------
NM_004012chrX42633 2584 1994 51 ------
NM_004013chrX42633 2584 1994 51 ------
NM_004014chrX42633 2584 1994 51 ------
NM_004015chrX42633 2584 1994 51 ------
NM_004016chrX32547 2498 1908 --11021 --
NM_004017chrX42633 2584 1994 51 ------
NM_004018chrX32547 2498 1908 --11021 --
NM_004020chrX42633 2584 1994 51 ------
NM_004021chrX32547 2498 1908 --11021 --
NM_004022chrX32547 2498 1908 --11021 --
NM_004023chrX32547 2498 1908 --11021 --
NM_004028chr1823851 2885 33169 50 38 ----
NM_004033chr53565 254 140 ------
NM_004035chr1794756 4553 3623 3455 3226 1991 1381 1220 722 --24418 3437 133
NM_004047chr1279 29 ------
NM_004050chr143634 420 310 --21801 1027 --
NM_004060chr52386 101 ----1133
NM_004067chr73585 310 152 ------
NM_004068chr31419 1349 1386 --
NM_004073chr1184 --1197 --
NM_004077chr1221341 1063 ------
NM_004081chrY298 33 11549 ----
NM_004082chr23128 75 36 --2342 244 --
NM_004085chrX1557 ------
NM_004087chr311943 11404 1416 11933
NM_004093chr1332808 500 451 22125 135 1622 --
NM_004094chr1472474 2149 2000 629 614 326 225 ------
NM_004096chr1052162 2078 1633 575 170 1270 12034 --
NM_004100chr672662 2552 2079 1772 991 657 381 1787 ----
NM_004112chr1741641 1445 1326 1200 21243 188 --21571 673
NM_004116chr22308 120 ------
NM_004117chr661748 1409 715 631 531 399 1583 ----
NM_004124chr1432464 2265 682 ------
NM_004126chr71277 ------
NM_004132chr102379 61 31144 1092 23 ----
NM_004145chr193885 333 254 191 ----
NM_004162chr31881 --11030 --
NM_004171chr11149163 8251 7745 7275 7150 6598 6294 6185 6020 2794 2002 1182 1173 651 48762 7014 3305 2471 12055 --
NM_004181chr41138 --186 --
NM_004183chr114755 295 263 167 ------
NM_004186chr33825 665 609 --1160 --
NM_004199chr52273 36 ------
NM_004227chr752826 2030 1172 399 158 1517 ----
NM_004229chrX169 1698 ----
NM_004232chr181703 11484 ----
NM_004235chr92755 715 ------
NM_004241chr102621 89 ------
NM_004242chr61149 ------
NM_004253chr92640 283 ------
NM_004261chr11360 ------
NM_004263chr261800 1790 1555 1342 1165 510 ------
NM_004269chr9------125
NM_004274chr1442752 1156 945 74 12796 ----
NM_004276chr12170 1398 1383 --
NM_004286chr2262441 1940 1750 853 435 267 --32243 2110 912 --
NM_004293chr933450 3325 684 33025 2818 472 --13851
NM_004295chr1741197 442 149 46 --21103 171 --
NM_004301chr31356 ------
NM_004302chr1232865 2230 1032 1872 --12157
NM_004309chr176964 853 750 427 206 174 --2800 328 --
NM_004311chr1022088 254 --1503 --
NM_004319chr173127 2442 2142 472 461 216 165 1764 12129 12055
NM_004323chr93799 354 87 42389 2268 670 362 ----
NM_004327chr2242219 1985 885 428 --11906 1206
NM_004329chr1041201 962 511 356 1102 ----
NM_004331chr812383 --1768 --
NM_004338chr18135697 4930 4855 4376 2821 2562 2525 2499 2222 1810 1118 996 22 ------
NM_004339chr2161945 1715 1581 1424 381 272 --1782 --
NM_004349chr81131 167 11008 --
NM_004357chr111138 1128 ----
NM_004369chr21593 ------
NM_004370chr622164 1949 --21650 286 --
NM_004374chr8126 ------
NM_004379chr2----1369 --
NM_004384chr531979 1482 417 ------
NM_004386chr1942072 2048 819 528 1632 ----
NM_004393chr31261 --11750 --
NM_004397chr1153629 1301 1254 1166 462 ------
NM_004405chr21904 --1139 1275
NM_004411chr71223 ------
NM_004416chr121814 --1391 --
NM_004419chr103844 685 169 4735 702 283 159 ----
NM_004420chr1132363 640 252 --11930 --
NM_004423chr351975 1865 907 628 501 1711 32710 896 539 --
NM_004426chr1221681 303 11785 1778 --
NM_004428chr13765 143 24 1220 ----
NM_004430chr831016 897 630 22258 785 1823 1736
NM_004432chr932251 2061 371 11845 11479 --
NM_004434chr142138 108 1459 ----
NM_004437chr173627 3367 2934 2862 2275 807 297 43474 555 492 96 11414 1694
NM_004438chr272878 2691 2576 932 903 846 546 1228 12048 --
NM_004439chr41183 --1130 --
NM_004440chr6160 ------
NM_004441chr33308 172 102 ------
NM_004442chr131654 1177 477 11427 ----
NM_004443chr32305 242 1611 194 --
NM_004454chr331779 1634 223 ------
NM_004456chr7----249 43 --
NM_004457chr231737 1403 73 ------
NM_004459chr1731555 370 346 ------
NM_004464chr444169 1357 215 41 2616 64 23787 97 --
NM_004474chr12136 40 ------
NM_004475chr173235 102 26 1356 ----
NM_004482chr21927 ------
NM_004490chr21212 ------
NM_004491chr1984343 4312 3692 3313 3136 2659 626 135 13539 ----
NM_004500chr1421417 100 ------
NM_004501chr143007 1609 978 208 ----13523
NM_004504chr232008 1047 677 1946 ----
NM_004505chr171179 21468 775 ----
NM_004513chr1541565 1426 1347 70 12840 13626 --
NM_004514chr1772851 2797 2683 2628 2587 142 112 --1349 --
NM_004516chr19194 ------
NM_004521chr101378 ------
NM_004525chr221200 167 1576 ----
NM_004528chr11107 ------
NM_004529chr931036 389 152 --1219 --
NM_004554chr14101859 1670 1589 1345 1338 644 597 479 176 135 --2357 45 --
NM_004556chr62992 26 ------
NM_004560chr93412 334 61 ------
NM_004574chr171110 ------
NM_004575chr421250 259 21166 269 ----
NM_004579chr11----147 --
NM_004586chrX104913 4894 4356 3953 3636 3498 3465 1761 1359 1251 45376 4619 3816 835 ----
NM_004588chr1133813 680 426 23208 1550 22852 929 1375
NM_004593chr32808 673 ------
NM_004594chr162840 376 1977 1669 --
NM_004595chrX1465 ------
NM_004598chr573334 2452 2272 979 761 571 402 32540 2401 710 ----
NM_004606chrX1125 ------
NM_004612chr943836 3705 2975 1315 2417 38 ----
NM_004631chr13982 975 27 ------
NM_004634chr3----1120 --
NM_004640chr6140 ------
NM_004642chr123622 512 150 ------
NM_004643chr141261 ------
NM_004645chr173835 646 572 ----1672
NM_004650chrX2630 598 11471 ----
NM_004656chr34958 886 864 774 ------
NM_004660chrY32209 914 85 ------
NM_004663chr154523 416 245 205 1361 1215 --
NM_004664chr121244 ----164
NM_004670chr1031604 1113 527 ------
NM_004673chr131591 1197 1092 11497 ----
NM_004680chrY------126
NM_004687chr17156 ------
NM_004697chr92728 123 --1673 --
NM_004703chr1722499 2415 11712 ----
NM_004717chr721402 1289 ------
NM_004718chr21522 ------
NM_004719chr1232254 2032 1049 ----12781
NM_004725chr101441 ----1433
NM_004726chrX75575 5331 4496 4471 2240 1503 374 25095 4049 11943 --
NM_004730chr551807 1663 475 94 33 ------
NM_004739chr112662 178 2614 579 ----
NM_004742chr321818 94 1266 --11836
NM_004745chr886694 5176 4828 4560 1842 1811 1673 1058 36870 5084 292 14858 22305 162
NM_004748chr1583937 3176 3165 1703 1295 1154 762 602 13428 1821 --
NM_004755chr143981 100 47 ------
NM_004762chr1721299 1289 --1134 1687
NM_004768chr121093 254 ------
NM_004774chr1732690 2471 2288 32926 2735 1931 ----
NM_004775chr1842172 1714 852 579 11757 ----
NM_004776chr2022783 114 1407 11181 --
NM_004781chr131608 709 444 ------
NM_004781chr131608 709 444 ------
NM_004788chr1122474 827 11879 11056 --
NM_004789chr9----1313 --
NM_004796chr1411617 11571 ----
NM_004798chr2073497 3208 2901 1286 1111 578 413 33253 2927 218 1438 --
NM_004801chr221382 627 ------
NM_004808chr1072732 2415 2311 2100 1072 992 661 1299 12188 --
NM_004811chr111490 127 ----
NM_004814chr1--2101 48 ----
NM_004815chr164467 4048 3511 1026 331 198 14039 23359 1710 --
NM_004817chr9----1268 --
NM_004822chr1763482 2578 2526 1047 865 158 --13368 --
NM_004831chr1921021 942 --2987 352 --
NM_004834chr222746 1131 --1850 --
NM_004840chrX52180 1732 384 350 35 2584 340 --1277
NM_004845chrX93727 3388 3194 3179 1389 1280 1101 508 232 --23212 3077 12689
NM_004849chr62217 72 11482 ----
NM_004850chr221265 343 11195 ----
NM_004859chr1752966 2740 1963 856 65 22511 2260 ----
NM_004863chr1485301 4936 4626 4531 3689 3465 1794 470 122 1118 1463
NM_004869chr18--1127 ----
NM_004872chr12333 91 ------
NM_004884chr1551722 460 448 420 50 --21144 502 --
NM_004893chr5145 1434 ----
NM_004896chr1021549 1227 ------
NM_004898chr412334 ------
NM_004902chr201770 ------
NM_004904chr7106030 5722 5189 4882 4496 4433 1556 1358 768 103 --15776 --
NM_004905chr12328 186 ------
NM_004906chr61185 ------
NM_004912chr741739 1694 1613 1436 ------
NM_004925chr92186 151 ------
NM_004926chr142415 318 1143 ----
NM_004929chr81528 ------
NM_004937chr1742260 1075 58 36 1736 32513 286 254 2947 826
NM_004938chr95855 836 450 265 176 ------
NM_004952chr11706 ----1713
NM_004956chr743003 2977 2921 891 --11302 12815
NM_004958chr11600 --1654 --
NM_004961chrX31124 545 200 --1429 --
NM_004969chr101390 ------
NM_004973chr611209 ------
NM_004975chr201341 1122 1378 1348
NM_004976chr1194869 4799 3932 3719 3657 3473 1021 414 58 --24581 3875 13208
NM_004978chr151534 1180 579 488 444 ------
NM_004985chr1233372 3186 1725 ------
NM_004992chrX118547 8275 6828 6671 5964 3232 3050 2657 2553 2419 612 27914 1821 1154 --
NM_004992chrX118547 8275 6828 6671 5964 3232 3050 2657 2553 2419 612 27914 1821 1154 --
NM_004995chr1461292 1217 1162 1030 414 254 1333 ----
NM_004996chr1641364 628 487 270 ----1391
NM_004999chr684259 3794 3593 2847 1530 1519 1316 595 23153 1373 --13737
NM_005006chr22907 718 ------
NM_005010chr71388 31774 843 233 ----
NM_005011chr731868 1366 699 11315 --11243
NM_005017chr3--2213 50 ----
NM_005028chr1041816 1696 794 130 ------
NM_005036chr22198341 7946 7937 7600 6928 6905 6511 6156 6033 5654 5307 5092 5065 2936 2800 2577 1542 1017 222 46283 5527 3217 111 12647 17509
NM_005044chrX64298 3524 3162 2816 1773 620 --1956 --
NM_005056chr1284481 4077 3463 1719 1303 811 376 299 25068 362 25179 1169 --
NM_005063chr1073526 3097 2941 2747 2528 976 470 --13425 --
NM_005066chr12617 313 ------
NM_005070chr24252 181 95 40 124 161 --
NM_005073chr131232 1107 1280 --
NM_005079chr812489 23178 2314 12876 --
NM_005080chr221103 1112 1141 --
NM_005087chr31762 ------
NM_005093chr20115071 4751 4181 3445 1593 1389 1057 486 464 426 406 64517 4456 3579 1095 924 562 24244 1476 --
NM_005094chr95655 624 610 266 196 ------
NM_005095chr131375 836 666 42243 348 341 231 ----
NM_005096chrX21194 62 ----1270
NM_005099chr131148 1003 82 11339 21166 886 143
NM_005105chr141515 507 376 344 ------
NM_005109chr36694 659 652 606 315 276 11821 --1535
NM_005110chr51619 1283 ----
NM_005116chr20104486 4150 4080 3655 3587 3580 3032 1785 1689 1552 11813 1311 --
NM_005121chr1753478 2937 1279 894 84 ----1376
NM_005124chr62219 168 ----1770
NM_005126chr321684 169 ------
NM_005134chr181257 1231 ----
NM_005135chr1583216 2746 2340 1354 1188 476 427 145 1376 23036 2620 13459
NM_005144chr831180 208 70 ----11096
NM_005151chr1842404 2270 1891 432 ------
NM_005153chr162716 305 ------
NM_005154chr151528 ------
NM_005156chr984322 4078 1718 1419 1365 1058 340 232 23716 56 44228 1567 1399 677 --
NM_005161chr1131656 1531 33 32207 652 164 1242 --
NM_005168chr22460 159 ------
NM_005180chr101583 ------
NM_005181chr8125 ------
NM_005187chr1621375 278 21555 271 21666 214 --
NM_005197chr14125538 5109 4570 4484 3951 3794 2061 1927 1693 1587 1430 427 ------
NM_005201chr311089 1300 ----
NM_005204chr102213 196 ------
NM_005206chr1741462 1382 417 126 ------
NM_005207chr2283649 3406 2532 2313 1412 822 803 788 12470 22722 687 --
NM_005214chr21456 ------
NM_005219chr571757 1503 1389 340 308 274 31 1315 1169 --
NM_005224chr193702 653 247 ------
NM_005230chr12------1569
NM_005233chr331802 257 141 ------
NM_005235chr267774 6486 5257 5199 2946 1704 ------
NM_005238chr1142818 1105 535 122 32758 2329 254 23201 638 --
NM_005239chr2131712 1321 135 1487 ----
NM_005241chr32313 94 ------
NM_005244chr201612 2146 40 ----
NM_005249chr141650 ------
NM_005252chr141152 2670 250 ----
NM_005257chr182868 44 ------
NM_005264chr102906 748 ------
NM_005271chr1011036 11189 ----
NM_005276chr1241695 536 374 193 1609 ----
NM_005276chr1241695 536 374 193 1609 ----
NM_005295chr71292 ------
NM_005308chr101511 156 1357 --
NM_005311chr792763 2229 1866 1072 1016 967 941 918 824 --12549 --
NM_005312chr92925 132 11020 2608 209 22021 108
NM_005324chr1742057 1438 857 165 ----11758
NM_005329chr1632178 1979 1498 11581 ----
NM_005334chrX1490 1547 149 --
NM_005336chr2102211 1672 1496 915 805 792 673 596 356 67 11526 21584 495 1825
NM_005338chr764062 3457 2799 1341 1272 438 --12685 --
NM_005339chr433663 3542 713 11080 1323 --
NM_005342chrX12226 --22133 557 --
NM_005359chr18115503 5253 4837 4192 4070 3975 2376 2145 1378 896 612 24621 190 25245 2193 --
NM_005374chr1742377 1839 1792 94 11482 1153 --
NM_005375chr611094 ----11024
NM_005380chr131294 229 53 --1425 1118
NM_005381chr2----1404 --
NM_005382chr83325 164 67 ------
NM_005385chr392699 2410 2363 2267 2159 2128 2063 644 607 1326 ----
NM_005386chr201742 ------
NM_005388chr921736 1411 1319 ----
NM_005392chr971625 1551 1263 507 287 151 91 ------
NM_005397chr753791 1458 835 571 140 11086 --23457 2433
NM_005399chr144100 3784 904 453 23367 596 ----
NM_005400chr23320 293 208 1104 ----
NM_005402chr731428 600 185 ------
NM_005406chr1831313 559 530 --1114 --
NM_005407chr1421116 53 ------
NM_005415chr22287 177 ------
NM_005417chr2022037 767 1618 21440 341 --
NM_005424chr11101 ------
NM_005433chr1832511 1932 683 ------
NM_005436chr1053662 2660 2510 317 125 --12652 --
NM_005440chr1793322 2867 2713 2601 2592 828 775 629 514 22156 1342 ----
NM_005443chr41152 ------
NM_005445chr101307 ------
NM_005455chr121439 342 ----21591 641
NM_005458chr941646 450 192 122 ------
NM_005460chr52209 177 ------
NM_005461chr2021534 536 --1556 --
NM_005465chr13360 228 216 11656 ----
NM_005474chr1761029 642 402 169 108 29 --3578 432 141 --
NM_005475chr1272289 1176 999 875 743 511 23 1581 ----
NM_005477chr1562258 1007 876 812 756 57 ----1457
NM_005477chr1562258 1007 876 812 756 57 ----1457
NM_005483chr191101 ------
NM_005487chr2281639 1418 1306 640 603 410 281 80 ------
NM_005497chr17135876 4911 4809 4470 4054 2008 1812 1725 1677 1420 1293 919 103 33800 2294 855 11868 --
NM_005502chr9--32975 2579 1089 ----
NM_005503chr1511065 ------
NM_005504chr1295872 5841 5396 4898 4758 4496 1667 1045 678 25696 1644 --16243
NM_005509chr531458 411 154 ------
NM_005512chr1141925 1582 1533 1483 --22024 2012 --
NM_005517chr1--1527 ----
NM_005520chr51192 ------
NM_005527chr61135 ------
NM_005537chr131930 ----1256
NM_005539chr102350 172 --1145 --
NM_005547chr13207 97 36 128 ----
NM_005558chr14671 641 382 38 1697 ----
NM_005561chr132735 112 --1689 --
NM_005563chr11256 --1649 --
NM_005573chr51136 174 ----
NM_005578chr395113 4703 4592 4173 4097 3934 1737 702 303 ----1127
NM_005594chr12131 ------
NM_005596chr984553 4513 4478 4462 2373 999 928 430 --15300 --
NM_005598chr14575 505 497 380 1651 --11123
NM_005602chr341119 470 417 185 --1503 --
NM_005603chr182815 64 ------
NM_005604chr642351 1788 1004 800 ------
NM_005607chr831006 368 89 ------
NM_005610chr11217 ------
NM_005614chr71411 2889 144 1347 --
NM_005625chr81194 ------
NM_005627chr61180 ----1261
NM_005637chr1851990 1849 1684 537 56 --21867 1732 --
NM_005638chrX31763 443 225 1196 ----
NM_005639chr1251908 1894 1497 721 68 ------
NM_005647chrX42681 1342 1149 894 --11155 22585 882
NM_005649chr53474 146 29 ------
NM_005650chr2231252 917 547 ------
NM_005655chr8----141 --
NM_005662chr8171 ------
NM_005664chr151386 ------
NM_005665chr111808 33595 1429 355 2745 609 --
NM_005668chr564295 4172 4100 2928 874 723 --32897 771 473 --
NM_005688chr321148 1105 --21295 855 --
NM_005704chr131022 765 759 ------
NM_005707chr1521169 493 ------
NM_005711chr53845 824 337 ------
NM_005715chr652723 2468 2413 708 619 1412 --11978
NM_005717chr13945 935 106 11311 129 1873
NM_005720chr71260 ------
NM_005721chr2--1862 ----
NM_005722chr222166 1874 ----11699
NM_005725chr112401 1392 ----
NM_005730chr12143415 3246 3217 3209 3116 2920 2725 2568 2316 1444 1431 704 426 96 23139 1271 --11166
NM_005731chr2191 ------
NM_005734chr113778 556 521 ------
NM_005741chr163892 222 110 1605 ----
NM_005742chr2------122
NM_005746chr71526 ----12101
NM_005748chr1243442 3363 2972 1074 ------
NM_005749chr17--1212 ----
NM_005754chr52965 947 ------
NM_005759chr274251 4236 3865 1297 563 329 26 23300 1177 ----
NM_005761chr12--140 ----
NM_005766chr1341361 1183 460 166 ------
NM_005779chr543262 2577 1390 1358 11308 --1400
NM_005789chr1762080 1856 1533 598 577 569 --1187 --
NM_005796chr162370 330 ------
NM_005801chr172759 321 ------
NM_005802chr91721 ------
NM_005822chr63909 729 440 --12249 12109
NM_005826chr11258 ------
NM_005832chr3--1579 ----
NM_005835chr61416 1209 ----
NM_005839chr11742 ------
NM_005840chrX42709 2689 206 65 26530 724 27296 7159 --
NM_005841chr42934 173 ------
NM_005842chr131500 ------
NM_005843chr21297 11702 ----
NM_005853chr161585 ------
NM_005860chr1941657 1569 1312 398 1103 11622 21453 1019
NM_005871chr10----1129 --
NM_005885chr541044 550 129 89 21419 1233 11281 --
NM_005896chr2--1779 ----
NM_005898chr1143122 2363 2331 957 12832 ----
NM_005901chr18128318 8187 7615 7474 7342 6629 6317 5763 3457 2197 2177 127 15292 11928 --
NM_005902chr1573946 3920 3420 3009 2857 1691 1185 1606 23414 860 --
NM_005903chr575121 4059 3382 1793 1573 1211 625 ------
NM_005905chr131344 ------
NM_005906chr631660 1398 1312 ------
NM_005909chr583286 2681 1268 1155 1136 694 526 163 1775 1944 13674
NM_005910chr17133929 3889 3866 3772 3449 3329 3030 2994 2593 1358 1252 1238 286 1825 12687 --
NM_005911chr2--21149 1036 ----
NM_005920chr1113206 2846 2723 2623 2562 2440 1560 1503 942 881 24 13031 ----
NM_005924chr7257 29 ------
NM_005927chr531291 915 348 31130 204 47 ----
NM_005930chr141122 ------
NM_005933chr1141930 661 655 366 11873 ----
NM_005934chr1982481 2145 2119 1947 1744 823 149 60 2448 248 1104 --
NM_005935chr495057 4194 3352 3285 2109 1759 1239 386 57 14613 33530 3232 828 --
NM_005937chr17104040 3368 3344 3100 2923 2872 2723 2637 2628 1079 --32662 1068 749 --
NM_005938chrX3444 348 256 1537 --133
NM_005941chr873600 3352 2686 744 732 693 215 ------
NM_005944chr33862 205 129 ------
NM_005955chr1104991 4840 4682 4415 4380 3897 3844 3352 2215 1074 1910 32091 1957 613 --
NM_005957chr174928 4262 3556 3469 3138 1685 1046 43565 3153 3029 1128 34899 4113 3726 --
NM_005964chr1721214 434 ----21135 159
NM_005966chr252431 2280 1850 93 75 ----11550
NM_005967chr122607 158 236 22 ----
NM_005977chr131352 1639 ----
NM_005984chr225509 466 454 406 64 --1396 --
NM_005999chr11465 ----1283
NM_006007chr964063 3121 3090 2905 1372 926 --23693 2935 --
NM_006015chr11228 195 11056 --
NM_006016chr621682 1659 1483 --1660
NM_006030chr331395 708 92 --1362 186
NM_006033chr1842222 2186 316 107 --1414 --
NM_006035chr141316 --21249 374 --
NM_006038chr2031365 877 404 188 ----
NM_006040chr1651099 1093 1031 545 85 ------
NM_006041chr173457 427 160 ------
NM_006047chr2023191 1293 1402 --1564
NM_006048chr11970 ------
NM_006054chr1131295 1116 163 11145 ----
NM_006067chr163844 686 227 ------
NM_006085chr1------2903 298
NM_006089chrX61866 1767 1480 1462 1447 36 1491 11370 --
NM_006090chr11691 ------
NM_006091chr15101277 1188 1173 585 519 498 417 395 305 256 11444 11159 --
NM_006094chr82977 817 11719 ----
NM_006095chr474360 3960 2805 2752 1677 1280 714 11440 12885 --
NM_006099chr12318 141 --1631 --
NM_006106chr1132542 414 375 --11363 --
NM_006108chr1141889 1827 602 495 ------
NM_006109chr142254 137 --141 --
NM_006113chr131797 499 132 21557 558 ----
NM_006121chr122335 92 ------
NM_006122chr1551851 1072 964 693 570 12453 12443 --
NM_006133chr1132203 968 163 11867 21802 118 --
NM_006135chr151211 1046 413 132 23 11128 ----
NM_006136chr71294 ------
NM_006141chr1642802 1819 1047 1028 11868 12706 --
NM_006154chr1522580 536 ------
NM_006158chr841717 1621 1117 698 11658 ----
NM_006159chr121221 ------
NM_006161chr54673 587 470 198 --175 --
NM_006162chr1881700 1569 1188 1173 656 618 406 93 --11410 --
NM_006166chr1222311 2048 ------
NM_006180chr92363 291 143 ----
NM_006183chr121187 ------
NM_006185chr113529 92 79 --1503 --
NM_006186chr21289 --199 --
NM_006194chr1441148 860 75 27 --147 --
NM_006195chr91323 ------
NM_006196chr21357 ------
NM_006203chr543718 3470 1948 1013 ------
NM_006206chr452325 2251 344 291 222 --2211 137 --
NM_006209chr81395 ------
NM_006218chr32247 63 ------
NM_006224chr1732515 163 118 12235 ----
NM_006235chr1121342 712 11570 31721 1561 718 --
NM_006237chr1322071 1792 185 ----
NM_006238chr631975 736 224 31553 499 130 --11643
NM_006243chr11399 ------
NM_006246chr141978 1212 ----
NM_006251chr51740 --2607 249 --
NM_006252chr136899 6247 5137 26258 1948 12514 --
NM_006256chr131812 351 191 ------
NM_006265chr831230 594 486 11315 ----
NM_006267chr211867 1709 ----
NM_006275chr2052194 1695 1010 850 501 11809 --1598
NM_006277chr21100 ------
NM_006281chr81394 ------
NM_006281chr81394 ------
NM_006282chr2094040 3997 3061 1723 1572 1346 835 802 67 33340 3014 1543 23282 3148 --
NM_006283chr854609 1526 760 261 71 44649 3108 1099 798 24599 4593 --
NM_006300chr1972343 1660 886 783 738 732 721 12438 --1668
NM_006307chrX169 ------
NM_006315chr443372 3036 389 352 --44269 3013 1158 247 13114
NM_006317chr51266 ------
NM_006320chr42724 221 134 ----
NM_006325chr121118 ------
NM_006327chr10135 ------
NM_006329chr141277 1661 ----
NM_006341chr12244 207 ------
NM_006350chr5--136 ----
NM_006352chr121598 417 --1652 --
NM_006358chr22--1949 1435 --
NM_006359chrX----1273 --
NM_006364chr142857 286 ------
NM_006369chr13391 385 24 ------
NM_006371chr395067 4442 4293 3738 2094 1936 1289 824 277 44913 2006 442 91 34738 4217 3201 --
NM_006375chrX41472 1414 1282 196 ------
NM_006377chr91114 ------
NM_006378chr941082 1040 345 134 --21119 31 --
NM_006380chr1733678 3649 2736 --23802 3554 --
NM_006390chr12--11258 1314 --
NM_006391chr111273 1219 ----
NM_006393chr1064504 4402 4128 4110 3820 1616 13589 1536 --
NM_006403chr61346 11499 ----
NM_006416chr6160 173 ----
NM_006420chr2052484 1330 1035 679 231 2923 114 ----
NM_006421chr81201 ------
NM_006424chr441885 1852 1373 1335 1342 ----
NM_006439chr41485 150 ----
NM_006445chr17----246 24 --
NM_006449chr211955 21856 1563 ----
NM_006454chr492917 2607 2232 2017 1021 928 760 324 70 1277 22304 1059 --
NM_006457chr463997 1024 971 839 394 168 13874 ----
NM_006459chr1041909 1544 1464 1314 181 ----
NM_006461chr17126 ------
NM_006465chr15101911 1702 1661 1494 896 855 845 815 707 579 12260 21793 680 11886
NM_006469chr12619 550 ------
NM_006471chr182115 76 ------
NM_006475chr13186 2544 59 ----
NM_006478chr22157 ----1214
NM_006482chr12112978 2947 2802 2678 2597 2447 1046 857 717 242 53 1535 ----
NM_006489chr14--1711 ----
NM_006497chr173570 154 144 --1170 --
NM_006500chr112974 67 ------
NM_006516chr141588 1449 302 54 ------
NM_006517chrX2756 707 ------
NM_006520chrX41544 1183 1170 464 ------
NM_006527chr41143 ------
NM_006534chr2033264 1200 450 12394 --11193
NM_006538chr263634 3598 3524 3428 1230 1199 1415 1472 --
NM_006540chr831339 249 27 11557 ----
NM_006544chr1454556 1823 435 71 61 14620 ----
NM_006546chr17175980 5900 4866 4742 4695 4157 2633 2173 2095 1925 1658 885 375 336 309 218 174 12354 24795 4190 --
NM_006547chr762104 1853 1583 568 471 290 ------
NM_006548chr331327 1312 597 11353 1255 --
NM_006549chr1272675 2502 2404 802 526 499 112 12588 1943 --
NM_006558chr81317 ------
NM_006559chr111031 ------
NM_006560chr111120 1391 ----
NM_006561chr1034198 1717 99 --35140 2245 1121 --
NM_006565chr16----11075 --
NM_006566chr1821214 372 196 1917 --
NM_006570chr91394 ------
NM_006572chr1753248 3074 2687 897 416 1272 12321 12209
NM_006578chr1541467 1132 291 196 21627 1434 ----
NM_006591chr1131846 1336 1293 --1683 --
NM_006595chr112160 77 11706 ----
NM_006599chr1697696 7648 6493 6199 5504 2563 1428 1191 919 26816 6186 22654 1242 --
NM_006601chr122357 158 ------
NM_006603chrX31410 1373 680 11440 ----
NM_006614chr363205 2774 2610 2289 414 187 12426 ----
NM_006618chr1173 11114 ----
NM_006620chr654845 4516 3499 1740 1039 21922 1304 1637 --
NM_006621chr131700 367 174 2485 418 ----
NM_006625chr13974 734 346 ------
NM_006625chr13974 734 346 ------
NM_006625chr13974 734 346 ------
NM_006626chr92616 200 --1226 --
NM_006628chr1563665 3463 2886 1290 1132 519 13246 33804 3683 3548 --
NM_006629chr1842513 2058 1814 1785 11052 ----
NM_006633chr51607 ------
NM_006644chr131247 ------
NM_006646chr1332769 2060 960 ------
NM_006650chr583865 3133 2656 404 259 148 103 81 12497 --12433
NM_006654chr1284626 3155 3110 1281 889 847 562 66 --1721 --
NM_006656chr1131058 357 273 11140 1157 --
NM_006675chr1293110 2670 2536 2361 2283 2135 1169 674 159 43119 944 738 554 22874 144 22659 151
NM_006682chr742379 2145 604 58 22544 989 ----
NM_006690chr2042288 2014 1591 564 22192 1845 ----
NM_006698chr205543 416 350 276 96 --11225 --
NM_006704chr132392 318 ------
NM_006709chr62244 212 ------
NM_006710chr22903 105 133 ----
NM_006717chr942960 2373 1360 797 12608 ----
NM_006720chr1064042 3965 3932 3215 1446 363 13719 ----
NM_006722chr343064 2215 1127 491 ------
NM_006727chr51172 ------
NM_006729chrX64338 4177 3972 3743 3515 2035 ------
NM_006731chr995743 5260 4879 4150 3928 3827 3717 2331 1507 21149 845 24237 2169 15291
NM_006738chr15104644 3751 3588 2974 2921 1807 1012 277 232 108 43823 3367 1457 568 33342 3237 3169 14623
NM_006741chr1231065 988 285 --11008 1808
NM_006749chr821326 1062 ----1487
NM_006750chr16107210 6257 6073 5441 2412 2335 1813 1208 588 96 11579 --17884
NM_006751chr2--1240 ----
NM_006754chr721212 303 ------
NM_006759chr21281 ------
NM_006761chr17------1117
NM_006766chr841915 1804 789 298 1809 ----
NM_006769chr1174 139 ----
NM_006772chr671670 1415 1314 521 388 312 186 ------
NM_006775chr642526 2083 1193 1160 11216 ----
NM_006777chrX22459 2263 --12254 --
NM_006788chr181504 1120 21595 1477 --
NM_006795chr1141453 994 445 71 --11397 --
NM_006802chr121094 109 --1262 --
NM_006805chr511238 ------
NM_006815chr1221282 393 ------
NM_006816chr5----1237 --
NM_006818chr12870 820 ----1356
NM_006819chr112360 104 --1345 --
NM_006826chr221234 226 11254 ----
NM_006827chr1452550 2366 2187 479 37 --22733 2598 --
NM_006832chr142218 127 ------
NM_006838chr1211201 ------
NM_006851chr1272777 2753 2613 2596 2087 889 454 31164 1079 742 ----
NM_006852chr1732249 1998 732 --11989 1356
NM_006854chr761995 1951 648 270 189 34 --11626 --
NM_006856chr124806 356 211 27 11092 ----
NM_006857chr22165 100 1590 ----
NM_006861chr1231653 622 71 11377 184 --
NM_006870chr204676 523 330 90 1816 ----
NM_006873chr233143 2294 2226 22515 1048 ----
NM_006885chr1643868 3168 1384 504 23059 1521 ----
NM_006887chr21591 ----1490
NM_006888chr1443012 1067 785 479 --12171 --
NM_006889chr31446 1222 ----
NM_006898chr21580 --1133 --
NM_006908chr731398 1105 266 1451 ----
NM_006914chr9122 ------
NM_006920chr221860 1496 ------
NM_006922chr232528 1667 873 ------
NM_006924chr1732794 2701 982 23784 240 --13665
NM_006925chr141372 ------
NM_006927chr1662050 1637 1570 759 699 550 --41613 448 384 361 --
NM_006931chr1221974 1390 31604 804 363 ----
NM_006943chr2072951 2436 1338 1267 1076 1010 695 2143 76 ----
NM_006951chr103642 335 69 ------
NM_006981chr912812 --1918 12338
NM_006990chr172494 869 723 606 502 376 334 11980 ----
NM_006997chr101374 ------
NM_006999chr52247 201 --157 --
NM_007005chr91206 ------
NM_007007chr12104786 4654 4382 4306 3528 3415 1228 1037 574 475 11351 13117 13470
NM_007010chr1721182 765 11472 1269 --
NM_007011chr15126695 6198 6042 5837 5811 5795 4248 4217 1962 1833 1665 87 21811 651 12493 24558 896
NM_007017chr52813 621 --1140 --
NM_007026chr17----1440 --
NM_007027chr31231 ----1119
NM_007030chr563473 3207 1720 859 247 240 23219 775 13946 --
NM_007033chr142252 2130 127 22 --21966 1654 --
NM_007038chr2175883 5300 5204 4682 2351 670 177 --1103 --
NM_007039chr1411755 11990 ----
NM_007042chr361805 1763 1698 801 794 397 1290 11811 --
NM_007050chr20166951 6641 6578 6489 5649 5349 5017 3071 3037 2793 2670 1740 1698 1454 484 389 25155 1372 22016 1818 --
NM_007052chrX150 1235 1169 --
NM_007054chr533824 2937 2861 22984 2601 32888 2754 2467 --
NM_007061chr221372 ------
NM_007067chr1741072 1005 249 129 --1199 --
NM_007068chr221941 ------
NM_007106chr1342618 2538 2323 760 22153 922 --180
NM_007111chr13----129 --
NM_007112chr12164 94 ------
NM_007114chr313005 ------
NM_007118chr51584 ------
NM_007125chrY2349 43 2585 196 1164 --
NM_007129chr131665 ------
NM_007144chr1731088 866 340 1403 ----
NM_007146chr1742369 2214 1879 772 11064 ----
NM_007157chrX3692 492 215 12352 ----
NM_007158chr11235 --1413 --
NM_007159chr31641 11637 ----
NM_007166chr1111211 ------
NM_007170chr1241 21 ------
NM_007172chr2263278 3106 1308 667 597 558 ------
NM_007174chr1242013 1575 1507 137 --1735 --
NM_007189chr721537 1238 --1151 --
NM_007191chr121124 ------
NM_007192chr1431117 751 333 ------
NM_007197chr121734 2724 284 ----
NM_007200chr15104644 3751 3588 2974 2921 1807 1012 277 232 108 43823 3367 1457 568 33342 3237 3169 14623
NM_007202chr17--1778 1507 --
NM_007203chr922638 2500 --11404 11011
NM_007212chr111453 ------
NM_007213chrX----2645 271 --
NM_007217chr32256 32 ------
NM_007218chr82358 81 ------
NM_007219chr203299 242 120 1976 --1814
NM_007236chr1572440 2027 1705 1588 995 631 495 1662 11723 --
NM_007245chr162670 190 1816 ----
NM_007246chr4----1113 1149
NM_007249chr1398531 8125 7518 6953 6687 6188 2870 2057 2023 39205 9178 6038 27612 2746 29248 7011
NM_007271chr621635 548 --2554 474 --
NM_007278chr17132 ------
NM_007282chr32735 277 ------
NM_007285chr162408 388 1157 ----
NM_007292chr1794756 4553 3623 3455 3226 1991 1381 1220 722 --24418 3437 133
NM_007294chr1731184 367 93 ------
NM_007295chr1731184 367 93 ------
NM_007296chr1731184 367 93 ------
NM_007297chr1731184 367 93 ------
NM_007298chr1731184 367 93 ------
NM_007299chr1731184 367 93 ------
NM_007300chr1731184 367 93 ------
NM_007302chr1731184 367 93 ------
NM_007303chr1731184 367 93 ------
NM_007304chr1731184 367 93 ------
NM_007305chr1731184 367 93 ------
NM_007308chr41242 ------
NM_007325chrX62144 2066 1967 173 166 60 21544 1504 ----
NM_007345chr1862285 2005 1916 1624 254 88 ------
NM_007347chr1543046 2717 2459 946 12122 32477 2340 364 --
NM_007358chr12731 143 ------
NM_007363chrX11017 ------
NM_007365chr152009 1468 682 488 199 --2692 168 --
NM_007372chr171113 --171 --
NM_007373chr1021338 1176 ----11400
NM_012081chr563638 3275 2479 2277 639 460 12452 ----
NM_012082chr82689 376 ------
NM_012090chr131068 392 132 ------
NM_012096chr373450 3431 2695 705 653 575 353 --33712 3165 3031 --
NM_012098chr941468 1234 1150 552 21087 452 11328 1421
NM_012102chr142472 1949 1890 315 ------
NM_012104chr1163532 3406 2490 1336 284 106 1709 11372 --
NM_012104chr1163532 3406 2490 1336 284 106 1709 11372 --
NM_012115chr6154 ------
NM_012120chr652011 1007 906 201 61 ------
NM_012134chr141433 1222 165 50 11563 11801 --
NM_012137chr152915 2554 890 655 149 ------
NM_012141chr1353877 2685 1367 960 291 23584 2973 ----
NM_012142chr152329 274 1252 ----
NM_012156chr2033379 2271 2079 12621 13059 --
NM_012158chr133394 192 117 --11411 --
NM_012164chr986473 6371 2827 2597 2437 1757 1656 1645 27148 5410 22320 1175 --
NM_012166chr941620 1024 347 149 --11000 --
NM_012174chr1282805 2617 2363 2260 1902 1105 761 272 1817 2282 263 --
NM_012180chr4124 2513 37 1119 --
NM_012193chr1163592 3376 3359 1843 1692 94 24455 1118 44172 3779 1650 1569 --
NM_012197chr93474 335 244 21123 30 ----
NM_012199chr152872 2843 1856 466 304 ------
NM_012210chr931465 406 54 1132 2520 457 --
NM_012214chr265918 5181 4117 2169 1731 1536 26136 192 11208 --
NM_012224chr42965 803 --173 --
NM_012229chr1021078 528 1973 --1345
NM_012234chr353339 3121 3105 2691 1118 ------
NM_012236chr14730 228 111 90 ------
NM_012238chr1031490 1240 1217 ------
NM_012247chr101118 ------
NM_012248chr16--132 1647 1634
NM_012249chr283174 2751 2699 2628 2590 2336 1391 246 2132 43 12423 --
NM_012250chr112206 63 1501 11383 2122 96
NM_012257chr73775 220 81 ------
NM_012262chr194898 1816 1783 1601 1536 1278 1115 480 64 14583 ----
NM_012264chr2261908 1331 706 376 189 69 --1815 --
NM_012264chr2261908 1331 706 376 189 69 --1815 --
NM_012281chr731948 1872 509 1530 ----
NM_012287chr342910 1464 1300 416 12975 11348 --
NM_012288chr6124408 4323 4170 3973 2308 2287 2115 1972 1043 328 232 107 --23751 1053 --
NM_012290chr221326 461 ------
NM_012297chr41772 --12249 --
NM_012300chr572530 2513 1960 1859 409 220 206 ------
NM_012301chr751647 1405 589 407 63 ------
NM_012304chr562572 2439 2094 1605 708 458 ------
NM_012306chr1242497 2287 1289 1120 13310 43503 2313 977 401 --
NM_012307chr183943 790 327 --1276 --
NM_012308chr111298 42460 2090 890 717 11908 11720
NM_012309chr11104176 4029 3803 3526 3134 1774 1079 447 291 263 44492 918 464 172 ----
NM_012310chrX2553 425 --1167 --
NM_012316chr1115481 5203 5098 4923 3769 3734 3465 1356 1208 766 364 35237 4549 809 34294 1744 1430 --
NM_012319chr181939 --1947 --
NM_012325chr2031324 401 326 186 ----
NM_012327chr184586 576 493 70 ------
NM_012328chr711006 ------
NM_012329chr1721200 172 ------
NM_012330chr1041671 1635 448 167 ----11320
NM_012334chr5113786 3767 3618 3569 3086 3054 3001 1503 719 300 249 23648 3260 21707 1590 --
NM_012338chr7--11223 ----
NM_012343chr52315 275 ------
NM_012384chr2062206 2042 1907 987 203 50 --1919 11975
NM_012388chr15186 ------
NM_012396chr13283 240 45 ------
NM_012399chr2231629 1411 330 ------
NM_012416chr91215 ------
NM_012417chr171409 ------
NM_012428chr151133 --1188 --
NM_012446chr52620 107 ------
NM_012448chr1772479 2462 2085 1851 948 136 23 ------
NM_012460chr141237 ------
NM_012463chr122563 111 --2743 607 --
NM_012464chr442831 2797 565 294 ----1712
NM_012465chr1032404 2205 828 1627 --1138
NM_012471chrX21722 1390 2378 61 ----
NM_012479chr782708 1754 997 944 748 687 510 219 ------
NM_013229chr1231102 1065 225 12229 41121 985 687 384 1954
NM_013231chr1453875 3527 3375 755 321 21644 1612 ----
NM_013232chr51387 ------
NM_013233chr231184 578 145 ------
NM_013252chr752405 1764 871 659 480 12504 --1303
NM_013253chr112478 185 ------
NM_013255chr7138394 6707 6411 6131 5757 5587 3392 3101 2597 2327 2040 1406 614 --15510 17292
NM_013256chr192678 142 ------
NM_013257chr81101 12390 ----
NM_013261chr433765 1379 1369 ------
NM_013262chr631277 956 908 ------
NM_013264chr11----153 --
NM_013275chr161236 ----1520
NM_013279chr1192106 1916 1846 1733 1651 1477 844 726 693 12163 11939 --
NM_013282chr192914 213 21329 344 ----
NM_013309chr1522113 29 12434 ----
NM_013312chr19----2233 81 --
NM_013313chr2293505 3462 2669 2372 1268 1237 873 799 638 21186 170 22970 2432 --
NM_013314chr10------135
NM_013316chr73790 282 61 11045 ----
NM_013323chr171314 1970 1418 --
NM_013336chr32330 304 --11820 148
NM_013354chr821475 214 1165 ----
NM_013357chr83792 228 136 ------
NM_013363chr3164 ------
NM_013364chrX41883 1812 542 175 ----1292
NM_013372chr1533323 3304 950 11013 ----
NM_013373chr223821 708 307 ------
NM_013374chr321152 548 ------
NM_013377chr12171 1693 1580 --
NM_013381chr121804 1750 1257 --
NM_013390chr91165 ------
NM_013411chr152468 2071 1784 1074 349 32484 2461 362 ----
NM_013423chrX----21151 204 --
NM_013427chrX----21151 204 --
NM_013434chr241975 1618 1426 505 11580 11806 --
NM_013434chr241975 1618 1426 505 11580 11806 --
NM_013437chr8------1892
NM_013438chr9----11706 11098
NM_013443chr93850 791 24 --21136 1084 --
NM_013444chrX4993 781 739 281 ------
NM_013449chr121867 --12177 31027 990 935
NM_013450chr22190 165 ----21068 776
NM_013995chrX22330 2156 ------
NM_013996chr7131 ------
NM_013996chr7131 ------
NM_013997chr7131 ------
NM_013997chr7131 ------
NM_013998chr7131 ------
NM_013998chr7131 ------
NM_014000chr1021614 614 --1754 --
NM_014010chr91445 ------
NM_014014chr21438 --2484 102 1533
NM_014015chr162650 509 ------
NM_014021chr132648 1114 344 12154 ----
NM_014023chr1062235 1838 1135 946 853 664 32175 1955 917 ----
NM_014028chr642533 2352 2092 1012 22928 123 12589 --
NM_014043chr31604 ------
NM_014048chr1655308 5285 3674 1438 265 ----13571
NM_014055chr121449 ------
NM_014057chr931517 563 55 ------
NM_014089chr134899 890 785 222 --11580 1842
NM_014106chr153913 597 307 --1683 --
NM_014112chr875467 5152 4619 4039 1301 1225 112 13403 24808 3831 --
NM_014117chr1662557 2325 2144 2135 2033 397 12610 ----
NM_014141chr784081 3771 3564 3384 1655 1208 866 78 1366 24997 3936 --
NM_014154chr3------1255
NM_014155chr1164775 2547 2403 2287 1443 975 22748 2159 35221 1361 291 --
NM_014157chr16103109 2810 2613 1368 1360 1005 900 832 425 413 1927 22481 595 --
NM_014181chr232660 2154 575 ----11143
NM_014183chr201273 ------
NM_014190chr431335 681 224 31542 561 90 21204 568 --
NM_014214chr182372 329 1396 ----
NM_014217chr12480 22 ----1301
NM_014232chr1741179 501 71 52 1365 ----
NM_014232chr1741179 501 71 52 1365 ----
NM_014240chr3113951 3372 3324 3285 2605 1354 1268 1245 1186 419 225 1641 31016 859 501 1330
NM_014245chr33953 935 920 1180 1818 --
NM_014250chr2281639 1418 1306 640 603 410 281 80 ------
NM_014253chrX1500 ------
NM_014263chr1021305 1092 11198 ----
NM_014264chr4--195 ----
NM_014267chr11139 ------
NM_014268chr1821177 951 ------
NM_014271chrX1304 1703 ----
NM_014280chr11794 ------
NM_014286chr952915 2310 720 289 64 23461 434 12592 12869
NM_014289chrX31437 1094 1081 11069 ----
NM_014292chr2241671 689 373 112 11498 11289 --
NM_014299chr1941972 1502 1389 36 1125 ----
NM_014300chr151324 ------
NM_014309chr2233291 1946 1886 31870 743 703 15407 11051
NM_014317chr10180 ------
NM_014319chr1231575 1493 457 ----11588
NM_014331chr477775 6720 5184 5018 4860 2105 1508 21081 508 --25498 2390
NM_014333chr1122080 1015 1427 22366 2332 --
NM_014338chr224717 410 324 259 --1104 --
NM_014342chr1141392 1054 580 310 ------
NM_014363chr13176 ------
NM_014368chr931903 298 52 ------
NM_014369chr22335 120 --11197 1529
NM_014372chr121435 1384 --1533 --
NM_014379chr81139 197 ----
NM_014386chr5132 ------
NM_014390chr7----1120 --
NM_014393chr832061 505 166 2950 337 --2631 44
NM_014394chr1011092 11005 1153 --
NM_014396chr741818 1809 1636 310 12265 22040 852 --
NM_014397chr95907 244 140 46 21 ------
NM_014399chr72869 676 ------
NM_014405chr1722132 727 32213 2115 767 21494 245 --
NM_014408chr11528 ------
NM_014417chr192589 317 --1757 --
NM_014421chr411690 2741 349 ----
NM_014423chr533830 1856 1423 11892 ----
NM_014431chr104679 608 558 487 1371 11590 --
NM_014445chr341652 976 873 131 ----1109
NM_014447chr421584 665 ------
NM_014454chr61191 ------
NM_014458chr11115 ------
NM_014470chr124712 559 330 303 ------
NM_014472chr101637 2646 59 ----
NM_014482chr21110 ------
NM_014491chr72371 22 ------
NM_014494chr162942 420 32127 1620 36 11938 --
NM_014500chrX----156 --
NM_014502chr11238 32 ------
NM_014504chr762012 1337 805 641 239 166 ------
NM_014507chr223795 397 59 11208 --11176
NM_014515chr121169 --156 --
NM_014521chr241744 1473 1368 636 1609 1687 --
NM_014554chr1261812 827 631 377 300 265 1177 ----
NM_014563chrX5829 696 279 166 110 11815 21400 365 --
NM_014570chr223330 300 67 ------
NM_014572chr1321745 1467 ------
NM_014574chr14----1378 --
NM_014584chr1421273 391 11041 --11088
NM_014588chr20194 ------
NM_014603chr1761373 1250 1182 529 304 52 21290 312 1602 --
NM_014613chr542632 2314 643 158 --11082 --
NM_014614chr23166 55 24 ----2311 260
NM_014615chr1673036 2837 2714 2457 696 439 399 22727 1350 33496 775 468 12895
NM_014623chr61195 ------
NM_014636chr9144276 4199 3838 3440 3115 2739 2693 1677 1659 1091 699 317 162 144 23786 29 1800 1446
NM_014640chr22277 246 ------
NM_014646chr1852462 2401 2363 708 498 2415 82 ----
NM_014647chr1641719 1676 632 405 --1906 --
NM_014653chr1221735 775 1665 1551 --
NM_014659chr151446 191 ----
NM_014663chr141124 1011 331 28 ------
NM_014665chr853490 2375 2288 1097 809 --21373 421 --
NM_014666chr5--1193 ----
NM_014667chr332459 661 326 --1258 --
NM_014670chr23423 60 21 1641 ----
NM_014671chr741543 624 467 291 ------
NM_014674chr393415 2992 2740 2602 1470 1117 707 166 21 1315 1468 --
NM_014676chr111229 --1604 --
NM_014678chr223575 230 191 ------
NM_014679chr113399 134 80 ------
NM_014680chr172186 131 ------
NM_014682chr822046 1735 ------
NM_014683chr1752071 1863 1659 809 187 1281 ----
NM_014686chr1952188 2106 1717 852 241 1102 11861 --
NM_014689chr2------1135
NM_014690chr772119 2110 1157 1129 1068 493 350 --23060 575 --
NM_014701chr1551292 736 713 640 66 32166 2130 843 22649 360 --
NM_014705chr7------1700
NM_014709chr21185 --190 --
NM_014712chr161469 --2153 77 --
NM_014717chr192846 57 ------
NM_014720chr1021619 107 179 ----
NM_014721chr697250 6671 6237 5874 5527 5379 5363 5152 5034 26410 1512 --27051 860
NM_014726chr17--31040 1026 415 11162 --
NM_014729chr81650 --1291 --
NM_014730chr1274121 3803 3479 1914 1621 1416 761 54046 3493 1116 690 448 44621 1836 1589 198 --
NM_014730chr1274121 3803 3479 1914 1621 1416 761 54046 3493 1116 690 448 44621 1836 1589 198 --
NM_014731chr2011320 11240 --1606
NM_014733chr5----1673 --
NM_014735chrX11977 --11863 --
NM_014741chr1171538 1434 1403 1367 674 485 260 11993 21928 1519 --
NM_014742chr2071525 1490 1233 534 401 393 240 138 2624 452 --
NM_014743chr43818 394 61 22013 386 ----
NM_014746chr2134021 3921 3764 3361 3343 2925 2874 1452 955 813 615 119 100 32735 929 398 43226 2792 1530 921 13676
NM_014751chr841385 854 686 659 --12172 --
NM_014755chr222610 421 2667 214 11362 --
NM_014756chr11----176 --
NM_014757chr521749 173 21566 55 11876 --
NM_014758chr1161741 1585 1567 827 611 444 12045 1862 --
NM_014759chr851357 1259 1117 299 217 11275 11646 --
NM_014764chr1221024 47 ------
NM_014765chr152688 2204 1073 1050 30 ------
NM_014767chr10123610 3448 3191 3172 3105 3089 2723 2652 2584 2254 1335 779 ----1626
NM_014772chr1833358 3331 369 32985 407 353 22797 629 --
NM_014774chr142757 2451 730 374 12244 ----
NM_014776chr1282578 2457 2117 2108 1940 984 579 189 21114 78 ----
NM_014781chr81157 --1515 --
NM_014784chr13230 210 44 1339 ----
NM_014786chr1161125 1108 993 894 825 45 ------
NM_014795chr21546 ------
NM_014798chr1731308 713 618 31799 1708 128 11351 --
NM_014800chr72202 130 --1216 --
NM_014802chr121218 ------
NM_014803chr1072198 1135 1042 732 705 374 92 144 ----
NM_014810chr142821 1469 1370 821 --13051 12735
NM_014813chr11450 164 ----
NM_014819chr52950 737 ------
NM_014822chr41147 ------
NM_014826chr194221 3550 3452 1380 1273 1264 866 689 363 1161 ----
NM_014827chr111444 --1675 --
NM_014828chr1451998 1584 978 144 96 ------
NM_014829chr531899 925 842 ------
NM_014832chr1312048 138 ----
NM_014835chr2041669 316 209 76 ----1752
NM_014838chr2282798 2743 2319 2006 1851 172 157 117 21830 1062 2946 804 22785 2755
NM_014839chr1188 11790 ----
NM_014840chr1232853 2596 125 32927 1172 332 12404 --
NM_014841chr61184 ------
NM_014847chr1148 --1137 --
NM_014850chr344105 4046 3809 3241 24561 522 --14661
NM_014851chr152610 2323 1966 1671 642 32465 880 538 128 --
NM_014853chr1721024 556 1192 21437 223 11487
NM_014870chr1104477 3421 2869 1439 1408 1062 983 526 491 132 --13429 33284 1663 296
NM_014871chr121534 --1420 --
NM_014873chr174651 4026 1892 1450 1432 1417 1267 13059 11315 --
NM_014876chr2261728 1440 785 677 473 39 21479 122 2684 30 --
NM_014877chr1777276 6995 6292 5998 5250 5230 2558 45431 2893 2858 1618 37716 6151 6017 25421 5006
NM_014883chr472427 955 659 648 635 584 577 ----1165
NM_014891chr741159 1114 523 516 --11673 --
NM_014893chrY21736 743 ------
NM_014897chr1773124 2761 2709 2678 1104 1078 83 191 12576 1781
NM_014898chr1942027 2013 717 96 11912 ----
NM_014900chr22748 204 142 1410 --
NM_014902chr2011519 1474 1521 --
NM_014903chr1252010 1607 936 827 819 --1463 --
NM_014904chr1063612 2835 2488 673 329 247 2378 308 1407 --
NM_014906chr1752846 1605 817 308 95 1584 --11166
NM_014909chr1453887 3397 617 419 69 13659 22866 2458 --
NM_014912chr1011037 1830 170 11353
NM_014913chr184999 413 135 102 ------
NM_014918chr1541601 1442 606 500 11428 ----
NM_014920chr681441 1272 1257 1229 1009 811 504 56 33606 2360 714 ----
NM_014921chr1932757 149 125 --11903 12584
NM_014923chr1321951 696 ------
NM_014932chr331972 1877 1219 11316 1486 --
NM_014934chr1363683 3260 3232 2980 2591 95 23808 276 13314 --
NM_014935chr193747 3651 2865 1425 1353 1223 1128 1060 189 22441 775 51462 965 875 516 314 13682
NM_014938chr122261 238 22052 592 22004 100 --
NM_014939chr1831090 624 453 ------
NM_014945chr531939 601 546 --11571 --
NM_014946chr233033 2409 2030 13066 ----
NM_014947chr112334 --31161 1026 391 --
NM_014949chr13688 419 30 1231 ----
NM_014951chr1031882 585 479 32347 2201 2057 11044 --
NM_014952chr1561768 1506 1377 839 453 215 ----11562
NM_014962chr2032121 432 297 1591 ----
NM_014964chr1752374 2089 845 301 190 22064 162 ----
NM_014969chr11256 ------
NM_014974chr101233 11552 ----
NM_014978chr1021386 1316 1646 ----
NM_014982chr1443550 1989 1242 791 2871 599 14764 --
NM_014989chr62539 167 ------
NM_014990chr142515 214 ------
NM_014991chr432572 919 789 ------
NM_014992chr14--1731 ----
NM_014994chr1562337 2330 2185 923 768 192 --11511 --
NM_014996chr32919 273 1331 ----
NM_014997chr762863 2156 2010 1112 1085 113 ------
NM_015002chr1242027 843 297 89 ----1365
NM_015008chr353682 3640 3449 2518 803 ------
NM_015012chr112147 44 ------
NM_015017chr14470 452 437 288 --1336 --
NM_015020chr1653643 3466 3313 2860 338 1743 2387 219 --
NM_015023chr171769 1275 1245 1154 471 346 298 --1316 11287
NM_015026chr1233296 1055 683 13759 11423 --
NM_015027chr1621572 113 ------
NM_015032chr1332590 1936 671 1566 ----
NM_015033chr962184 1187 1172 530 357 319 --42273 1205 1070 23 --
NM_015035chr20146688 6559 6171 5846 5544 5117 4261 4115 4058 2201 1888 1807 669 170 24176 1938 ----
NM_015039chr174122 3944 3375 2683 1575 1492 680 23574 859 23522 617 --
NM_015042chr1583706 3665 2741 1000 541 243 200 35 21347 1247 2940 314 11291
NM_015044chr1653235 2666 775 726 446 --42828 2822 738 332 21132 673
NM_015045chr1022167 1857 22005 50 ----
NM_015050chr611237 11123 ----
NM_015051chr952888 2790 2526 1064 1024 13114 12879 --
NM_015052chr72252 188 11325 ----
NM_015053chr182240 2154 1940 1765 1726 1455 813 155 1133 ----
NM_015057chr131643 ------
NM_015059chr15113871 3625 3469 3350 3341 2970 2946 869 827 421 234 33380 911 312 1245 --
NM_015063chr193970 879 511 --1484 1433
NM_015064chr1272941 2710 2677 1454 1052 963 299 --1233 --
NM_015068chr761414 1247 1097 684 505 101 3989 710 572 --11364
NM_015071chr566286 4035 2089 1272 473 177 1329 14535 11574
NM_015073chr1941693 1622 147 39 31832 1776 1489 3525 367 211 --
NM_015074chr184591 4291 4119 3423 3175 1988 1861 798 13439 1928 24915 1351
NM_015075chrX62277 1643 1457 1430 657 541 --21631 422 --
NM_015076chr653603 3208 2967 1694 283 --12850 --
NM_015079chr1542963 2318 355 323 12169 32843 2755 563 1597
NM_015084chr52401 29 --31062 488 87 --
NM_015090chr1136112 5695 5558 5420 4827 4505 4262 2471 2291 1337 1155 192 101 45438 3951 2229 1533 44821 1987 621 317 11599
NM_015092chr1614704 --167 --
NM_015093chr621730 167 1488 ----
NM_015094chr2293899 3701 3611 3564 2834 1789 1737 1722 379 23537 3396 44116 4027 846 837 23881 1665
NM_015097chr342158 1868 1666 169 ------
NM_015100chr1----11868 --
NM_015102chr11105 ------
NM_015110chr931926 897 201 --32147 2013 1865 --
NM_015115chr432909 2803 2683 ------
NM_015132chr731757 1720 112 11664 ----
NM_015138chr1522470 2082 --11825 --
NM_015143chr431107 210 25 ----11289
NM_015149chr112067 --11848 --
NM_015153chr6--1630 ----
NM_015155chr1093255 3144 3050 2786 1322 1140 1034 885 472 ------
NM_015156chr142244 157 23432 3157 --22540 339
NM_015157chr1141081 1067 1008 732 --1236 1332
NM_015158chr9------1829
NM_015162chr152192 78 ------
NM_015170chr811554 --12330 --
NM_015172chr131022 508 244 ------
NM_015173chr451444 1214 438 107 49 --1380 --
NM_015176chr111524 11660 11426 --
NM_015178chr832309 1657 820 2736 526 ----
NM_015185chrX73020 2473 2180 964 641 593 567 --11867 --
NM_015191chr1112707 1671 ----
NM_015199chr332620 962 38 22176 2009 11148 --
NM_015200chr412296 32319 1785 110 ----
NM_015205chr1384126 4105 4030 1460 781 125 66 40 11505 15277 --
NM_015206chr1563741 3628 3434 2656 2462 1074 ------
NM_015208chr1842844 2784 629 450 12817 ----
NM_015215chr152490 815 494 315 23 ------
NM_015219chr1732097 1604 637 12297 22103 664 --
NM_015225chr943161 2331 416 212 22989 299 22972 233 --
NM_015230chr431750 1385 452 ------
NM_015231chr112740 217 1676 ----
NM_015233chr1321089 655 1850 11790 12484
NM_015236chr411450 2236 136 ----
NM_015239chr9--1462 ----
NM_015245chr662803 2685 2099 425 107 80 12211 --1630
NM_015247chr1645331 4474 1748 1025 34588 2021 125 --14948
NM_015250chr921814 1497 --2447 404 --
NM_015251chr1642323 2016 1976 1542 ------
NM_015252chr22789 194 1609 ----
NM_015254chr872775 2495 2341 956 325 217 202 11111 12297 --
NM_015256chr52729 23 1520 ----
NM_015264chr2294334 4284 4176 3172 3085 1794 1035 714 475 31914 941 47 44352 1691 1359 765 14391
NM_015265chr221042 587 ------
NM_015267chr121806 ------
NM_015269chr1164 ----1403
NM_015271chr443861 3250 1255 702 21655 1014 ----
NM_015272chr1641469 439 211 35 12098 ----
NM_015275chr1232046 732 532 1300 11890 --
NM_015277chr1821325 424 ------
NM_015278chr673481 2228 1338 993 728 664 597 --43324 2945 2712 1370 --
NM_015282chr272669 2625 2542 2211 2165 1022 415 154 1975 --
NM_015284chr162094 2039 2001 1783 1644 1403 --21754 854 --
NM_015285chr1842391 2278 1919 157 ------
NM_015288chr543311 2511 1166 1091 13397 22994 53 --
NM_015291chr162964 2268 1364 1283 1207 1170 2807 33 ----
NM_015292chr123284 115 65 ------
NM_015293chr62243 107 ----1161
NM_015299chr1483739 3722 3422 3246 3062 894 214 184 --52779 2714 679 538 234 --
NM_015305chr1451772 1471 1360 1333 396 --11265 --
NM_015310chr8107015 6260 5982 5782 5706 5651 3161 3110 2774 542 32435 1523 1482 45497 2366 2087 1189 --
NM_015314chr751959 1853 1653 482 126 12539 ----
NM_015315chr583175 2231 2188 1319 1202 965 920 466 --22745 2271 --
NM_015316chr1441396 1177 1055 1036 ------
NM_015317chr222281 2222 12248 ----
NM_015320chr22810 280 ------
NM_015326chr172691 2515 2484 2159 1160 1131 89 1336 32678 1188 326 --
NM_015327chr111131 --31177 1117 265 --
NM_015328chr742522 2011 407 299 32487 2340 834 12555 --
NM_015329chr1972407 2298 2125 963 838 591 262 21862 251 1279 --
NM_015335chr123591 139 52 1102 ----
NM_015336chr1242423 1750 927 887 --11640 --
NM_015339chr20------1184
NM_015344chr8--1560 --11370
NM_015345chr642519 2033 1029 933 12156 1258 12721
NM_015347chr1252225 2155 681 146 102 --1190 --
NM_015349chr642893 2799 2230 552 ----12543
NM_015355chr17--11339 ----
NM_015365chrX43465 2683 739 466 --1294 --
NM_015375chr174834 4436 3526 969 721 520 276 24617 1666 23851 3576 1240
NM_015378chr172859 2535 2316 2223 1818 817 71 22052 626 12101 --
NM_015379chr7----189 --
NM_015382chr141298 1291 ----
NM_015393chr453348 3149 2751 654 636 1478 ----
NM_015396chr321390 68 2410 193 ----
NM_015397chr931831 310 46 1386 ----
NM_015399chr112483 99 2510 32 1367 --
NM_015404chr9170 ------
NM_015435chr821001 445 ------
NM_015439chr6----1400 --
NM_015441chr1------1299
NM_015443chr17--11453 --154
NM_015446chr11336 ------
NM_015447chr92780 182 ------
NM_015453chr33837 804 453 ------
NM_015455chr543338 1247 707 700 23294 1372 ----
NM_015458chr874685 3391 1864 1832 1753 1517 71 44232 3727 1773 1122 --15274
NM_015460chr33703 571 180 --1210 1174
NM_015463chr2172 1744 ----
NM_015465chr53665 532 72 --1286 --
NM_015470chr231005 256 136 --11215 --
NM_015477chr152718 102 ----1890
NM_015481chr125971 798 758 254 201 ----1176
NM_015483chr711082 ------
NM_015488chr281340 1295 1236 1160 465 451 363 225 --1629 --
NM_015496chr81306 --1331 --
NM_015497chr151809 ----1893
NM_015508chr311122 --11331 --
NM_015514chr144579 415 124 78 ------
NM_015520chr321867 691 ------
NM_015525chr6--1179 1994 --
NM_015526chr1921321 229 2523 256 ----
NM_015534chr11383 ------
NM_015535chr273902 3148 1107 1092 785 770 168 21527 1342 13768 --
NM_015541chr31376 --1533 --
NM_015542chr102988 95 ----11234
NM_015548chr61127 ------
NM_015553chr6124844 4732 4722 4417 4249 3623 3429 3232 1752 1712 1608 560 21933 1385 24148 3375 --
NM_015554chr1562636 2552 2477 1895 242 26 11838 32106 631 63 --
NM_015565chr211443 ------
NM_015567chr1321286 130 11166 ----
NM_015568chr2093477 3188 3087 3001 1737 1309 1119 479 143 32862 1659 1134 ----
NM_015569chr121878 642 23876 355 11826 --
NM_015570chr721805 411 ----11591
NM_015571chr632014 952 358 32642 2369 1789 12301 --
NM_015575chr223357 128 3985 824 193 23390 2524 12963
NM_015576chr342969 2518 743 448 12633 --1912
NM_015577chr51561 21616 229 11438 1175
NM_015578chr192753 279 ------
NM_015584chr173953 502 457 21314 163 1359 --
NM_015589chr14171 ------
NM_015601chr101893 ------
NM_015602chr121266 457 1251 ----
NM_015609chr132579 1057 883 ----12483
NM_015610chr772344 2075 1078 1033 490 187 47 11131 32683 2014 1067 22358 2058
NM_015626chr172930 792 --1326 --
NM_015635chr922097 1531 --21617 1404 --
NM_015638chr201493 1242 1198 --
NM_015640chr144032 3279 1940 1595 --14077 --
NM_015642chr32258 240 1229 ----
NM_015657chr2243 24 ------
NM_015686chrX42305 1843 859 501 12008 21721 190 --
NM_015691chrX42969 2715 2660 2087 --32120 777 741 --
NM_015695chr661898 844 665 612 374 223 ------
NM_015832chr18----151 --
NM_015845chr182280 201 ------
NM_015850chr851962 1823 898 458 421 ------
NM_015855chr112672 587 ------
NM_015866chr111153 1293 ----
NM_015878chr822099 890 ------
NM_015879chr18118583 8363 8325 6777 5754 5376 5250 5195 3299 1726 633 76461 5641 3433 2414 2326 943 69 ----
NM_015881chr112478 185 ------
NM_015885chr111125 ------
NM_015898chr1931537 807 551 21004 187 12299 11829
NM_015902chr82740 721 ------
NM_015906chr144470 3502 3197 3088 11170 ----
NM_015912chr842312 1675 998 100 ------
NM_015975chrX31613 1466 184 ------
NM_015981chr572448 2188 611 588 566 525 248 3873 720 182 22194 290 --
NM_015990chr421072 906 ------
NM_015995chr15135005 4431 3911 3892 3589 1036 689 675 652 595 302 251 125 21692 1190 45183 5061 4741 3780 --
NM_015999chr12562 231 --1139 --
NM_016003chr772344 2075 1078 1033 490 187 47 11131 32683 2014 1067 22358 2058
NM_016009chr174212 3634 3278 3232 3203 1961 268 21828 1743 13174 --
NM_016018chr841024 938 467 40 32816 908 286 ----
NM_016021chr661909 1129 934 537 218 40 33012 2399 2290 ----
NM_016023chr81536 11906 ----
NM_016025chr162738 719 125 1567 1636
NM_016032chrX2462 339 2931 893 31129 1070 268 --
NM_016045chr201409 ------
NM_016057chr123893 512 90 1336 1962 --
NM_016059chr61331 1793 ----
NM_016061chr241638 1016 385 79 11112 11384 1439
NM_016072chr1242257 1999 813 696 1312 ----
NM_016073chr1511148 ------
NM_016076chr152971 2613 1292 1074 800 --12827 1462
NM_016083chr61247 --13805 --
NM_016096chr851819 453 372 156 57 --21442 546 151
NM_016097chr181340 ----1967
NM_016098chr61174 ------
NM_016103chr52456 28 ------
NM_016107chr5121 --21390 356 --
NM_016121chr11994 ------
NM_016129chr41315 ------
NM_016131chr231796 1527 515 ------
NM_016133chr21186 180 ----
NM_016141chr32748 556 1103 ----
NM_016142chr1121033 338 11320 11181 --
NM_016152chr3141 ------
NM_016162chr121218 ----1802
NM_016185chr173829 785 339 ------
NM_016194chr1541467 1132 291 196 21627 1434 ----
NM_016201chr34579 495 239 63 ------
NM_016203chr73673 359 66 ------
NM_016205chr43124 106 94 ------
NM_016206chr378958 6294 6144 2768 2143 1395 672 1509 17500 27972 1798
NM_016218chr531229 1033 489 1126 ----
NM_016221chr552360 1878 1779 1685 77 11933 ----
NM_016235chr1641474 1033 1015 107 --1974 --
NM_016252chr21290 ------
NM_016255chr673357 2912 2638 2534 2246 928 919 ------
NM_016257chr142683 1094 997 506 23152 2699 21015 623 --
NM_016258chr11735 1108 ----
NM_016260chr267549 5615 2560 1480 1258 744 57590 7199 5900 1174 480 ----
NM_016263chr1951085 585 217 151 61 --13236 1685
NM_016270chr191330 ------
NM_016271chr1842090 2032 859 853 ----1747
NM_016272chr2272145 2124 1933 1870 1826 1794 516 ------
NM_016281chr121443 ------
NM_016284chr162643 43 --1947 --
NM_016289chr241635 758 575 422 1915 ----
NM_016297chr292686 2313 1286 1064 899 828 563 350 320 11363 --22393 993
NM_016319chr121593 169 ----
NM_016322chr962784 2149 1053 551 342 73 12594 ----
NM_016338chr551030 888 865 856 391 ------
NM_016340chr531196 1159 1088 ------
NM_016351chr7--198 ----
NM_016356chr652737 1954 1939 957 531 12567 ----
NM_016357chr1221000 25 ------
NM_016374chr11465 ------
NM_016374chr11465 ------
NM_016376chr17103451 3173 2987 2750 906 743 704 620 403 219 12912 34384 1028 1004 --
NM_016396chr1532619 1038 544 2874 176 ----
NM_016422chr1132870 2547 1108 13057 ----
NM_016424chr17--123 1210 --
NM_016436chr2042312 540 465 116 ------
NM_016441chr221671 1622 1505 ----
NM_016442chr521545 268 1893 ----
NM_016448chr121787 1501 ------
NM_016472chr1451475 1448 1404 509 452 ------
NM_016485chr64692 265 168 67 ------
NM_016490chr21244 --2313 39 --
NM_016492chr17--1130 ----
NM_016505chr11694 ------
NM_016506chr113444 285 246 1279 1122 --
NM_016507chr1722813 239 12069 ----
NM_016513chr681441 1272 1257 1229 1009 811 504 56 33606 2360 714 ----
NM_016521chrX----129 --
NM_016525chr92316 268 1962 ----
NM_016529chr131947 11215 1128 --
NM_016530chr1563813 1525 1436 935 607 160 33387 2766 590 --180
NM_016532chr171276 2956 888 1382 --
NM_016542chrX1393 ------
NM_016574chr11162 ----1958
NM_016577chr344304 3575 1733 767 23992 1598 43551 2856 1092 493 --
NM_016582chr11129 ------
NM_016592chr2021247 1123 ------
NM_016603chr531995 1777 735 11467 ----
NM_016605chr552084 1885 708 689 340 21736 398 21675 466 --
NM_016607chrX2542 397 ------
NM_016621chr1164526 4370 3827 3442 2827 611 43220 3040 1644 1543 ----
NM_016631chr212727 265 1156 ----
NM_016655chr15197 ------
NM_016823chr1731332 1252 287 ------
NM_016824chr102365 289 ------
NM_016831chr132154 468 344 1388 11879 --
NM_016834chr17133929 3889 3866 3772 3449 3329 3030 2994 2593 1358 1252 1238 286 1825 12687 --
NM_016835chr17133929 3889 3866 3772 3449 3329 3030 2994 2593 1358 1252 1238 286 1825 12687 --
NM_016836chr21612 ------
NM_016839chr21612 ------
NM_016841chr17133929 3889 3866 3772 3449 3329 3030 2994 2593 1358 1252 1238 286 1825 12687 --
NM_016929chr6114498 4142 3665 3265 1765 1587 1200 945 604 118 66 1340 1530 --
NM_016936chr1621391 126 2578 383 22042 1895 --
NM_016937chrX1117 1395 1351 --
NM_016938chr111404 --1138 --
NM_016946chr153353 2308 1254 94 39 --23220 2206 --
NM_016953chr2105861 5511 4517 3948 3796 2355 1779 1661 1164 972 --14438 15254
NM_016954chrX3480 229 148 ------
NM_017412chr811102 21385 433 ----
NM_017413chrX52257 1965 1840 319 83 --1655 --
NM_017414chr222178 130 123 ----
NM_017415chr564061 1559 1136 799 737 678 23155 821 23435 831 1927
NM_017420chr1463610 2567 710 626 546 531 ------
NM_017437chr1422221 2206 --12105 1335
NM_017447chr2183687 3060 1479 1401 1371 865 815 325 --11681 --
NM_017449chr131654 1177 477 11427 ----
NM_017451chr1731063 1009 82 2973 697 1153 --
NM_017455chr151133 --1188 --
NM_017456chr1721299 1289 --1134 1687
NM_017488chr241434 1268 1086 142 11462 ----
NM_017495chr2031348 1092 323 --2937 97 --
NM_017510chr51540 1269 ----
NM_017514chrX4817 753 723 33 ------
NM_017519chr611072 1452 ----
NM_017522chr13982 975 27 ------
NM_017544chrX1100 1232 ----
NM_017551chr1042178 2170 835 474 12673 ----
NM_017553chr152477 176 ------
NM_017563chr385971 5506 5262 4895 4853 1260 710 101 26379 805 24040 3905 22127 1193
NM_017575chr1741206 1044 315 293 1437 --11484
NM_017577chr33314 231 178 ------
NM_017581chr43434 368 133 ------
NM_017582chr1------11407
NM_017589chr111100 ------
NM_017590chr2242684 2510 2219 833 2677 668 2533 290 --
NM_017594chr932462 2353 704 1836 ----
NM_017596chr1164527 3951 3761 3726 3685 3481 2900 2855 1828 1527 1302 1216 1043 896 764 255 ------
NM_017599chr1231972 1370 60 ------
NM_017607chr19----1403 1104
NM_017610chr1521720 1305 ------
NM_017622chr173617 607 66 --1163 --
NM_017626chr1031595 1421 398 ------
NM_017628chr465287 2022 1820 1667 1192 386 2552 163 1800 --
NM_017629chr141799 435 97 48 ------
NM_017633chr673339 3138 2690 2630 1117 901 423 ------
NM_017634chr8--21541 758 ----
NM_017637chr957952 7403 3130 2600 893 37123 2274 1220 36023 5905 1730 11952
NM_017638chr12853 190 ------
NM_017644chr384843 4487 4081 3899 3731 3309 1197 1006 14542 13776 14361
NM_017650chr764910 4051 3816 958 676 516 11779 44323 4247 4084 1548 13826
NM_017651chr62623 492 176 ----
NM_017657chr21361 ------
NM_017658chr1464350 4298 3556 2993 780 462 ------
NM_017660chr1942964 2322 1307 200 22906 2745 12981 --
NM_017661chr1521182 261 1850 ----
NM_017666chrX21555 762 2578 280 11415 --
NM_017686chr111086 --1987 1435
NM_017694chr221509 46 ------
NM_017697chr82411 168 128 ----
NM_017700chr4281 35 ------
NM_017709chr143267 1498 420 55 11484 ----
NM_017714chr20--1941 --130
NM_017719chr312020 ------
NM_017728chr1762428 1980 945 842 783 303 2558 461 22608 1152 --
NM_017730chr32612 199 ------
NM_017736chr1642581 943 650 631 ------
NM_017737chr13878 760 752 ------
NM_017741chr432343 449 91 --12445 --
NM_017742chr1831523 1373 454 1242 --1786
NM_017744chr132195 1967 882 11741 1946 --
NM_017752chrX11429 21620 1335 --1847
NM_017753chr921021 320 ------
NM_017754chr6124885 4812 4796 4502 4217 3973 3836 3545 3384 3277 951 393 ----23463 3219
NM_017762chr1522018 760 1537 ----
NM_017769chr1423006 650 --12082 --
NM_017772chr641582 1325 404 305 11344 11627 --
NM_017778chr821278 517 ----11371
NM_017787chr1052370 2055 2038 1039 420 12308 12845 --
NM_017799chr1442014 1713 1685 1359 ------
NM_017801chr342029 1978 953 559 11656 ----
NM_017811chr962641 2626 285 152 85 40 --33031 2522 667 --
NM_017813chr885203 5089 4895 3885 2191 2173 195 67 35730 1128 956 22054 1618 --
NM_017824chr1012020 22244 381 ----
NM_017830chr43996 202 45 ------
NM_017842chr122678 666 ------
NM_017845chr42822 254 ------
NM_017848chrX44558 2972 1721 242 1174 14600 --
NM_017849chr293174 2754 2508 2341 1040 953 620 92 26 21202 176 22389 1072 12234
NM_017851chr15275 44 11029 ----
NM_017857chr117663 479 195 180 153 126 96 ------
NM_017866chr811071 1782 ----
NM_017873chr9102721 2710 2657 2390 2334 2305 2228 2125 1970 897 --53037 1194 784 650 335 --
NM_017902chr10185693 5580 4786 4757 4370 4261 4182 4063 3951 3813 2088 1983 1427 1270 1116 427 406 57 24872 4555 35636 5151 435 14095
NM_017907chr11174 ----1346
NM_017911chr2231183 428 250 --1516 --
NM_017915chr121783 11012 ----
NM_017919chr965502 4875 4721 4106 1926 1401 25151 4188 ----
NM_017925chr951530 1511 1470 686 268 ------
NM_017933chr221386 364 ------
NM_017935chr41177 1129 ----
NM_017938chrX2653 346 11949 155 --
NM_017944chr1152370 949 887 874 351 1632 --12285
NM_017945chr31233 11271 --1882
NM_017964chr21700 ------
NM_017988chr122675 223 ------
NM_017994chr752833 2649 2573 1210 846 21977 1036 12851 --
NM_018004chr31308 ------
NM_018011chr13158 ------
NM_018014chr221161 928 11076 ----
NM_018027chr1051320 558 214 174 133 ------
NM_018028chr191878 ------
NM_018032chr162730 107 ------
NM_018036chr1444041 3984 3876 106 23379 3300 --23277 72
NM_018045chr182930 2817 2483 2410 524 356 114 77 1646 22638 619 --
NM_018047chr53843 836 813 ------
NM_018053chr14883 786 655 555 --1765 --
NM_018054chr162600 122 2531 474 ----
NM_018056chr1----138 --
NM_018063chr102354 162 ------
NM_018064chr61229 ------
NM_018067chr11190 --1505 --
NM_018078chr4128 1283 ----
NM_018084chr252963 2084 533 62 54 ----12525
NM_018085chr1106378 2300 2196 2118 1874 824 605 541 516 492 25212 3197 67179 2832 2496 936 353 128 --
NM_018086chr241566 1410 709 384 ------
NM_018092chr162502 157 11643 11690 --
NM_018095chr113444 285 246 1279 1122 --
NM_018105chr81935 1231 ----
NM_018111chr19--265 33 ----
NM_018113chr12188 --2487 208 --
NM_018116chr13634 550 450 2540 471 ----
NM_018120chr821141 249 --1360 --
NM_018121chr1033216 2702 2056 12097 ----
NM_018126chr431500 1095 462 ------
NM_018128chr173991 369 280 --1155 --
NM_018131chr101872 ------
NM_018133chr31202 1432 ----
NM_018137chr131290 469 250 11278 ----
NM_018156chr172859 2535 2316 2223 1818 817 71 22052 626 12101 --
NM_018157chr1242980 2589 2538 656 1609 --1554
NM_018168chr1461464 1003 485 426 231 193 ----1403
NM_018171chr122769 650 ------
NM_018176chr411269 11457 ----
NM_018178chr141999 1979 1370 144 1431 11791 --
NM_018179chr121635 ------
NM_018181chr183692 589 476 ------
NM_018182chr1731970 1514 323 ------
NM_018184chr332002 1497 1357 ------
NM_018189chr37722 628 552 520 371 334 295 --1419 --
NM_018195chr11----11936 --
NM_018200chr1542619 674 303 256 ------
NM_018201chr972442 2177 914 741 691 598 468 --2330 310 --
NM_018205chr1042217 1982 1851 534 --12352 --
NM_018206chr161163 ------
NM_018208chr13891 416 54 --1390 --
NM_018211chr1166 ----1362
NM_018214chr631148 158 76 ------
NM_018221chr2136 ------
NM_018234chr242173 1666 1527 864 ------
NM_018239chr1042217 1982 1851 534 --12352 --
NM_018241chr41812 --1411 --
NM_018243chr463782 3130 2896 1229 1161 853 1966 23610 365 --
NM_018247chr62900 823 ----12912
NM_018254chr132086 1901 1558 1896 ----
NM_018263chr242547 2510 2128 550 1116 11898 --
NM_018270chr203599 143 135 ------
NM_018275chr7----1432 --
NM_018286chr171822 ------
NM_018290chr41296 1454 ----
NM_018293chr352949 2178 1195 328 97 12343 --12312
NM_018299chr832193 1334 1217 13221 ----
NM_018302chr442398 505 476 111 1877 12458 --
NM_018312chr1141940 1746 1613 1485 --11714 --
NM_018315chr441351 235 218 108 ------
NM_018316chr1911081 1829 ----
NM_018318chr122967 839 ------
NM_018320chr114816 804 280 49 --1392 --
NM_018323chr42736 466 ------
NM_018334chr73203 182 141 ------
NM_018348chr162848 129 ----1904
NM_018351chr1274199 4132 4008 3416 1302 1097 540 23654 3575 13970 --
NM_018358chr31113 147 ----
NM_018361chr844078 2556 2535 1148 --12931 11301
NM_018362chr1163466 3239 2772 1410 964 473 --23417 3282 11466
NM_018364chr1----13928 --
NM_018373chr1486207 5482 4594 2209 1308 1175 699 679 26259 1044 25530 4269 11260
NM_018374chr744857 3632 3601 1861 13499 ----
NM_018375chr1441588 280 94 82 ------
NM_018387chr91344 ------
NM_018400chr1164269 4223 3533 1738 1247 1025 54365 3910 3815 3686 1826 21112 944 --
NM_018403chr3123920 3520 3510 2718 2594 1387 819 571 365 318 159 56 ----141
NM_018416chr1242599 2503 2135 183 --12284 --
NM_018433chr22397 50 ------
NM_018436chr21104 ------
NM_018440chr896738 5718 5544 5415 3204 3033 2329 876 290 12669 38214 7644 6585 --
NM_018444chr822380 1863 ------
NM_018445chr15166 ------
NM_018446chr3283 34 ------
NM_018448chr1231221 876 99 ------
NM_018452chr6_random21517 147 --22723 751 --
NM_018457chr123526 126 32 --1580 161
NM_018460chr21113 ------
NM_018469chr171375 ------
NM_018482chr862616 1735 619 563 210 125 1986 11825 1196
NM_018489chr11228 1342 ----
NM_018509chr1731681 1233 166 1499 ----
NM_018555chr1972154 1994 1985 882 830 725 127 ------
NM_018566chr193884 1815 1356 1257 1090 971 921 817 685 11272 ----
NM_018569chr41393 1637 ----
NM_018571chr21518 ------
NM_018584chr1----1292 --
NM_018590chr1021339 58 ------
NM_018638chr1225492 3813 11529 25247 1320 15316
NM_018640chr1242385 2238 1974 1857 ----11968
NM_018650chr1--1850 11608 --
NM_018652chr152805 342 ------
NM_018657chr31268 ------
NM_018660chr833012 2629 78 22020 623 22699 1939 1893
NM_018662chr194249 3945 3685 3416 3396 3381 3358 2784 300 1492 13279 --
NM_018667chr1652486 2309 2274 458 172 12396 12173 --
NM_018685chr73999 390 245 ------
NM_018689chr1552255 2126 458 412 283 12358 ----
NM_018691chr531047 772 151 ------
NM_018698chrX2619 203 --11734 --
NM_018704chr131370 758 231 ------
NM_018712chr11143 ----11059
NM_018715chr121907 906 11648 ----
NM_018717chr43646 371 175 12358 2432 335 --
NM_018718chr73371 176 163 --2828 491 --
NM_018837chr202186 135 ------
NM_018841chr193929 3399 3189 2591 1476 784 539 117 77 --12724 13548
NM_018845chr13547 524 30 ------
NM_018847chr941317 1225 298 57 11245 ----
NM_018890chr731398 1105 266 1451 ----
NM_018898chr522085 2052 1117 ----
NM_018899chr522085 2052 1117 ----
NM_018900chr522085 2052 1117 ----
NM_018901chr522085 2052 1117 ----
NM_018902chr522085 2052 1117 ----
NM_018903chr522085 2052 1117 ----
NM_018904chr522085 2052 1117 ----
NM_018905chr522085 2052 1117 ----
NM_018906chr522085 2052 1117 ----
NM_018907chr522085 2052 1117 ----
NM_018908chr522085 2052 1117 ----
NM_018909chr522085 2052 1117 ----
NM_018910chr522085 2052 1117 ----
NM_018911chr522085 2052 1117 ----
NM_018912chr511727 --21268 1219 180
NM_018913chr511727 --21268 1219 180
NM_018914chr511727 --21268 1219 180
NM_018915chr511727 --21268 1219 180
NM_018916chr511727 --21268 1219 180
NM_018917chr511727 --21268 1219 180
NM_018918chr511727 --21268 1219 180
NM_018919chr511727 --21268 1219 180
NM_018920chr511727 --21268 1219 180
NM_018921chr511727 --21268 1219 180
NM_018922chr511727 --21268 1219 180
NM_018923chr511727 --21268 1219 180
NM_018924chr511727 --21268 1219 180
NM_018925chr511727 --21268 1219 180
NM_018926chr511727 --21268 1219 180
NM_018927chr511727 --21268 1219 180
NM_018928chr511727 --21268 1219 180
NM_018929chr511727 --21268 1219 180
NM_018945chr643050 1303 965 193 23443 1179 --11326
NM_018947chr7104780 4408 3484 1971 1875 1351 1033 493 382 43 44798 4692 4431 3648 --24660 3920
NM_018948chr111131 191 ----
NM_018951chr7163 ------
NM_018952chr171191 --1248 1502
NM_018959chr192269 250 --1709 --
NM_018970chr743191 2540 1272 822 1175 22607 1101 --
NM_018976chr1212235 1466 ----
NM_018979chr1232525 2220 1986 1160 12597 1240
NM_018993chr2041413 399 111 100 ------
NM_018994chr1----1463 --
NM_018999chr1094203 3862 3050 1584 929 582 536 466 192 1248 1328 --
NM_019000chr521499 1212 11261 ----
NM_019001chr3104793 3510 1783 1750 1629 1447 1150 888 327 72 ------
NM_019022chr1852935 2669 2448 2090 1008 --12049 --
NM_019027chr411743 --1737 --
NM_019046chr101379 --199 --
NM_019050chr431798 666 560 32234 738 127 --11918
NM_019057chr5----127 --
NM_019063chr292284 1984 1791 1486 907 522 355 247 33 ------
NM_019074chr152284 113 1873 ----
NM_019083chr141247 1205 1155 125 1161 ----
NM_019087chr5--11481 198 --
NM_019094chr1293709 3275 2826 1480 1450 1013 842 226 39 21005 825 23742 1349 --
NM_019102chr71406 ------
NM_019102chr71406 ------
NM_019106chr2272329 2322 2251 1286 1200 623 320 ------
NM_019114chr921716 557 --11864 --
NM_019116chr1653104 3059 2871 2549 220 12726 --23119 2883
NM_019555chr311807 ------
NM_019556chrX1554 ------
NM_019557chr14830 661 354 29 ------
NM_019558chr21287 ------
NM_019593chr2083187 2926 2882 2840 2797 2307 2208 101 --12055 --
NM_019594chr95634 507 241 107 50 21564 1432 --11449
NM_019595chr21100 ------
NM_019596chr212904 325 12718 ----
NM_019600chr152625 276 ------
NM_019604chr11152 3911 245 133 ----
NM_019605chr11682 ------
NM_019613chr17--145 1278 1478
NM_019843chr22164 ------
NM_019854chr12--2596 542 ----
NM_019859chr102236 213 --1647 11017
NM_019862chr1641364 628 487 270 ----1391
NM_019885chr242273 1004 972 411 12109 22168 21 11832
NM_019891chr11464 11311 ----
NM_019896chr2145 --169 --
NM_019898chr1641364 628 487 270 ----1391
NM_019899chr1641364 628 487 270 ----1391
NM_019900chr1641364 628 487 270 ----1391
NM_019903chr102365 289 ------
NM_020039chr12101712 1618 1477 1259 1242 1214 539 488 474 246 11843 ----
NM_020066chr11871 ------
NM_020120chr221239 388 31049 1004 207 ----
NM_020123chr101302 ------
NM_020132chr2153609 1653 1067 818 180 24853 4563 13616 24181 902
NM_020134chr241189 1000 795 440 --1235 --
NM_020141chr141965 1701 327 272 11679 1182 12303
NM_020143chr21127 2412 292 1712 --
NM_020144chr72139 28 1737 ----
NM_020148chr1852465 2293 1168 976 283 --22400 1178 --
NM_020150chr1042199 1891 1768 302 ------
NM_020151chr23380 281 220 11160 147 --
NM_020156chr71382 ------
NM_020159chr42431 395 ------
NM_020163chr321997 686 2376 270 ----
NM_020168chr1581200 1163 1147 415 404 179 147 93 11022 ----
NM_020178chr173307 110 30 --11029 --
NM_020182chr2042639 2576 2508 2223 23087 2874 ----
NM_020193chr111482 ------
NM_020194chr2132 ------
NM_020198chr171325 ------
NM_020205chr163229 3155 2957 2810 387 195 ------
NM_020211chr1551152 1072 975 548 285 ------
NM_020225chr4130 ------
NM_020228chr1141806 654 298 196 ------
NM_020239chr182177 2078 2020 1796 1702 547 273 139 ------
NM_020309chr194896 873 369 171 1937 2251 104 --
NM_020318chr1------135
NM_020336chr201312 33405 3383 416 1654 --
NM_020337chr462853 2265 976 827 527 51 --1846 --
NM_020338chr1012687 2154 90 23280 2963 --
NM_020340chr622014 1658 11523 21936 864 1117
NM_020341chr2011678 ------
NM_020342chr211941 --1669 --
NM_020346chr1121649 656 ------
NM_020348chr1032711 954 816 22180 1875 1650 11976
NM_020354chr102768 730 ----181
NM_020357chr31412 ----11312
NM_020360chr173566 537 229 ----1444
NM_020363chrY298 33 11549 ----
NM_020364chrY298 33 11549 ----
NM_020372chr14------1102
NM_020373chr12--1198 1457 --
NM_020374chr121800 11376 1361 --
NM_020381chr641969 1836 761 274 --2779 645 --
NM_020382chr1251433 1427 1300 480 204 1113 --11143
NM_020384chrX41672 1653 1638 695 11227 ----
NM_020390chr373532 3512 3280 3163 1151 945 777 24267 1657 41868 1169 1032 272 --
NM_020416chr492639 2013 1706 981 814 806 476 434 36 ----1533
NM_020420chrY298 33 11549 ----
NM_020432chr741541 1530 526 364 --299 90 --
NM_020440chr183163 3091 2691 2574 1191 738 383 117 --1875 --
NM_020443chr1146849 6616 6302 6069 5965 5633 5300 4489 2731 2680 2658 2485 2307 747 35250 1982 436 25848 1926 --
NM_020444chr531380 1273 533 ------
NM_020452chr141726 1470 1446 836 --1450 --
NM_020453chr422105 1315 ------
NM_020455chr642136 1108 338 114 22046 720 ----
NM_020456chr1341877 1846 1657 1523 22001 1952 21744 620 --
NM_020457chr161274 ----1187
NM_020463chr23376 341 264 ------
NM_020466chr644837 3555 547 153 21249 729 1202 11813
NM_020474chr182607 52 ------
NM_020478chr862231 2175 1728 1550 928 227 ------
NM_020526chr141848 1771 674 116 --21518 402 --
NM_020630chr102601 245 --1485 --
NM_020647chr821852 416 ------
NM_020651chr21301 1440 ----
NM_020654chr3--21158 1098 11323 1505
NM_020661chr1221864 1856 ----11439
NM_020673chr2086460 5558 5267 5104 5065 4716 2782 1374 22500 1276 46213 6077 5285 5150 16998
NM_020690chr52238 124 ------
NM_020693chr111477 ------
NM_020699chr144967 4738 1607 238 24916 3774 14254 --
NM_020702chr931427 1321 749 11146 ----
NM_020708chr2041856 714 256 205 --22386 639 --
NM_020717chrX114960 3848 3722 1661 1623 1475 1295 762 575 488 80 ------
NM_020718chr1666225 6191 5870 5167 571 187 11117 ----
NM_020724chr432547 2307 339 32254 1761 267 21898 569 --
NM_020727chr2153529 3211 3152 2452 645 --33877 3330 739 --
NM_020728chr762888 2556 1154 1131 488 29 ------
NM_020732chr611072 1452 ----
NM_020739chr1583937 3176 3165 1703 1295 1154 762 602 13428 1821 --
NM_020747chr52939 94 ------
NM_020748chr1721485 644 --11410 --
NM_020749chr82810 326 ------
NM_020752chr1042257 1911 923 539 ------
NM_020766chrX44588 4327 4034 3161 11069 ----
NM_020769chrX6887 805 766 726 334 112 ------
NM_020772chr17138146 7459 6979 6730 5925 5397 5263 2957 2859 2604 2533 2349 1021 15339 32540 2272 2022 15995
NM_020773chr482434 2293 2049 2005 1664 1012 188 137 22526 2240 11716 --
NM_020774chr1864214 2399 2335 1619 1480 1052 ------
NM_020776chr1893021 2585 2484 2418 1184 1088 991 303 114 12857 1568 --
NM_020781chr753215 2730 2067 1028 21 42866 2445 812 324 12511 11001
NM_020783chr181407 1237 1761 --
NM_020791chr1731411 556 515 --21419 369 --
NM_020794chr12585 365 21086 508 ----
NM_020796chr52274 82 22271 772 12634 --
NM_020800chr31298 11131 ----
NM_020801chr52838 586 ------
NM_020804chr692236 2221 1765 1687 1622 820 801 694 332 11889 12582 --
NM_020805chr1821664 1220 21770 335 11417 11698
NM_020806chr142577 525 ------
NM_020810chr143692 265 116 ------
NM_020813chr1932682 2523 113 11830 1962 --
NM_020824chr10--1624 ----
NM_020830chr222350 235 --1608 --
NM_020831chr223994 940 891 ------
NM_020834chr1461710 722 621 562 231 126 --21748 770 --
NM_020839chr31352 31545 1225 598 ----
NM_020841chr1233743 1562 1210 ------
NM_020845chr1251959 977 596 173 164 12040 32382 2243 702 --
NM_020850chr1643058 2407 2251 590 --13102 --
NM_020856chr192275 63 ------
NM_020858chr1511953 ------
NM_020859chr4103659 3467 3438 1407 1206 794 758 733 430 334 24068 853 ----
NM_020861chr611225 2508 369 ----
NM_020865chr31123 ------
NM_020868chr221522 646 ------
NM_020871chrX21735 721 --2117 105 --
NM_020872chr31183 1230 ----
NM_020886chr1141065 1042 878 323 --1926 --
NM_020888chr141365 668 123 52 1176 2247 235 --
NM_020896chr113942 229 184 --1864 --
NM_020897chr121194 166 --125 --
NM_020899chr172587 209 12096 ----
NM_020914chr1792764 2440 2401 2264 1685 1677 900 637 556 1616 1854 12089
NM_020917chr1992519 1131 669 648 592 499 292 217 165 11067 1455 --
NM_020918chr1032404 844 218 ------
NM_020922chrX11350 11280 1700 --
NM_020925chr111398 1518 ----
NM_020927chr1632251 593 397 --12242 --
NM_020935chr263985 3976 3272 1732 334 191 11492 22993 1824 --
NM_020940chr1032329 571 261 1837 ----
NM_020943chr2133 ------
NM_020951chr1921556 1541 11700 31876 1747 1574 --
NM_020956chr1953734 3218 983 904 716 1152 64310 4221 1287 962 781 297 --
NM_020959chr19----186 --
NM_020962chr1562318 2302 1883 1731 1623 862 ------
NM_020963chr1139 ------
NM_020967chr2031137 826 405 ------
NM_020971chr19------1551
NM_020972chr45906 900 887 88 78 2825 304 1254 --
NM_020975chr1041760 1410 621 256 11377 11298 --
NM_020977chr421837 1457 1742 ----
NM_020987chr1021136 416 ------
NM_020988chr16137 ------
NM_020993chr1262515 1838 1148 1109 624 591 1166 ----
NM_021003chr141141 ------
NM_021007chr231818 1620 685 ------
NM_021012chr1732358 2093 417 1792 52099 2081 2044 1968 804 31029 203 155
NM_021020chr893461 2260 1273 1084 1075 918 862 754 537 11126 12253 12417
NM_021033chr1373206 2644 2548 1383 832 618 206 ------
NM_021035chr2031267 929 382 11246 ----
NM_021061chr893865 3005 1667 1652 1502 1119 1088 868 64 73349 3283 3200 3168 3073 2768 177 21685 752 12920
NM_021069chr442110 1832 349 95 --11849 --
NM_021072chr521691 800 ------
NM_021078chr172158 65 2508 47 1390 --
NM_021079chr1743244 2452 2377 1042 32852 2248 428 13097 --
NM_021090chr22124956 4913 4825 3534 3063 3053 1608 1276 1245 920 804 622 23449 1202 34665 3373 1540 --
NM_021097chr21121 12182 1938 --
NM_021101chr321912 1701 22138 82 ----
NM_021116chr7168506 8385 7464 7251 7141 6851 6194 6141 6130 3604 3440 3296 2382 1854 710 499 57213 5886 5834 2474 349 38137 6030 1649 --
NM_021132chr102526 325 ------
NM_021135chr663204 2639 2390 990 580 189 ----167
NM_021140chrX--2353 210 ----
NM_021145chr72872 280 ------
NM_021147chr5------163
NM_021149chr163902 816 420 1170 21026 74 --
NM_021151chr72831 267 ------
NM_021155chr1942934 2519 2474 2366 1802 2819 683 --
NM_021156chr2031030 153 138 ------
NM_021158chr20194 ------
NM_021165chr1179 1700 --1245
NM_021183chrX32147 467 424 ------
NM_021184chr62245 89 ------
NM_021188chr141413 --174 --
NM_021189chr131085 1042 217 ------
NM_021190chr13865 549 307 ------
NM_021191chr1252467 2295 1770 813 769 ----1851
NM_021202chr2052415 1246 1208 403 68 --12346 --
NM_021205chr132820 1961 826 ------
NM_021210chr17----122 --
NM_021213chr1731104 981 328 21210 156 ----
NM_021215chr2052449 2278 710 154 120 22310 135 ----
NM_021222chr151320 1113 933 441 329 ------
NM_021229chr12--173 1334 --
NM_021237chr31220 ------
NM_021249chr1441385 1365 589 445 --11632 --
NM_021253chr61910 ------
NM_021255chr1463688 3532 3275 1614 624 394 --23027 520 --
NM_021259chr16141 ------
NM_021260chr1461337 1204 183 139 45 37 ------
NM_021574chr2242219 1985 885 428 --11906 1206
NM_021622chr104838 676 222 41 ------
NM_021627chr3--31163 953 884 ----
NM_021629chr384686 4114 3710 3648 3522 1161 1127 509 13629 13172 24362 3986
NM_021633chr131411 1202 330 ------
NM_021637chrX51328 963 881 865 526 ------
NM_021638chr434943 3258 1893 24533 1000 23583 97 128
NM_021643chr231649 1557 348 ------
NM_021647chr4124137 3953 3850 3603 3289 2903 2884 1442 1277 435 110 88 24489 552 ----
NM_021648chr641710 798 405 139 ------
NM_021722chr7--157 ----
NM_021723chr7--198 ----
NM_021724chr171269 ------
NM_021728chr14------1159
NM_021813chr6105378 5339 4575 4168 1855 625 500 347 320 54 14876 25208 1319 14199
NM_021814chr63589 418 271 11055 ----
NM_021818chr1411373 ------
NM_021911chr565353 4724 4626 4494 1942 117 11057 11478 --
NM_021912chr1563981 3012 1667 1378 792 151 --1911 --
NM_021913chr195661 482 439 94 30 ------
NM_021914chr142775 591 12455 ----
NM_021940chr631500 1326 445 ------
NM_021942chr41210 ------
NM_021943chr661800 1673 543 451 317 55 --11686 --
NM_021945chr662495 2367 2191 1244 636 624 11023 22576 102 --
NM_021946chrX51413 1068 996 964 128 1902 ----
NM_021949chrX32692 2122 242 12110 21878 311 --
NM_021951chr92758 658 1132 1373 --
NM_021958chr11320 ------
NM_021960chr132617 1846 963 22126 1955 22022 462 --
NM_021961chr11105473 5215 4673 2819 2409 2209 1759 1366 615 279 1257 14662 14556
NM_021964chr386483 4331 4222 4048 2020 910 398 190 ----12603
NM_021984chrX31124 545 200 --1429 --
NM_021987chrX31124 545 200 --1429 --
NM_021990chrX31124 545 200 --1429 --
NM_021992chrX1317 ------
NM_021998chrX21226 77 11379 ----
NM_022003chr113817 497 94 11034 ----
NM_022037chr21708 2659 238 ----
NM_022048chr15116250 4394 4027 2300 2065 1412 1323 1010 899 339 24 46063 5475 4290 4136 25518 5294 15083
NM_022062chr1151893 1448 464 182 62 ------
NM_022067chr14130 1152 ----
NM_022068chr183659 605 562 ------
NM_022073chr1451594 1191 1080 422 90 1186 1628 --
NM_022079chr101893 ------
NM_022085chr651530 1422 1017 979 577 ------
NM_022087chr7130 1571 ----
NM_022090chr51494 ------
NM_022107chr62520 40 ------
NM_022118chr131195 ------
NM_022121chr61929 --1897 --
NM_022123chr14--1199 ----
NM_022130chr52463 332 ------
NM_022138chr611167 ----1186
NM_022140chr582327 2199 2187 2084 1975 1586 871 113 21532 94 32027 392 256 --
NM_022143chr721371 405 1555 ----
NM_022164chr13536 458 87 1658 ----
NM_022166chr1695791 5130 2252 1902 1525 1388 720 688 232 75613 5380 4363 2267 1914 1777 496 46188 5103 4591 668 16104
NM_022170chr721264 420 31547 1108 301 11453 --
NM_022173chr21708 2659 238 ----
NM_022346chr411075 ----11216
NM_022367chr11287 --1571 --
NM_022371chr12275 159 ------
NM_022373chr73632 319 41 ------
NM_022374chr21464 ------
NM_022458chr722818 936 22786 107 12873 1644
NM_022459chr1366075 5123 1927 895 870 88 22245 477 15864 25714 962
NM_022461chr321073 117 21210 304 ----
NM_022462chr19123472 2968 2871 2659 1249 1227 996 698 531 249 148 137 --21132 200 --
NM_022465chr1271109 1045 1033 875 505 469 22 --12236 --
NM_022473chr1563974 1767 1720 1639 1548 1174 23103 1579 ----
NM_022474chr1452723 756 356 222 164 11770 11891 --
NM_022476chr162898 448 ------
NM_022477chr2041743 1487 1325 1310 11093 21343 1208 --
NM_022482chr2052366 2339 653 396 207 11765 ----
NM_022483chr531628 1252 1211 1580 --11509
NM_022485chr3250 38 1264 ----
NM_022488chr31160 ------
NM_022497chr353083 2474 1238 787 613 22813 2711 ----
NM_022552chr231181 1152 222 ------
NM_022566chr15--2644 398 ----
NM_022572chr281340 1295 1236 1160 465 451 363 225 --1629 --
NM_022650chr5160 ------
NM_022652chr124955 914 810 44 ------
NM_022716chr152909 2669 920 439 432 22540 291 ----
NM_022719chr2293381 2958 2778 2560 843 746 640 531 33 --21089 333 --
NM_022730chr2--1204 ----
NM_022733chr121092 35 2344 252 ----
NM_022735chr11680 2667 203 1509 --
NM_022737chr192920 274 21001 844 11148 --
NM_022739chr171391 1867 ----
NM_022753chr122439 882 ------
NM_022755chr962583 2182 2131 1680 896 324 12445 ----
NM_022758chr673186 3074 2567 2227 2153 2011 1061 --11986 --
NM_022760chr20143 ------
NM_022763chr312533 12326 11258 --
NM_022766chr2262631 2247 1932 1012 621 223 12241 1555 --
NM_022771chr122950 218 --1730 --
NM_022780chr241721 1681 1630 1262 1447 ----
NM_022781chr911075 21316 386 1722 --
NM_022817chr211565 12172 31992 1429 313 --
NM_022821chr12386 52 --139 --
NM_022822chr115765 685 642 154 128 ------
NM_022823chr22502 123 1360 1470 --
NM_022824chr521504 583 --11219 --
NM_022826chr231065 463 450 ------
NM_022828chr511097 21157 1117 ----
NM_022831chr121516 1420 1340 ----
NM_022832chr42905 117 ------
NM_022841chr1522214 138 --2536 163 --
NM_022842chr353034 2944 2580 2214 346 --12719 --
NM_022845chr1632192 430 127 --1729 --
NM_022875chr5179 ------
NM_022877chr5179 ------
NM_022893chr232438 2112 817 ------
NM_022894chr241647 1324 278 119 ------
NM_022912chr242878 175 112 44 12264 121 1629
NM_022918chr113583 563 93 ------
NM_022970chr1041279 1097 1007 981 ------
NM_023010chrX2730 79 --1808 --
NM_023018chr121626 1314 --2382 95 --
NM_023019chr23128 75 36 --2342 244 --
NM_023033chr123493 461 196 ------
NM_023075chr181731 ------
NM_023076chr1642825 2800 2311 741 --12549 1817
NM_023079chr172466 325 --11353 --
NM_023105chr851962 1823 898 458 421 ------
NM_023106chr851962 1823 898 458 421 ------
NM_023110chr851962 1823 898 458 421 ------
NM_023111chr851962 1823 898 458 421 ------
NM_023923chr1113531 3049 2962 2839 2821 2806 2705 2657 1467 1447 365 --11163 --
NM_023929chr83911 546 144 --12470 12727
NM_024007chr542969 2102 609 540 ------
NM_024034chr204976 288 84 69 1775 1672 --
NM_024046chr34899 820 343 262 ----11068
NM_024055chr52652 167 --1211 --
NM_024057chr12----1125 --
NM_024061chr71223 ------
NM_024071chr141201 --1452 --
NM_024076chr1941971 1648 530 36 11485 11953 --
NM_024077chr91513 ----1575
NM_024082chrX----2408 99 --
NM_024103chr195604 537 280 228 46 ------
NM_024294chr673186 3074 2567 2227 2153 2011 1061 --11986 --
NM_024297chr172150 69 --160 --
NM_024306chr163814 807 30 --2361 279 --
NM_024312chr1261348 1185 1074 662 62 31 --11230 --
NM_024323chr192164 105 ------
NM_024326chr101122 ------
NM_024329chr1----11439 21418 1372
NM_024345chr986100 6015 5506 4911 1818 1396 148 56 24247 1949 --14942
NM_024408chr141212 1172 639 612 ------
NM_024411chr2021126 590 ------
NM_024416chr931517 563 55 ------
NM_024421chr182881 492 ------
NM_024423chr1854197 4027 3887 3796 1592 ------
NM_024424chr113860 829 101 ------
NM_024425chr113860 829 101 ------
NM_024426chr113860 829 101 ------
NM_024429chr73673 359 66 ------
NM_024430chr1851798 1530 1515 1364 1189 --31548 1412 422 --
NM_024490chr152432 199 ------
NM_024501chr21280 --1475 --
NM_024511chr463125 2419 2320 2157 532 343 13069 32338 2205 429 --
NM_024512chr341054 1029 965 635 --11180 --
NM_024513chr363831 3656 3593 883 472 456 1129 ----
NM_024522chr141715 547 280 30 --21403 517 --
NM_024524chr322470 673 ------
NM_024529chr11123 11071 ----
NM_024539chrX31037 1017 222 ------
NM_024541chr1031558 771 581 1410 2669 345 --
NM_024545chr21114 1668 ----
NM_024546chr131836 1400 ----
NM_024548chr361732 1598 1493 1121 622 609 ------
NM_024551chr12102576 2405 2325 2318 2256 2134 1705 1650 788 114 ------
NM_024551chr12102576 2405 2325 2318 2256 2134 1705 1650 788 114 ------
NM_024554chr131429 701 498 11075 11283 --
NM_024567chr86536 494 181 160 65 51 1613 ----
NM_024569chr172934 2627 1121 1065 681 412 102 --12700 --
NM_024575chr12115 109 1395 ----
NM_024586chr14648 226 208 123 ------
NM_024595chr11282 ------
NM_024599chr173711 573 27 1499 1270 --
NM_024611chr1562485 1601 1483 1002 895 848 ------
NM_024612chr172284 265 ------
NM_024613chr82493 136 ------
NM_024624chr231539 1488 641 ------
NM_024631chr111509 ------
NM_024639chr642829 1955 566 380 52110 2003 426 286 79 ----
NM_024641chr642642 2281 815 437 12516 ----
NM_024646chr163804 3280 3010 2640 358 309 1331 1394 --
NM_024656chr1941658 1621 1261 1202 --11464 --
NM_024659chr21252 ----1173
NM_024665chr331243 1208 401 ------
NM_024670chr1031189 588 180 11478 ----
NM_024674chr172707 2315 2116 805 787 428 114 --12201 --
NM_024689chrX41829 1712 1297 335 11255 ----
NM_024692chr221198 537 21358 741 --1580
NM_024721chr852537 2504 1760 419 307 ----12037
NM_024740chr1153321 2992 1591 1076 601 --23176 3040 --
NM_024749chr13454 320 68 1905 11428 12097
NM_024755chr15----1330 --
NM_024770chr286399 6039 5629 2393 2294 2230 1640 1481 --35636 1671 1529 36309 5087 849
NM_024787chr85871 657 230 151 43 ------
NM_024798chr1542696 1948 1913 856 --32357 708 574 12564
NM_024804chr12372 343 ------
NM_024811chr1131540 677 451 11653 ----
NM_024817chr15115938 5828 5286 4946 4782 4623 4214 800 602 480 302 24182 2034 21157 54 14632
NM_024830chr531586 544 117 11535 1138 --
NM_024835chr171169 ------
NM_024837chr154687 351 113 42 ------
NM_024850chr52815 45 2229 89 ----
NM_024871chr331033 264 198 11415 157 11140
NM_024877chr192964 784 --31019 407 176 --
NM_024884chr14104521 4408 3908 3097 2815 1154 1035 594 487 204 13787 11172 --
NM_024893chr202968 907 --2811 629 --
NM_024900chr421927 1640 176 22014 843 12190
NM_024900chr421927 1640 176 22014 843 12190
NM_024909chr621584 27 1613 --11063
NM_024920chr421329 414 ------
NM_024923chr361302 1294 1203 923 128 43 11160 3560 403 33 --
NM_024930chr532691 1907 1889 --22048 1782 --
NM_024939chr1641238 1204 1019 40 3524 508 118 ----
NM_024946chr1631649 1596 1155 ------
NM_024947chr3109521 8924 8300 8079 7493 7366 5836 3595 669 635 11096 27414 2612 --
NM_024953chr1231927 677 498 1546 1999 --
NM_024956chr152507 194 ------
NM_024963chr785856 4870 4543 4122 2372 1607 1194 752 --24308 29 25294 2191
NM_024979chr1341582 1302 1294 476 ------
NM_024989chr2118127 7326 6139 5872 2393 2205 2136 1553 1542 1474 350 --47344 2291 1575 1233 15820
NM_025054chr853600 3001 2746 1049 970 ------
NM_025079chr12504 475 --1206 --
NM_025083chr1581922 1870 1587 1503 710 245 76 60 --21307 1299 --
NM_025126chr12------1578
NM_025134chr161591 ----1840
NM_025138chr131336 128 --1385
NM_025146chr332641 2031 841 --11804 --
NM_025160chr143379 1230 486 168 --12950 --
NM_025176chr201477 ----168
NM_025179chr1114498 4442 4386 4131 4077 3736 3627 3505 1322 988 216 --14154 164
NM_025181chr21260 ------
NM_025182chr92864 93 1432 1947 --
NM_025187chr1631367 1173 1105 --11148 --
NM_025191chr142545 916 653 261 --13240 --
NM_025202chr23412 266 38 1364 ----
NM_025208chr1121677 1566 --1139 --
NM_025222chr322531 2416 1961 1647 --
NM_025224chr2072304 2036 1756 1657 706 683 33 21906 762 1738 --
NM_025235chr1022211 776 ------
NM_025237chr171180 1290 ----
NM_025238chr1531517 1453 1356 ------
NM_025246chr3122 ------
NM_025248chr1752891 2813 2128 1070 146 --22971 679 --
NM_025256chr62244 212 ------
NM_030576chr1762313 1754 980 928 837 345 12572 1635 21787 1745
NM_030579chr1643544 3277 2864 184 31290 178 149 23483 2828 --
NM_030594chr151434 ------
NM_030621chr1453359 1594 1364 1100 665 23269 1016 ----
NM_030625chr1042232 1935 1065 984 12198 22008 1927 11838
NM_030627chr5--12940 11424 134
NM_030634chr12858 162 ------
NM_030637chr141740 2685 662 ----
NM_030647chr765398 4746 3861 2284 1949 1869 15542 15683 --
NM_030648chr4115377 4699 4652 4577 4270 4258 3908 3713 2012 1136 564 --34721 4321 1531 --
NM_030650chr243665 3092 2741 603 33839 3102 2984 11197 --
NM_030664chr1052345 2311 1900 1734 832 11649 12443 --
NM_030665chr1731343 1244 1133 ------
NM_030670chr1231686 531 156 --1468 --
NM_030671chr1231686 531 156 --1468 --
NM_030674chr1294491 4098 3799 3763 3614 1335 1129 675 173 24467 1195 11274 --
NM_030751chr1021743 649 1219 1465 --
NM_030751chr1021743 649 1219 1465 --
NM_030753chr17295 59 ------
NM_030755chr1432786 2399 445 --12553 --
NM_030758chr2221333 949 11196 ----
NM_030759chr103317 200 112 ------
NM_030762chr1221395 563 11904 ----
NM_030767chr962536 2489 2054 2003 640 272 21094 594 22472 2278 --
NM_030769chr14469 202 151 70 ------
NM_030789chr202300 25 ------
NM_030791chr14--11493 ----
NM_030797chr21191 140 ----
NM_030799chr532231 1921 675 ------
NM_030806chr1138571 8464 8248 8204 6319 5946 5704 3464 3243 2999 2849 1573 1490 37718 3109 2337 28287 5739 12079
NM_030808chr173742 70 62 ----1692
NM_030810chr651530 1422 1017 979 577 ------
NM_030912chr102613 350 ----1620
NM_030914chr91328 131 2951 774 --
NM_030918chr1125078 4884 4515 4297 4227 3302 2179 2044 2021 1936 1107 226 34684 3780 3748 45231 2077 2059 1713 --
NM_030920chr11145 ------
NM_030922chr153696 584 194 --1636 --
NM_030925chr1361384 1306 594 546 349 36 --1605 --
NM_030952chr131111 1043 200 139 ----
NM_030958chr81449 ------
NM_030962chr1131590 1515 422 1377 ----
NM_030964chr563347 2594 2579 2502 2495 629 13092 12807 --
NM_030979chr13137 ------
NM_031205chr12170 1398 1383 --
NM_031216chr1842187 1997 1833 882 ------
NM_031243chr73772 116 27 21877 1728 2924 77 --
NM_031262chr9181 ------
NM_031263chr91138 ------
NM_031272chr171119 --181 --
NM_031284chr151385 1869 ----
NM_031298chr17--1167 ----
NM_031305chr431276 730 345 21787 761 ----
NM_031309chr862376 1973 1561 638 591 36 1748 1610 --
NM_031314chr1421417 100 ------
NM_031369chr4------1229
NM_031370chr4------1229
NM_031371chr11465 ------
NM_031371chr11465 ------
NM_031411chr522085 2052 1117 ----
NM_031412chr122947 191 --1786 --
NM_031418chr1132777 2497 499 1246 1257 11799
NM_031419chr32417 83 --31059 462 428 --
NM_031426chr952515 2055 1911 567 162 11084 ----
NM_031427chr1484604 4411 3745 2043 1178 767 690 245 32252 1301 565 34353 3615 251 --
NM_031435chr1231395 642 195 1876 ----
NM_031442chrX62422 2354 802 548 494 322 --21258 661 --
NM_031444chr2262198 2142 1985 1927 1913 719 132 21614 120 --
NM_031445chr2103340 3059 2921 2606 2579 2384 675 520 212 206 23355 893 ----
NM_031453chr1042490 2386 986 68 1815 1847 --
NM_031461chr831823 1777 623 1363 ----
NM_031468chr7147015 6414 6020 5165 2738 2294 1998 657 583 463 443 271 210 170 46424 5376 2732 1179 26562 1791 --
NM_031469chr643458 1074 937 235 33593 3221 2656 ----
NM_031483chr2053542 3531 2726 1015 308 ------
NM_031492chr113226 102 37 ------
NM_031844chr143007 1609 978 208 ----13523
NM_031849chr522085 2052 1117 ----
NM_031857chr522085 2052 1117 ----
NM_031860chr522085 2052 1117 ----
NM_031866chr1021048 846 ------
NM_031892chrX1104 ------
NM_031899chr351048 1017 589 544 181 --1120 --
NM_031904chr1162062 2028 1879 1728 260 89 1132 21747 119 --
NM_031911chr421963 319 ------
NM_031935chr12961 751 ------
NM_031940chr841984 1638 441 323 ------
NM_031990chr1971344 1044 1007 957 336 254 89 --1908 --
NM_031991chr1971344 1044 1007 957 336 254 89 --1908 --
NM_031992chr721264 420 31547 1108 301 11453 --
NM_032012chr955138 3539 3500 797 134 34330 4303 979 13397 11168
NM_032013chr2041743 1487 1325 1310 11093 21343 1208 --
NM_032017chr121816 503 --41627 1558 1445 790 --
NM_032028chr52695 608 --2556 275 --
NM_032041chr842431 2135 363 149 ------
NM_032042chr532795 1859 1148 1449 ----
NM_032088chr511727 --21268 1219 180
NM_032092chr511727 --21268 1219 180
NM_032102chr1122663 402 11022 ----
NM_032116chr13105397 5151 4531 4176 4017 2209 1540 1407 1339 978 --22360 874 --
NM_032121chrX42701 570 362 162 21801 551 22410 890 12245
NM_032128chr42942 664 ------
NM_032139chr191120 ------
NM_032144chr231604 1320 1127 ----1647
NM_032145chr641529 1493 1445 179 ------
NM_032146chr32154 24 ------
NM_032174chr131441 928 307 31246 149 81 21013 428 --
NM_032182chr1011448 198 11537 --
NM_032193chr1141951 1857 1352 498 21832 514 11343 2379 122
NM_032199chr1032756 2560 48 --11276 --
NM_032208chr241306 1154 296 40 21431 32 1875 --
NM_032211chr106878 854 836 320 179 49 ------
NM_032217chr421382 204 ------
NM_032221chr2042016 1268 799 171 ------
NM_032228chr111347 ------
NM_032229chr1341027 276 187 74 ------
NM_032233chr141814 --1323 --
NM_032236chr12918 157 1684 ----
NM_032239chr421143 66 ------
NM_032242chr383223 2377 2271 2144 1173 970 751 146 53315 3273 3201 2243 599 32873 2179 1249 --
NM_032246chr151912 ------
NM_032268chr1652298 1111 1100 429 234 22023 1152 ----
NM_032283chr131865 1731 380 11210 21743 652 --
NM_032288chr332400 1678 1516 ------
NM_032298chr192502 41 ------
NM_032303chr931305 254 191 1699 ----
NM_032316chr341821 1773 171 150 12272 ----
NM_032320chr111665 ------
NM_032321chr262907 2876 2797 2060 1237 575 1830 ----
NM_032324chr11171 ------
NM_032327chr10--183 1119 --
NM_032352chr1421358 1031 ------
NM_032370chr191133 ------
NM_032373chr1065146 4201 1002 812 791 231 --1903 --
NM_032403chr511727 --21268 1219 180
NM_032408chr721171 1088 ------
NM_032410chr821127 839 ------
NM_032420chr5289 73 ------
NM_032434chr221630 120 ------
NM_032435chr141919 1736 351 278 ----11687
NM_032436chr131816 --1127 --
NM_032438chr631199 1089 288 ------
NM_032440chr1051804 904 871 796 772 32677 2295 693 21059 703 --
NM_032441chrX31155 417 117 --11002 --
NM_032442chr17--1149 --1490
NM_032445chr1532183 1826 1732 ------
NM_032446chr523689 3523 32892 741 299 ----
NM_032449chr172756 2707 2438 2103 1869 222 159 126 --1371
NM_032457chr433471 3186 719 1547 ----
NM_032458chrX52881 2624 2524 2300 1204 11119 ----
NM_032499chr151103 ------
NM_032503chr62360 242 1404 ----
NM_032509chr821836 1697 1573 ----
NM_032521chr2072640 1080 600 567 513 444 429 --31111 986 732 --
NM_032523chr21555 1520 ----
NM_032538chr692688 2443 2201 2118 2026 960 488 284 90 1476 1181 --
NM_032547chr4196 --1553 --
NM_032550chr1021064 474 --1142 --
NM_032552chr93781 700 244 ------
NM_032557chr41318 11010 ----
NM_032558chr92971 110 ------
NM_032582chr171191 11491 ----
NM_032594chr142694 356 ----139
NM_032595chr172991 537 --21387 149 --
NM_032603chr26727 714 637 603 566 68 3559 482 163 ----
NM_032622chr4--21160 158 --11060
NM_032632chr1421945 1550 1510 --11734
NM_032636chr1129 1487 ----
NM_032682chr372905 2718 2656 2532 2428 2292 649 1791 ----
NM_032701chr191439 --2519 260 --
NM_032717chr44940 811 781 386 142 ----
NM_032727chr1031556 253 242 21025 173 1118 --
NM_032765chr51166 1899 ----
NM_032777chr841288 364 345 59 --11457 --
NM_032788chr261377 585 502 419 335 306 1616 11627 --
NM_032810chr1041387 1357 1270 264 ------
NM_032827chr231143 135 88 ------
NM_032832chr61294 2627 163 1560 --
NM_032833chr111073 1914 31844 1708 978 --
NM_032842chr72629 611 11303 2679 494 --
NM_032846chr1421416 175 ----2414 45
NM_032859chr132842 237 ------
NM_032867chr113652 604 231 1244 ----
NM_032869chr821818 710 --11914 --
NM_032873chr1154583 3637 3001 1636 312 ------
NM_032880chr11121 ------
NM_032892chr15--1216 ----
NM_032900chr1043381 3351 3274 786 --1287 --
NM_032906chr42654 304 ------
NM_032924chr73922 56 41 ----1172
NM_032949chr131103 ------
NM_032968chrX23806 148 ----12698
NM_032969chrX23806 148 ----12698
NM_032973chrY23798 148 ----12693
NM_032975chr1842222 1387 1080 136 23311 235 11153 --
NM_032978chr18----171 --
NM_032979chr18----171 --
NM_032980chr1842222 1387 1080 136 23311 235 11153 --
NM_032981chr18----171 --
NM_032982chr7112269 2029 1955 1909 1659 924 740 689 569 104 75 11636 11678 --
NM_032992chr43516 448 51 ------
NM_032995chr221461 286 ------
NM_032998chr121139 1128 ------
NM_033014chr931517 563 55 ------
NM_033016chr2221542 405 ----1480
NM_033020chr144470 3502 3197 3088 11170 ----
NM_033029chr3182 1392 1121 --
NM_033030chr231455 1387 75 ------
NM_033044chr131068 392 132 ------
NM_033071chr62243 107 ----1161
NM_033083chr353298 3207 2149 925 354 1539 12858 --
NM_033089chr2021275 1210 ------
NM_033102chr141254 1167 941 37 --1935 --
NM_033102chr141254 1167 941 37 --1935 --
NM_033103chr1941084 948 900 56 ------
NM_033105chr82158 38 ------
NM_033118chr202855 105 --1728 2791 192
NM_033121chr1211182 11862 1665 --
NM_033122chr4156 ------
NM_033127chr11199 ------
NM_033132chr131698 31899 1460 903 ----
NM_033135chr1121677 1566 --1139 --
NM_033141chr1431489 344 76 1162 1662 --
NM_033143chr464500 2918 2872 1688 546 372 3947 395 284 34118 428 53 --
NM_033150chr122325 67 ------
NM_033181chr61247 --13805 --
NM_033201chr161244 1438 ----
NM_033211chr53789 577 375 ------
NM_033224chr787882 7510 6659 5557 5352 1200 1161 434 15691 46843 6707 2403 263 17916
NM_033225chr83873 527 375 12268 --22674 306
NM_033226chr162105 64 ------
NM_033246chr152385 106 ------
NM_033255chr13289 51 1375 ----
NM_033260chr62519 130 ------
NM_033274chr592545 2491 2294 1083 1026 950 857 341 168 1429 12929 --
NM_033281chr52900 807 ------
NM_033300chr13982 975 27 ------
NM_033315chr1751683 1425 710 433 225 11824 ----
NM_033326chr1112306 ----21545 521
NM_033331chr962638 2435 1197 992 748 638 2707 349 2251 100 --
NM_033340chr1031285 979 109 --132 --
NM_033360chr1233493 3307 1846 ------
NM_033375chr1731133 1124 600 --11479 --
NM_033380chrX2172 74 ------
NM_033381chrX2172 74 ------
NM_033389chr1784742 4266 4257 4066 3863 3367 3225 489 11412 23375 1585 --
NM_033394chr211056 ------
NM_033396chr111365 --136 --
NM_033421chr2041689 748 726 556 --2781 470 1682
NM_033425chr114529 393 281 54 --12177 --
NM_033428chr921697 615 22017 221 ----
NM_033430chr442859 2805 723 645 ------
NM_033437chr442859 2805 723 645 ------
NM_033448chr123480 79 26 ------
NM_033495chrX31017 388 271 ------
NM_033505chr276464 6240 5842 4683 1057 727 105 --12531 --
NM_033512chr862902 2707 2038 1870 1096 373