TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4649-5p
miRNA Sequence: UGGGCGAGGGGUGGGCUCUCAGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000016chr11613 ------
NM_000068chr1911310 --1607 2569 308
NM_000084chrX26758 6586 --26541 5380 --
NM_000089chr7--1652 ----
NM_000109chrX1335 ------
NM_000114chr201209 ------
NM_000115chr1322028 219 ------
NM_000118chr91694 ----1258
NM_000183chr21155 ------
NM_000192chr1221074 345 ------
NM_000216chrX23464 3284 1281 ----
NM_000245chr7195 ------
NM_000258chr31235 ------
NM_000259chr1534943 4124 1196 --24962 41 --
NM_000267chr171168 22694 2518 174 --
NM_000278chr1031675 881 56 --41785 820 588 305 11994
NM_000319chr1221095 898 ------
NM_000325chr4136 ------
NM_000332chr625402 4988 --15905 --
NM_000353chr161832 ----11014
NM_000368chr913590 --14131 --
NM_000430chr1743069 2992 2972 2558 ------
NM_000435chr191132 ------
NM_000450chr13387 335 100 ------
NM_000459chr91929 ------
NM_000461chr353812 3624 3276 1120 155 ------
NM_000480chr1111602 ------
NM_000484chr212436 123 ------
NM_000489chrX12403 ------
NM_000495chrX--1294 ----
NM_000533chrX1415 1535 ----
NM_000555chrX47059 4978 1952 313 1329 16990 --
NM_000578chr231321 1245 216 ------
NM_000609chr1042909 2725 2381 255 ------
NM_000612chr1133515 3487 2544 13282 23172 2919 --
NM_000618chr1225533 2560 15907 ----
NM_000618chr1225533 2560 15907 ----
NM_000681chr103875 297 118 11086 ----
NM_000682chr241834 1737 691 194 --163 --
NM_000687chr20------143
NM_000719chr1225622 400 --26550 2391 --
NM_000721chr1----1306 --
NM_000723chr1731427 1199 86 ------
NM_000724chr1021406 493 ------
NM_000767chr19--1259 ----
NM_000787chr9--1578 --1244
NM_000811chr51541 ------
NM_000813chr521958 1896 ------
NM_000817chr211103 ------
NM_000826chr4----11000 --
NM_000829chr1122223 1768 ------
NM_000833chr1621363 1006 ------
NM_000841chr62251 94 --2830 797 --
NM_000860chr4--11473 11266 --
NM_000868chrX11800 ------
NM_000875chr1565889 5439 4657 2821 1928 1731 ------
NM_000891chr1711414 13013 ----
NM_000901chr4----21707 550 1555
NM_000935chr31963 --1975 --
NM_000944chr4198 ------
NM_000949chr51143 ------
NM_000960chr191504 ------
NM_000961chr2043201 1265 1256 554 13252 22814 32 13891
NM_000964chr172884 505 --132 --
NM_000984chr17------1451
NM_001001395chr1222267 171 12476 ----
NM_001001436chr16----1125 --
NM_001001481chr812610 ------
NM_001001484chr1011542 ------
NM_001001523chr121032 22 ----11221
NM_001001549chr722222 202 --2827 337 --
NM_001001550chr722222 202 --2827 337 --
NM_001001555chr722222 202 --2827 337 --
NM_001001557chr81223 11556 ----
NM_001001664chr222842 1138 ------
NM_001001890chr2132605 152 47 --1463 --
NM_001001936chr102950 469 ------
NM_001001971chr101958 ------
NM_001002233chr82854 72 ------
NM_001002259chr122218 73 ------
NM_001002814chr82854 72 23815 3271 ----
NM_001002838chrX11822 ------
NM_001002909chr1731646 1635 428 ------
NM_001003712chr1211384 ------
NM_001003800chr931479 1294 1239 ------
NM_001004304chr1232892 861 547 ------
NM_001004720chr2----2674 25 1430
NM_001004722chr21154 --2843 194 --
NM_001005209chr21258 ------
NM_001005271chr172400 133 ------
NM_001005273chr172400 133 ------
NM_001005290chr1----132 --
NM_001005377chr19151 ------
NM_001005404chr171112 ------
NM_001005463chr101656 ------
NM_001005473chr546077 2015 1547 772 --1384 --
NM_001005476chr2----1677 --
NM_001005502chr1223781 1041 11720 14843 --
NM_001005505chr32246 50 --195 --
NM_001005732chr21------178
NM_001005733chr21------178
NM_001005910chr32468 172 ------
NM_001005911chr32468 172 ------
NM_001005920chr1621105 962 ----1755
NM_001006115chr352622 2334 1718 701 68 ------
NM_001006636chr21405 ------
NM_001006946chr231303 132 53 1741 ----
NM_001007098chr11278 ------
NM_001007156chr152465 193 --21672 662 11594
NM_001007214chr11345 ----1282
NM_001007226chr171982 ------
NM_001007227chr171982 ------
NM_001007228chr171982 ------
NM_001007229chr171982 ------
NM_001007230chr171982 ------
NM_001007277chr11192 ------
NM_001007279chr221110 1636 ----
NM_001007466chr6165 --11488 --
NM_001007559chr1811813 11657 ----
NM_001008222chrX--1526 ----
NM_001008495chr811393 ------
NM_001008529chr171454 ------
NM_001008701chr1922834 2241 ------
NM_001008925chr412946 1915 ----
NM_001010000chr1812812 23457 1123 ----
NM_001010854chr142163 75 ------
NM_001010862chrX--1171 ----
NM_001010888chrX24547 4217 ------
NM_001010917chr10------12041
NM_001010924chr102778 208 ------
NM_001010926chr1189 --161 --
NM_001010942chr1211282 150 ----
NM_001010984chr121960 854 11656 ----
NM_001011537chr331951 1531 345 --1420 --
NM_001011708chr212630 ------
NM_001012420chr1532030 479 271 --11994 --
NM_001012423chr1532030 479 271 ------
NM_001012426chr622570 1056 33131 3110 2580 23138 953 --
NM_001012427chr622570 1056 33131 3110 2580 23138 953 --
NM_001012751chr10--11970 ----
NM_001012974chr6----157 --
NM_001013415chr411083 ------
NM_001013438chr31221 ------
NM_001013439chr3167 ------
NM_001013690chr1241773 338 316 242 ------
NM_001013693chr132140 1934 1002 1929 ----
NM_001013693chr132140 1934 1002 1929 ----
NM_001014794chr111195 ------
NM_001014795chr111195 ------
NM_001014797chr10----27726 668 --
NM_001015887chr321369 672 11219 ----
NM_001017395chr322395 1206 --12725 --
NM_001017405chr41746 ------
NM_001017440chr737835 6365 2089 --15929 --
NM_001017523chr121718 ------
NM_001017923chr141437 ------
NM_001017926chr8--171 ----
NM_001017977chr11351 ------
NM_001017995chr554100 3623 3318 1288 133 11910 ----
NM_001017999chr1----11716 22059 480
NM_001017999chr1----11716 22059 480
NM_001018000chr1----11716 22059 480
NM_001018000chr1----11716 22059 480
NM_001018001chr1----11716 22059 480
NM_001018005chr15136 ------
NM_001018037chr911321 ------
NM_001018050chr2232904 2811 1266 13300 22139 146 --
NM_001018052chr2232904 2811 1266 13300 22139 146 --
NM_001018064chr9--1406 ----
NM_001018072chr121718 ------
NM_001018108chr1531769 122 37 --131 --
NM_001018111chr742459 2448 1607 877 13877 --1343
NM_001020658chr121407 227 --11355 --
NM_001020658chr121407 227 --11355 --
NM_001023567chr153481 330 271 ------
NM_001023587chr3129 ------
NM_001024226chr11794 --133 1814
NM_001024227chr11794 --133 1814
NM_001024228chr11794 --133 1814
NM_001024401chr1662803 2295 1973 971 454 90 --11983 --
NM_001024455chrX4977 780 744 655 ------
NM_001024460chr6----11051 --
NM_001024660chr31139 ------
NM_001024809chr172884 505 --132 --
NM_001024858chr142159 75 --2908 198 --
NM_001024934chr62591 527 ------
NM_001024935chr62591 527 ------
NM_001024936chr62591 527 ------
NM_001024959chr32870 703 ------
NM_001024960chr32870 703 ------
NM_001025068chr31186 ------
NM_001025069chr31186 ------
NM_001025076chr1024484 118 --14759 --
NM_001025077chr1035842 1476 1207 --26117 447 --
NM_001025079chr311216 21646 222 ----
NM_001025108chr211452 12929 ----
NM_001025205chr31338 1444 ----
NM_001025232chr121139 ------
NM_001025266chr323873 388 --13743 --
NM_001025366chr61262 ------
NM_001025366chr61262 ------
NM_001025367chr61262 ------
NM_001025367chr61262 ------
NM_001025368chr61262 ------
NM_001025368chr61262 ------
NM_001025369chr61278 ------
NM_001025369chr61278 ------
NM_001025370chr61262 ------
NM_001025370chr61262 ------
NM_001025389chr1111602 ------
NM_001025390chr1111602 ------
NM_001025579chr172810 296 ------
NM_001025580chrX1324 ------
NM_001025596chr11--1103 ----
NM_001025780chr911060 ------
NM_001029859chr112199 74 1500 ----
NM_001029863chr612771 ------
NM_001029864chr202681 397 2922 641 1321 --
NM_001029875chr51780 ------
NM_001029882chr1190 ------
NM_001029882chr1190 ------
NM_001029998chr41922 ------
NM_001030007chr1641010 931 777 388 ------
NM_001031702chr32121 32 --1683 --
NM_001031732chr4----13188 --
NM_001031804chr1622732 93 1548 ----
NM_001031812chr5--2450 236 ----
NM_001032280chr6--11346 ----
NM_001032283chr122941 108 ------
NM_001032284chr122941 108 ------
NM_001032289chrX1207 1316 ----
NM_001032380chr1011861 1450 ----
NM_001033044chr1----1405 --
NM_001033056chr1----1405 --
NM_001033057chr31847 ------
NM_001033059chr61377 ------
NM_001033506chr11--1166 ----
NM_001033518chr762403 2154 1080 721 584 287 12290 --12007
NM_001033519chr762403 2154 1080 721 584 287 12290 --12007
NM_001033520chr762403 2154 1080 721 584 287 12290 --12007
NM_001033551chr1733043 1352 865 --23941 3685 --
NM_001033554chr17139 ------
NM_001033561chr171789 ----1346
NM_001033677chr122359 67 --1380 --
NM_001033756chr61196 ------
NM_001033756chr61196 ------
NM_001034850chr5------11560
NM_001034915chr811564 ------
NM_001034954chr1022450 2407 1668 ----
NM_001034955chr1022450 2407 1668 ----
NM_001034956chr1022450 2407 1668 ----
NM_001034957chr1022450 2407 1668 ----
NM_001035003chr411215 ------
NM_001035004chr411215 ------
NM_001037174chr211850 ------
NM_001037553chr2144214 3822 760 475 ------
NM_001037582chr4----1538 --
NM_001037639chr3139 ------
NM_001038707chr112227 --11443 --
NM_001038707chr112227 --11443 --
NM_001039459chr7----1808 1374
NM_001039468chr11--1274 ----
NM_001039469chr11--1314 ----
NM_001039577chr11846 ------
NM_001039585chr12712 134 ------
NM_001039618chr1115815 15384 ----
NM_001039690chr1631836 1565 1467 --1825 --
NM_001039693chr233947 3827 990 ------
NM_001039840chrX25680 768 --23854 131 --
NM_001039937chr1323162 2914 ------
NM_001040110chr721307 723 ------
NM_001040144chr1631836 1565 1467 --1825 --
NM_001040146chr1631836 1565 1467 --1825 --
NM_001040152chr765043 1709 980 473 351 117 ----1857
NM_001040181chr31966 ------
NM_001040182chr31966 ------
NM_001040183chr31966 ------
NM_001040199chr31966 ------
NM_001040200chr31966 ------
NM_001040214chr63927 559 533 ------
NM_001040284chr1635056 3941 139 ------
NM_001040429chr1312867 ------
NM_001040439chr1621355 996 1490 ----
NM_001040446chr551762 882 868 708 537 ------
NM_001040450chr15--12254 ----
NM_001040453chr15--12254 ----
NM_001040624chr832735 2150 1904 ------
NM_001040625chr832735 2150 1904 ------
NM_001040626chr832735 2150 1904 ------
NM_001040627chr832735 2150 1904 ------
NM_001040628chr832735 2150 1904 ------
NM_001040629chr832735 2150 1904 ------
NM_001040630chr832735 2150 1904 ------
NM_001040653chr321629 865 ------
NM_001040665chr713528 ------
NM_001040709chr112581 --12386 --
NM_001040712chr92753 424 ------
NM_001042355chr1624569 4511 --15318 --
NM_001042388chr18162 ------
NM_001042404chr11236 ------
NM_001042406chr6--1838 ----
NM_001042412chr1624569 4511 --15318 --
NM_001042413chr922996 49 ------
NM_001042425chr6--11346 ----
NM_001042453chrX11710 ------
NM_001042492chr171168 22694 2518 174 --
NM_001042494chr1512535 12545 ----
NM_001042495chr1512535 12545 ----
NM_001042496chr1512535 12545 ----
NM_001042497chr1512535 12545 ----
NM_001042510chr812070 11395 ----
NM_001042511chr812070 11395 ----
NM_001042537chrX11897 --1543 --
NM_001042555chr1224273 1034 ------
NM_001042599chr247441 5629 4872 1739 15484 14838 --
NM_001042632chr2061667 851 699 664 165 45 ------
NM_001042633chr2061667 851 699 664 165 45 ------
NM_001042749chrX11266 ------
NM_001042750chrX11266 ------
NM_001042751chrX11266 ------
NM_001043318chr1443619 2808 1380 1325 12644 ----
NM_001044385chr2--13598 ----
NM_001044722chr5--2450 236 ----
NM_001044723chr5--2450 236 ----
NM_001065chr12148 ------
NM_001071775chr1311203 ------
NM_001077628chr11123 --153 --
NM_001079874chr132074 536 196 ------
NM_001083620chr4----1999 --
NM_001106chr387511 7230 6641 3079 2868 2520 2096 1108 ------
NM_001113490chrX23547 1271 ------
NM_001117chr1842074 964 322 82 ------
NM_001128chr1641010 931 777 388 ------
NM_001144chr161299 ------
NM_001149chr1011062 --1414 --
NM_001174chrX11973 ------
NM_001198chr621702 264 ------
NM_001204chr21226 16501 12118 --
NM_001206chr912367 ------
NM_001220chr7122 ------
NM_001256chr171106 ------
NM_001257chr1611279 ------
NM_001280chr19125 ------
NM_001283chr71535 ------
NM_001293chr111391 ------
NM_001304chr1711118 ------
NM_001310chr1222017 418 ------
NM_001316chr201445 ------
NM_001332chr51474 --11367 --
NM_001356chrX12548 11549 ----
NM_001364chr1154533 4023 3539 1671 983 11589 ----
NM_001365chr17--172 130 --
NM_001383chr171259 ------
NM_001386chr81318 1386 1880 --
NM_001387chr532902 2022 156 --1799 --
NM_001396chr211254 ------
NM_001397chr112238 ------
NM_001406chr1721666 143 ------
NM_001408chr12150 103 --21271 581 --
NM_001412chrX13146 ------
NM_001416chr17--1392 1194 --
NM_001417chr1221723 1380 ------
NM_001419chr1941951 1914 1318 1027 ------
NM_001420chr1922155 258 --11176 1401
NM_001423chr1231542 1502 1429 ------
NM_001426chr2169 ------
NM_001427chr711751 ------
NM_001430chr211828 ----1136
NM_001438chr111416 --12302 --
NM_001527chr633684 1048 720 24092 3402 21745 538 --
NM_001553chr4168 ------
NM_001584chr111264 ------
NM_001608chr21257 ------
NM_001614chr17160 ------
NM_001614chr17160 ------
NM_001616chr222669 2564 ----12632
NM_001619chr112741 152 --1725 1921
NM_001620chr111125 1209 ----
NM_001628chr7151 --122 --
NM_001634chr61377 ------
NM_001635chr7----1429 --
NM_001650chr1823590 311 ------
NM_001655chr1111860 1557 ----
NM_001658chr11794 --133 1814
NM_001659chr1222135 141 --12065 --
NM_001663chr14--1408 ----
NM_001665chr111391 ------
NM_001670chr22----1129 --
NM_001686chr12----137 --
NM_001694chr161374 --1163 --
NM_001754chr2132605 152 47 --1463 --
NM_001755chr1622235 514 1731 ----
NM_001777chr311216 21646 222 ----
NM_001802chr162817 45 ------
NM_001854chr1------11086
NM_001858chr633497 446 43 ------
NM_001859chr911006 13332 --1461
NM_001874chr1223781 1041 11720 14843 --
NM_001894chr221779 --1204 --
NM_001896chr16----1317 --
NM_001914chr181100 1114 ----
NM_001923chr11147 ------
NM_001935chr2----1808 --
NM_001945chr52912 114 ------
NM_001961chr191374 ------
NM_001964chr5--11172 ----
NM_001967chr3135 ------
NM_001968chr41152 ------
NM_001969chr1431325 1042 890 --1685 --
NM_001970chr17----1462 --
NM_001978chr8--2952 414 1206 --
NM_001981chr112021 12118 ----
NM_002009chr151747 ------
NM_002014chr121644 ------
NM_002025chrX18957 16824 16229 --
NM_002035chr181335 ------
NM_002048chr91263 --159 --
NM_002063chrX132 1879 ----
NM_002065chr1----1405 --
NM_002092chr414179 24563 1224 ----
NM_002126chr1733661 2698 222 --11010 --
NM_002128chr1322497 215 1532 ----
NM_002137chr711748 ------
NM_002140chr9----1773 --
NM_002147chr17----1119 --
NM_002156chr21344 ------
NM_002167chr12373 113 ------
NM_002193chr211256 --21309 1305 --
NM_002196chr20----2384 108 1390
NM_002196chr20----2384 108 1390
NM_002202chr52919 421 ------
NM_002211chr10--11061 ----
NM_002234chr12--1193 ----
NM_002249chr12509 418 ------
NM_002254chr251796 1552 941 707 166 --1231 --
NM_002264chr354300 3430 3105 1641 132 ------
NM_002275chr17130 ------
NM_002285chr211452 12929 ----
NM_002334chr1121296 68 --1621 1422
NM_002350chr8------11265
NM_002351chrX2558 296 ------
NM_002353chr12598 51 --1631 --
NM_002355chr12------11062
NM_002360chr721782 617 ------
NM_002375chr3121 --2384 288 --
NM_002397chr5------11381
NM_002399chr151984 ------
NM_002406chr541017 709 334 33 ------
NM_002442chr1221340 213 1282 1220 --
NM_002465chr12--1274 ----
NM_002478chr11------1594
NM_002499chr1511890 12014 ----
NM_002501chr1943607 1170 1133 936 13327 33011 970 844 --
NM_002507chr1711915 1623 1495 --
NM_002515chr141762 21597 1331 ----
NM_002522chr171114 --137 --
NM_002552chr21151 ----1126
NM_002553chr71426 ------
NM_002576chr11194 ------
NM_002581chr935026 819 183 ------
NM_002586chr63996 583 242 --11076 --
NM_002590chr131458 ------
NM_002605chr15--1438 ----
NM_002608chr223559 315 60 --21331 100 1213
NM_002623chr20------1136
NM_002628chr3--1131 ----
NM_002631chr1184 ------
NM_002646chr121743 1722 --31422 844 818 --
NM_002648chr62491 96 ------
NM_002657chr2032470 1487 620 1385 12445 1519
NM_002697chr11102 ------
NM_002698chr1932746 349 69 ------
NM_002699chr12234 196 ------
NM_002705chr163715 123 76 --2190 88 --
NM_002714chr63967 871 277 --152 --
NM_002716chr1123278 189 13390 13194 --
NM_002717chr82655 256 --1511 --
NM_002721chr91119 ------
NM_002745chr2214503 ------
NM_002748chr151314 ------
NM_002752chr5----1130 --
NM_002753chr4131 ------
NM_002763chr1--1223 ----
NM_002779chr10----1539 --
NM_002794chr1125 ------
NM_002808chr31103 ------
NM_002815chr171105 ------
NM_002821chr61806 ------
NM_002827chr2031457 1308 197 --1306 --
NM_002833chr151453 ------
NM_002839chr92753 424 ------
NM_002855chr1143594 2665 2348 305 --12680 23088 108
NM_002890chr5184 ------
NM_002891chr151123 1184 ----
NM_002892chr1411164 ------
NM_002904chr6----1195 --
NM_002906chr11195 --1379 --
NM_002941chr31220 ------
NM_002942chr3----1249 --
NM_002945chr171675 ------
NM_002956chr121155 ------
NM_002959chr123090 648 --33683 3416 252 --
NM_002966chr1121 --1217 --
NM_002968chr161314 --174 --
NM_002971chr3----1415 --
NM_002977chr221188 1172 12815 12643 --
NM_002997chr231303 132 53 1741 ----
NM_003010chr1711799 ----196
NM_003011chr92316 115 ------
NM_003028chr911479 11142 ----
NM_003030chr321928 1294 --1137 --
NM_003042chr321972 700 ------
NM_003043chr333994 3172 386 ------
NM_003047chr1--11229 179 --
NM_003060chr52889 47 ------
NM_003071chr3--11762 ----
NM_003072chr191389 ------
NM_003088chr73992 157 110 ------
NM_003108chr255574 2925 2586 1982 828 14876 ----
NM_003128chr232318 1965 1062 11017 ----
NM_003131chr63593 398 268 --21722 795 --
NM_003137chr61849 --1263 --
NM_003146chr11130 ------
NM_003151chr2--166 ----
NM_003155chr81368 ------
NM_003164chr111160 ------
NM_003165chr941523 1396 1274 114 ------
NM_003173chrX----1101 --
NM_003178chr311439 ------
NM_003184chr81104 ------
NM_003189chr14689 636 518 389 12532 23164 649 --
NM_003198chr11314 ------
NM_003216chr22198 ------
NM_003220chr6--11346 ----
NM_003221chr631318 1007 830 ------
NM_003223chr161574 ------
NM_003236chr2----12399 --
NM_003255chr1732655 868 515 ------
NM_003286chr20----178 --
NM_003292chr112189 ------
NM_003298chr335921 1939 461 ----14923
NM_003319chr2--2906 627 ----
NM_003323chr19143 ------
NM_003325chr22150 ------
NM_003334chrX1144 ------
NM_003336chrX1133 ------
NM_003340chr4--1238 ----
NM_003342chr1713076 ------
NM_003345chr161174 ------
NM_003371chr94637 581 448 318 --1539 --
NM_003373chr1021636 1480 ------
NM_003376chr61262 ------
NM_003376chr61262 ------
NM_003378chr7171 ------
NM_003390chr111877 ------
NM_003399chrX11059 ------
NM_003405chr22166 ------
NM_003409chr18--1232 ----
NM_003412chr331970 1110 676 ------
NM_003413chrX1383 ------
NM_003418chr31122 ------
NM_003458chr373368 3002 2624 1562 970 835 360 12463 --12560
NM_003468chr21105 ------
NM_003472chr6--1966 ----
NM_003478chr1111127 ------
NM_003482chr1211014 ------
NM_003483chr12--12255 ----
NM_003485chr142131 86 ------
NM_003498chr1622181 795 ------
NM_003528chr1----231 27 --
NM_003557chr121102 365 --170 --
NM_003559chr1723120 1296 --23655 535 --
NM_003563chr171982 ------
NM_003579chr1--1130 ----
NM_003581chr2----2674 25 1430
NM_003583chr12--13503 ----
NM_003607chr123673 742 --383 49 28 --
NM_003612chr15193 ------
NM_003628chr2----1677 --
NM_003636chr151862 1518 1438 178 57 --11720 --
NM_003644chr17105222 4417 4353 4271 4002 2279 1161 881 296 255 --14551 1848
NM_003654chr111541 ------
NM_003655chr17188 --1223 --
NM_003660chr19186 --1733 --
NM_003673chr17--1105 ----
NM_003685chr191728 --1182 --
NM_003713chr11106 ------
NM_003714chr5--12302 1384 --
NM_003745chr16164 ------
NM_003758chr15--138 ----
NM_003758chr15--138 ----
NM_003760chr1171 ------
NM_003768chr111810 ------
NM_003787chr181673 ------
NM_003794chr31435 ------
NM_003800chr6--161 ----
NM_003822chr133134 2272 664 12502 ----
NM_003862chr5130 --1280 --
NM_003873chr101480 ------
NM_003888chr15----11172 1402
NM_003897chr61626 1695 ----
NM_003908chr2021111 1099 ------
NM_003927chr181727 ------
NM_003930chr7--1145 --11972
NM_003931chr62591 527 ------
NM_003938chr192736 405 --2233 72 --
NM_003939chr1013150 ----130
NM_003958chr632682 2539 155 1938 ----
NM_003987chr1031675 881 56 --41785 820 588 305 11994
NM_003988chr1041752 1473 958 133 --41862 897 665 382 12071
NM_003989chr1021611 817 --41721 756 524 241 11930
NM_003990chr1021611 817 --41721 756 524 241 11930
NM_003992chr151273 ------
NM_004006chrX1335 ------
NM_004007chrX1335 ------
NM_004009chrX1335 ------
NM_004010chrX1335 ------
NM_004011chrX1335 ------
NM_004012chrX1335 ------
NM_004013chrX1335 ------
NM_004014chrX1335 ------
NM_004015chrX1335 ------
NM_004016chrX1249 ------
NM_004017chrX1335 ------
NM_004018chrX1249 ------
NM_004020chrX1335 ------
NM_004021chrX1249 ------
NM_004022chrX1249 ------
NM_004023chrX1249 ------
NM_004028chr1823590 311 ------
NM_004036chr22685 660 --2468 269 --
NM_004040chr22898 396 --1315 --
NM_004050chr1411856 ------
NM_004068chr31338 1444 ----
NM_004077chr12--1217 11054 --
NM_004093chr1322704 911 ------
NM_004098chr101246 ------
NM_004103chr81121 ------
NM_004171chr1169520 7565 6824 2811 976 283 12838 23190 429 --
NM_004187chrX11257 ------
NM_004200chr1152532 2169 1044 956 234 11168 ----
NM_004202chrY1182 ------
NM_004205chr114447 378 234 212 ------
NM_004225chr821368 1331 ------
NM_004227chr732229 191 98 12312 ----
NM_004235chr91752 ------
NM_004272chr51523 ------
NM_004276chr122359 67 --1380 --
NM_004311chr1032905 2361 2249 ------
NM_004316chr12----1438 --
NM_004321chr232664 589 58 ------
NM_004326chr111212 --1905 --
NM_004331chr812117 ------
NM_004342chr722239 67 ------
NM_004356chr111469 ------
NM_004359chr19121 ------
NM_004370chr611562 ------
NM_004384chr5--2450 236 ----
NM_004393chr312102 194 ----
NM_004395chr5130 ------
NM_004397chr1143388 1663 1580 793 ------
NM_004405chr21281 --2410 324 --
NM_004409chr191629 --1618 --
NM_004416chr123775 62 36 1949 1323 --
NM_004419chr101290 ------
NM_004420chr1122253 598 --11814 1848
NM_004429chrX41171 330 84 63 --1322 --
NM_004430chr831104 933 284 11776 22190 356 --
NM_004432chr91614 ------
NM_004437chr132626 1410 1329 11339 ----
NM_004438chr242793 2117 790 94 --11118 --
NM_004442chr11102 ----11349
NM_004454chr31743 --1105 --
NM_004458chrX22425 1698 ------
NM_004459chr17--11716 ----
NM_004463chrX--2526 48 ----
NM_004472chr53127 84 58 ------
NM_004480chr141269 ------
NM_004496chr141839 --1294 --
NM_004498chr151273 ------
NM_004501chr124078 1084 1765 ----
NM_004514chr1722713 2583 12666 12436 --
NM_004517chr111195 ------
NM_004529chr91508 ------
NM_004575chr411160 --140 --
NM_004576chr5--1279 ----
NM_004583chr17--1598 1315 --
NM_004586chrX24991 163 11997 ----
NM_004588chr111950 --31080 857 78 --
NM_004603chr72834 307 --1363 --
NM_004630chr11----1873 --
NM_004643chr141247 ------
NM_004656chr3136 ------
NM_004663chr151451 ------
NM_004667chr15156 ------
NM_004687chr1711597 ------
NM_004698chr12173 34 ------
NM_004703chr171285 ------
NM_004714chr191338 ------
NM_004719chr1212797 ------
NM_004723chr121035 120 --2989 407 --
NM_004732chr171267 --1295 --
NM_004734chr132984 88 --1101 --
NM_004737chr2241085 462 409 55 ------
NM_004738chr202565 119 --1362 --
NM_004739chr111194 --1531 --
NM_004742chr321869 96 ------
NM_004745chr866201 5524 5275 1559 1155 28 --1112 --
NM_004765chr16127 ------
NM_004781chr131720 1387 511 --11655 --
NM_004781chr131720 1387 511 --11655 --
NM_004786chr18171 ------
NM_004788chr1112719 ------
NM_004789chr9----1121 --
NM_004798chr201299 ----11434
NM_004836chr2--1104 ----
NM_004840chrX22327 380 ------
NM_004842chr641529 1240 322 243 ------
NM_004859chr171561 ------
NM_004860chr17137 ------
NM_004861chr22124 --137 --
NM_004886chr19135 ------
NM_004906chr6--1456 ----
NM_004925chr9------1173
NM_004926chr141710 ------
NM_004930chr1----2209 86 --
NM_004936chr911956 ----1624
NM_004947chr3146 ------
NM_004948chr181445 ------
NM_004953chr31343 ------
NM_004954chr11--1274 ----
NM_004959chr921000 226 ----1927
NM_004961chrX2458 62 ------
NM_004973chr631449 1328 269 ------
NM_004977chr191522 ------
NM_004978chr1------1628
NM_004991chr31120 ------
NM_004992chrX96992 5868 5702 5171 3153 3122 3092 2398 2295 12994 --16920
NM_004992chrX96992 5868 5702 5171 3153 3122 3092 2398 2295 12994 --16920
NM_004995chr1431242 340 94 --11314 --
NM_005005chr8----163 --
NM_005011chr721307 723 ------
NM_005028chr1032155 835 161 ------
NM_005056chr1225287 2042 ------
NM_005060chr121032 22 ----11221
NM_005065chr1455142 4229 2156 753 464 ------
NM_005078chr1531366 530 341 ------
NM_005087chr3167 ------
NM_005103chr11125 ------
NM_005105chr111645 ------
NM_005109chr332061 883 312 ------
NM_005110chr5------1739
NM_005112chr41145 ------
NM_005116chr2053840 3726 1549 1299 423 --1213 1182
NM_005119chr111089 ------
NM_005134chr18162 ------
NM_005135chr1512535 12545 ----
NM_005161chr1141610 1558 1549 52 --2675 458 --
NM_005164chr12--22587 802 11007 --
NM_005180chr10--1102 ----
NM_005184chr1921229 221 --1227 11165
NM_005187chr1631565 1414 1386 ------
NM_005188chr1166445 6007 5223 3090 1795 1232 --25738 112 --
NM_005191chr3----1109 --
NM_005197chr1425032 161 --1513 --
NM_005219chr541754 1636 1371 725 ------
NM_005229chrX11208 ------
NM_005235chr247441 5629 4872 1739 15484 14838 --
NM_005241chr311237 ------
NM_005263chr13155 85 63 ------
NM_005264chr101803 ------
NM_005311chr722222 202 --2827 337 --
NM_005312chr932397 912 705 --2977 667 11870
NM_005328chr81279 ------
NM_005339chr43630 107 34 ------
NM_005342chrX32228 2009 89 22097 1792 ----
NM_005370chr19------130
NM_005386chr201111 --1713 --
NM_005397chr742459 2448 1607 877 13877 --1343
NM_005398chr1011133 ------
NM_005400chr232997 589 438 1806 1149 --
NM_005417chr2031486 559 473 --2654 71 --
NM_005430chr123203 179 62 189 1927 --
NM_005437chr102405 72 ------
NM_005442chr31579 ------
NM_005455chr121621 454 ------
NM_005458chr9------11617
NM_005461chr20----132 --
NM_005469chr20121 ------
NM_005476chr91349 ------
NM_005509chr51135 ------
NM_005515chr7--1631 --1136
NM_005563chr1----1594 --
NM_005569chr222229 48 ------
NM_005576chr15--1268 ----
NM_005593chr121138 ------
NM_005596chr935023 2527 1492 ------
NM_005598chr121589 1413 --1678 --
NM_005599chr12143 75 ------
NM_005614chr72823 762 ------
NM_005634chrX2547 96 --1222 --
NM_005637chr1811813 11657 ----
NM_005639chr12--131 ----
NM_005647chrX2817 128 ------
NM_005650chr221100 ------
NM_005660chrX1256 --148 --
NM_005667chr2148 ------
NM_005668chr511330 22860 696 1687 --
NM_005688chr321292 94 ------
NM_005718chr32870 703 ------
NM_005736chr10155 ------
NM_005748chr1243356 3278 3102 824 ------
NM_005768chr12274 48 ------
NM_005822chr612246 ------
NM_005841chr41931 ------
NM_005842chr131689 ------
NM_005845chr131347 ------
NM_005852chr172400 133 ------
NM_005859chr51195 ------
NM_005882chr41746 ------
NM_005904chr181175 --1148 --
NM_005906chr6--1194 ----
NM_005909chr513588 ------
NM_005911chr2----11397 --
NM_005920chr133071 2837 197 ----12627
NM_005933chr1142791 2135 643 284 12431 ----
NM_005934chr1921707 476 --3124 85 63 22453 306
NM_005938chrX21310 518 ------
NM_005941chr821220 882 ------
NM_005943chr631374 1219 601 ------
NM_005955chr143975 1884 1033 754 --24971 1494 --
NM_005964chr1721174 369 ------
NM_005994chr172903 140 --1865 --
NM_006007chr924229 1761 13666 ----
NM_006011chr1524238 3079 ----12898
NM_006015chr131005 994 70 ------
NM_006022chr131104 --1412 --
NM_006030chr32246 50 --195 --
NM_006037chr211397 --14924 --
NM_006038chr201352 ------
NM_006047chr2032371 1290 369 ------
NM_006064chrX--1297 ----
NM_006076chr72325 75 --1191 13032
NM_006080chr7142 ------
NM_006089chrX--11296 11341 --
NM_006091chr152629 480 ------
NM_006095chr453920 3299 1484 262 126 ------
NM_006096chr821299 72 ------
NM_006099chr12838 783 ------
NM_006106chr11--22530 317 ----
NM_006108chr1112341 2451 125 ----
NM_006113chr132074 536 196 ------
NM_006156chr14--136 ----
NM_006158chr811585 ------
NM_006160chr1731225 186 41 --1205 --
NM_006167chr81679 ------
NM_006180chr9--1406 ----
NM_006186chr21454 ------
NM_006194chr141170 1261 1830 --
NM_006195chr91519 ------
NM_006210chr19--1299 ----
NM_006211chr8197 ------
NM_006228chr81363 --1309 --
NM_006237chr13175 --1134 --
NM_006251chr5--1699 ----
NM_006256chr11664 ------
NM_006265chr8154 ------
NM_006268chr112994 278 ------
NM_006281chr8196 ------
NM_006281chr8196 ------
NM_006283chr83739 88 68 ------
NM_006317chr5--1173 ----
NM_006328chr111189 ------
NM_006352chr121596 267 ------
NM_006359chrX11897 --1543 --
NM_006361chr1711749 11564 ----
NM_006367chr1126 ------
NM_006379chr711624 ------
NM_006380chr1723468 984 23478 2834 --1534
NM_006386chr223869 491 81 ------
NM_006411chr61204 ------
NM_006420chr20------13347
NM_006434chr1022450 2407 1668 ----
NM_006454chr41156 12366 ----
NM_006459chr1021793 357 ------
NM_006482chr12--13503 ----
NM_006483chr191338 ------
NM_006484chr191338 ------
NM_006489chr141762 21597 1331 ----
NM_006500chr11----1115 --
NM_006516chr131419 517 357 ------
NM_006517chrX11595 22066 784 ----
NM_006540chr8--1225 ----
NM_006544chr1414091 12310 --14520
NM_006546chr1715426 1130 12349 15126
NM_006548chr31657 ------
NM_006549chr1222648 41 ------
NM_006557chr91451 11698 ----
NM_006558chr81393 ------
NM_006560chr11--1103 ----
NM_006561chr1024484 118 --14759 --
NM_006562chr101236 ------
NM_006565chr161848 ------
NM_006575chr141186 1925 ----
NM_006587chr41592 ------
NM_006593chr22584 292 ------
NM_006599chr1636796 1838 1370 ------
NM_006603chrX11266 ------
NM_006614chr3--22496 587 ----
NM_006621chr131643 1583 365 ------
NM_006625chr11418 ------
NM_006625chr11418 ------
NM_006625chr11418 ------
NM_006628chr1514527 1569 13680 13473
NM_006646chr1322246 780 12628 ----
NM_006654chr1224273 1034 ------
NM_006698chr2021322 545 --1274 --
NM_006699chr112401 ------
NM_006711chr16----123 --
NM_006729chrX12032 ------
NM_006741chr12----1185 11016
NM_006744chr102167 85 ------
NM_006750chr1657040 5631 5450 669 568 17093 ----
NM_006761chr172748 614 ----1753
NM_006769chr11147 ------
NM_006772chr6--1140 21235 248 --
NM_006775chr63855 93 84 11248 11992 --
NM_006795chr1121506 365 --1116 --
NM_006800chrX--1141 ----
NM_006805chr52680 114 ------
NM_006813chr61250 ------
NM_006826chr21517 ------
NM_006827chr1442556 1160 430 118 ------
NM_006852chr1722066 522 ------
NM_006854chr721959 186 ------
NM_006861chr12----2663 538 11522
NM_006876chr112544 85 ------
NM_006884chr321928 1294 --1137 --
NM_006885chr161340 21030 516 ----
NM_006887chr2165 --174 --
NM_006888chr1443371 2983 2664 1039 --12575 --
NM_006896chr71221 ------
NM_006898chr21199 --1110 --
NM_006899chr201265 --1300 --
NM_006901chr15------181
NM_006908chr711210 ----11261
NM_006924chr17--1668 ----
NM_006939chr141893 ------
NM_006940chr1211586 ------
NM_006950chrX1884 ------
NM_006981chr91410 ------
NM_006988chr21196 ------
NM_006997chr101371 --1295 --
NM_007008chr21310 ------
NM_007011chr1576417 6356 4443 4236 2670 2604 556 --1250 --
NM_007014chr1631757 1508 135 ------
NM_007026chr171390 ------
NM_007030chr564221 1979 1917 1147 897 733 12011 2857 243 --
NM_007040chr1911051 ------
NM_007043chr1212121 ------
NM_007052chrX169 ------
NM_007064chr31139 ------
NM_007067chr171367 --1322 --
NM_007084chr131983 --2561 418 --
NM_007111chr131287 ------
NM_007124chr6146 1669 ----
NM_007126chr9------171
NM_007144chr1731278 957 364 ------
NM_007146chr1712748 ------
NM_007150chrX3727 135 71 ------
NM_007170chr11363 ------
NM_007185chr12778 336 ------
NM_007192chr141994 ------
NM_007202chr171736 ------
NM_007214chr6--2436 416 ----
NM_007221chr11366 ------
NM_007222chr8--171 ----
NM_007225chr171371 --11051 --
NM_007245chr16----1746 1144
NM_007249chr1339134 7944 7609 --1726 --
NM_007260chr11728 ------
NM_007331chr422537 1101 ------
NM_007357chr1--1180 ----
NM_007363chrX1806 1384 1351 1956
NM_007372chr17----1754 --
NM_012069chrX22433 135 ------
NM_012081chr523728 2645 ----13420
NM_012090chr1----1930 --
NM_012097chr211850 ------
NM_012124chr112827 610 ------
NM_012137chr12733 493 ------
NM_012141chr1323162 2914 ------
NM_012164chr912235 15703 ----
NM_012193chr1134652 4554 1565 ------
NM_012199chr124073 1410 ------
NM_012214chr246162 4608 2564 2314 12574 ----
NM_012215chr1011677 ------
NM_012232chr17----135 --
NM_012234chr31140 13447 ----
NM_012245chr141401 ------
NM_012247chr101284 ------
NM_012249chr21483 ------
NM_012257chr711029 ------
NM_012259chr6--11141 ----
NM_012262chr1--1546 --12066
NM_012264chr2211788 ----1178
NM_012264chr2211788 ----1178
NM_012282chrX2660 98 ----146
NM_012287chr3------1358
NM_012288chr644715 2175 745 325 --14908 --
NM_012297chr422157 409 ------
NM_012300chr531581 1575 740 ------
NM_012301chr73900 672 405 ------
NM_012308chr1132441 1640 268 --1277 --
NM_012311chr102640 57 ------
NM_012323chr2221522 241 ------
NM_012325chr2021573 598 11275 ----
NM_012329chr1711289 ------
NM_012399chr2231958 1824 716 ------
NM_012410chr16----1450 --
NM_012446chr51215 ------
NM_012447chr7--1347 ----
NM_012473chr22----131 --
NM_012479chr742171 536 392 146 ------
NM_013246chr113668 302 24 --1963 --
NM_013261chr423661 2782 ----12290
NM_013281chr20--11486 ----
NM_013309chr1522659 138 ------
NM_013316chr71913 ------
NM_013341chr212630 ------
NM_013392chr21408 ------
NM_013396chr21157 ------
NM_013423chrX1935 ------
NM_013427chrX1935 ------
NM_013443chr921003 408 ------
NM_013449chr122543 313 --1132 --
NM_013450chr211063 ------
NM_014000chr1021636 1480 ------
NM_014023chr1032420 1796 1176 ------
NM_014030chr17----2824 295 --
NM_014109chr81477 ------
NM_014155chr1124865 1059 11286 ----
NM_014181chr222652 140 ------
NM_014212chr122185 81 ----1394
NM_014231chr1231717 1619 1594 1593 ----
NM_014232chr1721234 269 --11339 --
NM_014232chr1721234 269 --11339 --
NM_014240chr322997 717 33466 3297 783 ----
NM_014243chr41268 ------
NM_014251chr71786 ------
NM_014253chrX2533 422 ------
NM_014282chr921294 1181 ------
NM_014283chr121257 541 ------
NM_014286chr932864 2542 537 13271 43571 463 456 450 --
NM_014289chrX31118 1100 961 ----11378
NM_014292chr221756 11737 179 --
NM_014293chr2253526 1321 1071 763 32 --13991 --
NM_014309chr2234333 3557 1046 --11884 15122
NM_014319chr1221750 298 ------
NM_014322chr1--2985 138 ----
NM_014325chr1211487 ------
NM_014363chr1311039 ------
NM_014393chr82305 81 ----12315
NM_014405chr1772306 1710 1597 1490 1442 818 356 11579 12286 12030
NM_014415chr31438 ------
NM_014423chr534560 4532 4195 11494 ----
NM_014431chr1011626 ------
NM_014445chr311544 ------
NM_014452chr6--1910 ----
NM_014491chr7--1291 ----
NM_014494chr1652144 2068 626 255 69 ------
NM_014515chr122871 782 ------
NM_014562chr2195 ------
NM_014572chr1331675 696 29 ------
NM_014612chr911438 ------
NM_014613chr512705 --12074 --
NM_014621chr2185 ------
NM_014636chr9----1881 1431
NM_014637chr81530 ------
NM_014665chr873011 2295 1386 1247 1149 652 251 ------
NM_014666chr51396 ------
NM_014667chr3----11684 --
NM_014676chr121407 227 --11355 --
NM_014686chr1922417 661 ------
NM_014689chr21126 ------
NM_014702chr623506 2115 ------
NM_014705chr7137 ------
NM_014707chr712268 ------
NM_014717chr191545 --136 --
NM_014721chr616286 --16405 --
NM_014730chr1223789 696 --23237 207 --
NM_014730chr1223789 696 --23237 207 --
NM_014746chr2197 11463 ----
NM_014748chr2----156 --
NM_014755chr22444 93 --11359 --
NM_014758chr112892 637 ----11539
NM_014765chr122505 885 ------
NM_014766chr7----23796 2843 --
NM_014772chr1853049 3006 2858 928 856 --12740 --
NM_014800chr7----1808 1374
NM_014812chr11236 ------
NM_014824chr1131721 1428 1299 ------
NM_014826chr123673 742 --383 49 28 --
NM_014827chr121670 109 ------
NM_014828chr141328 12434 1942 --
NM_014830chr1223686 906 11288 --1223
NM_014836chr1011861 1450 ----
NM_014840chr12--12973 1409 --
NM_014871chr121583 ------
NM_014876chr22184 1610 127 --
NM_014877chr1725941 2985 --15933 --
NM_014884chr19152 ------
NM_014901chr521830 107 ------
NM_014903chr1221950 392 ------
NM_014912chr101422 ------
NM_014918chr1511486 ------
NM_014921chr1922834 2241 ------
NM_014923chr1311939 ------
NM_014925chr122747 288 ------
NM_014931chr19194 1537 ----
NM_014934chr1323814 2877 ------
NM_014935chr142419 1062 568 495 --21157 322 --
NM_014946chr21210 ------
NM_014947chr1--22801 951 1942 --
NM_014949chr11668 ------
NM_014952chr1531490 836 593 --1392 --
NM_014961chr4--12058 ----
NM_014962chr2021792 57 ------
NM_014974chr1021371 1364 1207 --11418
NM_014991chr4--1650 12081 --
NM_014999chr1221428 52 --1263 --
NM_015000chr1221906 484 ------
NM_015001chr1--2805 384 ----
NM_015008chr322395 1206 --12725 --
NM_015020chr1613574 1145 11446 --
NM_015024chr81592 ----11294
NM_015026chr1211026 ------
NM_015032chr1311165 ------
NM_015033chr932722 246 207 --4986 762 749 336 --
NM_015039chr131268 433 91 ------
NM_015042chr1523304 906 --1844 --
NM_015045chr1011591 ------
NM_015059chr152820 579 --11487 --
NM_015063chr1941295 966 371 155 --122 --
NM_015068chr723895 561 ------
NM_015069chr16140 ------
NM_015071chr511109 24753 704 11144 14439
NM_015075chrX21825 1640 --32056 1646 388 --
NM_015080chr111200 1901 2359 167 --
NM_015090chr125774 585 14051 21214 265 --
NM_015091chr141309 ------
NM_015092chr1613287 ------
NM_015094chr2221129 292 --22980 1637 1805
NM_015099chr17----1176 --
NM_015107chrX2534 455 ----1272
NM_015125chr191102 --1515 --
NM_015133chr1621355 996 1490 ----
NM_015138chr1512823 ------
NM_015143chr41246 ------
NM_015144chr1623199 2639 13075 --1213
NM_015150chr31327 1842 ----
NM_015155chr1013226 1755 ----
NM_015158chr91837 ------
NM_015161chr162146 44 --1308 --
NM_015170chr822174 318 ------
NM_015192chr2012843 ----1655
NM_015200chr412009 ------
NM_015206chr1512581 12725 2720 546 --
NM_015209chr1----11716 22059 480
NM_015215chr123138 916 ------
NM_015247chr1624569 4511 --15318 --
NM_015250chr91270 ------
NM_015252chr21848 ------
NM_015265chr232382 2305 229 ------
NM_015271chr414115 11243 ----
NM_015272chr1621484 409 ------
NM_015288chr523313 2797 --1408 --
NM_015292chr12--1704 152 --
NM_015296chr131109 ------
NM_015299chr1433668 2788 1298 12921 ----
NM_015305chr1421468 421 --1192 --
NM_015315chr522615 1396 1455 21185 655 --
NM_015316chr143278 204 31 1180 ----
NM_015317chr2----12383 --
NM_015328chr711121 12511 --12717
NM_015332chr743289 3093 95 27 12754 1508 --
NM_015336chr1211636 ------
NM_015349chr612836 ------
NM_015356chr8----164 --
NM_015365chrX1324 ------
NM_015378chr11280 ------
NM_015382chr141106 ------
NM_015385chr1022450 2407 1668 ----
NM_015393chr433498 2394 1279 ------
NM_015449chr1267 21 ------
NM_015457chr11----1279 --
NM_015470chr221246 103 ------
NM_015475chr2--1265 ----
NM_015481chr121828 1706 2801 761 --
NM_015488chr2--11476 1401 --
NM_015496chr81276 ------
NM_015508chr331390 1213 592 ------
NM_015520chr3----1485 --
NM_015534chr11140 ------
NM_015541chr3--1134 ----
NM_015553chr654715 4647 3426 1983 512 34223 4073 362 ----
NM_015557chr142578 866 272 242 13580 ----
NM_015569chr124467 1570 24415 143 ----
NM_015571chr612281 ------
NM_015576chr332967 741 729 ------
NM_015577chr51709 ------
NM_015578chr1911908 ------
NM_015584chr171337 ------
NM_015595chr32136 124 1793 ----
NM_015610chr762403 2154 1080 721 584 287 12290 --12007
NM_015635chr922009 177 11543 ----
NM_015646chr1211282 150 ----
NM_015657chr21678 ------
NM_015678chr13187 ------
NM_015680chr2189 ------
NM_015686chrX----2953 513 12143
NM_015694chr7----1137 --
NM_015711chr191116 ------
NM_015719chr191610 1126 ----
NM_015726chr111571 --11541 --
NM_015850chr811727 ------
NM_015872chr131338 1171 1110 --2656 373 --
NM_015878chr811672 ------
NM_015892chr101458 ------
NM_015904chr21279 ------
NM_015912chr81355 ------
NM_015981chr512377 ------
NM_015982chr17----1318 --
NM_015995chr1553844 3645 3587 1631 937 ------
NM_016003chr762403 2154 1080 721 584 287 12290 --12007
NM_016019chr71297 ------
NM_016022chr11107 185 1445 --
NM_016026chr141126 ----1464
NM_016032chrX--1526 ----
NM_016037chr1--1811 1802 --
NM_016045chr2021286 391 1622 ----
NM_016073chr151238 ------
NM_016083chr6--1576 12814 --
NM_016096chr812070 11395 ----
NM_016107chr51266 ------
NM_016131chr222252 476 ------
NM_016147chr111851 1988 ----
NM_016169chr1022580 678 --13254 --
NM_016205chr4------128
NM_016206chr318535 23590 2022 ----
NM_016227chr121257 541 ------
NM_016231chr171467 ------
NM_016260chr212915 12927 --26540 2159
NM_016269chr4--11113 ----
NM_016312chr121386 ------
NM_016322chr922569 1050 12843 ----
NM_016338chr511046 ------
NM_016376chr171714 --33581 1126 505 --
NM_016377chr641529 1240 322 243 ------
NM_016395chr15127 ------
NM_016418chr2231114 853 782 22868 349 11320 --
NM_016436chr2011875 ------
NM_016488chr1231911 1695 45 ------
NM_016531chr42582 396 1967 ----
NM_016542chrX11710 ------
NM_016559chr31999 ------
NM_016605chr521685 841 11844 1145 --
NM_016607chrX1222 ------
NM_016626chr18------1622
NM_016628chr10--155 ----
NM_016656chrX--1297 ----
NM_016733chr222229 48 ------
NM_016830chr12179 ------
NM_016932chr25883 770 582 312 26 ----1672
NM_016936chr1621891 23 ------
NM_017409chr121539 ------
NM_017412chr831040 1006 946 ----11013
NM_017415chr514205 --13305 --
NM_017447chr2113944 ------
NM_017449chr11102 ----11349
NM_017450chr173999 335 85 --163 --
NM_017488chr2--1505 --1528
NM_017490chr11--1274 ----
NM_017491chr41145 ------
NM_017553chr15----179 --
NM_017573chr19----129 --
NM_017590chr2221883 1844 ------
NM_017599chr121307 ------
NM_017602chrX2223 90 ------
NM_017610chr15----21663 24 --
NM_017626chr1031303 1189 262 ------
NM_017632chr41447 ------
NM_017637chr958726 7491 6566 6050 2625 13418 ----
NM_017640chr62342 131 ------
NM_017643chr1733120 2538 2414 ------
NM_017650chr716047 ------
NM_017660chr191276 --22760 705 --
NM_017662chr911509 --134 12029
NM_017666chrX1274 --11558 --
NM_017694chr221506 835 ------
NM_017715chr72497 205 ------
NM_017730chr31159 ------
NM_017742chr1811794 ------
NM_017747chr5--1127 ----
NM_017753chr9----1164 --
NM_017758chr1731510 1256 51 --1424 --
NM_017778chr81109 ------
NM_017779chr112732 12184 ----
NM_017780chr81631 ------
NM_017798chr20187 1141 ----
NM_017799chr1421697 1422 --11530 --
NM_017813chr815165 ------
NM_017831chr1834184 3056 1517 11700 ----
NM_017848chrX24013 3316 1772 ----
NM_017849chr211244 13076 12303 --
NM_017851chr15----1884 --
NM_017902chr1043815 610 204 123 14674 34716 4177 781 12007
NM_017915chr1221105 371 ------
NM_017919chr911066 ------
NM_017921chr17----31789 1785 298 11570
NM_017933chr211150 --11012 --
NM_017938chrX1342 ------
NM_017944chr111916 ------
NM_017987chr102475 261 ------
NM_017990chr1623896 1634 --1183 --
NM_017994chr72207 52 1787 ----
NM_018027chr10------1320
NM_018071chr142226 153 ------
NM_018086chr221482 1193 ------
NM_018103chr11317 ------
NM_018110chr16----31238 878 134 --
NM_018113chr121397 ------
NM_018133chr3183 ----21409 854
NM_018156chr11280 ------
NM_018172chr1111110 ------
NM_018182chr17----32020 592 171 --
NM_018189chr311406 1344 ----
NM_018203chr1127 ------
NM_018207chr1--11727 ----
NM_018222chr111490 ------
NM_018245chr102366 29 --1356 --
NM_018246chr811785 11744 ----
NM_018299chr812610 ------
NM_018312chr1121710 271 --11781 --
NM_018315chr411083 ------
NM_018348chr16--148 ----
NM_018362chr1113409 13202 ----
NM_018364chr13357 345 101 --12826 --
NM_018387chr91441 ------
NM_018399chr61261 --1534 --
NM_018440chr845720 1530 569 509 --1789 --
NM_018442chr11351 ------
NM_018452chr6_random11078 23553 1452 ----
NM_018469chr1721198 346 ------
NM_018489chr11307 ----1543
NM_018490chr111535 ------
NM_018534chr2------185
NM_018557chr211063 ------
NM_018622chr3139 ------
NM_018640chr1222267 171 12476 ----
NM_018644chr1112095 --1867 --
NM_018650chr11117 ------
NM_018652chr151338 ------
NM_018667chr1612205 1343 ----
NM_018685chr71840 ------
NM_018698chrX1167 ----11562
NM_018712chr111234 ------
NM_018715chr142111 1476 913 825 ------
NM_018717chr42918 313 ------
NM_018718chr712136 1821 ----
NM_018841chr1----126 --
NM_018890chr711210 ----11261
NM_018898chr512166 ------
NM_018899chr512166 ------
NM_018900chr512166 ------
NM_018901chr512166 ------
NM_018902chr512166 ------
NM_018903chr512166 ------
NM_018904chr512166 ------
NM_018905chr512166 ------
NM_018906chr512166 ------
NM_018907chr512166 ------
NM_018908chr512166 ------
NM_018909chr512166 ------
NM_018910chr512166 ------
NM_018911chr512166 ------
NM_018951chr72915 121 ------
NM_018952chr17----1245 --
NM_018957chr221309 1110 175 --
NM_018958chr1523722 2858 ------
NM_018970chr7------12988
NM_018976chr121120 ------
NM_018977chrX1910 --1361 --
NM_018979chr121122 ------
NM_018994chr11563 ------
NM_018999chr1021298 701 11942 ----
NM_019000chr5------11560
NM_019008chr2243593 3578 2973 801 --1346 --
NM_019009chr1162307 1952 1914 722 110 27 --1474 --
NM_019027chr41663 11034 ----
NM_019036chr6--1838 ----
NM_019066chr15----123 --
NM_019072chr523529 451 ------
NM_019074chr151157 ------
NM_019084chr101396 ------
NM_019096chr61314 1440 ----
NM_019102chr71119 ------
NM_019102chr71119 ------
NM_019114chr922276 2210 1112 ----
NM_019116chr1623338 558 11481 23332 786 13217
NM_019556chrX----1439 --
NM_019605chr11624 ------
NM_019606chr72486 41 ------
NM_019885chr222261 522 --1117 --
NM_019895chr31966 ------
NM_020132chr2144214 3822 760 475 ------
NM_020144chr7125 ------
NM_020152chr211147 ------
NM_020177chr523233 1070 13017 ----
NM_020180chr1821351 1309 --21345 1238 --
NM_020182chr2023187 715 ------
NM_020189chr8152 ------
NM_020193chr11194 ------
NM_020235chr31119 ------
NM_020239chr112227 --11443 --
NM_020336chr2023749 1143 ------
NM_020338chr10--13734 --13202
NM_020362chr11848 ------
NM_020374chr1221371 357 ------
NM_020381chr61262 21468 570 ----
NM_020416chr41523 ------
NM_020432chr71361 ------
NM_020440chr121341 731 ----11003
NM_020449chrX1584 ------
NM_020456chr1321740 1481 ------
NM_020457chr161569 ------
NM_020475chr81558 --32101 1602 606 --
NM_020476chr81558 --32101 1602 606 --
NM_020477chr81558 --32101 1602 606 --
NM_020480chr81558 --32101 1602 606 --
NM_020532chr21310 ------
NM_020546chr52599 364 --1506 --
NM_020630chr101710 1197 ----
NM_020689chr20----21444 172 11290
NM_020690chr51211 ------
NM_020699chr133817 2146 1642 11460 ----
NM_020708chr207841 752 591 482 460 258 60 --2745 388 --
NM_020713chr2032108 1172 252 --13088 --
NM_020718chr1645310 1890 520 185 16004 ----
NM_020737chr6------1214
NM_020742chrX--1479 ----
NM_020748chr17--11384 ----
NM_020752chr1012296 ------
NM_020753chr17150 ------
NM_020760chr2--11651 ----
NM_020765chr1144 ------
NM_020766chrX24234 408 ------
NM_020769chrX1345 ------
NM_020772chr1742323 2269 2003 599 38398 7715 6564 ----
NM_020775chr11180 ------
NM_020783chr181379 12448 ----
NM_020801chr51856 1114 ----
NM_020820chr2021427 172 --1981 --
NM_020836chr142616 33 ------
NM_020841chr1211384 ------
NM_020845chr1231746 974 289 ------
NM_020854chr18176 --11055 --
NM_020858chr155866 410 194 156 91 ------
NM_020871chrX21672 167 ------
NM_020872chr31663 ------
NM_020895chr191219 ------
NM_020896chr113753 313 283 ------
NM_020899chr171687 ------
NM_020918chr1013392 12890 --1836
NM_020922chrX11822 ------
NM_020924chr91181 ------
NM_020940chr1012615 ------
NM_020943chr21221 ------
NM_020949chr31207 ------
NM_020962chr15--2535 387 4951 908 690 651 --
NM_020972chr4--1219 ----
NM_020987chr1011062 --1414 --
NM_021019chr12----125 --
NM_021033chr1311213 136 1987 164
NM_021035chr20128 ------
NM_021038chr313389 ------
NM_021103chr21190 ------
NM_021106chr91482 --1589 --
NM_021111chr91122 ------
NM_021148chr722518 2319 1872 ----
NM_021149chr16129 ------
NM_021174chr83686 591 256 ------
NM_021189chr11213 ------
NM_021238chr121744 --1701 --
NM_021242chrX2754 735 ------
NM_021249chr1421382 236 ------
NM_021260chr1421409 1330 ------
NM_021638chr454412 1150 901 545 47 23795 980 34925 3427 453 --
NM_021643chr221689 264 1570 ----
NM_021783chrX1663 ----139
NM_021813chr611016 --11831 1211
NM_021905chr641560 1539 632 290 --11473 --
NM_021911chr521958 1896 ------
NM_021954chr132907 621 ------
NM_021961chr1136815 5281 2024 11504 ----
NM_021964chr316352 ------
NM_021984chrX2458 62 ------
NM_021987chrX2458 62 ------
NM_021990chrX2458 62 ------
NM_022048chr1544361 4240 2376 2251 15705 --1246
NM_022080chr201139 ------
NM_022107chr6130 ------
NM_022114chr143538 1783 1196 1133 --24337 3690 --
NM_022117chrX2503 59 --1555 --
NM_022123chr141117 ------
NM_022166chr1645529 4155 1511 1272 14608 --1469
NM_022373chr7------1792
NM_022459chr1321000 418 25279 2148 --14132
NM_022479chr71976 --11352 --
NM_022494chr101329 ------
NM_022497chr332826 2792 550 ------
NM_022572chr2--11476 1401 --
NM_022574chr742043 1746 1415 871 ------
NM_022648chr224201 872 24004 1361 11832 --
NM_022650chr5184 ------
NM_022737chr1921037 47 --4992 523 140 92 --
NM_022745chr11118 --12470 11187
NM_022749chr811234 ----11125
NM_022753chr122436 136 ------
NM_022756chr1--11022 ----
NM_022758chr613076 ------
NM_022781chr932658 2546 1208 --1797 --
NM_022831chr1--11525 ----
NM_022841chr151159 11959 ----
NM_022845chr1622189 468 1685 ----
NM_022893chr2171 11000 ----
NM_022898chr1454257 3863 3095 704 74 ------
NM_022977chrX22425 1698 ------
NM_023000chr1411164 ------
NM_023001chr1411164 ------
NM_023009chr11753 ------
NM_023035chr191577 ------
NM_023037chr131269 ------
NM_023076chr1622734 79 ------
NM_023105chr811727 ------
NM_023106chr811727 ------
NM_023110chr811727 ------
NM_023111chr811727 ------
NM_023925chr122218 73 ------
NM_024007chr512961 --1975 --
NM_024017chr1731611 342 167 ------
NM_024034chr20--1345 --1418
NM_024045chr10135 ------
NM_024046chr33971 340 162 --31201 410 103 --
NM_024060chr111311 ------
NM_024071chr142448 421 ------
NM_024085chr23854 700 163 --1890 --
NM_024293chr21278 --1643 --
NM_024294chr613076 ------
NM_024312chr12--11158 ----
NM_024328chr14------1184
NM_024336chr16173 ------
NM_024430chr181212 ------
NM_024496chr14127 ------
NM_024507chr16------133
NM_024522chr1----2503 33 --
NM_024524chr321274 175 ------
NM_024525chr11562 ------
NM_024551chr1212283 --11724 --
NM_024551chr1212283 --11724 --
NM_024554chr1----11432 171
NM_024561chr1311375 ------
NM_024565chr521364 548 ------
NM_024612chr17------1984
NM_024624chr21623 ------
NM_024639chr612925 22359 151 ----
NM_024659chr21405 ------
NM_024676chr11336 11287 1324 --
NM_024692chr221370 521 ----1606
NM_024704chr202288 44 ------
NM_024740chr1122850 80 12965 ----
NM_024742chr1641271 692 424 403 ------
NM_024769chr11161 ------
NM_024770chr215690 24376 1928 15618 --
NM_024784chr11--1992 ----
NM_024785chr21493 ------
NM_024787chr8140 --1866 --
NM_024792chr17----1165 --
NM_024798chr1512255 22189 499 ----
NM_024837chr152734 231 ------
NM_024859chrX2414 245 ------
NM_024887chr122048 28 21968 508 ----
NM_024900chr4--11939 --22299 41
NM_024900chr4--11939 --22299 41
NM_024915chr812461 1257 ----
NM_024946chr161317 ------
NM_024949chr454621 4144 3854 3249 848 1252 ----
NM_024989chr227566 2417 ------
NM_024991chr1022450 2407 1668 ----
NM_024993chr231612 1348 528 ------
NM_025054chr8----14022 --
NM_025129chr19--164 ----
NM_025133chr2--185 ----
NM_025134chr1611971 ------
NM_025151chr82854 72 ------
NM_025160chr143590 1178 643 110 --1534 --
NM_025164chr11188 ------
NM_025179chr1--21278 209 ----
NM_025191chr111413 --1395 --
NM_025221chr411215 ------
NM_025222chr3--12036 1434 --
NM_025224chr20----136 --
NM_025235chr10------1100
NM_025237chr171406 ------
NM_025250chr732998 2254 618 12515 2538 138 --
NM_025251chr8192 --41187 415 252 66 1375
NM_030581chr16199 ------
NM_030594chr15----11166 --
NM_030621chr1453365 3264 2591 1548 662 ------
NM_030627chr5----11629 --
NM_030647chr725897 4202 --14430 --
NM_030648chr435454 3418 1682 11844 ----
NM_030661chr711039 ------
NM_030664chr1011542 ------
NM_030665chr171975 ----1251
NM_030755chr1412773 22478 437 ----
NM_030758chr221469 ------
NM_030761chr1----12570 --
NM_030762chr121310 ------
NM_030766chr121314 ------
NM_030767chr932696 2099 1912 12706 ----
NM_030780chr81352 1532 ----
NM_030795chr8----173 --
NM_030799chr511890 ------
NM_030808chr172724 210 ------
NM_030809chr12--11939 ----
NM_030813chr112571 182 ----1886
NM_030816chr112445 --12991 12374
NM_030881chr223869 491 81 ------
NM_030884chr3121 --2384 288 --
NM_030913chr11145 --4497 482 294 94 --
NM_030918chr164798 3675 3398 1809 1445 1075 22033 1863 --13686
NM_030923chr2----1162 --
NM_030958chr8------1366
NM_030964chr523468 2667 --1776 --
NM_030981chr1111053 ------
NM_031205chr122359 67 --1380 --
NM_031243chr711748 ------
NM_031262chr9----1716 --
NM_031263chr9----1773 --
NM_031297chr9----140 --
NM_031309chr821543 163 --1636 --
NM_031411chr512166 ------
NM_031417chr192318 242 1903 1520 --
NM_031418chr111470 1524 ----
NM_031438chr51583 ------
NM_031445chr242577 2159 1277 1127 ------
NM_031453chr102190 164 ------
NM_031468chr737835 6365 2089 --15929 --
NM_031469chr623093 122 ------
NM_031478chr16----198 --
NM_031844chr124078 1084 1765 ----
NM_031849chr512166 ------
NM_031857chr512166 ------
NM_031860chr512166 ------
NM_031890chr2222672 2233 1281 ----
NM_032041chr832735 2150 1904 ------
NM_032051chr222274 228 ------
NM_032108chr19----1172 --
NM_032109chr551185 1145 211 131 115 --3412 154 137 1584
NM_032121chrX2836 669 ------
NM_032153chr33953 599 107 --134 21879 756
NM_032156chr122218 73 ------
NM_032160chr1833314 777 208 13649 ----
NM_032182chr10--11093 ----
NM_032192chr17--1162 199 --
NM_032195chr211121 ------
NM_032199chr1033423 3329 621 ------
NM_032221chr2011964 ------
NM_032246chr15----179 --
NM_032268chr1632618 2268 431 --13109 --
NM_032281chr1922155 258 --11176 1401
NM_032288chr331951 1531 345 --1420 --
NM_032298chr192428 355 ------
NM_032307chr9--1115 ----
NM_032364chr1211017 2321 147 ----
NM_032373chr102303 54 ------
NM_032430chr191333 --1126 --
NM_032431chr11149 ------
NM_032434chr221260 211 --1280 1239
NM_032440chr101286 ------
NM_032452chr1421437 154 ----11370
NM_032457chr4------13839
NM_032482chr1922569 354 --1381 --
NM_032491chr121449 ------
NM_032538chr632674 1990 777 1366 2433 239 --
NM_032550chr102950 469 ------
NM_032552chr9123 ------
NM_032560chr141237 ------
NM_032569chr161137 --2788 313 --
NM_032595chr1711575 --2994 232 --
NM_032632chr14----11651 --
NM_032682chr3--1410 ----
NM_032741chr61204 ------
NM_032796chrX2679 144 ------
NM_032840chr1221153 270 ------
NM_032873chr112866 212 ------
NM_032875chr17------1560
NM_032876chr14--1342 ----
NM_032883chr202131 31 --1271 --
NM_032900chr1011452 ------
NM_032924chr7153 --1854 --
NM_032927chr4--133 ----
NM_032949chr131458 ------
NM_032961chr411369 ------
NM_033016chr223559 315 60 --21331 100 1213
NM_033044chr1----1930 --
NM_033055chr11232 ------
NM_033058chr8171 ------
NM_033129chr201373 --135 182
NM_033132chr131107 ------
NM_033133chr1732804 2297 945 11201 ----
NM_033138chr722239 67 ------
NM_033139chr722239 67 ------
NM_033140chr722239 67 ------
NM_033157chr722239 67 ------
NM_033161chr9----11624 --
NM_033181chr6--1576 12814 --
NM_033211chr51574 ------
NM_033224chr746618 6310 2531 1481 16628 ----
NM_033244chr155333 121 106 91 76 11063 ----
NM_033285chr823653 185 ------
NM_033305chr911321 ------
NM_033315chr17--1485 1196 --
NM_033343chr1172 ------
NM_033375chr171579 --11285 11075
NM_033380chrX--1294 ----
NM_033381chrX--1294 ----
NM_033387chr93839 617 251 1279 12349 --
NM_033389chr1724638 322 11538 ----
NM_033505chr215432 1679 16641 --
NM_033549chr52948 927 ------
NM_033551chr522615 1396 1455 21185 655 --
NM_033631chr133273 1322 780 1441 ----
NM_033632chr411083 ------
NM_033637chr1013150 ----130
NM_033644chr531581 1575 740 ------
NM_033645chr531581 1575 740 ------
NM_033656chr21--14081 ----
NM_052845chr1233211 2901 154 --166 --
NM_052896chr11124 --1159 --
NM_052897chr12----1844 --
NM_052904chr62942 169 ------
NM_052907chr121396 ------
NM_052910chr131675 11384 41423 1353 305 235 --
NM_052918chr1043180 2991 2423 53 ------
NM_052937chr81613 ------
NM_052954chr21143 ------
NM_052958chr81713 ------
NM_052998chr11175 ------
NM_053016chr92414 113 11488 ----
NM_053024chr31295 1453 ----
NM_054025chr1112095 --1867 --
NM_054027chr51408 --1859 --
NM_057089chr71333 ------
NM_057175chr41118 ------
NM_057749chr81104 ------
NM_058172chr41667 ------
NM_078470chr1012586 1642 ----
NM_078625chr6----11114 --
NM_078629chrX--1141 ----
NM_078630chrX--1141 ----
NM_079834chr1941666 1430 1308 538 --21589 579 --
NM_080415chr171930 --1640 --
NM_080422chr18199 ------
NM_080423chr18199 ------
NM_080552chr201555 ------
NM_080594chr16----123 --
NM_080629chr1------11086
NM_080630chr1------11086
NM_080645chr611562 ------
NM_080647chr224457 332 162 52 ------
NM_080654chr11193 1239 11298 --
NM_080671chr222053 1714 11558 11549 --
NM_080717chr1221074 345 ------
NM_080738chr121561 684 ----11948
NM_080744chr72114 100 ------
NM_080792chr201777 --1748 --
NM_080872chr813930 ------
NM_080881chr5130 ------
NM_080927chr342910 2810 737 156 --2686 199 --
NM_100264chr10--155 ----
NM_100486chr10--155 ----
NM_130385chr1112394 ------
NM_130391chr92753 424 ------
NM_130392chr92753 424 ------
NM_130393chr92753 424 ------
NM_130434chr1511104 ------
NM_130436chr211254 ------
NM_130438chr211831 1337 ----
NM_130442chr7----1808 1374
NM_130459chr931512 1171 175 --11506 --
NM_130466chr1221496 468 ------
NM_130469chr14--1958 ----
NM_130795chr91482 --1589 --
NM_133171chr201272 ------
NM_133264chr1723363 1160 22992 2944 ----
NM_133265chrX23547 1271 ------
NM_133369chr5----1945 --
NM_133370chr4----13188 --
NM_133378chr2--2906 627 ----
NM_133432chr2--2906 627 ----
NM_133437chr2--2906 627 ----
NM_133445chr923658 2474 ----1147
NM_133446chr10--1232 ----
NM_133499chrX2954 52 ------
NM_133509chr141430 135 ----
NM_133631chr31220 ------
NM_133642chr2241085 462 409 55 ------
NM_133647chr1512535 12545 ----
NM_134325chr1130 ------
NM_134427chr91482 --1589 --
NM_138270chrX12403 ------
NM_138286chr1912662 11147 ----
NM_138338chr2232904 2811 1266 13300 22139 146 --
NM_138395chr2--1305 ----
NM_138411chr191114 ------
NM_138415chr221567 --11268 --
NM_138423chr1512270 ------
NM_138457chr622570 1056 33131 3110 2580 23138 953 --
NM_138473chr1224504 4152 ------
NM_138479chr121410 139 ------
NM_138576chr1454257 3863 3095 704 74 ------
NM_138633chr641529 1240 322 243 ------
NM_138713chr1636796 1838 1370 ------
NM_138714chr1636796 1838 1370 ------
NM_138732chr111200 1901 2359 167 --
NM_138734chr111200 1901 2359 167 --
NM_138736chr161599 14221 130 --
NM_138783chr19262 36 ------
NM_138959chr122490 1118 1330 25012 304 --
NM_138981chr4131 ------
NM_139057chr151330 22177 23 ----
NM_139068chr5----1261 1487
NM_139069chr5----1261 1487
NM_139070chr5----1130 --
NM_139135chr131005 994 70 ------
NM_139155chr1021450 120 ------
NM_139167chr81142 ------
NM_139316chr7----1429 --
NM_144488chr91482 --1589 --
NM_144489chr91482 --1589 --
NM_144568chr141251 ------
NM_144586chr21432 --150 1861
NM_144599chr1515180 13903 ----
NM_144628chr2031037 489 406 13009 ----
NM_144635chr33230 219 128 ------
NM_144664chr11----12013 --
NM_144732chr1911051 ------
NM_144778chr1311908 ------
NM_144967chrX1250 ------
NM_144982chr121602 ------
NM_145065chr111438 --1262 --
NM_145117chr1132824 1333 1149 --21163 1063 --
NM_145185chr1941971 1858 404 372 --11565 --
NM_145206chr1042522 2094 772 698 11237 ----
NM_145239chr161165 ------
NM_145260chr2----199 --
NM_145296chr191833 ------
NM_145307chr10--11467 ----
NM_145638chr113753 313 283 ------
NM_145793chr101803 ------
NM_145800chrX1951 ------
NM_145805chr152494 393 --196 --
NM_145808chr712153 ------
NM_145861chr121561 684 ----11948
NM_145891chr1611687 ------
NM_145892chr1611687 ------
NM_145893chr1611809 ------
NM_145912chr2223945 3909 1214 23192 30 1311
NM_146388chr192941 492 ----186
NM_147156chr1011255 --1395 --
NM_147181chr411215 ------
NM_147182chr411215 ------
NM_147183chr411215 ------
NM_147193chr1166 ----153
NM_147202chr9183 --22549 615 --
NM_148174chr811672 ------
NM_148898chr7--1291 ----
NM_148899chr7--1291 ----
NM_152221chr221779 --1204 --
NM_152233chr1421382 236 ------
NM_152237chr2211155 ------
NM_152263chr135915 5354 1409 15598 173 --
NM_152271chr81414 1433 ----
NM_152272chr821211 286 ------
NM_152278chrX2500 414 ------
NM_152280chr153441 2717 2620 263 254 ------
NM_152344chr1721298 372 ------
NM_152350chr172533 153 1448 ----
NM_152371chr111583 ------
NM_152375chr142420 2220 905 387 ------
NM_152388chr2--13598 ----
NM_152409chr512199 ------
NM_152424chrX41751 1704 1523 159 --11649 11235
NM_152470chr1834063 3439 1050 --12863 --
NM_152493chr131212 547 445 11254 ----
NM_152538chr321369 672 11219 ----
NM_152563chr1111110 ------
NM_152594chr1521628 97 ------
NM_152622chr512687 13145 ----
NM_152629chr922996 49 ------
NM_152641chr1212888 ------
NM_152652chr161198 ------
NM_152682chr41196 ------
NM_152699chr31145 12721 ----
NM_152716chr112397 282 ------
NM_152731chr611021 1779 ----
NM_152793chr715076 11799 ----
NM_152835chr11327 ----12404
NM_152838chr2032371 1290 369 ------
NM_152860chr122487 71 ------
NM_152878chr2221522 241 ------
NM_152904chr17139 ------
NM_152924chr1576417 6356 4443 4236 2670 2604 556 --1250 --
NM_152989chr1211586 ------
NM_152999chr713528 ------
NM_153029chr1644014 4001 3933 3391 22951 1155 --23260 2772
NM_153186chr91837 ------
NM_153261chr161427 ------
NM_153262chr11681 ------
NM_153273chr352622 2334 1718 701 68 ------
NM_153280chrX1144 ------
NM_153341chr1--1133 ----
NM_153350chr161666 11543 2327 323 --
NM_153367chr1063764 3497 1495 889 439 89 --1315 23970 548
NM_153426chr4136 ------
NM_153427chr4136 ------
NM_153487chr633965 1915 306 --34324 3068 34 --
NM_153499chr1232746 139 113 --11876 --
NM_153500chr1232746 139 113 --11876 --
NM_153607chr512395 ------
NM_153616chr155866 410 194 156 91 ------
NM_153617chr155866 410 194 156 91 ------
NM_153618chr155866 410 194 156 91 ------
NM_153619chr1531432 1394 1329 ------
NM_153620chr71336 ----1266
NM_153631chr711039 ------
NM_153632chr711039 ------
NM_153686chr412369 ------
NM_153715chr72915 121 ------
NM_153756chr111397 11800 121 --
NM_153815chr151123 1184 ----
NM_153828chr21310 ------
NM_170662chr3------1495
NM_170665chr1253526 3517 3274 2863 666 12972 ----
NM_170674chr151984 ------
NM_170677chr151984 ------
NM_170696chr15----11172 1402
NM_170697chr15----11172 1402
NM_170706chr131268 433 91 ------
NM_170721chr1711221 ------
NM_170782chr12509 418 ------
NM_171825chr512377 ------
NM_171998chrX1973 ------
NM_172071chr146782 2266 1298 857 22233 1624 ----
NM_172078chr7122 ------
NM_172079chr7122 ------
NM_172080chr7122 ------
NM_172081chr7122 ------
NM_172082chr7122 ------
NM_172083chr7122 ------
NM_172084chr7122 ------
NM_172127chr412081 ------
NM_172130chr151862 1518 1438 178 57 --11720 --
NM_172216chr1222648 41 ------
NM_172226chr1232746 139 113 --11876 --
NM_172230chr11149 ------
NM_172315chr151984 ------
NM_172316chr151984 ------
NM_173076chr21678 ------
NM_173156chr11112 --12073 --
NM_173171chr21454 ------
NM_173173chr21454 ------
NM_173174chr81121 ------
NM_173175chr81121 ------
NM_173176chr81121 ------
NM_173198chr91410 ------
NM_173199chr9159 ------
NM_173200chr91410 ------
NM_173214chr1636796 1838 1370 ------
NM_173359chr3186 ------
NM_173454chr15--1438 ----
NM_173465chr511025 ------
NM_173470chrX2905 519 --12921 --
NM_173492chr9----183 --
NM_173511chr221048 357 11440 ----
NM_173517chr71164 ------
NM_173519chr812041 ------
NM_173531chr1912572 13349 ----
NM_173552chr3--12340 ----
NM_173576chr101549 ------
NM_173582chr1114135 ------
NM_173595chr1255129 4533 4177 2097 1697 14044 --21996 1535
NM_173596chr12130 ------
NM_173624chr17163 ------
NM_173633chr191216 ------
NM_173674chr6164 ------
NM_173683chr811450 ------
NM_173694chrX22558 613 ------
NM_173808chr142748 1720 801 126 ------
NM_174856chr201265 --1300 --
NM_174890chr101710 ------
NM_175061chr731834 647 624 ------
NM_175063chr192754 25 ------
NM_175630chr22309 71 1623 ----
NM_175733chr1122209 1489 1846 ----
NM_175736chr1267655 2837 2653 1915 1907 205 --27765 7394 --
NM_175747chr61398 ----1922
NM_175767chr511800 11358 ----
NM_175854chr131449 ------
NM_175866chr1--1142 ----
NM_175900chr16141 21514 1353 ----
NM_175907chr1822718 918 ------
NM_175931chr1631565 1414 1386 ------
NM_177414chr11106 ------
NM_177424chr12255 62 ------
NM_177438chr1453365 3264 2591 1548 662 ------
NM_177539chr11141 1182 ----
NM_177947chrX1222 ------
NM_177948chrX1222 ------
NM_177974chr1512270 ------
NM_177985chr211850 ------
NM_178010chr1211586 ------
NM_178123chr21359 ------
NM_178126chr172462 385 2800 471 ----
NM_178151chrX47059 4978 1952 313 1329 16990 --
NM_178152chrX47059 4978 1952 313 1329 16990 --
NM_178153chrX47059 4978 1952 313 1329 16990 --
NM_178154chr141269 ------
NM_178155chr141269 ------
NM_178156chr141269 ------
NM_178157chr141269 ------
NM_178313chr22811 176 --1741 --
NM_178441chr1421409 1330 ------
NM_178450chr5----1700 --
NM_178585chr4--1650 12081 --
NM_178835chr4--1707 ----
NM_178863chr16280 31 ------
NM_181332chrX--1479 ----
NM_181354chr81492 ------
NM_181358chr143062 1674 500 208 ------
NM_181443chr2021792 57 ------
NM_181486chr1221074 345 ------
NM_181492chr22138 ------
NM_181505chr17--1162 199 --
NM_181670chr12139 ------
NM_181674chr5--1279 ----
NM_181675chr5--1279 ----
NM_181676chr5--1279 ----
NM_181677chr5--1279 ----
NM_181678chr5--1279 ----
NM_181689chr201111 --1713 --
NM_181741chr21151 ----1126
NM_181742chr21151 ----1126
NM_181762chrX1133 ------
NM_181777chrX1133 ------
NM_181782chr61649 ------
NM_181784chr23448 257 50 ----11696
NM_181825chr22184 1835 ----
NM_181828chr2231114 853 782 22868 349 11320 --
NM_181829chr2231114 853 782 22868 349 11320 --
NM_181830chr2231114 853 782 22868 349 11320 --
NM_181832chr2231129 868 797 22883 364 11335 --
NM_181876chr41523 ------
NM_181886chr4--1238 ----
NM_181887chr4--1238 ----
NM_181888chr4--1238 ----
NM_181889chr4--1238 ----
NM_181890chr4--1238 ----
NM_181891chr4--1238 ----
NM_181892chr4--1285 ----
NM_181893chr4--1238 ----
NM_182481chr2111334 ------
NM_182482chr2111334 ------
NM_182485chr412550 ------
NM_182493chr16--21909 1759 ----
NM_182507chr1232257 747 399 --22067 308 1365
NM_182509chr1421551 1491 11172 ----
NM_182526chr1432640 2344 75 ------
NM_182546chr7162 ------
NM_182553chr111546 ------
NM_182557chr1111894 --31870 1723 796 --
NM_182616chr15--1308 ----
NM_182641chr17--11716 ----
NM_182646chr412550 ------
NM_182700chr71275 --1109 --
NM_182706chr8----164 --
NM_182717chr101236 ------
NM_182720chr101236 ------
NM_182721chr101236 ------
NM_182722chr101236 ------
NM_182723chr101236 ------
NM_182757chr663187 2959 652 134 94 80 12783 ----
NM_182767chr1212038 --11477 --
NM_182853chr101236 ------
NM_182907chr621702 264 ------
NM_182917chr31343 ------
NM_182943chr31963 --1975 --
NM_182964chr1132824 1333 1149 --21163 1063 --
NM_183004chr1431325 1042 890 --1685 --
NM_183011chr101236 ------
NM_183012chr101236 ------
NM_183013chr101236 ------
NM_183059chr12341 299 ------
NM_183078chr632588 2445 61 1844 ----
NM_183415chr1221496 468 ------
NM_183422chr131104 --1412 --
NM_183425chr20----2167 83 --
NM_194247chr22329 87 ------
NM_194248chr21759 --1904 1382
NM_194259chr161174 ------
NM_194260chr161174 ------
NM_194261chr161174 ------
NM_194278chr1443619 2808 1380 1325 12644 ----
NM_194282chr432779 1182 969 ------
NM_194285chr11--11032 ----
NM_194291chr832992 2312 1972 ------
NM_194322chr21759 --1904 1382
NM_194328chr932658 2546 1208 --1797 --
NM_194329chr932658 2546 1208 --1797 --
NM_194330chr932658 2546 1208 --1797 --
NM_194332chr932658 2546 1208 --1797 --
NM_198074chr11470 ------
NM_198086chr14--1342 ----
NM_198181chr152567 357 ------
NM_198225chr1011861 1450 ----
NM_198240chr121155 ------
NM_198241chr31343 ------
NM_198242chr31343 ------
NM_198244chr31343 ------
NM_198268chr143062 1674 500 208 ------
NM_198269chr143062 1674 500 208 ------
NM_198270chrX13108 ------
NM_198273chr513130 ------
NM_198279chrX11063 ------
NM_198281chr422251 1374 ------
NM_198291chr2031486 559 473 --2654 71 --
NM_198320chr1223781 1041 11720 14843 --
NM_198324chr12--1217 11054 --
NM_198391chr20--11486 ----
NM_198399chr31186 ------
NM_198504chr3--134 1235 --
NM_198513chr821567 1397 ------
NM_198560chr353733 3167 2993 2451 65 21489 814 11146 --
NM_198563chr3----1140 --
NM_198576chr12863 80 --2803 317 --
NM_198581chr226922 6812 35505 5177 4878 ----
NM_198595chr454412 1150 901 545 47 23795 980 34925 3427 453 --
NM_198679chr932397 912 705 --2977 667 11870
NM_198700chr11--1103 ----
NM_198793chr311212 21642 218 ----
NM_198794chr141186 1925 ----
NM_198829chr711210 ----11261
NM_198859chr323699 313 ------
NM_198880chr31159 ------
NM_198900chr1267655 2837 2653 1915 1907 205 --27765 7394 --
NM_198935chr2022242 635 1108 --1619
NM_198956chr71275 --1109 --
NM_198968chr1323814 2877 ------
NM_198993chr1711178 ----136
NM_199054chr191748 --11623 --
NM_199169chr2023187 715 ------
NM_199170chr2023187 715 ------
NM_199171chr2023187 715 ------
NM_199183chr3131 ------
NM_199205chr83686 591 256 ------
NM_199324chr4----12697 --
NM_199327chr41931 ------
NM_199334chr17----1114 --
NM_199355chr161429 ------
NM_199424chr1631757 1508 135 ------
NM_199427chr20--154 ----
NM_199436chr21210 ------
NM_199440chr21344 ------
NM_199454chr143538 1783 1196 1133 --24337 3690 --
NM_199478chrX1415 1535 ----
NM_201267chr2------185
NM_201413chr212436 123 ------
NM_201414chr212436 123 ------
NM_201432chr17105222 4417 4353 4271 4002 2279 1161 881 296 255 --14551 1848
NM_201433chr17105222 4417 4353 4271 4002 2279 1161 881 296 255 --14551 1848
NM_201434chr17--1598 1315 --
NM_201520chr1771536 1507 1191 1117 560 403 234 11201 11472 11374
NM_201568chr11112 --12073 --
NM_201569chr11112 --12073 --
NM_201570chr1021406 493 ------
NM_201571chr1021406 493 ------
NM_201572chr1021406 493 ------
NM_201575chr16----1450 --
NM_201590chr1021406 493 ------
NM_201593chr1021406 493 ------
NM_201596chr1021406 493 ------
NM_201597chr1021406 493 ------
NM_201627chr52344 323 ------
NM_202002chr121589 --1859 --
NM_203327chr2053840 3726 1549 1299 423 --1213 1182
NM_203342chr132626 1410 1329 11339 ----
NM_203343chr132626 1410 1329 11339 ----
NM_203365chr2----1481 --
NM_203394chr121593 --1370 --
NM_203399chr1----1594 --
NM_203401chr1----1594 --
NM_203454chr121171 1040 ------
NM_203499chr17----1754 --
NM_203504chr422157 409 ------
NM_203505chr422157 409 ------
NM_205768chr121596 267 ------
NM_205860chr133134 2272 664 12502 ----
NM_205861chr122048 28 21968 508 ----
NM_206594chr111416 --12302 --
NM_206595chr111416 --12302 --
NM_206819chr12--1284 ----
NM_206820chr12--1284 ----
NM_206821chr12--1284 ----
NM_206853chr611450 ------
NM_206860chr101371 --1295 --
NM_206861chr101371 --1295 --
NM_206862chr101371 ------
NM_206907chr5--1699 ----
NM_207009chr102343 189 ------
NM_207043chr11521 --11616 --
NM_207044chr11521 --11616 --
NM_207047chr11521 --11616 --
NM_207292chr313389 ------
NM_207293chr313389 ------
NM_207294chr313389 ------
NM_207295chr313389 ------
NM_207296chr313389 ------
NM_207297chr313414 ------
NM_207299chr9----1164 --
NM_207304chr1311795 ------
NM_207317chr51163 ------
NM_207336chr7------132
NM_207396chr11120 2432 129 ----
NM_207442chr141759 11015 ----
NM_207520chr21310 ------
NM_207521chr21310 ------
NM_207577chr11--22158 582 12520 --
NM_213594chr121449 ------
NM_213606chr1022127 618 11786 ----
NM_213662chr1721964 1862 --11769 --