TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4650-3p
miRNA Sequence: AGGUAGAAUGAGGCCUGACAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr562069 1970 1846 505 247 33 --1688 --
NM_000051chr1173509 3269 2825 2778 2556 959 678 1359 1796 --
NM_000052chrX83482 3435 3415 3300 3252 1087 909 123 12518 ----
NM_000081chr161588 1326 1147 715 330 188 ------
NM_000084chrX66668 6166 5374 5359 1818 1796 --46596 4810 1882 1436 26685 2716
NM_000090chr2------1218
NM_000092chr284268 4104 3826 3498 3076 3029 707 233 14533 --13791
NM_000108chr741565 1378 342 174 --11450 --
NM_000109chrX52590 2164 739 264 95 1597 11938 --
NM_000115chr1361973 1930 1781 644 328 241 ------
NM_000125chr643801 3048 2614 686 --22891 49 --
NM_000138chr1522451 919 ------
NM_000142chr451309 1115 610 566 369 ------
NM_000153chr142626 156 ----21485 1114
NM_000161chr1451820 1475 618 585 186 11396 1612 --
NM_000165chr611334 11478 --1377
NM_000167chrX51779 1701 710 475 41 1528 ----
NM_000168chr723295 2292 --22734 2379 --
NM_000176chr533566 1447 1113 --13772 --
NM_000208chr1954740 3258 1103 471 328 197 34372 4323 832 --
NM_000214chr2021630 1214 --11562 21585 311
NM_000216chrX43756 3553 1511 288 --22852 692 --
NM_000217chr1235316 4107 717 11867 13343 --
NM_000222chr451767 1665 1597 1458 339 --21419 315 1229
NM_000230chr731916 945 499 22644 1772 1718 --
NM_000232chr482526 2371 2253 2051 1129 687 415 73 --23002 775 --
NM_000233chr23612 339 137 --2650 604 --
NM_000237chr821227 74 ------
NM_000248chr362658 2413 1017 909 815 183 ------
NM_000252chrX41197 1120 1042 1032 11309 ----
NM_000253chr42103 21 ------
NM_000259chr1566095 5481 4074 2527 1554 1458 11159 16035 15219
NM_000264chr963105 2414 2389 2125 391 171 ------
NM_000267chr1752926 2648 2525 2349 370 12209 22816 210 --
NM_000276chrX42215 1817 1486 816 1158 --1576
NM_000284chrX41910 1840 1621 522 --21545 1527 1345
NM_000297chr441618 1366 162 133 --21892 647 --
NM_000302chr12711 246 --2606 501 --
NM_000304chr172753 205 1695 1353 --
NM_000314chr1072911 2786 1263 1202 1115 995 739 --23012 149 --
NM_000317chr111336 ------
NM_000321chr1361770 1553 571 552 507 450 --11219 --
NM_000325chr41640 ------
NM_000328chrX4394 318 305 134 ------
NM_000329chr11139 ------
NM_000332chr6126981 5428 4973 4951 2698 2439 1893 741 734 622 447 437 --12113 11715
NM_000337chr586494 6221 6153 5814 5081 1701 690 78 24428 1010 ----
NM_000340chr351297 1235 1225 1191 529 ------
NM_000351chrX63184 2918 1646 1549 1418 784 --12834 --
NM_000362chr2252591 2386 1106 1049 748 12782 23001 2903 13662
NM_000367chr661586 1513 782 762 612 454 11767 --1278
NM_000368chr974496 3736 3565 1012 921 370 227 --11415 13507
NM_000378chr1121098 185 --1280 1378
NM_000393chr231766 1715 177 1758 --11683
NM_000396chr11414 --1447 --
NM_000408chr293459 3320 2778 2692 2670 2596 2293 2145 541 ------
NM_000411chr21113169 3148 3078 3051 2225 2191 2164 996 961 352 297 13030 ----
NM_000421chr17--1273 ----
NM_000430chr1753758 3703 1370 752 355 13026 ----
NM_000435chr193721 410 357 ------
NM_000447chr1167 ------
NM_000448chr1172968 1035 859 813 583 473 436 --22103 2093 11168
NM_000449chr11146 --1990 --
NM_000459chr92872 346 183 ----
NM_000461chr394571 3955 3844 3828 3428 3112 1523 1471 816 ------
NM_000484chr213832 786 719 --1196 --
NM_000486chr1253217 2741 2654 1225 397 --12916 --
NM_000489chrX63317 3220 1278 1235 1082 136 --23342 1117 23197 709
NM_000492chr721254 101 1248 ----
NM_000522chr721017 494 ----11242
NM_000523chr231170 199 166 ------
NM_000553chr83616 441 428 ------
NM_000555chrX115562 5497 5350 5162 3028 3020 2645 2003 849 839 67 11055 26795 2602 16161
NM_000560chr11697 1668 ----
NM_000572chr11160 1727 ----
NM_000573chr142149 2063 609 507 12314 2478 215 --
NM_000598chr711309 --11385 11489
NM_000599chr254284 4109 3911 2839 123 ------
NM_000601chr7147 ------
NM_000610chr1122256 2040 11950 1132 12405
NM_000611chr1156715 6439 5108 2286 1922 24688 769 --1940
NM_000615chr1152792 2688 2397 1865 678 12373 --22923 706
NM_000618chr12186102 5853 5201 4995 4422 4327 4148 2566 2278 2271 1796 1742 1614 1429 1311 457 434 245 11209 25163 1367 35489 4169 1693
NM_000618chr12186102 5853 5201 4995 4422 4327 4148 2566 2278 2271 1796 1742 1614 1429 1311 457 434 245 11209 25163 1367 35489 4169 1693
NM_000627chr22923 310 1781 1825 --
NM_000633chr1865090 4785 4639 3907 3832 234 13764 15038 --
NM_000651chr142149 2063 609 507 12314 2478 215 --
NM_000663chr1622860 2781 --2658 294 --
NM_000676chr171219 ------
NM_000684chr1011054 --11243 11263
NM_000693chr1541748 722 393 125 ------
NM_000701chr12304 99 ------
NM_000719chr1265468 4878 2266 1848 1768 1745 25120 4198 --24661 959
NM_000723chr171609 --2322 201 --
NM_000724chr1041430 1266 581 533 11975 ----
NM_000726chr231478 1180 407 ------
NM_000758chr5----1284 --
NM_000782chr2021072 81 ------
NM_000788chr42987 576 --11358 --
NM_000793chr1453448 1977 1095 283 121 14174 11575 --
NM_000800chr531628 1196 364 --1174 --
NM_000809chr4219289 9184 8192 7475 7375 7150 6792 6773 6750 6574 6231 6149 6088 6015 5793 2251 1545 1420 1020 915 342 27065 6132 77425 6889 6607 5938 3505 3150 2582 --
NM_000811chr52704 28 1326 1554 --
NM_000813chr584334 4148 1748 1570 1539 1402 226 166 24357 3610 --11638
NM_000814chr1543427 1258 599 59 21041 282 43991 3846 1683 1157 11523
NM_000817chr22905 317 ------
NM_000826chr462499 2490 2445 849 439 404 --1344 --
NM_000827chr532342 1656 1029 --11700 --
NM_000829chr1132273 2093 2049 --11951 --
NM_000838chr652797 2385 2141 1929 1820 ----11889
NM_000844chr32972 761 ------
NM_000861chr322232 2184 --31819 1765 633 --
NM_000866chr31405 --1375 --
NM_000868chrX82139 1918 1791 1045 804 505 181 119 22431 1666 ----
NM_000875chr1586665 5991 5481 2623 2394 1345 1227 1166 16470 1500 11425
NM_000879chr5152 ------
NM_000880chr82810 59 ------
NM_000885chr22854 107 1743 ----
NM_000891chr1733221 987 371 --23133 2826 --
NM_000899chr1254244 4065 2920 1476 183 1774 ----
NM_000901chr43995 837 566 1986 ----
NM_000902chr342664 2420 694 445 2287 202 --22766 2540
NM_000921chr121155 ------
NM_000929chr15975 400 359 73 51 11011 ----
NM_000933chr2041089 687 483 149 1522 ----
NM_000935chr321073 246 ------
NM_000943chr51104 --1123 --
NM_000944chr442381 1877 925 757 ------
NM_000945chr262032 1856 1325 780 585 356 --11297 --
NM_000949chr53955 924 651 1363 2874 638 --
NM_000950chrX73183 2720 2377 1209 903 891 513 22895 69 33340 2875 348 --
NM_000958chr51993 ----1272
NM_000961chr2063983 3023 2868 1091 332 37 23175 1363 13323 --
NM_000963chr162287 901 673 514 350 259 ------
NM_000965chr391268 1250 1054 816 451 362 305 249 77 1925 ----
NM_000983chr171619 1575 1311 1266 654 233 177 --11425 --
NM_001001132chr2121083 167 --1177 --
NM_001001323chr1283068 2575 2538 2331 1940 900 866 681 ----22675 461
NM_001001344chrX42490 2477 890 345 --1379 --
NM_001001389chr1122256 2040 11950 1132 12405
NM_001001390chr1122256 2040 11950 1132 12405
NM_001001391chr1122256 2040 11950 1132 12405
NM_001001392chr1122302 2086 11996 1178 12451
NM_001001395chr1252811 2463 2343 2308 1038 3609 522 434 1952 --
NM_001001396chr184039 2850 2718 1790 1073 530 420 337 11359 31172 817 317 --
NM_001001415chr19--124 ----
NM_001001419chr5115163 4980 4171 3736 1978 1870 1570 1049 1017 279 119 14361 14190 1423
NM_001001420chr5115163 4980 4171 3736 1978 1870 1570 1049 1017 279 119 14361 14190 1423
NM_001001433chr2032652 2610 1193 12799 23120 728 --
NM_001001436chr161840 1200 ----
NM_001001481chr873047 2757 1299 619 521 140 129 ------
NM_001001484chr1041719 1538 858 464 1308 1597 --
NM_001001557chr852166 2098 762 697 496 1689 1184 --
NM_001001664chr273950 3672 3639 1272 1109 848 483 ------
NM_001001701chr442357 1684 707 137 11659 12166 --
NM_001001791chr1031667 1640 1549 ------
NM_001001890chr2153871 3372 3344 3104 2834 --53650 3205 2701 1519 1195 11078
NM_001001936chr1011061 ----11168
NM_001001971chr1031315 1246 1122 164 ----
NM_001001974chr1041577 863 784 33 ------
NM_001001995chrX31815 1652 630 ----21789 300
NM_001002026chr332437 2366 431 --31552 612 268 12292
NM_001002027chr17--180 ----
NM_001002033chr17--1332 ----
NM_001002233chr82673 184 --21614 695 2647 147
NM_001002258chr241903 713 375 306 11411 ----
NM_001002275chr13515 459 138 1391 ----
NM_001002814chr883765 3383 3218 2866 2614 2593 673 184 22373 1127 1695 2647 147
NM_001002838chrX31877 1715 519 21737 1642 1235 --
NM_001002843chr1531313 1189 130 ------
NM_001002860chr1494641 4453 4084 3899 2872 1836 1711 1619 939 33822 3390 408 24650 396 --
NM_001003406chr2243198 2869 301 54 12699 ----
NM_001003407chr1084060 3508 1849 1661 1228 733 620 210 11990 24145 3485 --
NM_001003408chr1084060 3508 1849 1661 1228 733 620 210 11990 24145 3485 --
NM_001003652chr18188543 8383 8052 8031 6764 6278 6202 6161 3488 2782 2446 2149 1661 1447 1265 1165 1088 1063 38727 5468 5378 58634 6215 5943 2811 551 22982 559
NM_001003674chr18127036 6921 6564 6199 5637 5464 2518 1948 1634 1169 1091 624 26766 1726 16930 36119 1420 745
NM_001003675chr18127036 6921 6564 6199 5637 5464 2518 1948 1634 1169 1091 624 26766 1726 16930 36119 1420 745
NM_001003679chr152242 2072 2005 1895 77 --11408 --
NM_001003688chr441196 962 846 226 ------
NM_001003712chr1264055 3671 2956 1237 970 328 --23435 3358 --
NM_001003760chr673444 3099 3072 3032 2885 2267 176 --12261 1705
NM_001003792chr31823 ------
NM_001003793chr31823 ------
NM_001004065chr963798 3444 2949 2471 942 659 --13325 --
NM_001004196chr371111 1095 841 346 199 149 41 1386 ----
NM_001004304chr1233274 2150 2114 ----13202
NM_001004317chr631619 48 31 14115 33417 1634 930 --
NM_001004342chr165016 4214 3817 3757 1988 1171 13829 11609 16073
NM_001004346chr4297 76 ------
NM_001004360chr222011 173 1371 ----
NM_001004722chr23804 149 53 ------
NM_001005207chr171224 ------
NM_001005375chrY21194 549 11345 ----
NM_001005386chr272393 2287 2080 2006 701 390 105 --21653 690 --
NM_001005404chr1784389 4067 3779 3231 3046 2776 1443 1088 13323 24210 1312 --
NM_001005463chr1032608 2530 1861 ------
NM_001005473chr595458 5044 4208 4059 2336 1409 639 366 218 14269 25420 5403 --
NM_001005474chr341323 1051 644 109 --11194 --
NM_001005732chr213251 174 150 --1211 --
NM_001005733chr212174 150 --1211 --
NM_001005743chr1411264 ------
NM_001005744chr1411264 ------
NM_001005745chr1411264 ------
NM_001005746chr231478 1180 407 ------
NM_001005747chr231478 1180 407 ------
NM_001005753chr252319 2045 494 303 133 ------
NM_001005861chr33785 655 371 ------
NM_001006600chr532150 797 570 12363 12095 --
NM_001006612chrX1404 --189 --
NM_001006613chrX1404 --189 --
NM_001006614chrX1404 --189 --
NM_001006618chr91247 ------
NM_001006623chr262081 1993 1743 701 322 240 141 1135 --
NM_001006657chr252652 1978 870 582 547 12712 12170 --
NM_001006684chrX2484 83 ------
NM_001006935chrX--122 ----
NM_001006936chrX--122 ----
NM_001006937chrX--122 ----
NM_001007023chr1453448 1977 1095 283 121 14174 11575 --
NM_001007024chr17103271 1724 1312 1261 961 924 885 805 765 369 --23840 1510 --
NM_001007025chr17103271 1724 1312 1261 961 924 885 805 765 369 --23840 1510 --
NM_001007067chr83383 259 206 --1123 --
NM_001007068chr83383 259 206 --1123 --
NM_001007069chr83383 259 206 --1123 --
NM_001007070chr83383 259 206 --1123 --
NM_001007072chr151263 --2174 93 --
NM_001007075chr421029 894 ----167
NM_001007088chrX2492 56 ------
NM_001007237chr162549 2477 2439 527 369 283 ------
NM_001007245chr73642 48 36 ------
NM_001007246chr2141611 1261 465 176 ----11685
NM_001007267chr22231 163 ------
NM_001007466chr694962 3153 1127 1067 1059 1050 516 423 395 34689 4232 3762 --11228
NM_001007553chr151236 831 377 355 114 --1409 --
NM_001007565chr31335 ------
NM_001008239chr1862693 1099 1013 407 295 264 11471 1561 --
NM_001008392chr353460 3137 827 441 219 1294 1347 --
NM_001008393chr4102866 2741 2384 2075 2061 1894 1823 1015 649 468 11091 12757 12208
NM_001008401chr1931499 1460 377 ------
NM_001008405chr73660 497 422 21759 32 ----
NM_001008408chr755260 4888 4644 1174 600 25741 5535 --14260
NM_001008491chr252025 1992 1974 1925 558 1394 11426 --
NM_001008492chr252025 1992 1974 1925 558 1394 11426 --
NM_001008495chr831916 748 311 21495 1403 --12087
NM_001008539chr895306 5199 3434 2109 1566 1536 662 451 313 25363 3346 13867 --
NM_001008566chr221186 --1451 --
NM_001008660chr1121290 567 ------
NM_001008707chr1451782 1401 1205 606 298 11842 ----
NM_001008708chr21614 ------
NM_001008711chr871754 1712 1268 289 281 156 59 1231 ----
NM_001008726chr1431594 507 359 ------
NM_001008738chr582833 2791 2599 2521 2400 2391 280 133 ------
NM_001008777chr174687 528 476 227 ------
NM_001008783chr62729 250 --1904 --
NM_001008860chr153740 241 211 ------
NM_001008892chr153740 241 211 ------
NM_001008894chr153740 241 211 ------
NM_001008895chr1321366 1088 --11302 --
NM_001009185chr51578 1164 ----
NM_001009554chr474015 3978 3925 3553 3161 909 772 24073 269 24028 3811 --
NM_001009554chr474015 3978 3925 3553 3161 909 772 24073 269 24028 3811 --
NM_001009555chr461774 1445 1393 1370 398 365 --1220 --
NM_001009569chr1031550 1314 122 --11624 --
NM_001009881chr15626 465 240 198 31 ------
NM_001009882chr15626 465 240 198 31 ------
NM_001009958chr72557 182 ------
NM_001009959chr262527 1708 559 501 76 53 22513 1795 ----
NM_001009960chr752578 2153 1123 809 633 11791 --12567
NM_001009993chr244316 2830 392 332 --11725 --
NM_001010853chr673120 2572 2535 2321 2154 1096 592 23221 480 32970 251 113 --
NM_001010854chr142706 506 194 --1586
NM_001010861chr1102699 2574 2076 2067 970 874 662 634 548 374 22728 2250 12497 52060 1865 1829 1803 50
NM_001010862chrX43256 3003 2595 2397 12967 32675 1309 137 --
NM_001010867chr155320 4146 2065 1726 358 14481 24868 712 12176
NM_001010876chr6173 ------
NM_001010888chrX74507 4098 3817 3764 1300 737 518 --24009 1222 --
NM_001010891chr5126826 6499 5984 2582 2105 1532 1128 1081 920 441 144 129 --15323 --
NM_001010895chr922029 132 ------
NM_001010922chr154004 2876 2718 961 144 --23254 243 23334 924
NM_001010923chr631232 702 637 ----1292
NM_001010932chr7147 ------
NM_001010934chr731207 365 27 1303 ----
NM_001010986chrX72432 2246 2135 1998 1703 763 511 1139 ----
NM_001011513chr494013 3908 3787 3488 2976 2670 1638 1007 987 21253 641 ----
NM_001011515chr42853 118 --1951 --
NM_001011516chr42853 118 --1951 --
NM_001011553chr74930 881 771 281 --1858 --
NM_001011666chr7116519 6027 6012 5755 5395 4649 4441 4122 2246 1909 1502 1205 11737 --
NM_001011708chr262857 2827 2809 1917 1177 375 ------
NM_001011713chr1421432 1289 1572 --11167
NM_001011885chr1521530 1160 --11653 11145
NM_001012393chr11104671 4195 3711 3662 3459 1498 950 875 838 616 3923 811 325 --1209
NM_001012420chr1521166 418 ----22836 1150
NM_001012423chr1521166 418 ----22836 1150
NM_001012478chr191644 ------
NM_001012514chr241143 983 803 109 ------
NM_001012516chr241143 983 803 109 ------
NM_001012751chr1041191 771 525 142 --11580 --
NM_001012753chr192992 284 11110 --2825 35
NM_001012754chr1332100 1948 1851 11393 ----
NM_001012980chrX------144
NM_001012989chrX2670 474 ----144
NM_001013031chr1033464 3283 538 --33501 2976 2948 --
NM_001013398chr711309 --11385 11489
NM_001013415chr421218 361 ----1379
NM_001013438chr31187 --1745 --
NM_001013439chr3133 --1591 --
NM_001013629chr1052157 2138 2121 1717 1319 ------
NM_001013635chr1281099 1014 937 456 449 399 347 338 --1192 --
NM_001013690chr1252495 2374 1799 657 136 12173 12420 1179
NM_001013699chr121566 ------
NM_001013843chr15------1369
NM_001014286chr132344 101 --170 --
NM_001014380chr13115599 5147 5070 4566 4541 2218 1193 1038 844 568 541 25077 259 24889 2330 --
NM_001014443chr1166 ------
NM_001014449chr161238 ------
NM_001014451chr161238 ------
NM_001014796chr11190 ------
NM_001014796chr11190 ------
NM_001014797chr10118140 7711 5272 2121 1909 1572 1181 1110 832 821 284 11117 12844 15949
NM_001014809chr41899 ------
NM_001014812chr151429 ------
NM_001014831chr191802 ------
NM_001014832chr191802 ------
NM_001014834chr191802 ------
NM_001014835chr191802 ------
NM_001015045chr452377 2344 1765 606 428 --1119 12084
NM_001015048chr1443100 989 129 53 --22961 2495 --
NM_001015049chr1443100 989 129 53 --22961 2495 --
NM_001015877chrX62663 2608 2009 1208 924 103 ----11984
NM_001015880chr1041689 1653 1299 52 --2507 265 --
NM_001015881chrX--1793 146 --
NM_001015887chr341231 1182 537 226 ----1518
NM_001017369chr421002 182 --1165 --
NM_001017371chr2------1239
NM_001017395chr373652 3018 2922 2715 1405 1016 90 --22483 2411 --
NM_001017415chr13781 659 564 ------
NM_001017416chr13781 659 564 ------
NM_001017424chr121607 370 1142 2568 455 --
NM_001017425chr121607 370 1142 2568 455 --
NM_001017440chr778015 7966 5323 2333 2074 1963 1185 28241 8176 27349 2346 --
NM_001017923chr1421371 293 --11694 --
NM_001017926chr831518 441 194 --1676 --
NM_001017969chr91265 ------
NM_001017992chr51985 --11039 --
NM_001017995chr584672 4133 3878 3279 3173 1861 1774 49 34801 3434 2978 54441 4240 1813 1632 657 14189
NM_001018004chr151456 ----195
NM_001018006chr151456 ----195
NM_001018007chr151456 ----195
NM_001018020chr151456 ----195
NM_001018054chr13531 208 88 11249 ----
NM_001018056chr91406 --1193 --
NM_001018065chr9115086 4815 4790 4780 4729 4698 4204 2151 1647 1070 86 35322 4666 4018 25118 1523 --
NM_001018066chr9115086 4815 4790 4780 4729 4698 4204 2151 1647 1070 86 35322 4666 4018 25118 1523 --
NM_001018067chr175351 4770 4536 4278 4131 1695 1510 --24073 1450 11370
NM_001018068chr175351 4770 4536 4278 4131 1695 1510 --24073 1450 11370
NM_001018069chr175351 4770 4536 4278 4131 1695 1510 --24073 1450 11370
NM_001018074chr533566 1447 1113 --13772 --
NM_001018075chr533566 1447 1113 --13772 --
NM_001018076chr533566 1447 1113 --13772 --
NM_001018077chr533566 1447 1113 --13772 --
NM_001018100chr152807 25 ----1865
NM_001020658chr121453 238 ------
NM_001020658chr121453 238 ------
NM_001023560chr61684 ------
NM_001023567chr151418 ----12228
NM_001023587chr32981 884 --1995 --
NM_001024094chr533566 1447 1113 --13772 --
NM_001024226chr11986 ------
NM_001024227chr11986 ------
NM_001024228chr11986 ------
NM_001024372chr832015 1609 772 11761 2292 218 --
NM_001024455chrX3702 432 376 --11029 1928
NM_001024596chr19103472 3321 2982 2855 2723 2636 2565 2443 1419 436 --23521 372 --
NM_001024647chr12106819 6528 5853 4935 4905 4697 2432 546 507 465 37038 5251 4773 1982 16918
NM_001024649chr562921 2790 2659 2138 1878 1121 ------
NM_001024660chr32584 392 ----1671
NM_001024666chrX1504 --2253 60 1655
NM_001024680chr21483 21672 673 11527 11282
NM_001024688chr861949 1908 1453 470 455 51 --1798 --
NM_001024808chr12--1124 ----
NM_001024847chr352460 2442 772 250 185 1878 21582 814 --
NM_001024912chr1961902 1701 1657 1577 1319 700 --137 --
NM_001024934chr61183 ------
NM_001024935chr61183 ------
NM_001024936chr61183 ------
NM_001024937chr171103 ------
NM_001024947chr531058 894 189 ------
NM_001024948chr133427 2556 330 12322 1273 11238
NM_001024956chr1175487 2337 2285 1716 1685 1079 642 14175 14350 --
NM_001025068chr331749 1712 589 --21856 374 --
NM_001025069chr331749 1712 589 --21856 374 --
NM_001025076chr10145984 5858 5203 4806 4533 4293 4236 2474 2327 2140 1651 1540 638 524 --24839 1445 --
NM_001025077chr10187342 7216 6561 6164 5891 5651 5594 4784 3009 2898 1996 1882 1381 879 860 570 208 132 --36197 2803 276 1112
NM_001025079chr374009 3815 3307 3214 2678 2631 753 1496 23441 1252 --
NM_001025108chr274177 3597 3072 2687 1447 838 358 --13143 --
NM_001025201chr22496 33 ------
NM_001025252chr872102 2087 2055 1179 759 474 359 --22730 1052 192
NM_001025253chr872102 2087 2055 1179 759 474 359 --22730 1052 192
NM_001025266chr3104727 4278 4213 3797 3499 3024 1664 1091 905 225 --53683 1404 1343 1337 96 --
NM_001025356chr1223032 255 11154 12114 1930
NM_001025580chrX64314 3791 1261 959 440 88 ------
NM_001025595chr41198 ----11290
NM_001025603chr11146 --1990 --
NM_001029839chr351463 1363 984 512 156 --1593 --
NM_001029840chr351463 1363 984 512 156 --1593 --
NM_001029858chr653227 944 835 719 412 12089 13209 --
NM_001029863chr692931 2838 2780 2506 2211 2098 805 488 351 --21132 1000 --
NM_001029875chr572161 2029 1092 916 160 133 109 1470 12645 --
NM_001029997chr192546 291 --1621 --
NM_001030006chr1722419 291 --22289 906 --
NM_001030007chr1643981 3316 3158 2734 --32747 537 400 --
NM_001030055chr1454368 3732 1726 630 323 ----44695 4263 3218 1862
NM_001030272chr113507 353 61 ------
NM_001030273chr113507 353 61 ------
NM_001031679chr12--1789 12339 12856
NM_001031685chr11282 ----1903
NM_001031689chr91116 ------
NM_001031690chr752977 2951 2599 2393 996 --11119 1667
NM_001031692chr72301 42 ------
NM_001031695chr2264758 1483 1423 1247 632 464 --1202 1320
NM_001031700chr472445 1974 1795 1752 908 705 580 ----22002 845
NM_001031710chr72998 349 --1721 --
NM_001031712chr61269 ------
NM_001031716chr221095 320 11012 ----
NM_001031732chr483209 1382 1059 1026 949 734 383 99 13566 11109 12380
NM_001031746chr104364 356 281 26 ------
NM_001031804chr1653476 3102 2997 524 327 1859 13349 --
NM_001031812chr511528 --11759 --
NM_001032221chr911728 ------
NM_001032280chr621407 1063 ----1310
NM_001032293chr171151 ------
NM_001032380chr1031829 1558 405 ------
NM_001032394chr692825 2683 947 933 806 797 527 488 85 --22163 2098 --
NM_001032395chr682692 2550 814 800 673 664 394 355 --22030 1965 --
NM_001032999chr2055255 3301 3288 3240 1446 11125 25354 960 1872
NM_001033002chr17127 1237 ----
NM_001033044chr121166 450 11348 ----
NM_001033045chr264034 3942 2731 970 624 173 23172 463 21778 1563 --
NM_001033047chr432514 517 40 ----1959
NM_001033049chr2152198 1704 1551 1531 238 --1311 --
NM_001033056chr121166 450 11348 ----
NM_001033057chr33707 278 28 ------
NM_001033059chr651604 726 443 421 270 1227 1506 --
NM_001033085chr21118 ------
NM_001033087chr2053077 2862 2821 2162 1219 --11013 --
NM_001033117chr3104807 4243 4055 3806 3718 3528 3166 1733 703 517 14419 24591 1474 11096
NM_001033521chr202210 39 --2487 156 --
NM_001033522chr202210 39 --2487 156 --
NM_001033557chr221236 382 --11093 --
NM_001033578chr851863 571 324 149 62 1712 ----
NM_001033602chr1322739 2416 --2521 497 1218
NM_001033723chr841975 799 792 555 --22541 333 --
NM_001033925chr1052157 1683 1619 765 695 12085 1173 21850 1498
NM_001034837chr54152 118 86 70 ------
NM_001034838chr54152 118 86 70 ------
NM_001034841chr1655529 4640 4410 507 380 25168 4705 --14358
NM_001034845chr411281 ------
NM_001035003chr41531 1998 --150
NM_001035004chr41531 1998 --150
NM_001035254chr962339 2177 1622 965 898 396 12369 ----
NM_001037132chr751739 1669 695 684 108 11392 21369 678 --
NM_001037133chr751739 1669 695 684 108 11392 21369 678 --
NM_001037164chr761916 1335 717 604 325 94 11892 --1526
NM_001037165chr798965 8945 8452 7222 7013 2596 2580 1868 1556 17904 48850 6601 2566 661 13494
NM_001037172chr311408 --1385 --
NM_001037174chr241827 1727 117 54 --12143 --
NM_001037317chr1102699 2574 2076 2067 970 874 662 634 548 374 22728 2250 12497 52060 1865 1829 1803 50
NM_001037334chr1832369 1653 61 --11776 --
NM_001037339chr161301 1226 1198 623 471 299 1391 31361 1350 33 --
NM_001037340chr161301 1226 1198 623 471 299 1391 31361 1350 33 --
NM_001037341chr161301 1226 1198 623 471 299 1391 31361 1350 33 --
NM_001037341chr161301 1226 1198 623 471 299 1391 31361 1350 33 --
NM_001037442chr41376 ----1513
NM_001037535chrX41546 526 480 164 --179 --
NM_001037536chrX41546 526 480 164 --179 --
NM_001037540chrX41546 526 480 164 --179 --
NM_001037553chr21134466 4358 4163 3659 3574 3310 3296 3280 1604 994 585 425 386 14374 ----
NM_001037872chr23251 212 195 --1648 --
NM_001037954chr1173405 3044 1256 1000 970 666 249 --33274 3098 255 --
NM_001038707chr14725 528 168 126 2832 628 --31974 1871 25
NM_001038707chr14725 528 168 126 2832 628 --31974 1871 25
NM_001039199chr2074520 4206 3355 1694 1532 840 745 34334 3580 1373 23213 942 13972
NM_001039350chr72613 38 --11804 --
NM_001039395chr922329 743 1958 ----
NM_001039479chr1452203 2095 2039 1804 164 1191 1905 --
NM_001039538chr263467 3362 3218 2923 2331 147 12702 1295 --
NM_001039547chr3127826 7272 7223 7159 6176 3078 1735 1671 1465 997 654 227 47490 5595 3016 339 16183 12809
NM_001039569chr233346 2081 708 23005 1248 ----
NM_001039570chr2274669 4644 4242 4109 3847 1672 110 21467 876 14126 --
NM_001039571chr2274669 4644 4242 4109 3847 1672 110 21467 876 14126 --
NM_001039585chr132689 1145 99 21509 1073 13485 13076
NM_001039590chrX93975 3467 3277 2726 2561 1395 1134 1118 752 ------
NM_001039591chrX93975 3467 3277 2726 2561 1395 1134 1118 752 ------
NM_001039616chr19154 ------
NM_001039618chr1195620 5391 5312 5025 4241 3596 1467 338 33 11692 13967 --
NM_001039709chr2055255 3301 3288 3240 1446 11125 25354 960 1872
NM_001039711chr12217 81 ------
NM_001039712chr12217 81 ------
NM_001039840chrX85000 4143 4106 2018 1061 882 645 439 15829 --12065
NM_001039937chr13103556 2756 2561 1587 1375 1009 698 526 298 153 --33129 2608 748 --
NM_001040001chr631431 176 31 21513 183 31929 1506 486 --
NM_001040020chr741533 1079 1057 402 ------
NM_001040033chr11697 1668 ----
NM_001040057chr751482 1348 1293 1268 469 ------
NM_001040100chr32373 228 --2144 136 1877
NM_001040102chr1062656 2616 2158 1777 1753 1658 22175 756 12577 --
NM_001040103chr1062656 2616 2158 1777 1753 1658 22175 756 12577 --
NM_001040108chr1483181 2471 2086 1318 964 445 418 258 1535 11145 --
NM_001040110chr741676 260 51 37 1682 ----
NM_001040113chr161153 ----1642
NM_001040142chr272299 1724 757 514 392 215 113 --12249 12282
NM_001040143chr272299 1724 757 514 392 215 113 --12249 12282
NM_001040152chr774756 3770 3406 1178 832 591 410 1532 25002 1466 13208
NM_001040153chr131900 ------
NM_001040158chr51404 ------
NM_001040159chr441495 1127 602 30 --1567 --
NM_001040202chr452480 2393 1030 610 298 --11593 22354 663
NM_001040214chr631548 895 420 31869 879 756 ----
NM_001040260chr441148 456 294 189 --11086 1231
NM_001040261chr441148 456 294 189 --11086 1231
NM_001040284chr1675894 4339 4070 3761 880 672 565 35713 2115 487 14398 --
NM_001040402chr423028 2580 ----1627
NM_001040429chr1342722 2307 404 85 11268 1479 --
NM_001040432chr31297 --1133 --
NM_001040440chr51454 ----1181
NM_001040441chr185498 4142 3583 2119 2057 497 317 70 35124 1748 893 ----
NM_001040446chr562596 2392 2302 2099 2056 526 --3958 922 878 --
NM_001040450chr1542473 873 554 420 22762 1149 ----
NM_001040453chr1542473 873 554 420 22762 1149 ----
NM_001040653chr321981 80 ----1700
NM_001040665chr784953 4334 3971 2015 1846 1555 1017 65 1845 44658 3952 3365 39 14937
NM_001040666chr72655 36 ----1639
NM_001040697chr112551 107 --262 35 --
NM_001040712chr973492 3044 3010 2827 1147 770 28 12761 13316 --
NM_001042355chr1684492 4053 3883 1332 609 559 507 455 --15188 --
NM_001042399chr12191 ------
NM_001042403chr125789 383 348 217 142 ----1292
NM_001042404chr141897 1833 747 434 ------
NM_001042412chr1684492 4053 3883 1332 609 559 507 455 --15188 --
NM_001042413chr973652 3587 3328 2850 1049 919 356 --21625 747 13895
NM_001042414chr13----164 --
NM_001042422chr17169 ------
NM_001042423chr17169 ------
NM_001042425chr621407 1063 ----1310
NM_001042440chr582060 1910 1828 1447 1423 1391 667 353 ------
NM_001042441chr582060 1910 1828 1447 1423 1391 667 353 ------
NM_001042442chr582060 1910 1828 1447 1423 1391 667 353 ------
NM_001042443chr582060 1910 1828 1447 1423 1391 667 353 ------
NM_001042444chr582060 1910 1828 1447 1423 1391 667 353 ------
NM_001042445chr582060 1910 1828 1447 1423 1391 667 353 ------
NM_001042446chr582060 1910 1828 1447 1423 1391 667 353 ------
NM_001042473chr1051455 858 634 309 251 21752 223 12007 --
NM_001042478chr1----121 --
NM_001042481chr1472465 2447 2310 2272 2184 1965 865 ----1395
NM_001042486chr2051189 1165 1040 322 196 --1332 --
NM_001042492chr1752926 2648 2525 2349 370 12209 22816 210 --
NM_001042493chr631915 1676 691 ------
NM_001042494chr1563875 3363 3346 2703 2590 578 13305 --22869 1168
NM_001042495chr1563875 3363 3346 2703 2590 578 13305 --22869 1168
NM_001042496chr1563875 3363 3346 2703 2590 578 13305 --22869 1168
NM_001042497chr1563875 3363 3346 2703 2590 578 13305 --22869 1168
NM_001042510chr842062 1906 1349 244 --21585 43 --
NM_001042511chr842062 1906 1349 244 --21585 43 --
NM_001042517chr133958 360 164 ------
NM_001042533chr372671 2575 2524 2276 904 751 666 1111 22815 2386 --
NM_001042537chrX41962 1698 1547 852 --12476 --
NM_001042543chr441190 1122 1100 222 164 11527 11355
NM_001042555chr12124222 4138 3605 3511 3490 3088 1818 1557 1298 1263 732 644 11606 13931 --
NM_001042575chr32184 21 ------
NM_001042599chr297666 6903 6135 5305 2829 2084 2042 1056 495 11976 67820 7603 4751 2697 1757 86 15521
NM_001042601chr373079 3041 2674 1214 862 805 54 --12444 --
NM_001042603chr1253519 3461 3403 1182 1146 1179 55367 3503 3445 3387 3329 1807
NM_001042604chr3104109 3566 3401 3358 3334 3136 3005 1028 387 45 24700 1320 ----
NM_001042681chr142522 528 513 66 22129 842 21887 801 --
NM_001042682chr142522 528 513 66 22129 842 21887 801 --
NM_001042682chr142522 528 513 66 22129 842 21887 801 --
NM_001042683chr651632 1483 630 584 214 ----11723
NM_001042749chrX41824 1644 1353 572 ------
NM_001042750chrX41824 1644 1353 572 ------
NM_001042751chrX41824 1644 1353 572 ------
NM_001044385chr243870 3583 3352 2745 --1583 --
NM_001044722chr511528 --11759 --
NM_001044723chr511528 --11759 --
NM_001046chr552813 2130 1887 753 512 ------
NM_001048183chr153172 3019 1035 486 297 32357 1282 842 13352 13380
NM_001071775chr1331481 574 116 21545 313 ----
NM_001079874chr111552 --1552 1467
NM_001083620chr462497 2488 2443 848 438 403 --1343 --
NM_001095chr1291373 1301 1200 341 304 187 174 168 83 1317 ----
NM_001099678chr3156234 5967 5127 5010 4272 2311 2212 2198 1760 1708 1068 890 642 304 153 25295 4851 35685 5568 4482 --
NM_001105518chr12900 839 ------
NM_001106chr3199591 8750 8103 7289 7072 6259 6104 6057 5968 5929 3910 3174 2152 1970 1240 490 483 418 217 38859 2452 1094 47262 1474 898 122 58868 8245 7875 7584 202
NM_001112808chr12129 94 ------
NM_001113490chrX32339 1342 914 23020 3010 22719 2237 --
NM_001117chr1832287 636 167 --194 --
NM_001121chr1041654 1283 233 143 ------
NM_001126chr11410 --1360 --
NM_001128chr1643981 3316 3158 2734 --32747 537 400 --
NM_001140chr172623 162 ------
NM_001144chr1631243 1157 182 --2322 75 --
NM_001146chr852307 1901 1579 590 189 11815 11852 --
NM_001149chr10135 ------
NM_001151chr41194 ------
NM_001153chr22873 66 --1280 --
NM_001159chr22706 138 --1720 --
NM_001160chr1222727 810 ------
NM_001167chrX76707 5845 5592 4733 2327 1444 208 36402 4135 2254 36354 1392 836 --
NM_001173chr1454368 3732 1726 630 323 ----44695 4263 3218 1862
NM_001178chr113507 353 61 ------
NM_001186chr2173162 2342 2195 2165 1094 464 167 2730 120 --1958
NM_001198chr662448 2344 2308 1878 1593 491 1793 22252 767 --
NM_001200chr2021168 955 --21045 949 --
NM_001201chr493811 3376 3181 2747 2574 2410 1441 1205 124 --13235 --
NM_001204chr2167639 6304 5997 5707 5569 5497 4730 3117 3024 2284 2066 1764 1607 1573 911 631 14937 35247 1136 599 --
NM_001206chr942878 2112 892 620 --11973 --
NM_001219chr742259 1905 1523 44 ------
NM_001222chr102766 211 --11303 --
NM_001233chr73615 397 324 ------
NM_001238chr192500 89 ------
NM_001241chr241966 1710 964 342 ------
NM_001241chr241966 1710 964 342 ------
NM_001254chr172309 111 --1189 1240
NM_001256chr1732297 1898 22 ----1208
NM_001257chr16165 ----11236
NM_001259chr7145802 5202 5122 4764 4683 4629 4522 3843 2167 1651 1443 1270 1123 724 11492 44579 2198 2080 1315 11085
NM_001270chr5------1107
NM_001278chr104477 440 339 162 11130 --1139
NM_001280chr191619 ------
NM_001282chr1722419 291 --22289 906 --
NM_001284chr53542 522 387 274 59 ----
NM_001293chr112563 29 ----1402
NM_001304chr1793863 3512 3178 2797 2548 1475 885 775 567 23840 1526 2939 582 --
NM_001310chr1232653 1026 592 1652 1980 1138
NM_001313chr41899 ------
NM_001319chr191213 11039 ----
NM_001324chr202210 39 --2487 156 --
NM_001329chr1021489 1233 ------
NM_001331chr1172685 2454 2051 1874 1761 977 673 ------
NM_001338chr2121037 497 1208 --1388
NM_001343chr5----3323 153 97 11532
NM_001356chrX31560 869 628 ------
NM_001363chrX1688 ------
NM_001364chr1194061 3593 3284 3093 1870 1633 1367 1223 747 --23134 270 11711
NM_001386chr832119 2097 757 1909 --1748
NM_001390chr1853328 2907 2414 2379 1173 13022 11380 --
NM_001391chr1821034 431 --11097 --
NM_001396chr2172413 1962 1915 1909 1865 1112 291 ------
NM_001401chr931419 1111 1022 ------
NM_001402chr62804 358 11853 ----
NM_001407chr341734 1178 1147 130 --11501 --
NM_001412chrX73655 3572 3553 3169 2916 1420 726 1247 12840 --
NM_001416chr171448 ------
NM_001417chr1241871 1737 1555 74 --1395 --
NM_001418chr112691 145 2742 188 1483 --
NM_001418chr112691 145 2742 188 1483 --
NM_001419chr1984822 4242 3875 3568 1760 1167 957 537 12948 11234 --
NM_001420chr1933141 1925 637 1721 ----
NM_001423chr1241912 1655 1516 165 ------
NM_001427chr742036 1983 1793 140 ----1446
NM_001429chr222974 798 ------
NM_001430chr241862 1697 389 32 --21849 211 --
NM_001438chr173310 2634 1330 1211 530 350 328 22428 1069 1189 --
NM_001440chr831884 1092 315 --1899 --
NM_001444chr81134 ------
NM_001448chrX31724 1712 117 --11583 166
NM_001449chrX51259 1149 504 266 140 --167 --
NM_001452chr62684 575 ----1592
NM_001482chr155380 307 200 182 148 ------
NM_001483chr731048 986 724 ------
NM_001491chr622528 815 12252 1869 --
NM_001494chr101720 ------
NM_001497chr922164 2144 22710 63 --195
NM_001511chr44625 228 181 147 ------
NM_001518chr771100 918 426 380 232 145 106 --21106 125 --
NM_001530chr1451072 744 418 397 75 --2840 145 --
NM_001542chr162549 2477 2439 527 369 283 ------
NM_001543chr544582 4012 1597 1050 1768 23778 3703 13188
NM_001546chr661455 1237 1119 556 433 210 1407 ----
NM_001550chr73642 48 36 ------
NM_001554chr11660 ------
NM_001565chr42245 220 ------
NM_001584chr1131200 1133 989 ------
NM_001587chrX42215 1817 1486 816 1158 --1576
NM_001609chr1064489 3904 3725 3321 3071 284 --11724 1462
NM_001614chr17----1648 --
NM_001614chr17----1648 --
NM_001616chr283420 3254 2866 2625 1387 1166 1015 453 ------
NM_001621chr742483 2283 932 633 12089 1565 --
NM_001621chr742483 2283 932 633 12089 1565 --
NM_001634chr651604 726 443 421 270 1227 1506 --
NM_001649chrX32365 2114 747 --11991 11837
NM_001650chr183857 399 356 2883 338 --12964
NM_001658chr11986 ------
NM_001659chr1282672 2556 2437 2177 1970 821 585 424 --22492 384 --
NM_001660chr33723 231 150 ------
NM_001663chr1421865 130 --21095 994 11794
NM_001668chr111589 --1634 --
NM_001677chr15938 817 762 250 137 --2400 197 --
NM_001679chr31533 ------
NM_001682chr1272782 2289 2252 2045 614 580 395 ----22389 175
NM_001684chr173756 2567 1507 790 247 137 54 11076 3889 534 34 --
NM_001689chr241903 713 375 306 11411 ----
NM_001693chr841071 970 951 807 2852 100 --11083
NM_001698chr92378 349 ------
NM_001701chr92221 45 ------
NM_001704chr61390 --179 --
NM_001709chr1132845 452 147 11911 22476 1867 1935
NM_001729chr4--1365 ----
NM_001730chr1321124 403 --1314 --
NM_001730chr1321124 403 --1314 --
NM_001742chr721596 1483 --11749 1484
NM_001743chr21609 ------
NM_001746chr562921 2790 2659 2138 1878 1121 ------
NM_001748chr13885 287 281 --11063 1448
NM_001750chr582060 1910 1828 1447 1423 1391 667 353 ------
NM_001752chr113602 397 135 ------
NM_001753chr731826 1745 1596 --21429 559 --
NM_001754chr2153871 3372 3344 3104 2834 --53650 3205 2701 1519 1195 11078
NM_001755chr1662135 1898 1892 854 434 281 1615 1926 --
NM_001759chr1254804 4411 2074 1986 1804 --63868 3489 3473 3278 1595 112 --
NM_001769chr122127 34 1367 ----
NM_001777chr374009 3815 3307 3214 2678 2631 753 1496 23441 1252 --
NM_001788chr74930 881 771 281 --1858 --
NM_001789chr32496 53 ------
NM_001792chr182964 214 198 ----
NM_001795chr1641506 1499 1364 413 ------
NM_001797chr162634 121 --1568 --
NM_001799chr52112 24 ------
NM_001801chr53509 121 27 1540 1257 --
NM_001812chr41305 ------
NM_001822chr22496 33 ------
NM_001829chr44917 645 265 87 ------
NM_001830chrX31271 341 332 --23645 1572 13759
NM_001839chr12490 308 --1160 --
NM_001854chr121079 400 ------
NM_001855chr93592 226 109 ----1303
NM_001858chr6105011 4950 4850 4469 3877 3350 762 575 534 239 11965 ----
NM_001861chr161123 ------
NM_001880chr21115 ------
NM_001881chr102479 379 ------
NM_001884chr52544 112 ------
NM_001893chr17149 --1357 --
NM_001901chr621085 798 1175 1984 --
NM_001903chr52901 794 ------
NM_001904chr3260 54 2999 125 ----
NM_001918chr1149033 8841 7216 7142 7072 6394 3102 2206 1427 1270 1079 677 163 151 32715 2258 411 15961 16592
NM_001920chr122766 484 --2650 112 --
NM_001923chr112487 476 ----2661 213
NM_001924chr1------1473
NM_001931chr1121295 1200 --21101 1046 --
NM_001936chr72613 38 --11804 --
NM_001938chr171841 1750 741 364 330 31 22 --11208 --
NM_001939chrX73847 2500 1400 1391 674 534 435 12630 11471 --
NM_001949chr622677 932 ----1681
NM_001955chr6--2989 746 ----
NM_001964chr541096 471 255 140 --1177 --
NM_001968chr41353 --1316 --
NM_001969chr1421189 994 ----1370
NM_001970chr172573 420 ------
NM_001977chr42537 115 ------
NM_001980chr1211946 --11717 22294 563
NM_001981chr152160 1685 1596 509 283 --31573 861 313 --
NM_002006chr485750 5574 4707 4573 3608 2232 1401 1078 21819 1509 11628 15037
NM_002009chr153822 520 302 --12507 --
NM_002015chr1362728 2168 830 674 524 485 12050 11144 --
NM_002017chr112938 176 ------
NM_002019chr134913 751 734 616 ------
NM_002024chrX22029 1420 11935 11376 --
NM_002025chrX109093 8372 6303 6087 5784 5723 2333 911 421 43 22105 50 47879 6679 6600 1123 --
NM_002031chr62569 334 ------
NM_002033chr1154084 3680 3471 832 62 41490 1409 347 144 13599 13784
NM_002035chr1893869 3240 3097 3064 2795 2701 2656 902 319 ------
NM_002040chr2183161 3155 3135 3050 2367 2327 953 167 ------
NM_002060chr1----1496 --
NM_002063chrX21245 977 --11032 --
NM_002065chr121166 450 11348 ----
NM_002069chr751912 1714 1449 707 254 ------
NM_002076chr1252184 1085 1004 718 189 --23190 2963 13128
NM_002089chr43233 190 147 ------
NM_002090chr42584 202 --1158 --
NM_002092chr474991 4923 4072 3839 3787 1027 681 13374 ----
NM_002111chr432370 1043 610 1150 11196 12886
NM_002126chr1763817 3766 3742 3136 2624 1660 2636 101 13580 1657
NM_002128chr1321741 739 --11888 --
NM_002137chr732281 2192 848 ------
NM_002139chrX------165
NM_002156chr22308 21 ------
NM_002158chr252786 1340 1068 693 476 ----13794
NM_002160chr91434 ----160
NM_002163chr164477 460 291 257 --1250 --
NM_002165chr201364 ------
NM_002202chr531012 403 197 ------
NM_002203chr533466 2599 1034 --23333 1514 --
NM_002211chr1041125 715 302 95 ------
NM_002214chr795250 4838 4822 4454 4163 2014 1403 1246 677 --22127 950 15055
NM_002222chr321154 29 ------
NM_002223chr1253218 3091 2713 457 324 13235 12900 --
NM_002224chr62723 238 1125 ----
NM_002227chr1--1823 --1957
NM_002228chr131164 1120 776 ------
NM_002240chr212159 119 1450 ----
NM_002247chr1062332 2299 1800 1617 919 115 140 ----
NM_002254chr251959 1514 1462 152 74 --3934 665 379 --
NM_002264chr3104878 4872 4792 3764 3308 3296 1292 938 413 234 23872 3740 ----
NM_002266chr171193 168 ----
NM_002267chr1332134 1706 641 21625 616 1800 --
NM_002268chr321703 1246 ------
NM_002269chr61400 ------
NM_002270chr5135350 5275 5202 4567 3970 3748 2181 1997 1613 1230 965 396 301 24941 997 24060 695 --
NM_002271chr1321573 246 ----2829 186
NM_002285chr274177 3597 3072 2687 1447 838 358 --13143 --
NM_002293chr121819 401 12114 --12178
NM_002313chr1084060 3508 1849 1661 1228 733 620 210 11990 24145 3485 --
NM_002334chr112715 379 1156 --1226
NM_002336chr1284616 4291 3523 3125 1672 1553 975 733 22003 1641 ----
NM_002351chrX134 11485 ----
NM_002356chr631940 260 133 11076 11754 12883
NM_002358chr41103 ------
NM_002361chr191224 ------
NM_002374chr263467 3362 3218 2923 2331 147 12702 1295 --
NM_002381chr22857 160 1294 --1675
NM_002382chr1431004 447 144 ------
NM_002384chr182969 656 --1954 --
NM_002387chr5115158 3848 3759 3670 3649 1778 1405 1278 958 904 274 13487 44953 3190 1259 27 14612
NM_002395chr651461 1428 1077 382 111 --1231 --
NM_002398chr22412 379 ----11389
NM_002399chr1531234 1225 441 ------
NM_002401chr1722290 723 42343 1712 563 547 ----
NM_002403chr11414 ------
NM_002416chr421322 44 ----1219
NM_002442chr1231532 582 446 ------
NM_002444chrX52007 1407 1389 800 714 11501 21431 571 --
NM_002449chr551075 926 483 465 364 ------
NM_002460chr673606 3313 1332 1265 1247 953 784 ------
NM_002469chr122509 421 ------
NM_002473chr224912 884 498 352 2948 428 ----
NM_002481chr1117948 7880 7238 5457 5422 5036 3001 2905 1524 1381 386 36532 2162 1555 3972 696 360 23079 124
NM_002485chr861949 1908 1453 470 455 51 --1798 --
NM_002487chr152734 644 ------
NM_002499chr1531814 1706 235 1590 1406 --
NM_002500chr25948 925 407 216 205 ------
NM_002508chr151758 1644 1608 533 51 ------
NM_002514chr821188 266 ------
NM_002515chr1421844 43 ----2277 167
NM_002518chr241104 939 853 818 ------
NM_002519chr1121270 617 ------
NM_002524chr12417 357 2758 286 2901 251 --
NM_002526chr661624 1540 1231 1174 267 64 --11083 --
NM_002537chr15122 --1279 --
NM_002540chr92683 590 ------
NM_002545chr11104671 4195 3711 3662 3459 1498 950 875 838 616 3923 811 325 --1209
NM_002552chr22132 94 --1453 --
NM_002553chr7--1193 ----
NM_002556chr1161743 1412 643 596 369 308 ------
NM_002572chr11----1392 153
NM_002577chr352967 2817 2728 294 41 --2800 629 --
NM_002581chr9145672 5497 4901 4651 4592 3647 1415 1152 979 928 859 669 309 130 34585 3933 1855 2688 142 --
NM_002594chr204973 659 631 179 1526 ----
NM_002595chr1241846 782 737 427 1221 ----
NM_002600chr161301 1226 1198 623 471 299 1391 31361 1350 33 --
NM_002605chr153978 958 155 --1801 --
NM_002607chr721243 1179 ------
NM_002610chr272736 2657 2396 2268 817 297 190 22764 566 --1414
NM_002613chr1695277 5241 4974 4727 3905 3668 3649 1607 1125 14215 11964 --
NM_002623chr202522 276 1532 ----
NM_002628chr331073 779 99 ------
NM_002641chrX31891 1606 46 1641 ----
NM_002645chr1152692 2361 1173 1099 336 1390 --1855
NM_002646chr141699 1630 1475 262 --1836 1741
NM_002648chr62523 343 --2844 500 --
NM_002655chr894598 4259 3880 3862 3798 356 288 196 102 11777 ----
NM_002656chr61973 ------
NM_002657chr2053880 3079 2795 2593 2499 22886 845 ----
NM_002670chr361443 1237 1209 604 481 343 1194 --21339 23
NM_002687chr1411006 1147 ----
NM_002699chr13553 274 98 ------
NM_002706chr21519 ------
NM_002707chr21277 ------
NM_002709chr273629 3586 3536 3444 3019 2537 520 ------
NM_002710chr123980 934 869 ------
NM_002716chr1143284 2799 858 184 11197 22353 994 --
NM_002719chr1432257 2012 746 ----11715
NM_002731chr182975 2233 2172 2140 2114 2013 1993 1156 ------
NM_002734chr1751934 757 618 504 213 ------
NM_002736chr74866 761 341 121 ------
NM_002740chr352817 2554 2388 2318 164 1708 128 --
NM_002745chr22104441 4190 3624 3502 2950 1517 1233 1223 1048 341 --11657 --
NM_002748chr1571089 1076 908 491 297 158 84 ------
NM_002755chr153645 611 348 --1146 --
NM_002760chrY75230 5215 4494 3855 2226 2010 229 --15973 --
NM_002788chr14----138 --
NM_002811chr163522 366 127 ------
NM_002814chrX1234 --1214 --
NM_002815chr17----197 --
NM_002821chr62832 799 2332 256 ----
NM_002822chr122620 179 ------
NM_002827chr2061832 1805 1326 188 139 45 ------
NM_002828chr182701 29 --1998 1675
NM_002833chr1531517 1184 600 ------
NM_002834chr1263779 2760 1490 1242 980 523 1481 11145 1908
NM_002835chr72785 144 ------
NM_002839chr973492 3044 3010 2827 1147 770 28 12761 13316 --
NM_002840chr121589 494 --11537 11315
NM_002841chr32506 109 --1215 --
NM_002843chr1162963 2284 1169 1147 1004 508 --1410 --
NM_002844chr62352 120 ------
NM_002849chr1251036 860 758 727 713 1296 ----
NM_002851chr72553 223 1629 1136 --
NM_002852chr31584 ------
NM_002858chr11350 ----11325
NM_002859chr1231231 718 22 11470 21249 623 --
NM_002863chr14155 ------
NM_002868chr1242455 2240 2036 377 --22259 1848 --
NM_002869chr112519 205 ----1490
NM_002882chr221101 ------
NM_002886chr355037 1756 1372 780 411 14360 14837 1589
NM_002887chr5------135
NM_002892chr1411573 ------
NM_002893chrX1327 ------
NM_002894chr181208 ------
NM_002902chr153526 504 90 ------
NM_002906chr11--1451 --12327
NM_002912chr62759 135 ------
NM_002924chr11560 ----1213
NM_002938chr461628 1409 563 394 378 68 --31569 735 530 11864
NM_002942chr321313 472 ------
NM_002956chr1251421 1240 1035 461 236 ------
NM_002958chr33785 655 371 ------
NM_002968chr1621087 353 ------
NM_002971chr33922 768 187 ------
NM_002973chr122532 406 --148 158
NM_002977chr2102366 2182 2170 1283 838 635 559 532 303 296 ------
NM_002994chr441926 1627 1468 634 ------
NM_002995chr11126 1309 ----
NM_002998chr861725 1520 1493 686 583 412 ----11732
NM_003010chr1732047 1882 1795 3747 710 634 12428 --
NM_003011chr941649 467 208 141 1450 11196 --
NM_003013chr43764 620 58 --1858 --
NM_003016chr1711468 ------
NM_003017chr61565 ------
NM_003026chr921218 1100 1346 41116 1107 1002 966 --
NM_003030chr331416 765 713 --11741 --
NM_003034chr12228105 7967 7953 7925 7808 7588 6944 6596 6215 5597 5591 5456 5155 5123 5036 3053 2135 1844 1554 1082 614 53 12145 46899 6081 1396 947 25095 4909
NM_003036chr121004 464 11236 31198 1029 179 --
NM_003042chr342272 2148 2051 672 ------
NM_003043chr31322 11419 13919 1366
NM_003046chr895306 5199 3434 2109 1566 1536 662 451 313 25363 3346 13867 --
NM_003051chr141962 730 566 509 179 21260 63 --
NM_003069chrX2585 289 --1302 --
NM_003070chr93598 286 102 --161 --
NM_003074chr362048 2031 1536 759 531 371 1328 11863 --
NM_003079chr1741004 861 419 308 ----1723
NM_003100chr52352 312 ------
NM_003101chr121563 1027 --1598 1651
NM_003106chr321070 1001 1410 ----
NM_003107chr652412 2147 1611 900 231 --12223 --
NM_003108chr2126564 6234 5651 5526 5489 5475 5089 4850 1810 1708 808 677 15999 22074 824 --
NM_003111chr2------1239
NM_003112chr732630 2611 2043 32765 2289 1050 ----
NM_003114chr84777 621 163 131 ----2737 613
NM_003126chr12436 391 ------
NM_003137chr692160 1859 1822 1726 1555 1535 749 721 436 1225 12210 --
NM_003140chrY151 ------
NM_003150chr1732385 1549 139 1704 1394 159
NM_003153chr1221148 754 ----2196 42
NM_003155chr81176 31831 569 264 2220 118 1251
NM_003161chr1783548 3247 2310 1388 1138 1130 1111 489 13489 21122 793 --
NM_003162chr23836 756 106 11030 ----
NM_003178chr341472 727 502 171 ------
NM_003185chr2041284 1037 498 323 --1353 --
NM_003188chr61184 --1633 --
NM_003189chr153422 3267 2488 667 384 --12643 --
NM_003194chr6------1400
NM_003199chr1875292 4136 2130 1953 1722 1716 761 13884 15631 14160
NM_003201chr102708 669 --1258 1149
NM_003202chr541903 573 527 511 11511 1363 --
NM_003211chr1231753 708 101 1541 ----
NM_003216chr2293173 2960 2887 2495 2450 2060 1220 257 50 ------
NM_003220chr621407 1063 ----1310
NM_003223chr163745 605 93 1291 ----
NM_003242chr352460 2442 772 250 185 1878 21582 814 --
NM_003246chr1562016 1954 1850 1276 302 267 --11410 11720
NM_003247chr652036 1674 1556 1437 1270 ------
NM_003253chr2161644 1590 1503 745 295 56 --2710 382 --
NM_003257chr1531291 1117 1008 170 ----
NM_003262chr393731 3357 3283 1970 883 325 226 107 52 11602 15069 --
NM_003270chrX21083 33 --1259 --
NM_003274chr2182698 2664 2572 2454 2301 1138 975 478 --22077 1901 --
NM_003286chr2031122 402 376 ----1295
NM_003289chr91181 ------
NM_003292chr141874 1560 411 230 ----22155 265
NM_003298chr395718 5702 5223 4931 4831 4760 2116 2026 1094 15868 25801 4686 --
NM_003304chr331496 1047 617 ------
NM_003315chr171240 ------
NM_003318chr62243 229 ------
NM_003319chr22633 266 ------
NM_003337chr541446 1286 103 50 ------
NM_003338chr1051300 783 452 429 330 --21778 120 --
NM_003339chr55619 517 243 128 90 ------
NM_003340chr41131 ------
NM_003341chr34641 530 218 109 ------
NM_003342chr1753042 2274 1001 988 81 --21279 914 --
NM_003347chr2262335 1919 1504 246 211 138 ----11906
NM_003350chr83847 760 365 --144 --
NM_003359chr441077 991 504 67 ------
NM_003368chr13781 659 564 ------
NM_003369chr1132010 301 41 21769 695 --12258
NM_003373chr1051702 1292 691 329 244 139 11944 1699
NM_003379chr62758 422 11014 ----
NM_003383chr91406 --1193 --
NM_003385chr231020 860 657 ------
NM_003387chr261903 1802 695 560 412 22 11866 11121 --
NM_003390chr111111 ------
NM_003392chr364355 3649 2662 1215 543 434 12913 11715 --
NM_003399chrX1792 ------
NM_003400chr22605 246 1829 ----
NM_003406chr871921 1720 1456 565 132 120 24 ------
NM_003410chrX62843 907 459 304 257 185 1439 12064 --
NM_003411chrY61855 1240 650 494 421 246 ------
NM_003413chrX41716 1295 1283 221 --11228 --
NM_003439chr733034 968 957 12359 53154 887 688 591 155 --
NM_003442chr111865 ------
NM_003445chr191842 1104 ----
NM_003453chr134697 519 261 175 ------
NM_003454chr1641434 1376 1320 1135 ------
NM_003457chr171151 ------
NM_003458chr342522 1359 1261 1026 12961 13699 11210
NM_003463chr673119 3037 2961 2849 2610 1019 595 23101 944 --2573 130
NM_003468chr264129 2941 1307 299 201 87 ------
NM_003469chr23459 447 329 --183 --
NM_003471chr34937 881 574 200 12375 --12068
NM_003473chr102856 756 ------
NM_003478chr1163190 2999 2862 2747 1219 123 11201 ----
NM_003483chr1262902 2716 1988 1811 791 703 --125 12709
NM_003489chr2132219 1359 753 ------
NM_003496chr7164 --2834 734 --
NM_003505chr721950 1544 ------
NM_003506chr83497 327 272 --1288 --
NM_003507chr242020 1984 1774 113 ------
NM_003557chr131586 1407 1303 --21292 95 138
NM_003558chr92530 503 ----1205
NM_003566chr1282635 2322 2168 1124 1117 954 494 168 ------
NM_003574chr1875408 4810 1934 1374 911 481 66 14968 13880 --
NM_003580chr82576 468 1412 --1110
NM_003583chr1263834 3251 3141 3082 1250 107 --11473 --
NM_003589chr1321366 1088 --11302 --
NM_003590chr263675 3617 3060 2955 1624 99 ----1553
NM_003592chr72493 483 ------
NM_003595chr221186 --1451 --
NM_003597chr242325 1445 327 315 ------
NM_003603chr421740 663 --11974 --
NM_003607chr173895 3117 3072 1568 1478 898 517 13434 1270 --
NM_003613chr151476 1578 128 --
NM_003615chr384035 3926 3854 3163 2732 1180 820 287 12957 ----
NM_003617chr154102 4012 3274 1163 177 ----11715
NM_003618chr21975 ------
NM_003622chr1261849 1039 910 777 220 118 22105 1946 147 1283
NM_003626chr1171333 1283 1237 1126 1024 437 32 ------
NM_003632chr173786 673 249 ----1293
NM_003633chr532050 1703 612 11997 21017 72 --
NM_003642chr21118 ------
NM_003655chr172660 505 ------
NM_003659chr22218 159 1771 ----
NM_003660chr192315 268 ------
NM_003663chr383337 2827 2439 1315 908 816 778 533 --23307 314 21373 1202
NM_003671chr943403 3296 3138 3000 ------
NM_003672chr121870 106 1636 ----
NM_003677chr1231758 812 258 ------
NM_003690chr22519 247 --178 --
NM_003692chr91248 ----1679
NM_003713chr141186 1133 451 142 --11245 --
NM_003714chr592641 2542 2325 2159 2053 1173 875 614 211 22090 77 12486 13043
NM_003716chr31741 ------
NM_003718chr72440 395 ------
NM_003722chr342548 2042 1055 1032 --12474 --
NM_003744chr1411264 ------
NM_003749chr1352020 1921 1684 1495 886 --1810 --
NM_003758chr15--21021 337 --186
NM_003758chr15--21021 337 --186
NM_003759chr494232 4212 3076 2983 2792 2747 2708 1132 1010 --1950 --
NM_003763chr2032652 2610 1193 12799 23120 728 --
NM_003766chr171451 ------
NM_003769chr12--1278 ----
NM_003787chr1841393 1141 639 534 ------
NM_003797chr111186 ------
NM_003800chr662339 1750 1647 1548 823 817 1470 ----
NM_003816chr821395 1116 --1373 --
NM_003822chr141130 829 647 518 ----12352
NM_003831chr182704 371 ------
NM_003840chr83486 458 39 1112 ----
NM_003842chr83914 640 41 --22420 707 --
NM_003861chr1442069 1941 1877 1806 --1149 --
NM_003862chr5178 ------
NM_003870chr15--12033 ----
NM_003872chr242968 2358 2011 287 ----1573
NM_003873chr1042395 2376 2317 941 ------
NM_003877chr121634 --3899 781 191 --
NM_003884chr351813 1691 665 247 71 11170 --11322
NM_003885chr1712175 ------
NM_003887chr22589 154 --11509 --
NM_003888chr1541503 1485 1461 1258 --1645 --
NM_003895chr2121983 523 1395 1700 --
NM_003906chr21151 ------
NM_003909chr872382 2289 2175 1094 813 493 76 --188 --
NM_003913chr674090 3754 3558 3406 3245 1561 1101 13952 11211 --
NM_003922chr151374 ------
NM_003930chr732007 261 28 2829 317 31998 711 665 --
NM_003931chr61183 ------
NM_003932chr2221582 168 ----11474
NM_003934chr931285 465 74 ------
NM_003938chr191188 ------
NM_003941chr71820 22255 2218 11717 198
NM_003947chr331141 433 210 ------
NM_003953chr172679 2165 1934 828 506 228 170 12501 ----
NM_003958chr673354 2934 2677 851 713 506 248 13468 22709 1331 --
NM_003966chr5127657 6870 6738 6330 5672 5042 3043 2999 2806 1696 1148 712 35600 2989 1116 25051 1639 26640 2408
NM_003971chr17264 43 ----1158
NM_003980chr64555 423 274 47 --1384 11135
NM_003982chr14147 ------
NM_003983chr1673995 3311 3226 873 727 686 249 12923 23456 2971 13525
NM_003994chr1254244 4065 2920 1476 183 1774 ----
NM_004001chr13515 459 138 1391 ----
NM_004006chrX52590 2164 739 264 95 1597 11938 --
NM_004007chrX52590 2164 739 264 95 1597 11938 --
NM_004009chrX52590 2164 739 264 95 1597 11938 --
NM_004010chrX52590 2164 739 264 95 1597 11938 --
NM_004011chrX52590 2164 739 264 95 1597 11938 --
NM_004012chrX52590 2164 739 264 95 1597 11938 --
NM_004013chrX52590 2164 739 264 95 1597 11938 --
NM_004014chrX52590 2164 739 264 95 1597 11938 --
NM_004015chrX52590 2164 739 264 95 1597 11938 --
NM_004016chrX42504 2078 653 178 1511 11852 --
NM_004017chrX52590 2164 739 264 95 1597 11938 --
NM_004018chrX42504 2078 653 178 1511 11852 --
NM_004019chrX199 --1402 --
NM_004020chrX52590 2164 739 264 95 1597 11938 --
NM_004021chrX42504 2078 653 178 1511 11852 --
NM_004022chrX42504 2078 653 178 1511 11852 --
NM_004023chrX42504 2078 653 178 1511 11852 --
NM_004028chr183857 399 356 2883 338 --12964
NM_004040chr221327 954 ----11244
NM_004067chr731325 1171 1012 --1437 11053
NM_004079chr122722 715 2653 258 22963 2490 1669
NM_004081chrY21194 549 11345 ----
NM_004087chr32766 663 11980 --1478
NM_004089chrX--1793 146 --
NM_004093chr1322775 2526 12634 1400 --
NM_004094chr1462915 2594 2306 2074 942 373 --12484 11874
NM_004096chr1021490 705 --21605 555 21981 785
NM_004098chr1031193 1137 1046 ------
NM_004099chr931524 1384 703 --11975 11401
NM_004100chr631989 1013 1005 ------
NM_004109chr1131766 767 310 --21533 37 11645
NM_004112chr1741426 509 449 135 --21652 456 --
NM_004114chrX--1110 2474 139 --
NM_004119chr131618 --1563 1669
NM_004124chr1452674 2367 2223 834 267 ----23013 2180
NM_004125chr93953 852 318 --1163 --
NM_004133chr822390 1855 1912 --12647
NM_004134chr53210 116 95 --1614 --
NM_004136chr1573062 2134 1303 1221 1140 1042 913 13127 12299 13055
NM_004170chr991469 1360 1278 544 403 390 249 226 139 --11743 --
NM_004171chr11158887 7098 6715 6704 6551 6081 6061 6004 3435 3300 2479 997 648 451 108 11442 17861 23828 1115
NM_004172chr512060 --11564 --
NM_004180chr22609 33 ------
NM_004185chr12504 112 1641 ----
NM_004187chrX11317 ------
NM_004193chr101409 ------
NM_004202chrY468 59 37 26 --1545 --
NM_004207chr17169 ------
NM_004215chr81594 ------
NM_004225chr831378 537 214 --11206 --
NM_004229chrX31875 1715 1407 11577 11546 --
NM_004232chr1842774 2630 1403 1068 11236 32926 2460 1479 --
NM_004235chr92739 55 ----1221
NM_004241chr102791 312 ------
NM_004242chr61289 1105 --168
NM_004244chr121429 ------
NM_004251chrX--1102 ----
NM_004261chr14755 679 304 106 ------
NM_004272chr511283 ------
NM_004273chr1064943 4853 4399 3564 3332 3244 33747 3098 526 156 14619
NM_004274chr1453220 2924 2818 2510 357 21043 290 22609 490 32181 1031 666
NM_004277chr631634 1534 315 --188 --
NM_004279chr72726 315 1502 --1359
NM_004282chr62637 193 1614 ----
NM_004285chr1126419 5863 5739 5513 5297 4855 4588 4110 2354 2267 2196 1463 14122 24679 115 25897 1188
NM_004301chr3----2352 23 --
NM_004302chr1292939 2858 2381 2257 2168 1957 833 530 193 32627 2492 2191 22544 94 --
NM_004319chr163053 2482 2461 2240 774 327 2307 203 ----
NM_004323chr982188 2042 1973 1051 857 256 75 54 --1880 --
NM_004326chr11165 ------
NM_004329chr1021357 947 --3436 407 50 --
NM_004331chr892244 1988 1944 1792 828 731 365 178 116 ----12050
NM_004338chr18127036 6921 6564 6199 5637 5464 2518 1948 1634 1169 1091 624 26766 1726 16930 36119 1420 745
NM_004342chr731696 1532 411 12187 1257 --
NM_004344chrX----123 --
NM_004349chr811228 1349 ----
NM_004359chr19130 ------
NM_004362chr43703 608 499 ----1464
NM_004370chr652003 1512 467 454 170 --11836 --
NM_004371chr121360 147 ------
NM_004380chr163738 585 495 11815 ----
NM_004384chr511528 --11759 --
NM_004392chr1362578 2547 2376 1882 1627 148 ------
NM_004393chr352365 2341 513 494 403 ------
NM_004395chr51170 ------
NM_004397chr1173966 3854 1586 1435 1415 1189 1132 21281 816 1608 --
NM_004404chr252025 1992 1974 1925 558 1394 11426 --
NM_004408chr91203 ----1479
NM_004414chr2141567 576 395 55 ------
NM_004417chr52662 417 ------
NM_004423chr392603 2424 2253 796 673 507 468 223 79 22666 1817 ----
NM_004426chr1241518 1397 649 593 11510 2687 206 --
NM_004432chr942093 695 316 247 21674 776 1229 --
NM_004434chr1451782 1401 1205 606 298 11842 ----
NM_004438chr273170 2414 2085 928 833 82 42 --11308 --
NM_004440chr621665 1229 ------
NM_004441chr311134 --11280 --
NM_004447chr12--1238 ----
NM_004450chr141295 ------
NM_004454chr311611 --11873 --
NM_004457chr221703 410 1220 ----
NM_004459chr1771874 1846 1793 1430 1385 555 229 11396 ----
NM_004464chr493770 3545 3449 1381 996 634 561 319 51 14265 13347 --
NM_004469chrX1106 ------
NM_004480chr14----1263 --
NM_004481chr142179 2127 965 585 --1276 --
NM_004492chr15124 ------
NM_004499chr53466 416 97 ------
NM_004500chr1431899 731 44 --11264 --
NM_004501chr163919 3506 3278 1063 731 252 ------
NM_004503chr121583 ------
NM_004504chr242875 2536 1897 517 32970 837 666 ----
NM_004505chr171787 21720 326 ----
NM_004506chr61289 ------
NM_004514chr1732860 2257 1056 12332 3929 486 248 --
NM_004516chr192376 38 ------
NM_004520chr52571 278 ------
NM_004521chr102283 91 ------
NM_004525chr25950 463 176 154 57 ------
NM_004529chr911464 ----11176
NM_004537chr124523 430 50 44 ------
NM_004538chrX--1649 2752 193 --
NM_004563chr141162 ------
NM_004569chr14--1219 ----
NM_004571chr2142764 1115 876 53 11025 23276 576 --
NM_004580chr1531903 1668 541 --11679 --
NM_004586chrX35313 3658 1040 34857 4365 1598 25119 3727 --
NM_004593chr35272 240 168 125 116 --1305 --
NM_004598chr553345 3070 1171 1002 924 11037 11183 12863
NM_004600chr13552 531 233 1185 ----
NM_004612chr994099 3956 3892 3101 1595 1561 810 471 240 --179 --
NM_004615chrX1778 ------
NM_004631chr13531 208 88 11249 ----
NM_004637chr341250 1231 542 252 --21092 432 11045
NM_004641chr1031550 1314 122 --11624 --
NM_004655chr171903 --11303 --
NM_004660chrY32334 1506 624 ------
NM_004661chr52387 108 1380 11086 --
NM_004667chr151447 ----1641
NM_004670chr1041689 1653 1299 52 --2507 265 --
NM_004685chr1351961 1088 631 523 511 ------
NM_004694chr172633 96 ------
NM_004697chr92951 223 --1428 2101 89
NM_004703chr1762324 2177 1890 1799 790 726 ----1534
NM_004705chr112308 134 ------
NM_004713chr144755 652 544 253 ------
NM_004715chr182194 178 ------
NM_004717chr751568 1373 1339 125 48 --1392 --
NM_004719chr1232847 1889 662 1886 21921 1115 --
NM_004726chrX105560 4816 3858 1661 1350 815 624 348 254 167 2544 42 ----
NM_004730chr531946 273 267 ------
NM_004734chr1372961 2781 927 725 518 201 121 --13224 --
NM_004744chr463978 3758 2975 2752 1266 1206 12437 13767 --
NM_004745chr8116527 6007 5722 4714 2318 2211 1926 1749 507 348 195 25936 934 25455 1970 22635 1832
NM_004748chr1554006 2906 2746 1213 359 13450 1611 --
NM_004760chr73966 255 34 1411 --12221
NM_004765chr16150 ------
NM_004766chr3121 ------
NM_004768chr171166 948 798 783 461 351 236 ------
NM_004775chr1842169 2134 2029 1727 ------
NM_004779chr53908 892 143 ------
NM_004781chr131104 673 485 --11726 --
NM_004781chr131104 673 485 --11726 --
NM_004788chr1142529 2267 738 127 --11676 --
NM_004791chr132697 122 ------
NM_004796chr1442266 1885 1590 348 1861 146 12315
NM_004798chr2063590 2873 2662 923 636 595 13367 23414 3205 --
NM_004805chr21993 --21440 413 --
NM_004815chr174905 4271 4076 3226 3021 1425 628 24748 1881 23849 935 11204
NM_004834chr233374 3094 2875 ----31185 901 250
NM_004836chr2----1614 --
NM_004840chrX52122 2003 850 558 502 --2831 755 --
NM_004841chr141085 1047 423 65 ------
NM_004842chr641617 1488 1442 573 ------
NM_004845chrX73403 3325 2820 1250 977 384 311 1431 13073 --
NM_004849chr61684 ----31322 1135 1051
NM_004850chr2--21625 372 ----
NM_004857chr1474041 3260 2918 1434 1059 749 428 23718 172 34085 1589 1030 --
NM_004859chr1752737 2244 2082 2044 55 --12485 --
NM_004863chr1453966 2050 1265 1191 946 44773 3716 1631 657 1277 --
NM_004865chr61363 ------
NM_004866chr564654 3345 3212 697 169 64 14211 11716 11283
NM_004867chrX2696 676 ------
NM_004869chr1821566 350 --11514 1101
NM_004871chr17103271 1724 1312 1261 961 924 885 805 765 369 --23840 1510 --
NM_004873chr1443100 989 129 53 --22961 2495 --
NM_004887chr51186 ----1171
NM_004893chr51404 ------
NM_004898chr432850 2083 1998 --12011 --
NM_004902chr202347 101 --1221 1803
NM_004904chr7116519 6027 6012 5755 5395 4649 4441 4122 2246 1909 1502 1205 11737 --
NM_004905chr13905 598 181 ----1681
NM_004925chr94844 825 551 125 ------
NM_004929chr851348 1044 1008 565 158 1547 11051 --
NM_004932chr521693 316 1536 199 --
NM_004938chr931195 229 155 ------
NM_004947chr332497 236 222 12565 1145 --
NM_004948chr18--11308 ----
NM_004956chr7104498 3497 3472 3400 1110 1056 489 270 152 49 43897 3447 1649 161 --24143 3130
NM_004969chr10----1447 --
NM_004972chr91421 ----1379
NM_004976chr1153412 3304 1410 1104 1098 ----1639
NM_004985chr1294253 3892 3159 3059 1629 1314 929 604 428 --1132 --
NM_004987chr23329 65 24 ------
NM_004998chr15------1318
NM_004999chr654394 3374 1035 908 105 13944 12885 --
NM_005006chr241105 811 789 734 ------
NM_005010chr751739 1669 695 684 108 11392 21369 678 --
NM_005011chr741676 260 51 37 1682 ----
NM_005017chr31236 ------
NM_005022chr17------1244
NM_005025chr3183 ------
NM_005028chr10--11458 21954 599 --
NM_005032chrX2935 249 ------
NM_005044chrX74529 3749 3734 3013 2827 615 46 --21824 1580 --
NM_005054chr241772 1734 1526 59 ------
NM_005056chr1253763 3705 3647 1426 1390 1423 55611 3747 3689 3631 3573 11051
NM_005065chr1495043 5024 4213 3451 3314 1403 1107 932 293 22150 1468 --11982
NM_005066chr14829 713 304 225 ------
NM_005067chr32634 292 --1655 1977
NM_005076chr163614 2921 2822 2688 1397 867 --21474 169 11551
NM_005079chr872102 2087 2055 1179 759 474 359 --22730 1052 192
NM_005086chr1231573 275 170 ------
NM_005087chr3133 --1591 --
NM_005088chrX3753 646 113 ------
NM_005093chr2055255 3301 3288 3240 1446 11125 25354 960 1872
NM_005095chr121922 1586 21755 328 ----
NM_005105chr12491 160 --1373 12028
NM_005109chr362551 2115 1859 931 734 63 1423 1978 --
NM_005114chr43553 492 439 --1173 --
NM_005116chr2084135 4029 3961 3482 1378 852 145 107 --13365 --
NM_005119chr131245 1228 858 ------
NM_005121chr1743012 1411 1140 968 ------
NM_005126chr352263 1954 1836 1542 599 2483 285 ----
NM_005135chr1563875 3363 3346 2703 2590 578 13305 --22869 1168
NM_005151chr1832369 1653 61 --11776 --
NM_005156chr964933 3461 2006 1692 1684 217 23849 911 14788 22022 207
NM_005160chr22156762 6518 5860 5636 5558 5477 4386 2307 2132 2029 1532 1247 1130 534 399 --36604 4648 885 22281 1575
NM_005164chr1242461 2445 1917 1666 --12172 22568 1682
NM_005168chr211466 ----11544
NM_005171chr123941 377 344 ----1423
NM_005175chr17--180 ----
NM_005180chr1091544 1523 1483 1400 1260 1193 629 589 470 ------
NM_005181chr81694 ------
NM_005188chr11128249 7835 7266 6793 5203 3110 3058 3026 837 586 498 381 23121 2424 57862 6654 5896 5322 1005 --
NM_005189chr1722523 2263 22498 2333 ----
NM_005191chr331435 1412 592 ------
NM_005197chr1465763 5381 4912 4193 3873 247 22378 995 ----
NM_005204chr103920 386 58 ------
NM_005219chr521674 574 ----1708
NM_005222chr74831 348 265 179 --1225 --
NM_005229chrX11225 ------
NM_005230chr122542 68 ------
NM_005233chr322623 671 ------
NM_005235chr297666 6903 6135 5305 2829 2084 2042 1056 495 11976 67820 7603 4751 2697 1757 86 15521
NM_005238chr1132991 500 88 --1117 --
NM_005241chr31304 ------
NM_005249chr142286 35 ------
NM_005254chr1531348 226 28 --11079 --
NM_005257chr181936 ------
NM_005259chr231417 1183 1018 ------
NM_005261chr82685 272 --21017 991 --
NM_005264chr106915 880 849 770 612 374 ------
NM_005277chr431702 1501 206 ----125
NM_005302chr72179 144 ------
NM_005308chr101350 ------
NM_005318chr2211052 ------
NM_005324chr1731956 1852 567 ----1704
NM_005327chr41141 1707 ----
NM_005328chr83708 562 210 ----2572 156
NM_005329chr1632278 2042 1882 --22307 428 --
NM_005334chrX11521 --31643 1420 574 1183
NM_005339chr484034 3867 3570 3336 3153 1304 1160 77 13070 ----
NM_005358chr1341859 1449 478 227 1587 1511 --
NM_005359chr18136419 5381 5361 2163 1981 1526 1457 1423 970 905 886 353 97 25193 1838 32393 1713 1274 32499 1398 489
NM_005376chr121125 984 ------
NM_005381chr2157 ------
NM_005382chr82356 113 ------
NM_005385chr362521 1838 974 310 207 83 --32383 2335 739 --
NM_005387chr112603 160 ------
NM_005398chr1041274 1033 521 471 --11414 --
NM_005399chr143625 3376 2810 1754 12841 1269 23483 387
NM_005400chr242593 2252 1004 329 --1900 12632
NM_005402chr7----1391 --
NM_005406chr1811524 ------
NM_005410chr53558 261 127 ------
NM_005426chr11282 ----1903
NM_005433chr1831983 1042 65 22154 35 11740 --
NM_005436chr106819 728 571 556 217 55 1437 --11262
NM_005455chr161639 1608 1569 1497 1413 38 ------
NM_005460chr5----1523 --
NM_005465chr112000 --12058 1718
NM_005475chr12103028 2951 2778 1263 1194 733 440 379 190 151 --52877 2642 864 576 506 --
NM_005479chr1031215 412 223 1490 173 --
NM_005493chr62861 750 ------
NM_005497chr1785872 5762 5439 4694 4030 1695 1576 929 45582 5242 4338 1095 1454 11129
NM_005502chr963256 2985 2554 2415 2186 2100 22910 580 1247 22456 1069
NM_005504chr1285966 5118 5055 2123 845 788 763 346 --15869 14136
NM_005506chr452785 2217 2062 1059 958 --12928 --
NM_005513chr331550 334 231 --190 --
NM_005517chr131197 1173 98 ----1539
NM_005522chr7------1996
NM_005524chr31265 ------
NM_005526chr81288 ------
NM_005542chr741943 1505 1260 1247 11869 1241 --
NM_005563chr12581 191 --2786 252 --
NM_005573chr5148 ------
NM_005578chr364463 3720 1761 1274 1149 269 24515 377 13930 --
NM_005593chr121611 ------
NM_005594chr12------176
NM_005595chr12856 344 ------
NM_005596chr986097 5158 4801 4598 4582 2563 1775 1175 25658 1599 24883 2155 12517
NM_005599chr121003 966 --11523 --
NM_005604chr621593 847 ------
NM_005607chr81840 ------
NM_005610chr11944 --1711 --
NM_005618chr61604 ------
NM_005625chr83383 259 206 --1123 --
NM_005638chrX11291 3338 174 101 21408 1228 --
NM_005639chr1251256 532 376 207 22 --11557 --
NM_005647chrX32328 955 529 --1584 --
NM_005665chr1104793 4777 4757 4195 1449 898 831 474 163 150 2200 189 44700 4207 1612 1348 14298
NM_005667chr21353 ------
NM_005668chr574218 4201 3582 3249 3054 3033 1150 --13498 --
NM_005669chr522292 161 1592 1385 --
NM_005682chr1611325 ------
NM_005685chr71114 ------
NM_005715chr622549 2161 11107 52328 1973 1788 693 673 --
NM_005722chr272393 2287 2080 2006 701 390 105 --21653 690 --
NM_005725chr142470 1830 1722 165 ----11593
NM_005733chr51208 186 ----
NM_005737chr21208 --22866 2694 --
NM_005738chr761916 1335 717 604 325 94 11892 --1526
NM_005739chr1592306 2195 2058 1643 1630 786 566 378 141 12235 1584 --
NM_005742chr23685 572 193 198 ----
NM_005744chr15--139 ----
NM_005746chr762654 2566 2185 926 826 631 ------
NM_005748chr1252394 1283 833 571 122 1321 --12159
NM_005751chr7----1392 --
NM_005752chr1641011 857 240 88 --1997 --
NM_005754chr561171 998 806 392 312 128 ------
NM_005756chrX31280 443 64 --2467 58 --
NM_005759chr294503 4134 4016 3618 3593 3451 1878 553 507 --21459 966 1191
NM_005760chr2----134 --
NM_005762chr191131 ------
NM_005765chrX2787 577 1849 1819 --
NM_005766chr1321114 404 --1510 --
NM_005779chr551261 1013 395 363 94 ------
NM_005786chr1821102 834 ----11215
NM_005789chr1762143 2048 1378 765 199 169 --11832 11618
NM_005796chr161279 ------
NM_005808chr353460 3137 827 441 219 1294 1347 --
NM_005822chr611544 ------
NM_005828chr1794976 4562 3876 1799 1295 785 525 342 54 44436 3841 1731 496 25062 1792 --
NM_005832chr361393 1336 1266 1053 1036 151 ----1509
NM_005836chr83393 387 49 ------
NM_005840chrX167091 6983 6868 6455 6312 5954 2533 2397 2382 1589 1199 666 624 557 375 192 15782 57657 6862 3011 2457 636 12665
NM_005843chr241477 1368 1279 144 11359 --11515
NM_005857chr111475 1243 21038 951 1549
NM_005859chr521477 1371 11430 --11357
NM_005862chr31789 ----2890 826
NM_005863chr101579 ----1376
NM_005866chr92884 790 ------
NM_005871chr10146 ------
NM_005880chr1631533 1509 1317 1445 --21250 595
NM_005884chr191802 ------
NM_005895chr1274130 1423 1047 994 939 789 469 11373 13229 --
NM_005896chr23738 207 137 ------
NM_005898chr1162746 2303 2201 2145 194 164 1825 --12268
NM_005900chr441196 962 846 226 ------
NM_005901chr18188543 8383 8052 8031 6764 6278 6202 6161 3488 2782 2446 2149 1661 1447 1265 1165 1088 1063 38727 5468 5378 58634 6215 5943 2811 551 22982 559
NM_005902chr1574327 3955 3316 1227 1138 210 77 1198 --13637
NM_005903chr5115163 4980 4171 3736 1978 1870 1570 1049 1017 279 119 14361 14190 1423
NM_005906chr61155 11378 2540 92 --
NM_005909chr543193 1287 1220 294 12819 24167 3138 --
NM_005923chr62519 187 ------
NM_005935chr454354 4023 3559 1085 299 --25049 1547 1566
NM_005938chrX4903 429 68 61 ------
NM_005941chr833596 3328 975 13080 ----
NM_005944chr371111 1095 841 346 199 149 41 1386 ----
NM_005955chr1114750 4461 3933 2167 1681 1471 1313 1047 881 601 104 --34858 1953 1167 --
NM_005966chr23451 408 388 ------
NM_005994chr171730 ------
NM_005999chr1199 ------
NM_006007chr964411 1324 952 426 333 110 ----1433
NM_006009chr12131 ------
NM_006016chr672255 2058 1879 1710 1618 520 208 --12204 12188
NM_006033chr1842318 2156 823 341 ------
NM_006035chr1431298 1229 1197 ------
NM_006037chr274509 3228 3039 1764 1733 1588 506 --21679 154 --
NM_006047chr2043410 3398 3210 2222 1758 ----
NM_006070chr31335 ------
NM_006076chr72687 90 1554 --12822
NM_006079chr62839 281 ------
NM_006080chr762752 2379 1040 957 797 456 1595 --11191
NM_006086chr162235 220 ------
NM_006089chrX41892 1204 419 217 ----1534
NM_006095chr494428 4166 3875 3485 2945 1704 1467 1378 1201 14533 13779 13795
NM_006106chr1173023 2853 2815 2773 2510 1330 538 --12162 1887
NM_006107chr172425 411 ------
NM_006108chr1152400 2114 1817 963 692 --11753 --
NM_006113chr111552 --1552 1467
NM_006114chr191472 ------
NM_006135chr171312 1199 967 423 308 293 184 ----1263
NM_006136chr73518 458 306 11101 11055 --
NM_006148chr1752261 524 497 465 170 12370 12644 1163
NM_006154chr1542955 672 330 30 22541 349 12593 --
NM_006155chr252025 1992 1974 1925 558 1394 11426 --
NM_006156chr14126 ------
NM_006158chr851821 1681 1251 642 93 --11399 --
NM_006159chr123572 213 207 ------
NM_006166chr1252405 1725 1690 1663 614 --1891 --
NM_006182chr11190 ------
NM_006191chr12------1304
NM_006195chr91287 ------
NM_006203chr5124613 4099 3589 3542 1965 1887 1439 1240 971 745 339 271 2658 104 14591 13574
NM_006206chr442654 2482 1885 1841 22874 2569 ----
NM_006223chrX1434 ------
NM_006224chr1732446 2388 554 ------
NM_006226chr231222 889 443 --11158 --
NM_006237chr1352175 2085 1933 1856 1427 --12139 12162
NM_006241chr332305 2223 1958 1208 1857 --
NM_006247chr191113 ------
NM_006251chr563022 2813 2731 2489 2233 2122 11241 12953 12875
NM_006252chr1106296 6264 2489 2188 1790 1569 1413 786 746 197 14977 --26026 1506
NM_006255chr141733 1726 ----
NM_006256chr132563 994 584 1873 --11022
NM_006258chr1021475 266 11292 125 --
NM_006264chr43176 123 68 ------
NM_006267chr221597 634 1702 ----
NM_006275chr2052456 2386 973 672 86 1546 1572 --
NM_006277chr21483 ------
NM_006282chr2064132 2966 1530 1007 297 90 21430 824 --14436
NM_006283chr864425 1897 998 897 872 822 14999 --11667
NM_006287chr292668 2596 2314 1719 505 486 242 117 70 21873 952 12482 32096 669 33
NM_006298chr622208 505 11230 23261 2687 --
NM_006305chr151203 --151 --
NM_006312chr122717 231 ------
NM_006313chr121636 ------
NM_006315chr443432 2751 1783 1501 13754 ----
NM_006317chr5285 73 1278 ----
NM_006321chr35897 857 736 427 82 12167 22119 412 1186
NM_006324chr16175 ------
NM_006330chr851569 1537 1365 631 184 21119 219 --11663
NM_006334chr91101 ------
NM_006338chr12552 168 ----151
NM_006345chr41872 1418 11096 --
NM_006348chr71143 192 ----
NM_006353chr631046 530 42 ------
NM_006357chr2----4474 439 432 113 --
NM_006359chrX41962 1698 1547 852 --12476 --
NM_006364chr142996 283 --11027 --
NM_006366chr621192 333 144 1396 --
NM_006367chr12198 86 --11035 1314
NM_006371chr385317 5073 3867 3560 1499 1151 455 317 14616 15205 14381
NM_006375chrX11627 ------
NM_006378chr911395 --31464 1414 1074 --
NM_006379chr741968 1781 420 133 188 ----
NM_006380chr1724212 1390 11565 44021 3708 2757 527 --
NM_006401chr92433 336 1192 ----
NM_006408chr71983 1297 1903 --
NM_006415chr931191 987 884 ------
NM_006416chr61766 1208 ----
NM_006420chr2053416 3166 1339 1232 592 13154 13241 1240
NM_006421chr831167 959 348 ------
NM_006424chr451959 1637 555 215 73 ----1793
NM_006427chr142125 116 ------
NM_006439chr42528 466 ------
NM_006449chr252169 871 698 652 435 --1140 11630
NM_006451chr561043 993 851 776 763 704 1157 3895 319 231 --
NM_006457chr494013 3908 3787 3488 2976 2670 1638 1007 987 21253 641 ----
NM_006459chr1052032 1864 1686 1606 547 ------
NM_006465chr1532346 871 71 --12305 1395
NM_006467chr542001 1805 1491 377 22056 217 1454 --
NM_006469chr121602 229 21430 565 ----
NM_006482chr1263834 3251 3141 3082 1250 107 --11473 --
NM_006489chr1421844 43 ----2277 167
NM_006516chr12564 468 --1438 21537 1106
NM_006520chrX1188 --11674 1513
NM_006534chr2043449 2600 1046 209 11288 32548 2481 325 --
NM_006536chr12969 139 --1649 --
NM_006537chr15------1181
NM_006538chr263831 3280 2877 2716 2612 837 --13141 13731
NM_006539chr162385 106 ------
NM_006544chr14116046 6039 6025 4766 4553 4026 1926 1709 1188 664 541 35955 3910 1398 11668 14261
NM_006546chr1786470 5886 5572 5172 5114 4668 471 212 46483 6201 4243 1339 ----
NM_006547chr762037 1986 1980 1608 713 555 --2484 111 --
NM_006548chr331712 246 148 11240 11323 --
NM_006561chr10145984 5858 5203 4806 4533 4293 4236 2474 2327 2140 1651 1540 638 524 --24839 1445 --
NM_006565chr1621267 350 ----1113
NM_006572chr1762781 960 699 237 146 111 12822 2489 305 --
NM_006575chr1441396 940 179 157 ------
NM_006577chr22326 83 ----11188
NM_006595chr1131309 393 53 --1454 21798 112
NM_006599chr16138230 7919 7468 6643 6154 5514 5499 5115 3136 2817 2444 1492 131 16777 25708 1610 47989 7459 2118 683
NM_006601chr12--1933 ----
NM_006603chrX41824 1644 1353 572 ------
NM_006609chr262982 2021 967 901 697 29 2550 346 12316 11991
NM_006614chr372978 2570 2550 1198 807 531 315 --33690 3126 841 --
NM_006618chr151493 1411 1305 566 125 1347 1329 --
NM_006620chr654842 3360 2954 1513 322 21277 694 ----
NM_006621chr131355 237 151 1272 11621 --
NM_006624chr1042071 1992 680 282 ------
NM_006626chr9142 22245 758 2775 751 1474
NM_006628chr15144697 4687 4377 4334 4016 3518 3119 3072 1669 1438 1091 551 397 67 21159 917 ----
NM_006629chr1862506 2416 1863 1828 650 604 2483 359 1642 --
NM_006654chr12124222 4138 3605 3511 3490 3088 1818 1557 1298 1263 732 644 11606 13931 --
NM_006660chr152325 96 ------
NM_006667chrX2780 446 --31207 1152 249 --
NM_006670chr62541 533 --1210 --
NM_006699chr162729 2582 2515 2309 2129 1868 1892 32086 1716 1077 --
NM_006704chr132455 118 ------
NM_006705chr91456 ------
NM_006706chr5167 ------
NM_006713chr55711 638 342 208 59 ------
NM_006716chr751166 936 429 209 149 ----193
NM_006717chr973378 2541 2346 2125 748 551 400 1124 1331 --
NM_006718chr61973 ------
NM_006720chr1084060 3508 1849 1661 1228 733 620 210 11990 24145 3485 --
NM_006722chr362658 2413 1017 909 815 183 ------
NM_006726chr42882 27 --1976 171
NM_006727chr53558 379 44 --1498 --
NM_006729chrX155438 5375 4922 4916 4574 4278 3880 3843 3613 1248 991 912 845 762 109 --35341 1444 1129 14545
NM_006738chr1574289 4183 3917 3414 3080 1240 812 ------
NM_006745chr421002 182 --1165 --
NM_006746chrX41546 526 480 164 --179 --
NM_006750chr1677780 7488 6188 5147 4985 584 177 25850 4884 57335 7031 2923 676 277 16319
NM_006754chr72848 141 1906 ----
NM_006761chr172209 104 ------
NM_006766chr832481 2161 222 ----1904
NM_006769chr1------1506
NM_006772chr631676 1281 309 ----1569
NM_006775chr643043 3002 935 727 --12791 --
NM_006777chrX32272 2065 2031 1103 32894 1935 1080 --
NM_006800chrX2585 90 ------
NM_006802chr151200 1091 933 921 63 1430 --1203
NM_006805chr561414 1281 1098 497 447 437 ------
NM_006807chr173386 268 237 --168 --
NM_006818chr13167 159 142 1128 ----
NM_006823chr821192 978 ------
NM_006826chr241219 401 312 46 ------
NM_006827chr1472725 2396 1324 1318 761 671 474 ----22815 390
NM_006832chr141697 2860 176 ----
NM_006837chr8124 ------
NM_006851chr1272829 2727 2453 1914 864 703 87 21973 162 11949 22245 1020
NM_006854chr751842 1550 1423 812 224 ------
NM_006857chr21635 --1357 --
NM_006884chr331416 765 713 --11741 --
NM_006885chr1684036 3618 2747 2734 1700 1404 691 184 --12811 --
NM_006888chr1473535 3171 3064 475 221 115 57 1699 ----
NM_006892chr2041423 1284 1192 975 1317 1559 --
NM_006892chr2041423 1284 1192 975 1317 1559 --
NM_006902chr143144 2675 1278 561 ----140
NM_006908chr741453 1254 408 225 ------
NM_006910chr161147 ------
NM_006912chr162487 2178 1757 1741 713 410 --1746 1233
NM_006914chr941352 595 587 407 --11511 --
NM_006915chrX42330 1000 717 96 21019 609 22243 400 --
NM_006918chr1175487 2337 2285 1716 1685 1079 642 14175 14350 --
NM_006920chr231603 1315 112 ------
NM_006922chr272137 1895 983 867 841 363 333 1354 1631 21652 1599
NM_006924chr1743688 3250 2898 265 34294 3479 2852 ----
NM_006939chr1451153 869 457 444 96 ------
NM_006940chr1231895 575 337 ------
NM_006948chr214960 323 140 106 ------
NM_006951chr101165 --1638 --
NM_006962chrX2492 56 ------
NM_006963chr1031230 1173 448 ----1899
NM_006965chr182448 340 --21045 464 11215
NM_006981chr942507 2222 2148 664 ----1887
NM_006982chr121250 1199 ----
NM_006991chr3--1257 ----
NM_006996chr171914 1535 1442 1181 507 453 357 11210 --1522
NM_006999chr542069 1590 472 430 --1226 11269
NM_007002chr20----195 --
NM_007005chr951540 1060 965 549 215 ------
NM_007006chr1672895 2825 2539 2338 2239 215 134 ------
NM_007007chr1294396 4198 4041 3346 3181 683 676 532 178 14023 1702 14451
NM_007008chr23584 289 252 ------
NM_007011chr1566908 6758 5861 2735 2047 1955 25497 1876 26250 4360 16831
NM_007013chr821030 362 1886 1171 --
NM_007026chr172448 119 ------
NM_007033chr162117 2080 1600 1395 883 548 --1859 1847
NM_007034chr141000 862 841 170 ------
NM_007038chr21105648 5343 4978 4968 1807 1646 536 457 433 78 ----24625 979
NM_007039chr1472352 2013 1868 1855 1752 643 310 --2614 362 --
NM_007040chr194984 444 436 75 ------
NM_007042chr362693 2521 2104 1758 838 500 21000 702 ----
NM_007043chr1241725 1375 1309 351 ------
NM_007050chr2088008 6334 5826 2952 2859 2473 1316 413 37642 6927 2500 17416 17608
NM_007054chr563692 3469 2724 1014 977 742 --14000 --
NM_007064chr32584 392 ----1671
NM_007067chr1761567 1560 1515 1171 1156 442 --11102 --
NM_007076chr121111 ------
NM_007078chr1022216 378 12642 13055 11074
NM_007087chr166592 552 302 284 192 41 1754 ----
NM_007106chr131101 12436 22553 1717 22675 540
NM_007111chr13--1825 ----
NM_007114chr332596 804 142 22810 1317 12830 --
NM_007124chr641837 412 401 226 --31809 1604 137 1465
NM_007125chrY51397 988 456 54 36 --11473 --
NM_007126chr91457 ------
NM_007129chr13------1135
NM_007137chrX44036 2173 2011 1923 2784 558 --25387 587
NM_007144chr171185 --183 --
NM_007146chr1722821 2119 145 22843 525 --
NM_007147chr1921174 1037 ------
NM_007157chrX42830 2167 894 272 ------
NM_007158chr151236 831 377 355 114 --1409 --
NM_007159chr351125 496 477 335 93 --1200 --
NM_007166chr1121290 567 ------
NM_007172chr2263216 2920 2723 2253 677 520 --12828 --
NM_007173chr1131766 1560 687 --2903 137 12268
NM_007175chr863673 3559 3429 3026 897 395 12707 33356 3315 2223 12439
NM_007192chr142154 58 ----1295
NM_007195chr1873660 3532 3178 3116 2786 2734 76 1551 ----
NM_007197chr123971 867 134 ------
NM_007200chr1574289 4183 3917 3414 3080 1240 812 ------
NM_007203chr963798 3444 2949 2471 942 659 --13325 --
NM_007212chr162230 1527 791 709 681 447 ----11495
NM_007214chr63968 522 119 1841 ----
NM_007218chr83917 904 800 ------
NM_007222chr831518 441 194 --1676 --
NM_007231chrX92373 2124 1863 1703 768 594 398 345 214 --1545 12086
NM_007236chr1572089 1792 1558 793 592 479 262 1390 1514 22004 67
NM_007242chr161238 ------
NM_007249chr13159110 8778 7887 6616 6499 3690 3393 3322 3259 3246 1399 1149 737 423 201 32136 2050 271 13378 1610
NM_007270chr721458 1258 --21385 1094 --
NM_007271chr6--1400 1538 21450 200
NM_007279chr191644 ------
NM_007287chr342664 2420 694 445 2287 202 --22766 2540
NM_007288chr342664 2420 694 445 2287 202 --22766 2540
NM_007289chr342664 2420 694 445 2287 202 --22766 2540
NM_007308chr41106 ----1495
NM_007315chr231500 1247 488 --11177 --
NM_007331chr412723 1974 --12684
NM_007332chr861349 1111 1094 1027 638 452 --11085 1178
NM_007345chr1832243 2203 1756 1540 ----
NM_007347chr1562558 2469 2310 1962 372 22 22933 64 --12923
NM_007350chr1234154 171 66 13926 12910 --
NM_007353chr732676 1189 288 ------
NM_007358chr131633 1321 81 ------
NM_007361chr141518 --1497 --
NM_007371chr92166 54 --1700 --
NM_007372chr173911 888 335 --1729 --
NM_007373chr1041845 1587 1526 129 ----11751
NM_007375chr142402 2237 1739 374 --12699 1605
NM_012081chr533737 3403 150 ----32860 2815 902
NM_012082chr8----1922 1210
NM_012089chr121399 443 1389 1422 --
NM_012092chr241446 1258 634 118 ----1581
NM_012095chr1052958 2838 2141 1233 786 13113 13408 --
NM_012096chr3113360 2486 1487 1432 1238 1110 903 848 532 459 48 --22571 2307 --
NM_012097chr241827 1727 117 54 --12143 --
NM_012102chr142522 528 513 66 22129 842 21887 801 --
NM_012104chr1163440 3122 903 883 269 136 --11087 1861
NM_012104chr1163440 3122 903 883 269 136 --11087 1861
NM_012120chr682413 2232 2163 1072 1057 899 890 517 --22733 2044 --
NM_012129chr732541 1600 375 1947 2554 488 11973
NM_012137chr172888 2220 2208 2111 591 450 91 31985 608 576 31168 991 942 32031 1820 501
NM_012141chr13103556 2756 2561 1587 1375 1009 698 526 298 153 --33129 2608 748 --
NM_012157chr33943 742 179 --2389 307 --
NM_012158chr1321492 1443 ----21720 87
NM_012160chr61367 ------
NM_012161chr431109 923 26 1153 ----
NM_012164chr9137101 7009 5848 5717 5516 5507 2678 2586 2511 2195 2070 1827 973 12354 47476 6024 5225 4824 26699 385
NM_012193chr1155032 4164 4010 1185 925 1404 --170
NM_012199chr174685 4124 3998 3307 3029 2967 134 --1655 --
NM_012207chr102310 298 149 1830 --
NM_012210chr931293 1167 28 21016 537 ----
NM_012214chr275077 5067 2434 1649 550 368 109 11373 182 --
NM_012234chr3123744 3484 3127 1442 1419 1207 1150 1072 965 601 264 135 ------
NM_012238chr1021740 1607 ------
NM_012243chr12972 78 --1265 --
NM_012249chr292939 2711 2560 2433 1388 1346 589 426 139 13247 23170 348 --
NM_012250chr1111042 ------
NM_012252chr7105143 4840 4697 4678 4616 4319 4028 1113 1107 42 13834 14710 --
NM_012255chr20139 --1138 --
NM_012259chr641420 1298 566 547 ------
NM_012262chr194963 4132 4100 3803 1745 1715 900 528 423 --2884 391 14414
NM_012287chr374448 4224 3637 3605 1403 1035 76 --191 --
NM_012288chr685253 4785 4097 3946 577 396 351 308 24082 1474 15532 --
NM_012290chr221229 113 ----1598
NM_012293chr2--12037 ----
NM_012296chr1153108 3042 2414 196 105 2318 111 13931 --
NM_012297chr42903 323 22469 2384 42434 1687 759 356 --
NM_012300chr51317 21679 645 ----
NM_012301chr722178 2066 ------
NM_012302chr161170 820 504 473 314 260 --21100 783 --
NM_012309chr1184589 4572 4310 4274 3614 3546 911 708 21752 871 24073 1912 1213
NM_012316chr183549 3480 1994 1948 1856 1177 1129 413 ------
NM_012317chrX2670 252 --1568 --
NM_012327chr1831556 1273 620 --1107 --
NM_012328chr75941 552 408 313 256 21459 533 11212 --
NM_012329chr1771636 1582 1392 1189 383 297 288 --21039 169 2678 440
NM_012333chr12575 468 ----11546
NM_012338chr761192 1148 1014 256 136 39 ----1369
NM_012345chr1341882 1757 1664 163 --21751 1626 --
NM_012383chr91331 ------
NM_012388chr1553168 2895 2275 1997 781 11097 --1763
NM_012399chr222793 706 ------
NM_012405chr123790 2728 23404 2411 13779 1909
NM_012406chr122907 310 169 ----
NM_012412chr74639 594 319 265 --1792 --
NM_012414chr14535 341 245 65 ------
NM_012416chr931039 928 878 --11119 --
NM_012417chr17----1627 --
NM_012419chr62509 481 --1240 --
NM_012420chr1031946 1575 1506 ----11778
NM_012425chr1012694 12303 --2783 731
NM_012430chr31524 ------
NM_012434chr641302 1148 1119 89 --1213 --
NM_012444chr202330 324 ------
NM_012448chr1742476 1679 1655 305 1460 12154 --
NM_012463chr1231614 1285 472 1180 --21235 1177
NM_012464chr432300 2099 1794 12762 ----
NM_012465chr1063445 3383 3166 2825 2445 84 1483 12856 --
NM_012471chrX1682 ----11366
NM_012475chr1166 ------
NM_012479chr732255 1736 601 12393 1415 --
NM_012486chr1167 ------
NM_013229chr1222727 810 ------
NM_013230chrY81473 1459 1174 1154 671 541 438 395 1112 ----
NM_013231chr1474313 3979 3653 2743 1450 502 185 --14000 23385 1755
NM_013233chr231405 1032 199 --2379 78 --
NM_013236chr222922 474 --2786 62 --
NM_013238chr134719 424 200 98 11450 11280 --
NM_013243chr1521048 138 ------
NM_013248chr201232 --1241 --
NM_013254chr124688 503 287 96 ------
NM_013255chr798647 7114 6452 3098 1972 1949 1502 699 314 28318 6100 38778 8452 146 17908
NM_013257chr851863 571 324 149 62 1712 ----
NM_013267chr122440 145 ------
NM_013279chr1131568 701 269 ------
NM_013281chr2021111 224 --2304 78 --
NM_013282chr19------11132
NM_013293chr7----1282 --
NM_013302chr1664510 4081 1305 1120 1018 599 11662 22909 903 13514
NM_013309chr1521981 452 ------
NM_013316chr71925 ----1826
NM_013322chr721735 1605 ------
NM_013341chr262857 2827 2809 1917 1177 375 ------
NM_013346chrX256 28 ------
NM_013357chr83716 710 606 ------
NM_013377chr121205 ------
NM_013380chr192809 762 --1779 --
NM_013381chr1282437 2338 2285 1770 900 877 834 202 11954 12445 --
NM_013386chr141573 1567 1162 260 --11496 21807 615
NM_013396chr2131490 1476 551 21441 974 ----
NM_013400chr731054 987 375 --11005 --
NM_013412chr211241 --1104 --
NM_013423chrX1465 --21288 1082 --
NM_013427chrX1465 --21288 1082 --
NM_013436chr2----276 52 --
NM_013437chr831192 349 325 ------
NM_013445chr2------1149
NM_013446chr731335 984 424 --1131 --
NM_013448chr142731 623 ------
NM_013449chr1232723 2536 2442 ------
NM_013450chr241279 1111 928 387 1848 ----
NM_013989chr1453448 1977 1095 283 121 14174 11575 --
NM_013995chrX52467 2350 2258 253 214 --1390 --
NM_014000chr1051702 1292 691 329 244 139 11944 1699
NM_014021chr143306 2634 1313 416 11011 ----
NM_014023chr106626 535 469 395 187 67 12053 1513 --
NM_014031chr51348 ------
NM_014043chr3174 11536 11516 11093
NM_014048chr1674863 1606 1147 1040 730 560 192 44589 3768 1857 1369 14242 11172
NM_014055chr122444 28 ------
NM_014057chr921571 642 --11050 --
NM_014071chr20147 ------
NM_014106chr1542624 1202 1174 432 11006 11071 --
NM_014112chr854658 2022 1666 1611 1553 13968 25423 632 25516 4256
NM_014117chr1652730 2563 915 485 125 32114 994 909 21830 1738 --
NM_014141chr765086 3458 2108 1896 725 347 14968 24285 3481 11829
NM_014154chr3----11343 --
NM_014155chr11177113 6562 6314 5180 5034 5001 2953 2364 2230 2201 2191 1780 1653 1148 1022 410 259 16213 36870 6746 2253 --
NM_014171chr2139 --2775 47 --
NM_014178chr143513 175 63 ------
NM_014181chr282949 2556 2525 2442 2121 808 669 367 --12583 --
NM_014182chr123757 302 95 ------
NM_014184chr1------1147
NM_014217chr121607 370 1142 2568 455 --
NM_014220chr31116 ------
NM_014231chr122752 55 12183 11898 --
NM_014240chr384126 4103 3502 2929 2788 1593 845 510 23790 3235 --11547
NM_014243chr43767 601 180 1196 --12077
NM_014245chr331116 321 312 21058 739 ----
NM_014252chr131303 --1133 --
NM_014253chrX62507 2339 1770 1586 745 334 1624 ----
NM_014255chr12186 ------
NM_014263chr102349 68 2604 316 ----
NM_014267chr111662 ------
NM_014271chrX1617 ----2201 189
NM_014278chr4162 --1302 --
NM_014283chr11186 --1131 --
NM_014289chrX31414 1305 1140 --11208 11388
NM_014294chr821482 1136 ----151
NM_014309chr2264748 1473 1413 1237 622 454 --1192 1310
NM_014319chr1211257 --11849 --
NM_014329chr16189 --1285 1220
NM_014331chr4157808 7519 7363 6497 6160 5124 5068 1194 1007 853 481 384 216 61 31 11461 ----
NM_014333chr1172773 1981 1786 1740 963 462 366 ------
NM_014342chr114573 238 140 75 ------
NM_014344chr112834 824 174 ----
NM_014350chr551086 1029 869 769 117 ------
NM_014372chr132090 1506 700 --11842 --
NM_014374chr731054 987 375 --11005 --
NM_014379chr82936 852 1146 ----
NM_014381chr1483181 2471 2086 1318 964 445 418 258 1535 11145 --
NM_014382chr33433 328 290 11606 21520 1124 --
NM_014391chr10194 --2577 533 --
NM_014393chr892101 2072 1819 585 445 380 296 271 189 --2415 331 --
NM_014399chr72671 141 --1282 --
NM_014421chr471947 1795 1668 1444 747 539 392 --1696 --
NM_014423chr5105579 5210 4789 3882 1811 1513 1475 641 600 514 --34963 4674 363 --
NM_014429chr32638 606 ------
NM_014432chr621482 233 11096 ----
NM_014445chr321978 1799 ----1614
NM_014447chr41198 ----11289
NM_014455chr12379 359 ------
NM_014456chr1021245 587 ------
NM_014458chr111081 11436 ----
NM_014469chr11----1110 --
NM_014488chr111565 ------
NM_014491chr74791 766 277 88 ------
NM_014494chr163910 309 199 1497 1863 --
NM_014515chr12--1316 ----
NM_014517chr341333 729 370 320 ----196
NM_014521chr221798 221 11682 149 1741
NM_014548chr1521498 1438 --1439 --
NM_014554chr1272347 1754 1733 1505 1470 789 158 --11689 21514 273
NM_014572chr134728 674 344 136 --11801 --
NM_014574chr1421419 103 11137 ----
NM_014575chr32448 172 ------
NM_014585chr271264 1212 984 974 947 901 373 ----1108
NM_014587chr1631410 496 176 --21364 207 --
NM_014592chr54152 118 86 70 ------
NM_014606chr441526 1282 1097 86 ------
NM_014607chr241551 1397 1364 451 1248 22034 67 --
NM_014615chr1653447 3385 2373 2231 521 --12303 --
NM_014616chr363192 2272 1069 1038 880 388 12453 22902 2867 11168
NM_014629chr821044 468 --1434 --
NM_014630chr1593580 3514 3041 2829 2512 737 488 132 88 --1746 --
NM_014633chr111459 ----2636 126
NM_014635chr231750 1712 1498 ------
NM_014636chr964085 3239 3054 679 403 216 --23006 328 --
NM_014647chr1642219 1725 1425 50 --1659 2265 138
NM_014653chr1212074 --31721 1634 718 11779
NM_014660chr72718 134 ------
NM_014666chr531135 1124 423 --11195 --
NM_014667chr341999 1780 1559 848 1726 ----
NM_014670chr241597 1579 333 148 --2271 255 --
NM_014671chr751442 1202 1188 499 275 ----1128
NM_014674chr363783 3677 3657 3296 3048 554 --1464 --
NM_014675chr11466 ------
NM_014676chr121453 238 ------
NM_014677chr811026 ------
NM_014679chr112492 292 ----1474
NM_014682chr831857 374 364 ------
NM_014683chr173779 671 184 --41881 1758 1478 1388 --
NM_014686chr1912097 --12079 --
NM_014689chr21121 ----1395
NM_014690chr752977 2951 2599 2393 996 --11119 1667
NM_014697chr13968 884 157 ------
NM_014700chr16------11326
NM_014701chr1582799 2644 2585 2558 1206 378 138 24 ----12222
NM_014702chr693351 3298 3117 2948 2888 2181 1358 1293 1046 --12441 12904
NM_014705chr741430 668 616 358 ----11613
NM_014707chr752186 1438 653 468 135 1688 193 --
NM_014711chr1642029 1927 786 308 ------
NM_014713chr21194 ------
NM_014721chr6136991 6754 6232 5907 5246 4624 2515 2401 2146 1892 1849 1565 1375 --1685 --
NM_014729chr841635 855 578 545 ------
NM_014733chr52919 689 22033 832 --11619
NM_014735chrX31944 523 172 ----12131
NM_014736chr15141 1847 1386 1233
NM_014739chr6114088 3567 2762 1155 887 726 695 646 277 104 93 --2823 56 13919
NM_014747chr175787 5659 5294 4594 3918 1946 609 31180 843 495 24052 209 14835
NM_014751chr851979 1685 1565 287 222 ------
NM_014752chr1121430 785 --1540 1755
NM_014755chr2114153 3692 3242 3094 1514 1274 1160 1142 570 358 119 13464 11489 --
NM_014757chr562175 939 920 841 569 467 --22319 273 --
NM_014760chr311832 ------
NM_014765chr132123 1957 212 1120 --12526
NM_014774chr133144 182 47 --32526 1178 1044 --
NM_014776chr1253087 2746 2573 2100 85 --1588 --
NM_014779chr34333 197 142 45 --2788 262 --
NM_014781chr8127 --1232 --
NM_014782chrX2328 273 ------
NM_014783chr1541114 1106 535 258 --11540 --
NM_014795chr221106 311 ------
NM_014803chr1022150 1977 1942 188 --
NM_014810chr153161 3131 2557 1265 1103 2783 490 32906 736 56 12843
NM_014812chr141897 1833 747 434 ------
NM_014819chr522451 865 11846 11539 --
NM_014820chr371966 1817 1571 788 552 384 42 --11897 --
NM_014824chr1121565 201 ------
NM_014826chr173895 3117 3072 1568 1478 898 517 13434 1270 --
NM_014827chr131387 599 75 11432 11519 --
NM_014828chr1451641 996 818 550 204 22341 692 ----
NM_014829chr532203 1533 306 --2104 24 --
NM_014832chr1361790 1705 1338 841 715 529 ------
NM_014836chr1031829 1558 405 ------
NM_014838chr2262526 2070 639 354 306 81 ------
NM_014839chr162285 872 746 730 664 311 1108 22068 56 --
NM_014840chr1253149 2811 2285 1280 848 22784 2505 --1185
NM_014841chr611049 ------
NM_014850chr3104807 4243 4055 3806 3718 3528 3166 1733 703 517 14419 24591 1474 11096
NM_014857chr1----184 --
NM_014864chr144372 978 759 34 24277 2886 --21567 429
NM_014867chr873403 3117 3008 1248 1029 940 828 1742 ----
NM_014872chr942097 2076 875 830 1475 22213 541 22335 2322
NM_014873chr1114874 4496 4328 4303 3226 1795 1584 1534 1442 1285 70 2235 163 ----
NM_014877chr17127764 6143 4973 4877 2942 2514 2209 1908 1709 1702 1567 1272 26445 6322 14944 11219
NM_014883chr452377 2344 1765 606 428 --1119 12084
NM_014887chr132712 279 ------
NM_014888chr741533 1079 1057 402 ------
NM_014893chrY42349 2122 458 32 11783 --1572
NM_014897chr173932 734 559 1110 ----
NM_014899chr522781 2695 32450 1194 1024 ----
NM_014901chr572229 2009 1777 1557 1523 420 210 11853 ----
NM_014902chr2051189 1165 1040 322 196 --1332 --
NM_014903chr1232378 1793 841 ----1673
NM_014904chr1063330 2945 2746 1339 1217 914 1286 1139 --
NM_014905chr262028 1915 1461 708 663 100 --179 --
NM_014906chr1763750 3611 3071 2701 1250 908 ------
NM_014912chr1032399 2273 1342 --13082 --
NM_014913chr1811290 --11485 --
NM_014918chr1541575 1331 423 103 11186 1397 --
NM_014920chr663430 2971 1498 807 629 361 12403 173 --
NM_014923chr13----22005 469 --
NM_014924chr1432176 930 159 --22747 233 31220 476 283
NM_014926chr3----1838 1760
NM_014932chr321517 1487 11351 ----
NM_014937chr1021316 162 ------
NM_014939chr182418 58 ------
NM_014946chr282434 2276 1132 1086 965 839 634 34 1282 2620 435 --
NM_014947chr132996 1153 462 1107 1567 --
NM_014950chr1421667 1085 --21761 1358 --
NM_014951chr1072560 2140 1890 735 706 682 309 ------
NM_014952chr151421 ------
NM_014961chr461746 1721 1645 757 564 95 --1751 1410
NM_014962chr2082672 2498 2352 1965 1069 938 652 524 12285 ----
NM_014964chr1711994 1723 11619 11921
NM_014969chr121038 980 ------
NM_014978chr1011311 2259 108 21805 96 --
NM_014982chr1484990 4610 4392 4334 3312 1979 568 411 25236 4637 44858 4509 3619 1443 --
NM_014988chr472720 2590 2257 2013 1784 500 103 ------
NM_014989chr651999 1859 369 359 37 1192 11678 11938
NM_014990chr143939 431 421 1256 145 --
NM_014991chr452689 2568 2169 2122 1145 33315 2540 1129 --21247 1013
NM_014996chr32666 359 ------
NM_014999chr1261462 1412 1251 1186 566 201 ----195
NM_015000chr1262866 2317 2160 2071 417 132 --1304 1932
NM_015008chr383652 3018 2922 2715 2216 1405 1016 90 --22483 2411 --
NM_015009chr31266 --1253 --
NM_015015chr1921382 355 ------
NM_015020chr1663500 3355 3273 2780 2608 358 --172 --
NM_015024chr831340 1098 411 --11495 --
NM_015025chr221065 83 ----1233
NM_015026chr1284579 4183 3821 3257 1754 1700 1648 623 --2942 133 24672 3934
NM_015032chr1342758 2241 825 436 22861 585 ----
NM_015035chr20106452 6062 5093 4708 4691 4449 4273 1274 743 252 26419 715 44867 4093 1769 1707 15382
NM_015037chr101270 ------
NM_015039chr143793 3105 2675 971 24226 3983 23695 1517 --
NM_015040chr263439 3326 2348 2107 1025 389 11186 22904 997 --
NM_015042chr1574291 4256 3973 3117 673 567 482 1989 13780 --
NM_015045chr1031853 1426 658 --11512 --
NM_015046chr952643 2329 2111 700 260 11770 ----
NM_015051chr963042 2961 2868 2215 489 86 --12352 --
NM_015052chr71501 ----1359
NM_015057chr131104 ------
NM_015061chr92567 239 ------
NM_015071chr595690 5675 5665 5458 4665 1876 1661 865 462 24883 680 14493 24867 4509
NM_015076chr6104307 4007 3772 3587 3525 3277 3121 1581 787 492 --11809 11205
NM_015082chr532635 2077 84 12569 --11860
NM_015090chr175714 4982 1657 1417 1234 739 617 22321 130 15465 --
NM_015092chr1654237 3730 3018 1090 684 --34430 3274 1051 2867 270
NM_015093chr641769 1743 702 127 ------
NM_015097chr341580 1528 725 691 --11550 --
NM_015100chr161990 1893 1818 652 236 105 --1370 --
NM_015107chrX92234 2213 2018 1561 1512 524 402 86 33 --21673 266 --
NM_015110chr962461 2299 1760 1628 874 799 ------
NM_015113chr1722434 877 138 --12349
NM_015115chr423028 2580 ----1627
NM_015130chr421324 1171 2910 222 ----
NM_015137chr872425 2175 2080 890 732 680 415 12513 ----
NM_015143chr43583 481 261 ------
NM_015147chr273294 2988 2240 1089 985 935 289 1346 ----
NM_015149chr162177 2157 2021 659 640 390 1651 ----
NM_015153chr63682 234 108 ------
NM_015155chr1043251 2770 2643 2525 --11016 --
NM_015156chr1464001 3984 3879 3409 224 154 --2721 396 13492
NM_015158chr9----1776 --
NM_015161chr162119 60 1464 31539 1494 1430 --
NM_015162chr152555 26 1151 --1101
NM_015163chr1431431 570 159 1556 --11698
NM_015170chr811805 --11442 --
NM_015176chr131676 296 195 --11622 1233
NM_015185chrX52393 1025 709 523 343 --32341 1005 302 1833
NM_015186chr9123 ------
NM_015192chr2032961 2264 619 --22915 1997 --
NM_015198chr711227 ----1377
NM_015199chr392859 2557 2295 2116 2073 1890 674 659 171 12363 12439 12280
NM_015200chr461887 793 563 462 126 58 --1548 --
NM_015203chr12202 163 ------
NM_015206chr1593719 2780 2704 2640 1181 1161 868 177 122 23372 988 2950 843 --
NM_015208chr1832680 2670 1087 13917 ----
NM_015215chr143183 2311 2170 2098 --12848 --
NM_015225chr943193 2842 1067 62 2544 312 --13043
NM_015233chr1322739 2416 --2521 497 1218
NM_015234chr621247 319 ------
NM_015239chr92528 409 1536 ----
NM_015247chr1684492 4053 3883 1332 609 559 507 455 --15188 --
NM_015250chr9----11697 --
NM_015256chr51578 1164 ----
NM_015265chr262258 2230 1028 658 309 49 ------
NM_015267chr1242145 1919 208 159 ------
NM_015268chr33668 640 126 1550 ----
NM_015269chr15626 465 240 198 31 ------
NM_015271chr453954 2707 890 461 235 14308 21577 210 11588
NM_015272chr1621987 675 ----1591
NM_015275chr125819 796 739 247 178 ------
NM_015277chr1841809 535 298 44 11163 21705 1252 --
NM_015285chr1822489 863 1495 ----
NM_015286chr1562086 672 600 282 229 112 11796 --12148
NM_015288chr563267 2734 2637 655 499 159 ------
NM_015310chr8148304 8102 7810 7775 6068 5250 2980 2178 1841 1541 1290 1276 866 130 --47369 7184 2025 1989 --
NM_015313chr1153755 3103 808 226 111 ----14460
NM_015315chr512961 ----2698 576
NM_015317chr242569 2065 1912 1004 22578 2240 22605 314 --
NM_015323chr631326 1199 1193 ----11771
NM_015326chr162780 2427 1145 482 465 446 ------
NM_015329chr1922850 2491 --11989 --
NM_015335chr1252653 2282 2193 2178 159 ----21826 843
NM_015336chr124663 521 316 131 ----1594
NM_015344chr862157 2017 1886 1658 829 610 --1875 --
NM_015345chr652661 2259 2248 980 692 1714 --12678
NM_015346chr1441879 1639 483 109 11909 1243 --
NM_015347chr1272765 2510 2105 1124 987 928 528 --12222 --
NM_015349chr622478 2294 12358 ----
NM_015352chr2073333 2940 2429 1273 419 353 233 23567 1029 12407 --
NM_015355chr1751975 1868 1845 592 572 --2354 157 --
NM_015358chr2131174 1000 129 --11095 --
NM_015359chr872956 2852 2779 2578 994 345 104 ----11821
NM_015365chrX64314 3791 1261 959 440 88 ------
NM_015367chr2231589 1068 121 ------
NM_015375chr142009 1772 1145 1047 1806 33176 1434 1121 --
NM_015378chr132531 681 413 --12517 11950
NM_015381chr2252023 1757 814 496 104 11905 11634 --
NM_015382chr141699 ------
NM_015387chr24624 617 577 387 --1397 --
NM_015393chr482775 2683 2644 2399 2347 1196 1065 387 13439 --11383
NM_015396chr351381 1357 1120 449 83 ------
NM_015397chr931743 1358 215 ----11792
NM_015415chr1------1221
NM_015419chrX1422 ------
NM_015429chr341134 983 418 177 ------
NM_015435chr82471 338 --11238 --
NM_015446chr141172 563 407 186 ----11188
NM_015453chr341836 1810 834 737 31740 828 290 --11540
NM_015455chr523719 3639 33507 2818 763 1268 --
NM_015458chr875310 5269 4728 1509 613 249 82 14019 14310 --
NM_015461chr18160 1783 ----
NM_015463chr2147 ------
NM_015465chr51494 ------
NM_015472chr32213 200 --1531 --
NM_015472chr32213 200 --1531 --
NM_015475chr23976 762 221 ------
NM_015477chr152714 698 ----1939
NM_015483chr7----1105 --
NM_015508chr33610 581 393 ----1527
NM_015530chr23787 649 366 ------
NM_015535chr243210 2852 1319 137 ----12816
NM_015541chr31251 ----1968
NM_015553chr684990 4269 4259 4118 3396 1339 791 729 14214 11281 1348
NM_015554chr1542884 2157 1980 932 ----1118
NM_015564chr532900 1044 47 22776 2220 2564 322 182
NM_015565chr2181523 1516 1480 1406 812 678 246 209 ------
NM_015569chr184592 4390 3096 1406 1115 890 848 125 43368 1221 440 327 ----
NM_015570chr721718 1400 ------
NM_015571chr632074 969 586 --127 --
NM_015575chr283570 2358 1468 857 818 372 303 39 21122 899 ----
NM_015576chr352654 2111 877 812 614 --22161 199 --
NM_015577chr52698 558 11148 21640 1116 --
NM_015607chr11162 ------
NM_015622chr71248 ------
NM_015626chr1741098 1010 958 902 ------
NM_015630chr2--1847 ----
NM_015640chr175351 4770 4536 4278 4131 1695 1510 --24073 1450 11370
NM_015641chr731224 943 358 --158 --
NM_015642chr31109 ------
NM_015660chr71100 --1295 --
NM_015676chr141290 --1296 --
NM_015678chr131159 ------
NM_015690chr21671 ----159
NM_015691chrX22947 2348 22653 527 --11854
NM_015695chr641817 1810 1437 506 1655 22117 69 --
NM_015713chr873321 2859 2775 2766 2531 2461 1364 --32301 1033 277 --
NM_015716chr171103 ------
NM_015723chr72577 541 --1643 --
NM_015833chr2152198 1704 1551 1531 238 --1311 --
NM_015844chr182969 656 --1954 --
NM_015846chr182969 656 --1954 --
NM_015847chr182969 656 --1954 --
NM_015878chr872253 2218 2140 1917 1624 1501 565 --22231 1453 --
NM_015886chr8145097 5036 4311 2086 2072 1883 1805 1483 1278 1242 934 879 513 197 24145 2238 --15216
NM_015888chr173260 3253 2184 2146 1298 889 536 --22163 1031 --
NM_015892chr1062022 1940 1525 797 207 59 21909 117 --11544
NM_015898chr1942231 1870 457 102 ------
NM_015904chr22573 255 ------
NM_015906chr184838 3988 3771 3360 1940 1454 673 143 24349 1357 31130 611 493 --
NM_015938chr341007 384 373 235 171 ----
NM_015955chr21504 172 ----
NM_015967chr15872 791 372 319 311 1809 ----
NM_015975chrX2570 312 11666 2273 90 2431 281
NM_015981chr553129 2758 2277 1214 632 11042 1780 --
NM_015986chr1751235 1062 1045 958 280 --11388 11291
NM_015990chr421029 894 ----167
NM_015995chr1555479 3776 2004 1138 529 --24508 1752 --
NM_015999chr11244 --2526 291 --
NM_016009chr1114843 4560 4250 3771 3655 3470 3348 3059 1756 1614 518 --43760 3264 293 257 1141
NM_016013chr15125 ------
NM_016027chr82430 395 ----2464 217
NM_016037chr121144 144 ------
NM_016039chr14--1134 ----
NM_016045chr2021511 1296 ------
NM_016061chr221240 59 --1233 --
NM_016070chr17140 ------
NM_016072chr1222449 715 --21823 184 11900
NM_016073chr1511070 ------
NM_016076chr142497 1228 966 721 --11289 --
NM_016078chr171443 ----21136 750
NM_016079chr252319 2045 494 303 133 ------
NM_016083chr643070 1470 565 396 1102 13391 33199 2832 1168
NM_016090chr112756 668 ------
NM_016094chr31582 1274 ----
NM_016096chr842062 1906 1349 244 --21585 43 --
NM_016097chr185861 836 724 716 144 --1327 --
NM_016098chr63193 126 114 ------
NM_016106chr14130 ------
NM_016107chr54514 466 449 133 ------
NM_016121chr131002 201 81 1465 ----
NM_016122chr12191 ------
NM_016132chr153769 538 513 --22342 2250 --
NM_016138chr162470 290 21674 47 --21236 187
NM_016152chr391268 1250 1054 816 451 362 305 249 77 1925 ----
NM_016166chr151183 --182 --
NM_016179chr13--125 ----
NM_016185chr17--1332 ----
NM_016200chr72698 144 ------
NM_016206chr3198816 8578 8413 7625 6774 6715 6271 6091 6050 5718 5475 3112 3052 2422 1970 1864 1172 979 660 26973 6738 27774 1650 37812 5498 1885
NM_016213chr15161 ------
NM_016224chr642228 1610 1531 303 ------
NM_016227chr11186 --1131 --
NM_016230chr62356 191 --1397 --
NM_016231chr1731151 1120 100 --1215 --
NM_016248chr1343197 768 600 215 11025 --12649
NM_016252chr23685 336 162 ------
NM_016255chr633315 992 940 --22798 2773 --
NM_016257chr183397 3075 3058 2581 2164 1385 1061 129 21350 955 22498 451 --
NM_016258chr11302 ----1782
NM_016260chr2196875 6583 6512 6202 5953 5805 5664 5521 5381 4972 4913 2782 2394 2327 2259 2094 594 553 166 17263 21366 849 37637 1980 272
NM_016269chr41215 --1150 --
NM_016272chr2262771 2444 2228 2194 1763 284 ------
NM_016274chr1179 ------
NM_016275chr332583 1817 197 1887 --12357
NM_016277chr651432 1266 1202 404 217 ------
NM_016281chr122875 234 ------
NM_016289chr222201 690 11739 1131 --
NM_016300chr3------1525
NM_016303chrX1404 --189 --
NM_016312chr122582 441 ------
NM_016315chr241863 1186 1179 294 11740 1232 --
NM_016316chr23251 212 195 --1648 --
NM_016319chr121820 ------
NM_016320chr112849 112 1219 ----
NM_016322chr92467 66 --1317 12386
NM_016328chr71114 ------
NM_016338chr541123 1041 361 131 ------
NM_016339chr1731552 597 139 --11342 --
NM_016351chr73581 502 87 ------
NM_016374chr111242 ------
NM_016374chr111242 ------
NM_016376chr1783548 3053 2907 1658 785 527 468 287 11336 ----
NM_016377chr641617 1488 1442 573 ------
NM_016395chr1521950 1351 --161 11615
NM_016396chr1563026 1161 653 617 484 171 --32962 2494 718 1291
NM_016401chr111265 ------
NM_016422chr1172890 2521 2489 804 543 475 353 11061 22634 1258 --
NM_016424chr1741930 1916 1496 731 ------
NM_016436chr203994 911 791 12264 1758 1384
NM_016441chr242345 2254 786 575 ------
NM_016447chr71235 --168 --
NM_016448chr141770 1524 1235 361 21600 383 21902 452 1178
NM_016467chr2129 ------
NM_016468chr141229 ----180
NM_016485chr641536 1411 653 62 ------
NM_016499chr111212 --1521 --
NM_016505chr1----2690 654 1535
NM_016507chr1732918 742 235 ------
NM_016513chr663430 2971 1498 807 629 361 12403 173 --
NM_016530chr15103764 3685 3371 3181 2790 2760 834 806 671 288 ------
NM_016531chr453402 3339 2575 417 86 --23638 1018 --
NM_016544chr273596 2425 1124 608 470 370 166 23901 1206 13058 --
NM_016559chr341434 1249 951 527 ------
NM_016562chrX21587 1030 135 1348 --
NM_016575chr1263854 3738 2101 1491 1335 738 24580 942 24105 3835 --
NM_016603chr512132 ------
NM_016607chrX31319 680 255 ----11666
NM_016613chr482784 2445 1974 1795 1752 908 705 580 --12762 22002 845
NM_016620chr111022 --1531 --
NM_016621chr1194623 4046 2959 1650 1382 1041 1029 895 867 --13906 --
NM_016625chr3181 ------
NM_016626chr1831589 496 474 ----11143
NM_016628chr102670 323 ------
NM_016631chr212885 740 ------
NM_016644chr53498 388 38 --175 --
NM_016651chr1411136 ------
NM_016653chr211195 --2279 235 --
NM_016654chr1531348 226 28 --11079 --
NM_016824chr1041654 1283 233 143 ------
NM_016830chr12--1545 ----
NM_016936chr1661766 1557 869 645 350 90 ------
NM_016937chrX1628 ------
NM_016940chr211441 ------
NM_016950chr441495 1127 602 30 --1567 --
NM_016952chr1143927 2790 1619 810 12925 13306 13855
NM_017412chr82927 414 ----1204
NM_017420chr1473601 2632 1275 980 804 652 409 23472 2935 1993 21061 839
NM_017423chr452082 1945 636 446 160 --22013 206 --
NM_017426chr43556 522 279 ------
NM_017437chr1442075 1548 729 290 1109 2541 185 --
NM_017440chr124575 455 200 193 --1104 --
NM_017447chr2174417 3499 3334 2997 1095 891 757 34404 3909 3622 13056 12860
NM_017459chr11414 ------
NM_017519chr63507 444 119 1136 ----
NM_017520chr13------1601
NM_017522chr13531 208 88 11249 ----
NM_017544chrX----1280 --
NM_017551chr1052405 2264 1767 660 254 --12497 --
NM_017563chr3106387 6096 5585 5462 5201 1088 1077 764 456 164 25809 5074 12183 12322
NM_017567chr2187 ------
NM_017569chr132381 138 --1107 --
NM_017594chr973090 2495 2330 2091 1308 1069 488 21343 199 32872 2777 2284 --
NM_017599chr1251803 1500 770 381 43 ------
NM_017610chr1541527 1301 354 231 11830 ----
NM_017612chr122511 115 ----1391
NM_017613chr213349 147 113 ------
NM_017628chr473887 3763 2105 2083 2003 1982 1200 --11896 14438
NM_017629chr151553 560 541 431 304 --1243 1111
NM_017633chr643962 3706 2801 1559 22576 2543 1236 13306
NM_017634chr831447 1350 268 --11303 11576
NM_017637chr997994 7787 7486 3490 2314 2046 1394 718 601 17057 28762 8354 --
NM_017640chr61939 ----1699
NM_017643chr17103128 2865 2581 2427 2283 2181 985 855 88 40 22054 843 11256 13036
NM_017644chr374858 4736 4341 3632 3418 2024 1152 14163 23772 1858 --
NM_017646chr13638 527 271 ------
NM_017650chr7105687 5007 4491 4150 1810 1475 1466 1160 605 157 --21686 1001 14988
NM_017651chr621034 650 1597 ----
NM_017658chr1463816 3133 3020 2955 2886 251 --34508 3930 1344 --
NM_017661chr1531313 1189 130 ------
NM_017664chr133967 817 203 ----1691
NM_017666chrX52007 1750 1679 902 413 ------
NM_017673chr12900 839 ------
NM_017676chr531887 1737 1241 1348 ----
NM_017684chr1551737 1592 486 209 167 --1509 --
NM_017686chr1--1849 --1964
NM_017693chr1331286 1026 422 1656 11663 --
NM_017709chr154153 3855 1689 1348 120 13980 ----
NM_017719chr351593 764 312 220 82 --12344 --
NM_017730chr31518 1573 ----
NM_017737chr152136 532 417 260 142 ------
NM_017740chr1631665 1168 671 ----11475
NM_017742chr184753 349 283 113 11884 ----
NM_017745chrX1258 ------
NM_017747chr5--1404 ----
NM_017752chrX21651 595 12174 ----
NM_017753chr93820 798 50 ------
NM_017758chr1741462 1030 418 128 --11167 --
NM_017768chr12845 185 ------
NM_017769chr1452724 2482 2250 1169 326 12570 ----
NM_017770chr643016 2489 1166 669 1568 ----
NM_017784chr331105 374 348 ------
NM_017787chr1062030 1940 1934 1834 965 957 1508 --12390
NM_017799chr1441858 694 557 474 ------
NM_017811chr952746 2684 2052 1972 228 13122 13109 --
NM_017824chr102871 22 12592 ----
NM_017831chr1874251 3634 3297 1426 1372 984 187 1655 ----
NM_017845chr43660 652 646 ------
NM_017848chrX124260 4250 4190 3933 3793 3243 3152 1745 1707 1596 488 48 ----13641
NM_017902chr1095689 4776 4009 3771 3642 1886 1079 522 234 11319 ----
NM_017905chr132575 152 --1244 --
NM_017907chr112471 50 ------
NM_017919chr9135764 5326 5264 5172 5096 4423 2273 2220 2009 1293 1126 620 39 21470 1003 22045 787 --
NM_017926chr142348 219 --2667 642 --
NM_017935chr42573 247 ------
NM_017938chrX72069 1840 1827 1614 1440 110 50 --11640 1750
NM_017943chr1411024 ------
NM_017944chr1142080 1929 1223 271 1791 12465 --
NM_017952chr264572 3871 3813 2980 990 952 21640 1017 1368 33526 3102 871
NM_017958chr232581 1126 607 1862 11155 --
NM_017966chr1121481 317 11425 ----
NM_017969chr22201 30 ------
NM_017972chr142348 219 --2667 642 --
NM_017990chr1673173 1600 1567 861 558 507 335 --13771 --
NM_017994chr742779 1916 1906 891 --2940 774 --
NM_018003chr154701 548 211 124 11649 ----
NM_018010chr351562 582 358 311 109 --11029 --
NM_018011chr132249 23 ------
NM_018014chr231176 364 355 ------
NM_018018chr1231422 620 28 21606 127 1226 --
NM_018027chr1083155 3035 2600 2387 2198 760 689 43 1372 ----
NM_018030chr1811098 --184 --
NM_018046chr531911 1659 110 ------
NM_018048chr1231836 581 489 11850 12050 --
NM_018051chr72132 70 ------
NM_018061chr121448 520 --1664 --
NM_018063chr101440 1454 ----
NM_018072chr1128 ------
NM_018078chr42762 309 --1932 --
NM_018084chr243043 2278 406 276 13071 --12347
NM_018086chr24740 587 529 322 11573 11406 --
NM_018087chr11251 ------
NM_018092chr1621555 120 --1613 1453
NM_018098chr331131 865 166 ------
NM_018105chr851112 1042 845 190 140 ------
NM_018107chr142824 59 1805 ----
NM_018112chr94406 212 74 49 ------
NM_018120chr851514 1360 983 422 315 --1158 --
NM_018121chr1022667 2206 --12611 12530
NM_018126chr44986 555 194 60 ----1425
NM_018128chr1731498 596 90 ------
NM_018133chr321795 52 12206 ----
NM_018155chr343443 1201 870 333 1263 23146 2980 --
NM_018156chr132531 681 413 --12517 11950
NM_018157chr12103201 3181 3112 2767 2205 2074 2040 1052 952 275 ----1962
NM_018164chr122113 73 ------
NM_018171chr121638 1736 ----
NM_018177chr42839 171 --180 --
NM_018179chr121618 ------
NM_018191chr1341677 1590 839 88 11817 11957 --
NM_018200chr1522634 43 ----21916 1813
NM_018202chr14768 761 751 92 ------
NM_018206chr16----1137 --
NM_018208chr141183 925 430 148 --21107 474 --
NM_018211chr112182 2722 617 ----
NM_018214chr6----122 --
NM_018222chr1141936 1793 1214 451 ------
NM_018223chr121160 ------
NM_018227chr442783 2163 1982 418 12574 11252 12025
NM_018243chr433860 1315 805 21373 64 34094 537 108 12978
NM_018247chr683132 3019 2013 1976 1206 1119 932 308 --1820 --
NM_018254chr152286 2263 305 279 187 --11996 --
NM_018257chr2052440 2026 1809 857 172 --11024 12326
NM_018270chr201672 ------
NM_018285chr15269 32 ------
NM_018293chr392880 2452 2154 2093 1999 1895 1032 420 236 --12068 --
NM_018299chr873047 2757 1299 619 521 140 129 ------
NM_018302chr462266 1873 1838 1728 658 410 ----190
NM_018312chr1131339 874 848 --12107 --
NM_018313chr33535 290 115 ------
NM_018315chr421218 361 ----1379
NM_018323chr441390 1153 267 179 11330 ----
NM_018325chr951519 1087 427 365 102 --31320 1022 384 --
NM_018327chr2021811 667 ----2521 227
NM_018340chr1633422 3107 340 23793 1646 11033 --
NM_018351chr1233961 3747 984 1759 34235 1635 536 11016
NM_018360chrX------1105
NM_018361chr853926 1451 1393 584 457 13119 1913 --
NM_018362chr1151439 1203 600 320 237 23785 2924 23956 2966 --
NM_018364chr15779 470 433 156 112 1954 ----
NM_018371chr81159 11196 11288 --
NM_018373chr1496203 5500 5229 4658 4338 2001 1392 482 242 --16134 21196 71
NM_018375chr1441792 1625 1537 1530 ------
NM_018383chr222024 334 1468 12011 --
NM_018388chrX41126 1081 500 59 ----187
NM_018403chr363624 1600 1589 1567 1236 1123 32864 1113 1028 ----
NM_018409chr473087 3048 3025 2425 272 118 61 --22706 573 --
NM_018416chr1232123 813 383 ----1601
NM_018424chr931466 512 280 ------
NM_018427chr164496 443 347 229 ----11226
NM_018429chr522553 903 12779 11081 --
NM_018431chr202614 242 ------
NM_018437chr92532 116 1162 ----
NM_018440chr8138729 7888 7229 6729 5731 3430 3188 3029 2945 2926 2706 2479 1570 37974 7692 6253 1560 18539
NM_018445chr15--1551 1205 --
NM_018448chr122832 308 ------
NM_018460chr2157 ------
NM_018462chr32322 252 2839 155 1225 --
NM_018469chr1751342 409 355 294 133 --1126 --
NM_018476chrX191 --1189 --
NM_018482chr862385 2362 1616 826 603 268 --22573 170 --
NM_018489chr122248 614 --1697 --
NM_018490chr1121201 392 --1422 --
NM_018509chr1721724 65 ----1330
NM_018553chr173332 247 184 11655 --11182
NM_018557chr231755 1695 1185 ------
NM_018566chr1115046 4564 3235 1946 1801 1567 1279 1164 1131 671 226 1493 11388 --
NM_018569chr451634 475 322 202 196 ------
NM_018584chr1------11109
NM_018590chr10----2270 66 --
NM_018593chr62706 479 ----1164
NM_018638chr12115418 5410 4380 4199 3876 3607 3555 3525 1035 831 390 1689 41998 1935 1686 957 15621
NM_018640chr1252811 2463 2343 2308 1038 3609 522 434 1952 --
NM_018650chr142010 1723 313 89 ------
NM_018652chr151211 ----147
NM_018667chr1662697 2210 1873 1794 859 253 2582 28 --2970 942
NM_018682chr7------1469
NM_018684chrX41366 1244 306 162 ------
NM_018686chr122330 138 ------
NM_018689chr1532670 1860 193 ------
NM_018695chr532150 797 570 12363 12095 --
NM_018698chrX31497 195 121 --11682 --
NM_018700chr51258 --31431 1177 178 --
NM_018703chr161147 ------
NM_018704chr141999 768 422 199 11892 ----
NM_018710chr851165 992 957 362 232 ------
NM_018712chr1121196 265 21429 602 11574 --
NM_018715chr131639 675 148 1249 ----
NM_018717chr462442 2224 2167 1096 823 292 22252 874 ----
NM_018718chr761980 1940 1521 549 382 91 --12256 --
NM_018719chr731177 349 87 1251 ----
NM_018836chr1----121 --
NM_018841chr152877 2761 1022 865 72 ------
NM_018844chr72739 664 22001 274 ----
NM_018890chr741453 1254 408 225 ------
NM_018898chr542269 2042 1711 317 ----11807
NM_018899chr542269 2042 1711 317 ----11807
NM_018900chr542269 2042 1711 317 ----11807
NM_018901chr542269 2042 1711 317 ----11807
NM_018902chr542269 2042 1711 317 ----11807
NM_018903chr542269 2042 1711 317 ----11807
NM_018904chr542269 2042 1711 317 ----11807
NM_018905chr542269 2042 1711 317 ----11807
NM_018906chr542269 2042 1711 317 ----11807
NM_018907chr542269 2042 1711 317 ----11807
NM_018908chr542269 2042 1711 317 ----11807
NM_018909chr542269 2042 1711 317 ----11807
NM_018910chr542269 2042 1711 317 ----11807
NM_018911chr542269 2042 1711 317 ----11807
NM_018944chr214750 631 503 266 --127 --
NM_018945chr621336 483 12889 ----
NM_018959chr191545 ------
NM_018970chr752015 1169 1008 727 131 1647 11140 --
NM_018976chr1262190 2001 1843 1783 479 341 --1626 --
NM_018979chr121919 --21878 474 1930
NM_018993chr203560 454 67 ------
NM_018999chr1094577 4192 3514 3461 3261 1764 1666 1407 1027 --11987 1867
NM_019001chr3104109 3566 3401 3358 3334 3136 3005 1028 387 45 24700 1320 ----
NM_019004chr722355 926 1536 ----
NM_019005chr7------1129
NM_019008chr22113513 3348 2789 2730 2547 1449 435 378 340 331 218 33282 1372 1111 22839 1028 --
NM_019009chr1132597 2549 681 12233 11765 1320
NM_019022chr1892427 2203 2098 1141 852 802 276 259 227 --33188 3121 919 --
NM_019026chr1------126
NM_019027chr462131 1854 951 556 362 345 ------
NM_019035chr43750 508 251 --11945 1516
NM_019042chr731196 1075 954 --11245 11063
NM_019044chr263992 3860 3523 3160 3001 36 14242 ----
NM_019045chrX4743 648 273 42 ------
NM_019049chr13532 509 21 --1188 --
NM_019050chr452123 1843 1577 582 119 --11565 --
NM_019053chr102332 313 ------
NM_019058chr101820 ------
NM_019072chr5104182 4034 3838 3545 3470 3424 2645 1576 1293 686 11011 --23239 287
NM_019084chr103564 479 458 12467 ----
NM_019087chr531755 1210 285 1230 ----
NM_019091chr2--1426 ----
NM_019096chr65801 448 410 279 25 1125 ----
NM_019098chr821357 742 --11867 --
NM_019114chr962257 2045 963 925 331 200 --22105 1008 --
NM_019116chr1663582 3101 3072 2764 2561 1075 23518 317 13535 --
NM_019117chrX83119 2824 2813 2695 1229 975 617 543 2635 527 ----
NM_019555chr321551 321 --11497 --
NM_019556chrX41375 1260 1147 183 1446 11095 1491
NM_019590chr102595 481 --1187 --
NM_019592chr92824 67 1638 ----
NM_019593chr2062734 2113 2043 1277 634 500 22314 2152 23182 2627 --
NM_019595chr21483 ------
NM_019605chr1------1208
NM_019610chr121548 1360 1852 1387 170
NM_019843chr22190 ------
NM_019857chrX61782 1744 1676 1627 1438 1178 ------
NM_019887chr122569 489 --1265 --
NM_019903chr1041654 1283 233 143 ------
NM_020039chr1291373 1301 1200 341 304 187 174 168 83 1317 ----
NM_020066chr14962 843 162 92 --1372 --
NM_020116chr421502 37 --11666 --
NM_020122chr2105601 5431 5259 4305 2197 2014 783 526 359 181 35402 5245 4812 --12187
NM_020123chr1031056 466 414 ------
NM_020130chr841268 1202 916 904 ------
NM_020132chr21134466 4358 4163 3659 3574 3310 3296 3280 1604 994 585 425 386 14374 ----
NM_020144chr721434 1375 1267 --11966
NM_020148chr1863087 2999 2360 1086 1025 704 --1433 12208
NM_020150chr103419 336 31 --11443 --
NM_020157chr2041038 938 819 203 ------
NM_020159chr43600 385 240 --31569 1169 334 11476
NM_020177chr563114 2783 2766 2746 2686 575 32955 2381 248 1412 1440
NM_020178chr172938 388 ------
NM_020182chr2043645 3044 2918 270 12319 1818 --
NM_020184chr22720 248 1158 --1893
NM_020186chr71511 ------
NM_020191chr3128 ------
NM_020193chr112949 472 --21028 345 --
NM_020198chr1741461 435 162 139 ------
NM_020205chr133378 2244 1111 ------
NM_020235chr33257 58 34 ----1336
NM_020239chr14725 528 168 126 2832 628 --31974 1871 25
NM_020245chr684868 1033 973 965 956 422 329 301 34595 4138 3668 --11134
NM_020307chr32411 336 ------
NM_020310chr1712699 1660 12345 --
NM_020311chr2--1576 ----
NM_020336chr2043310 3029 1156 1134 --42633 2554 486 376 --
NM_020337chr482411 2100 2052 2000 986 883 551 510 --11180 --
NM_020341chr2021403 335 11987 11611 --
NM_020342chr231918 1847 748 21027 954 ----
NM_020346chr1131613 676 591 --11222 --
NM_020378chr191582 --184 --
NM_020379chr13783 237 224 ------
NM_020390chr394784 4583 4554 4288 4035 3851 1529 1479 1002 34500 4250 566 14705 --
NM_020403chr1321773 641 ------
NM_020416chr411658 22128 334 ----
NM_020420chrY21194 549 11345 ----
NM_020425chr631915 1676 691 ------
NM_020429chr783031 2993 2757 2482 2309 1039 693 285 22660 201 22392 2181 1573
NM_020432chr742315 1567 175 157 ------
NM_020438chr911333 ------
NM_020440chr151172 634 516 465 145 1177 ----
NM_020443chr142726 2133 1857 1141 16366 25345 776 12524
NM_020444chr541494 1063 955 579 1219 159 --
NM_020449chrX4738 655 302 211 ----1749
NM_020453chr451946 1454 755 331 112 --21338 1331 11598
NM_020455chr692825 2683 947 933 806 797 527 488 85 --22163 2098 --
NM_020456chr1332152 69 31 --12231 12291
NM_020463chr231458 599 366 ------
NM_020465chr1631972 1396 601 1675 31999 1449 1439 --
NM_020466chr644895 4581 4071 1798 21864 413 1789 --
NM_020473chrX31891 1606 46 1641 ----
NM_020474chr183589 495 361 --11790 167
NM_020532chr23584 289 252 ------
NM_020640chr372225 2040 1708 1598 1463 834 74 ----11684
NM_020642chr111545 ------
NM_020644chr113285 259 240 ------
NM_020647chr842120 1774 1553 1451 22187 686 11815 1427
NM_020648chr1832778 2285 614 1712 ----
NM_020651chr231539 412 90 ------
NM_020653chr173350 63 30 ------
NM_020657chr1911789 ----11464
NM_020673chr20127709 6531 5770 5420 4771 3029 2927 2233 1983 1231 1096 191 1535 11108 27083 2070
NM_020686chr1622860 2781 --2658 294 --
NM_020696chr3127 ------
NM_020697chr81149 ------
NM_020698chr1242134 2002 603 76 ------
NM_020699chr185232 4492 3328 1819 1532 981 755 268 --1218 --
NM_020704chr752521 2425 1602 945 61 1686 11803 --
NM_020711chr262527 1708 559 501 76 53 22513 1795 ----
NM_020715chr1441902 1717 558 328 --21778 1676 --
NM_020717chrX134526 3421 3275 3234 3187 3118 1455 970 604 403 390 306 120 44797 3583 1230 789 44152 3708 1898 199 14231
NM_020718chr1696524 6232 5898 4613 4579 2362 1903 1613 511 24083 530 --35733 1058 195
NM_020727chr2143903 3677 3342 1371 --13956 12839
NM_020728chr742967 2947 2054 49 12931 22455 559 12030
NM_020732chr63507 444 119 1136 ----
NM_020734chr1252931 2872 1079 532 56 ----1472
NM_020739chr1554006 2906 2746 1213 359 13450 1611 --
NM_020742chrX62608 2514 2478 2422 2191 32 1275 ----
NM_020748chr1741627 1420 219 201 ------
NM_020750chr611454 --1248 --
NM_020752chr1062716 2321 2247 2045 428 278 1663 ----
NM_020755chr631279 1252 134 --21669 483 --
NM_020761chr17------11948
NM_020766chrX84278 4083 3446 2909 1806 1752 832 308 24526 3856 11573 --
NM_020768chr551163 921 891 792 150 --23012 354 12283
NM_020769chrX1384 --1928 --
NM_020772chr17188422 8061 6558 6192 5990 5973 5726 5545 5304 5256 2232 2215 1960 1565 895 695 511 32 17269 27589 1716 15939
NM_020774chr18106243 5866 5733 4882 4542 2412 1977 922 381 241 11389 14316 --
NM_020778chr1564966 4625 4456 1787 1067 337 --21821 414 --
NM_020779chr252652 1978 870 582 547 12712 12170 --
NM_020783chr1831493 66 36 ------
NM_020791chr1711007 21235 42 ----
NM_020792chr342777 410 128 107 ----1653
NM_020796chr553054 2744 2367 843 649 22051 957 ----
NM_020800chr321142 368 1528 1183 11500
NM_020801chr542517 1733 530 395 1561 --1786
NM_020803chr442042 1505 684 91 12296 21675 469 --
NM_020805chr1841780 1483 555 360 --2647 582 --
NM_020810chr1463588 2957 2228 1454 122 91 ----13388
NM_020819chr641076 434 225 217 ------
NM_020821chr1551737 1592 486 209 167 --1509 --
NM_020825chr1622980 298 23739 3236 12496 1440
NM_020830chr253197 3033 3026 2301 973 --22849 897 --
NM_020841chr1264055 3671 2956 1237 970 328 --23435 3358 --
NM_020844chr8137255 6850 6809 6620 6381 6215 6046 5545 2726 2517 1994 1629 565 12566 33024 1398 515 15691
NM_020845chr124805 776 660 633 --21009 787 --
NM_020853chr1282597 1958 1824 998 966 923 82 55 1113 --1791
NM_020858chr1512200 ------
NM_020860chr431104 270 163 1379 1257 --
NM_020861chr62878 36 ------
NM_020866chr13131 ------
NM_020868chr222011 173 1371 ----
NM_020870chr412105 --21980 903 --
NM_020871chrX51868 1572 401 336 235 12512 --11011
NM_020872chr331808 1428 334 --21294 114 --
NM_020890chr32463 194 ------
NM_020892chr7----1355 --
NM_020897chr141229 1187 1076 894 11216 1451 --
NM_020899chr1752448 1937 909 694 310 --1825 --
NM_020909chr274026 3629 3359 794 527 316 227 ----14082
NM_020917chr1932930 2837 1417 22459 2401 23363 770 --
NM_020919chr221206 477 2270 35 ----
NM_020921chr1443661 2718 1150 1029 --13592 --
NM_020922chrX31877 1715 519 21737 1642 1235 --
NM_020925chr11912 ----1548
NM_020927chr1612248 --21491 586 12134
NM_020935chr264254 3830 3428 3031 1871 1224 --23779 94 1859
NM_020940chr1052656 1182 974 652 211 ------
NM_020946chr941306 525 99 89 --11145 --
NM_020947chr1611749 --32105 1916 1503 1304
NM_020948chr173035 2894 1140 690 417 246 171 22944 2729 43416 3400 948 153 --
NM_020964chr18124831 3899 3879 3197 3178 3171 3098 3026 1499 1269 1023 468 14142 23477 1439 24297 1190
NM_020975chr1041891 1615 165 65 ------
NM_020987chr10135 ------
NM_020988chr1631314 1266 395 --11071 --
NM_020993chr12--1124 ----
NM_021003chr14128 ------
NM_021005chr152465 189 ------
NM_021007chr272299 1724 757 514 392 215 113 --12249 12282
NM_021012chr1753089 2811 2712 1169 1140 22032 524 32245 721 273 --
NM_021033chr1343004 2714 2324 1359 --11162 --
NM_021035chr2031168 1008 468 1219 ----
NM_021038chr363275 3247 2732 1318 1037 374 --12217 22895 2769
NM_021045chr1072140 2021 1053 809 595 507 176 ----12639
NM_021069chr421740 663 --11974 --
NM_021072chr542527 2007 828 301 --175 1689
NM_021079chr1743331 3103 2591 2279 22549 133 ----
NM_021083chrX23140 1115 ----21343 1225
NM_021090chr2274654 4494 4411 3631 3487 752 213 14394 ----
NM_021096chr2243198 2869 301 54 12699 ----
NM_021097chr223061 2529 ------
NM_021105chr33731 703 289 ------
NM_021109chrX159 ------
NM_021109chrX159 ------
NM_021111chr941382 1192 882 180 ------
NM_021116chr777615 7562 7002 6865 6693 2445 1845 26354 5912 29053 6668 --
NM_021120chrX33188 1045 1039 12046 1682 --
NM_021132chr10------1986
NM_021140chrX61050 850 778 718 61 36 ------
NM_021143chr193553 526 499 1442 ----
NM_021145chr71903 1100 1157 --
NM_021148chr762470 2370 2314 2054 1676 917 ------
NM_021151chr711080 ----1175
NM_021155chr1962959 2358 2073 2047 811 653 1934 ----
NM_021158chr201839 ------
NM_021177chr61106 ------
NM_021183chrX1934 1217 1571 --
NM_021190chr161321 1306 1068 541 485 213 ------
NM_021213chr1791275 1248 1076 1038 1004 871 785 362 264 --1991 11014
NM_021239chr1441036 1016 896 284 --11156 --
NM_021249chr1421628 334 ----11235
NM_021252chr1031478 1468 294 --11413 --
NM_021255chr1464095 3411 3363 901 343 271 13971 2716 73 --
NM_021619chr91987 11076 11164 --
NM_021622chr1041577 863 784 33 ------
NM_021626chr174461 409 184 136 ----1432
NM_021627chr32968 409 --1996 --
NM_021629chr394882 4788 4742 4726 3591 1701 1510 1338 108 13303 180 --
NM_021639chr1------1339
NM_021643chr251699 1398 1332 1187 345 ------
NM_021644chr102310 298 149 1830 --
NM_021647chr474015 3978 3925 3553 3161 909 772 24073 269 24028 3811 --
NM_021648chr682550 1717 795 656 253 244 208 25 ------
NM_021649chr541612 1193 580 148 ----11157
NM_021722chr73540 461 51 ------
NM_021723chr73581 502 87 ------
NM_021813chr655545 5534 5523 5455 394 --15701 35052 4686 1583
NM_021814chr621531 1162 11427 ----
NM_021830chr102873 78 ------
NM_021911chr584334 4148 1748 1570 1539 1402 226 166 24357 3610 --11638
NM_021912chr1543427 1258 599 59 21041 282 43991 3846 1683 1157 11523
NM_021914chr1422368 2284 1704 11571 --
NM_021943chr651899 1742 1473 869 709 21754 771 1603 --
NM_021946chrX------11352
NM_021947chr1721281 919 ------
NM_021949chrX42785 2772 640 206 --1674 --
NM_021951chr9----1907 1717
NM_021956chr621567 1170 ------
NM_021960chr12822 707 12291 12161 --
NM_021961chr11106440 5875 5315 5105 4985 4801 2786 2465 1965 1786 15181 12238 26555 1723
NM_021964chr3116611 5921 5503 5408 5096 4781 4290 4060 2636 1517 892 26539 6345 12558 52489 2363 1959 1535 674
NM_021973chr41665 ------
NM_021998chrX11269 11403 ----
NM_022041chr1632506 2452 2010 --1793 12677
NM_022048chr1586205 5835 5035 2167 2155 1373 826 643 --2833 358 --
NM_022051chr13722 544 249 ------
NM_022054chr14------1776
NM_022058chr241483 1370 400 117 ------
NM_022062chr1111678 ------
NM_022085chr631419 1178 391 ----11242
NM_022091chr632055 1737 984 12114 2955 899 --
NM_022103chr19--2812 346 ----
NM_022114chr143500 1706 1400 595 11641 1658 14191
NM_022118chr133190 73 39 --1258 1527
NM_022121chr61254 1948 --11135
NM_022123chr141539 ------
NM_022129chr1041428 1422 102 50 1251 ----
NM_022130chr581221 1027 936 452 276 209 164 117 --1374 --
NM_022140chr542250 1964 1824 1497 11555 1549 --
NM_022156chr17172 ------
NM_022166chr16145627 5027 4994 4965 4864 4794 4656 4385 2547 2348 2289 1755 1407 589 14619 24587 2335 --
NM_022167chr171854 ------
NM_022168chr21115 ------
NM_022351chr893571 2791 2769 1390 991 581 474 149 95 --12972 11323
NM_022374chr2127 1436 1330 --
NM_022444chr751893 1854 1824 1813 440 --1666 --
NM_022454chr82808 789 1160 ----
NM_022456chr12106819 6528 5853 4935 4905 4697 2432 546 507 465 37038 5251 4773 1982 16918
NM_022458chr773137 2593 2551 2528 2283 2131 875 12891 1803 2984 25
NM_022459chr1375734 4653 4160 1493 1108 182 37 24936 1979 36060 1511 1085 14420
NM_022461chr351283 928 338 277 271 --11221 --
NM_022469chr142946 2344 1352 1031 12965 ----
NM_022473chr1544474 3414 1138 745 11393 ----
NM_022474chr1442602 686 448 307 12198 ----
NM_022477chr2081713 1670 1495 1178 695 669 393 155 21697 91 ----
NM_022482chr2062508 2213 1860 1773 393 138 12086 --22441 2132
NM_022491chr1263022 2970 2553 1173 859 235 1368 22605 194 --
NM_022495chr141360 ------
NM_022497chr353503 2670 2448 1417 388 23900 3857 --11505
NM_022552chr23917 516 448 --1302 --
NM_022726chr631783 1378 407 ------
NM_022735chr13545 101 71 ------
NM_022739chr172302 133 --11118 --
NM_022748chr782843 2794 2774 2298 2065 1015 800 784 ----188
NM_022750chr73259 160 38 ------
NM_022763chr362842 2649 1244 898 286 113 --12998 1697
NM_022771chr121379 ----21002 186
NM_022776chr32551 47 ----1197
NM_022780chr261717 1520 1479 351 287 106 ------
NM_022781chr932955 1339 368 22690 103 ----
NM_022782chr123357 321 113 ------
NM_022802chr1021489 1233 ------
NM_022824chr53714 492 369 --1394 --
NM_022828chr521807 500 --21388 693 21132 553
NM_022831chr14705 484 243 235 1280 --140
NM_022836chr141644 1186 569 479 --2626 106 --
NM_022843chr1341497 1311 1162 119 ------
NM_022844chr161153 ----1642
NM_022845chr1662089 1852 1846 808 388 235 1569 1880 --
NM_022875chr52516 184 --1510 --
NM_022877chr52516 184 --1510 --
NM_022893chr273108 2941 2894 2087 1163 837 295 --1766 22660 705
NM_022894chr251746 1677 1114 526 271 21577 1414 ----
NM_022897chr551030 984 814 749 345 ----1235
NM_022898chr1444569 4520 1236 1226 24780 3173 11577 --
NM_022900chr731122 1030 73 --1257 --
NM_022901chr921621 1210 11396 11584 --
NM_022902chr51427 ----1313
NM_022909chr52187 27 ----1522
NM_022910chr1631972 1396 601 1675 31999 1449 1439 --
NM_022912chr253045 2183 2014 464 109 ------
NM_022918chr1141884 1876 1406 390 --12123 --
NM_022965chr451309 1115 610 566 369 ------
NM_023000chr1411573 ------
NM_023001chr1411573 ------
NM_023009chr11721 ------
NM_023016chr241104 898 475 218 22382 1790 ----
NM_023037chr131734 ------
NM_023039chr5125 --2308 84 --
NM_023914chr331603 1090 26 ------
NM_023923chr153172 3019 1035 486 297 32357 1282 842 13352 13380
NM_023927chr511069 21287 963 11042 --
NM_023929chr892645 2335 2160 2111 1730 788 693 515 441 --32534 2506 1040 --
NM_023943chr31153 ------
NM_024007chr5102832 2772 2766 1937 1201 910 790 719 303 46 23016 1067 ----
NM_024034chr20--1205 2728 274 --
NM_024045chr101166 122 145 --
NM_024061chr72557 182 ------
NM_024089chr13----1138 --
NM_024090chr41389 1257 ----
NM_024095chr1221477 1329 1523 ----
NM_024295chr81449 ----11941
NM_024326chr10----1140 --
NM_024339chr16171 ------
NM_024345chr955869 3979 1853 1536 809 35364 1656 905 34070 2080 1197 12382
NM_024416chr921571 642 --11050 --
NM_024423chr1883934 3651 2977 1531 1258 1095 765 476 ----13727
NM_024424chr1121098 185 --1280 1378
NM_024425chr1121098 185 --1280 1378
NM_024426chr1121098 185 --1280 1378
NM_024491chr3122 ------
NM_024494chr12504 112 1641 ----
NM_024496chr141177 --1666 --
NM_024511chr483556 2976 2948 2175 868 722 399 229 23409 2345 22527 314 --
NM_024519chr161293 ------
NM_024524chr332692 896 354 --22190 952 --
NM_024525chr12638 403 ------
NM_024529chr141066 1054 865 372 ------
NM_024546chr1351258 1235 1214 297 87 --1496 --
NM_024556chr112480 463 --1193 --
NM_024563chr521835 1192 11630 1583 11888
NM_024569chr172756 2242 2011 905 583 305 247 12578 ----
NM_024582chr41968 2314 274 11123 --
NM_024590chr431226 746 550 ----2629 147
NM_024602chr12864 725 1666 --1591
NM_024607chr853714 3050 1284 851 565 43135 1385 1064 440 33632 3119 810 --
NM_024612chr17----158 --
NM_024613chr851885 1868 1549 1147 193 ------
NM_024616chr341459 1289 572 154 21175 42 ----
NM_024624chr23514 412 338 ------
NM_024631chr11148 ------
NM_024632chr51192 160 1281 --
NM_024639chr632825 1008 763 11940 --1317
NM_024645chr831347 404 49 21410 556 11146 --
NM_024646chr163939 3903 3676 441 277 96 12848 23582 1117 --
NM_024663chr20----139 --
NM_024665chr3104340 4187 3640 3566 3207 2865 1834 1799 1425 1328 --14068 1849
NM_024666chr1551538 678 652 537 61 ------
NM_024670chr1011630 --31287 509 99 --
NM_024674chr132325 2171 970 12545 11035 1943
NM_024700chr12963 919 ------
NM_024702chr172598 99 --2558 205 --
NM_024715chr551699 1552 1278 634 231 ------
NM_024721chr862210 2171 1857 1800 739 646 --2753 608 --
NM_024731chr162138 114 ------
NM_024740chr1183625 3401 2845 2592 1432 1380 1164 203 ----34020 3125 814
NM_024744chr25945 696 536 505 186 --1166 --
NM_024749chr16852 614 508 298 285 56 11512 ----
NM_024755chr15------1369
NM_024757chr9----1816 1740
NM_024761chr995189 5143 4494 4477 4042 3268 1948 1201 669 11089 33965 1121 308 --
NM_024763chr171200 1096 1026 902 840 404 386 ------
NM_024770chr296480 6186 5610 5594 5326 4446 4157 1407 1379 12027 25601 4589 --
NM_024811chr1151826 1789 1375 524 148 ------
NM_024812chr841909 1503 838 666 11655 2186 112 --
NM_024817chr1585446 5147 5113 4800 1766 1148 658 173 31670 962 754 11525 --
NM_024824chr1461730 1334 680 505 213 139 ------
NM_024828chr941454 1120 1073 390 ----11307
NM_024835chr171341 ------
NM_024837chr1541569 1549 527 60 21789 1509 ----
NM_024863chrX--122 ----
NM_024887chr192120 1757 1638 1333 1326 563 425 376 39 11593 ----
NM_024896chr932386 2263 680 --11835 --
NM_024909chr611115 ------
NM_024915chr82623 412 --1672 --
NM_024930chr552739 1752 768 400 66 --11103 --
NM_024944chr21----1404 --
NM_024947chr3125818 3324 3297 2431 1428 1413 1251 996 586 212 152 36 11302 37257 5809 396 --
NM_024948chr102712 646 --1198 --
NM_024979chr131411 --1294 11128
NM_024989chr2147375 6480 6227 5712 5400 3223 2974 2426 2056 1504 918 424 365 119 11444 28077 7549 --
NM_024993chr211644 1407 129 --
NM_025004chr112637 39 ------
NM_025027chr1931181 1022 916 1254 ----
NM_025054chr894128 2862 1537 1379 1149 994 859 513 203 ----13683
NM_025074chr452883 2828 2712 636 484 --32469 2453 581 11160
NM_025076chr21537 ------
NM_025077chr11235 ------
NM_025104chr1751491 1196 387 256 96 11644 ----
NM_025107chr642000 574 473 434 ------
NM_025134chr1682551 2541 2189 2109 1891 966 632 363 22454 1572 11943 --
NM_025135chr181437 ------
NM_025146chr322415 1951 ------
NM_025151chr82673 184 --21614 695 2647 147
NM_025154chr741505 1047 961 557 --11107 --
NM_025160chr143934 3797 3544 3376 --13253 --
NM_025179chr174797 4655 4522 4463 3070 1889 1668 23430 773 43678 1374 1362 293 --
NM_025184chrX3847 765 159 --1626 --
NM_025191chr142759 2727 2541 2509 ------
NM_025195chr8--2528 423 21823 1555 11212
NM_025208chr1132448 1794 191 --12035 --
NM_025211chr9--1214 ----
NM_025221chr41531 1998 --150
NM_025222chr342570 1981 608 118 12369 1370 --
NM_025235chr1041508 808 336 70 ------
NM_025246chr3165 ------
NM_025263chr621482 600 ------
NM_030579chr1653681 3639 3180 2906 2472 11038 1980 11436
NM_030594chr1541292 529 395 158 ------
NM_030621chr1484028 3079 2921 1479 1095 921 725 244 14105 ----
NM_030625chr1072575 2539 2084 1777 790 631 357 22525 2365 ----
NM_030627chr543899 3791 3150 423 --24005 3483 23550 2822
NM_030634chr142495 2394 2337 419 --11596 12253
NM_030639chrX61658 1416 1390 715 685 218 --11214 21699 1334
NM_030640chr123864 582 25 ------
NM_030647chr7126342 6098 5285 4933 4685 2173 1609 1518 1429 1392 1309 885 --25557 4067 --
NM_030648chr475397 5212 5067 4635 3858 1923 659 --14649 --
NM_030650chr242918 961 732 660 14124 12893 --
NM_030664chr1041719 1538 858 464 1308 1597 --
NM_030670chr1261662 634 351 282 267 248 --31636 1549 1437 --
NM_030671chr1261662 634 351 282 267 248 --31636 1549 1437 --
NM_030751chr1041769 1633 1604 502 --21627 1239 11899
NM_030751chr1041769 1633 1604 502 --21627 1239 11899
NM_030755chr1451230 1077 954 843 568 12208 32549 2117 1000 --
NM_030756chr10------1226
NM_030758chr2211040 --11265 11150
NM_030763chrX4894 643 365 291 --1901 --
NM_030771chr11167 ------
NM_030780chr861298 1131 273 208 82 31 ------
NM_030786chr151417 692 504 494 215 ------
NM_030791chr1461848 1620 1502 1332 1275 555 ----11578
NM_030799chr521968 189 1508 ----
NM_030802chr17--127 ----
NM_030806chr1179444 9339 8616 8318 5731 3542 2995 2112 2067 1588 1540 758 397 342 317 286 85 47193 6049 3628 900 28335 3621 --
NM_030810chr631419 1178 391 ----11242
NM_030816chr163495 3199 2929 2607 2271 307 --1710 --
NM_030821chr42571 71 1332 ----
NM_030885chr371971 1733 1489 1441 924 276 159 --1917 11935
NM_030918chr164419 3294 1684 1587 1382 1299 1166 34292 4168 4152 --
NM_030920chr171743 1589 1539 595 558 314 132 ------
NM_030922chr153740 241 211 ------
NM_030923chr24562 517 156 138 ----1488
NM_030926chr241143 983 803 109 ------
NM_030938chr1731171 717 111 --147 --
NM_030939chr62896 831 ------
NM_030945chr542179 1790 1684 90 ----1301
NM_030949chr6--11489 ----
NM_030954chr81241 1767 ----
NM_030959chr6273 27 --1757 --
NM_030962chr1131176 462 155 1536 1431 11398
NM_030964chr583440 2298 1167 806 732 489 117 30 13673 1643 --
NM_031216chr1842217 1622 1391 839 --12184 --
NM_031217chr111120 ------
NM_031243chr732281 2192 848 ------
NM_031266chr53466 416 97 ------
NM_031267chr72440 395 ------
NM_031268chr1695277 5241 4974 4727 3905 3668 3649 1607 1125 14215 11964 --
NM_031296chr432018 1884 151 ------
NM_031314chr1431899 731 44 --11264 --
NM_031371chr111242 ------
NM_031371chr111242 ------
NM_031372chr43634 290 175 --11416 1493
NM_031407chrX------137
NM_031411chr542269 2042 1711 317 ----11807
NM_031418chr1152591 2115 2021 1935 284 --1704 --
NM_031419chr341323 1051 644 109 --11194 --
NM_031422chr182506 71 ----2454 135
NM_031427chr1455166 2334 1343 1330 868 44248 1639 1278 278 24590 1903 24492 3814
NM_031435chr1252539 2447 2271 509 100 --22800 2523 23172 523
NM_031442chrX23024 168 22472 976 --12382
NM_031445chr263254 2975 2773 830 141 97 ------
NM_031452chr15297 85 --1214 --
NM_031461chr872037 1995 1985 1767 720 286 257 ------
NM_031468chr778015 7966 5323 2333 2074 1963 1185 28241 8176 27349 2346 --
NM_031469chr694028 3709 3086 2814 1265 1238 896 331 217 1413 11608 --
NM_031475chr1--1540 ----
NM_031483chr2073307 3176 2735 2678 2269 344 62 23168 2500 22212 164 --
NM_031492chr113532 522 389 ------
NM_031844chr163919 3506 3278 1063 731 252 ------
NM_031845chr263467 3362 3218 2923 2331 147 12702 1295 --
NM_031847chr263467 3362 3218 2923 2331 147 12702 1295 --
NM_031849chr542269 2042 1711 317 ----11807
NM_031857chr542269 2042 1711 317 ----11807
NM_031860chr542269 2042 1711 317 ----11807
NM_031889chr451357 1221 669 511 51 --1380 11246
NM_031890chr2252942 2551 2358 2348 140 --42137 782 592 61 --
NM_031892chrX1851 1731 2253 60 1655
NM_031911chr43733 274 186 ------
NM_031914chr145858 825 618 312 59 ------
NM_031922chr63543 400 382 ------
NM_031935chr13975 932 761 ------
NM_031953chr41195 ----1452
NM_031954chr1262538 2255 1962 1093 226 92 ----1554
NM_031966chr52221 110 1411 --1486
NM_032012chr984883 3267 1946 1197 1095 1084 1014 76 23880 854 34058 1346 502 13734
NM_032013chr2081713 1670 1495 1178 695 669 393 155 21697 91 ----
NM_032017chr141688 1554 841 263 ----1567
NM_032042chr542699 2057 1101 436 --22792 2275 --
NM_032047chr321598 175 --12302 --
NM_032102chr1193143 3135 3106 2423 1240 967 469 284 176 12132 1129 --
NM_032116chr13115599 5147 5070 4566 4541 2218 1193 1038 844 568 541 25077 259 24889 2330 --
NM_032120chr7186 ------
NM_032121chrX52848 2319 2190 1877 724 11061 ----
NM_032128chr42906 44 ------
NM_032138chr132537 473 1180 132 --
NM_032142chr182199 64 ------
NM_032144chr22368 55 ------
NM_032145chr631800 1634 395 ------
NM_032146chr33447 110 49 ------
NM_032147chr125789 383 348 217 142 ----1292
NM_032153chr362552 1794 1784 423 416 141 --12009 --
NM_032160chr1883849 3232 2857 649 496 392 346 246 11112 22751 1641 --
NM_032174chr121171 468 ------
NM_032177chr5164 ------
NM_032182chr103446 350 168 ----1583
NM_032186chr111022 --1531 --
NM_032189chr1354632 1766 1233 892 183 --34586 3269 1495 --
NM_032208chr232540 1205 395 1236 --23072 2875
NM_032217chr421196 455 --41132 555 200 93 --
NM_032221chr2051669 1419 729 678 199 ----1358
NM_032231chr151305 ------
NM_032242chr353304 2510 2291 1107 1041 12551 ----
NM_032246chr1561355 1300 1087 958 929 314 11107 ----
NM_032250chr91293 168 ----
NM_032268chr1652588 2479 2159 510 125 --32676 2628 2182 --
NM_032271chr1631440 288 173 --2302 92 --
NM_032281chr1933141 1925 637 1721 ----
NM_032291chr151562 1489 1415 542 517 11635 --21678 295
NM_032312chr21102 ------
NM_032321chr262817 2785 1106 734 490 171 ----12599
NM_032329chr264008 3800 3118 1497 755 222 1828 23450 857 --
NM_032352chr1431178 948 29 --21237 540 --
NM_032373chr10105406 5265 5026 4723 3801 1898 1859 194 168 134 24006 631 11651 --
NM_032408chr731055 1044 492 ------
NM_032410chr831072 938 107 ----1331
NM_032435chr131925 1724 65 ----11933
NM_032439chr1021278 374 ------
NM_032440chr1082618 2478 2459 2015 1068 1051 913 356 ------
NM_032445chr1541636 786 591 35 12174 1622 --
NM_032446chr533034 1155 387 1407 13457 --
NM_032449chr152243 929 798 205 47 ------
NM_032457chr433732 3200 1270 --2176 134 --
NM_032458chrX72993 2938 2339 2093 1254 433 306 ----12314
NM_032466chr831700 1272 558 ------
NM_032468chr831700 1272 558 ------
NM_032499chr1531738 92 58 ----11355
NM_032505chr372569 1074 1030 982 858 823 530 --22782 1764 --
NM_032509chr821705 1694 12087 22122 385 12525
NM_032510chr1842415 2215 1953 301 1602 --12435
NM_032521chr2083225 3138 3094 3073 2573 956 906 649 12763 ----
NM_032538chr682771 2159 2034 1852 885 617 409 224 --12108 --
NM_032550chr1011061 ----11168
NM_032557chr45713 324 313 191 83 --1658 --
NM_032558chr961446 1418 571 517 146 24 --2565 439 --
NM_032560chr142800 137 ----2781 382
NM_032576chrY------1105
NM_032622chr431466 1421 249 21602 345 ----
NM_032626chr162278 251 ------
NM_032632chr1421327 1243 2458 35 11617 11452
NM_032663chr1251468 629 600 571 252 21749 621 11644 11727
NM_032682chr333320 2940 2848 --1197 21086 625
NM_032717chr451099 731 237 128 110 ------
NM_032737chr194937 908 410 34 ------
NM_032765chr54851 659 176 73 ------
NM_032778chr372671 2575 2524 2276 904 751 666 1111 22815 2386 --
NM_032787chr32348 312 ------
NM_032796chrX1566 1705 1153 --
NM_032800chr152455 1910 1902 874 97 --32013 1776 396 --
NM_032801chr1142307 797 745 717 --22470 924 --
NM_032804chr1052469 979 319 94 69 1675 ----
NM_032810chr1051534 1287 1168 1120 605 --1466 --
NM_032813chr1331127 122 108 ----1889
NM_032826chr763484 3408 1229 1020 643 259 33717 3685 861 23770 665 --
NM_032828chr1963309 1857 1301 964 903 806 34279 3741 1079 53065 1744 1388 1106 832 1329
NM_032833chr132596 616 462 --1629 1707
NM_032837chr1772091 2053 2045 734 606 518 341 ------
NM_032840chr123992 123 89 1751 ----
NM_032846chr1441236 499 409 353 1529 31514 1219 549 --
NM_032857chr151208 ------
NM_032859chr1393965 3935 3658 2611 1473 1162 750 490 158 --1824 --
NM_032873chr1142806 1789 1150 599 --13143 --
NM_032892chr151348 ------
NM_032900chr1083755 3483 3369 3359 2919 2726 2540 1331 11575 --13562
NM_032905chr101833 --1808 --
NM_032906chr41227 --1165 --
NM_032932chr1765867 5467 5247 1920 1729 936 12005 46393 2526 2428 348 15068
NM_032947chr541244 960 838 151 --1411 1315
NM_032961chr461375 1162 1114 942 936 271 ------
NM_032968chrX144228 3759 3745 3533 3433 3287 3202 3134 3087 2950 770 691 409 398 1818 1591 --
NM_032969chrX144228 3759 3745 3533 3433 3287 3202 3134 3087 2950 770 691 409 398 1818 1591 --
NM_032973chrY154220 3751 3737 3529 3429 3282 3197 3129 3082 2945 2684 770 691 409 398 --1591 --
NM_032975chr1853328 2907 2414 2379 1173 13022 11380 --
NM_032978chr1821034 431 --11097 --
NM_032979chr1821034 431 --11097 --
NM_032980chr1853328 2907 2414 2379 1173 13022 11380 --
NM_032981chr1821034 431 --11097 --
NM_032982chr762119 2046 1787 1780 943 152 --197 --
NM_032983chr772933 2860 2601 2594 966 788 185 --1911 --
NM_032998chr12217 81 ------
NM_032999chr771100 918 426 380 232 145 106 --21106 125 --
NM_033000chr771100 918 426 380 232 145 106 --21106 125 --
NM_033001chr771100 918 426 380 232 145 106 --21106 125 --
NM_033014chr921571 642 --11050 --
NM_033017chr781679 1441 1328 1058 684 646 142 91 --2557 76 --
NM_033020chr184838 3988 3771 3360 1940 1454 673 143 24349 1357 31130 611 493 --
NM_033023chr721219 1155 ------
NM_033030chr271233 1115 1023 491 456 263 194 1582 ----
NM_033056chr103600 232 192 --199 --
NM_033081chr2021081 375 ------
NM_033087chr921379 972 --11189 --
NM_033119chr165925 913 686 343 73 ----1635
NM_033121chr1261633 1554 1378 544 503 285 --1496 --
NM_033125chr6142 ------
NM_033132chr1311979 ----22219 521
NM_033133chr173931 346 102 1668 ----
NM_033135chr1132448 1794 191 --12035 --
NM_033136chr541809 1377 1203 545 --1355 --
NM_033137chr541809 1377 1203 545 --1355 --
NM_033138chr731696 1532 411 12187 1257 --
NM_033139chr731696 1532 411 12187 1257 --
NM_033140chr731696 1532 411 12187 1257 --
NM_033143chr4124101 3876 3780 2910 1712 1327 965 892 650 382 276 163 14596 13678 1175
NM_033157chr731696 1532 411 12187 1257 --
NM_033181chr643070 1470 565 396 1102 13391 33199 2832 1168
NM_033207chr1062656 2616 2158 1777 1753 1658 22175 756 12577 --
NM_033211chr531780 714 408 ------
NM_033224chr7138053 7506 7206 6835 5018 2538 2181 1987 1523 1488 1156 813 451 37951 7239 5190 ----
NM_033225chr863007 2701 1156 177 155 128 --12492 --
NM_033255chr131473 --1100 --
NM_033272chr23320 81 65 ------
NM_033274chr532835 769 419 --13025 12286
NM_033285chr883844 3578 3120 1793 1221 1191 893 463 11325 33518 1530 1284 --
NM_033290chrX63138 2925 1451 847 632 162 ------
NM_033300chr13531 208 88 11249 ----
NM_033331chr943403 3296 3138 3000 ------
NM_033360chr12104374 4013 3280 3180 1750 1435 1050 725 549 25 --1253 --
NM_033364chr341955 1645 654 563 1370 ----
NM_033387chr922691 1724 --42385 742 570 103 1590
NM_033419chr1751528 368 282 235 21 11418 ----
NM_033425chr1173405 3044 1256 1000 970 666 249 --33274 3098 255 --
NM_033429chr1542712 2540 2191 716 33109 2689 423 ----
NM_033430chr443680 3480 1253 49 43726 3687 3503 796 11409 11449
NM_033437chr443680 3480 1253 49 43726 3687 3503 796 11409 11449
NM_033495chrX----2925 35 --
NM_033505chr2116726 6669 4989 4796 4278 4188 2561 2010 1547 1195 1157 12255 22030 1829 --
NM_033512chr83590 178 69 --32993 1205 696 --
NM_033535chr431109 923 26 1153 ----
NM_033546chr18149 ----1151
NM_033550chr2011513 12316 11815 1768
NM_033551chr512961 ----2698 576
NM_033631chr152914 1062 878 486 25 21022 471 ----
NM_033632chr421218 361 ----1379
NM_033642chrX--1110 2474 139 --
NM_033644chr51317 21679 645 ----
NM_033645chr51317 21679 645 ----
NM_033656chr21115750 5586 5539 4992 4543 4531 4275 3787 1858 391 116 24137 1968 35136 4120 1654 14259
NM_048368chr182313 297 ------
NM_052832chr842639 2368 1153 307 136 1737 1280
NM_052834chr1822489 863 1495 ----
NM_052840chr1511117 ------
NM_052849chr151657 ------
NM_052854chr111446 ------
NM_052864chr441962 555 542 308 11857 ----
NM_052867chr132987 510 ------
NM_052877chr1187 1130 153 --
NM_052879chr1243432 3335 1477 261 12776 ----
NM_052885chr1264592 4503 3866 1969 1447 1161 11222 --33891 3601 3171
NM_052886chr841698 520 206 46 --11428 --
NM_052900chr871705 1570 1482 1331 654 600 192 2476 179 ----
NM_052905chr251369 1167 584 440 249 ----1577
NM_052907chr1253474 819 768 663 358 14172 13763 11072
NM_052910chr1361576 1393 1365 637 556 345 12103 ----
NM_052911chr183943 924 207 ------
NM_052913chr631046 911 24 --1980 --
NM_052918chr1033663 3482 737 --33700 3175 3147 --
NM_052927chr541582 1488 815 472 ------
NM_052937chr872125 1962 1688 1031 638 580 451 ------
NM_052944chr16189 ------
NM_052954chr2192077 2042 1961 1771 687 653 401 206 63 --1161 --
NM_053016chr9197618 7244 6908 6288 6040 5939 5761 5433 5255 5168 5142 5096 5037 2709 1892 1750 1134 828 697 36706 5716 3102 25707 2224 27196 4869
NM_053023chr1152652 2600 2173 1152 411 1218 --12392
NM_053024chr341395 1101 421 342 --1169 --
NM_053043chr755260 4888 4644 1174 600 25741 5535 --14260
NM_053046chr191557 ------
NM_053053chr11901 --2818 415 --
NM_053056chr1132446 2065 866 --22262 922 --
NM_053064chr1492612 2540 2507 2045 818 701 497 304 265 1555 ----
NM_053280chr112190 157 ----1169
NM_053281chrX1270 ----1368
NM_054027chr521625 535 12124 ----
NM_054110chr31702 1979 ----
NM_054111chr64958 821 808 113 ----1733
NM_057159chr931419 1111 1022 ------
NM_057169chr1253087 2746 2573 2100 85 --1588 --
NM_057170chr1253087 2746 2573 2100 85 --1588 --
NM_057175chr462181 2022 1698 903 371 135 21949 861 ----
NM_057182chr192500 89 ------
NM_057749chr82991 77 ------
NM_058170chr141449 1428 367 294 ----1581
NM_058172chr451749 1144 400 151 145 1544 11854 1190
NM_058241chr241866 1610 864 242 ------
NM_058241chr241866 1610 864 242 ------
NM_078470chr1052702 1045 332 317 79 1258 1363 12634
NM_078471chr1721216 1156 --2474 258 --
NM_078487chr932717 2696 233 12052 --13329
NM_078625chr65545 460 387 157 34 ----11030
NM_078629chrX2585 90 ------
NM_078630chrX2585 90 ------
NM_080491chr1153108 3042 2414 196 105 2318 111 13931 --
NM_080546chr962342 2324 649 542 439 235 --12136 --
NM_080597chr1811098 --184 --
NM_080604chr62694 104 ------
NM_080629chr121079 400 ------
NM_080630chr121079 400 ------
NM_080645chr652003 1512 467 454 170 --11836 --
NM_080654chr1131078 99 78 --285 51 11150
NM_080664chr1431977 217 21 --1225 --
NM_080666chr1431594 507 359 ------
NM_080676chr2053077 2862 2821 2162 1219 --11013 --
NM_080683chr43176 123 68 ------
NM_080684chr43176 123 68 ------
NM_080685chr43176 123 68 ------
NM_080723chr621153 391 ----1903
NM_080732chr191557 ------
NM_080737chrX21239 157 --31374 1258 523 --
NM_080759chr1362578 2547 2376 1882 1627 148 ------
NM_080760chr1362578 2547 2376 1882 1627 148 ------
NM_080764chr2243112 998 646 304 --12897 --
NM_080867chr14104221 4131 3646 3099 1822 1816 702 131 120 87 --55096 4107 1464 905 230 --
NM_080872chr8113651 3563 3112 3098 2943 2848 2598 2564 1278 672 649 33192 1152 212 23540 78 1419
NM_080874chr421741 44 ------
NM_080881chr51170 ------
NM_100264chr102670 323 ------
NM_100486chr102670 323 ------
NM_130386chr181508 --2623 543 1151
NM_130387chr331204 1013 64 ------
NM_130391chr973492 3044 3010 2827 1147 770 28 12761 13316 --
NM_130392chr973492 3044 3010 2827 1147 770 28 12761 13316 --
NM_130393chr973492 3044 3010 2827 1147 770 28 12761 13316 --
NM_130436chr2172413 1962 1915 1909 1865 1112 291 ------
NM_130438chr21112990 2539 2492 2486 2442 868 456 401 301 222 211 ------
NM_130440chr121589 494 --11537 11315
NM_130469chr142770 726 ------
NM_130797chr72613 38 --11804 --
NM_130808chr3------171
NM_130846chr1251036 860 758 727 713 1296 ----
NM_133170chr2088008 6334 5826 2952 2859 2473 1316 413 37642 6927 2500 17416 17608
NM_133264chr1783823 3649 3427 3029 2691 1468 1249 941 11152 1284 --
NM_133265chrX32339 1342 914 23020 3010 22719 2237 --
NM_133334chr475193 4300 1421 1047 694 534 109 --34852 3981 525 170
NM_133367chr673463 3375 2862 2851 1304 1238 1084 13368 13158 1831
NM_133370chr483209 1382 1059 1026 949 734 383 99 13566 11109 12380
NM_133372chr582833 2791 2599 2521 2400 2391 280 133 ------
NM_133378chr22633 266 ------
NM_133432chr22633 266 ------
NM_133433chr53677 600 210 ------
NM_133437chr22633 266 ------
NM_133445chr963789 3507 2812 2419 1047 936 ------
NM_133473chr1951834 1817 1515 719 207 21881 154 11541 --
NM_133474chr431443 1053 432 ------
NM_133477chr473171 3133 2760 2407 833 772 340 --12147 --
NM_133478chr231854 641 315 1843 12438 --
NM_133486chrX188 ----1116
NM_133496chr1104046 3970 3656 3604 3521 3481 2832 1718 1656 1335 --23645 3493 --
NM_133499chrX1317 ------
NM_133503chr122766 484 --2650 112 --
NM_133504chr122766 484 --2650 112 --
NM_133505chr122766 484 --2650 112 --
NM_133506chr122766 484 --2650 112 --
NM_133507chr122944 662 1155 3828 290 38 --
NM_133638chr531183 1007 560 ------
NM_133646chr275436 5365 5026 4894 4489 4481 4424 1511 24453 158 --
NM_133647chr1563875 3363 3346 2703 2590 578 13305 --22869 1168
NM_134265chr1741098 1010 958 902 ------
NM_134428chr91247 --1103 --
NM_138270chrX63317 3220 1278 1235 1082 136 --23342 1117 23197 709
NM_138286chr1984101 3911 3819 3659 3614 2657 1098 590 ------
NM_138288chr1441923 1773 408 342 11802 1424 --
NM_138292chr1173509 3269 2825 2778 2556 959 678 1359 1796 --
NM_138316chr1031314 478 159 --1403 --
NM_138333chr972660 2265 1974 1018 1012 490 157 --1510 --
NM_138335chr44641 628 272 47 ------
NM_138340chr183565 551 220 ----1683
NM_138344chr141336 ------
NM_138357chr10----1108 11207
NM_138389chr41196 ------
NM_138395chr221048 415 ------
NM_138396chr122774 289 ------
NM_138423chr1532229 2192 892 --32236 772 56 11787
NM_138444chr1343751 1998 492 278 --34212 3503 3417 --
NM_138448chr21164 ------
NM_138459chr621191 1087 13269 23579 3067 12945
NM_138468chr2105867 5726 5617 4667 4270 2122 1707 1109 729 231 22301 1472 35990 1072 919 12074
NM_138473chr1284554 4363 4067 3994 1950 1757 1302 409 --12030 13331
NM_138477chr15--1603 ----
NM_138492chr53322 265 32 11354 ----
NM_138494chr752578 2153 1123 809 633 11791 --12567
NM_138569chr61204 --1248 --
NM_138572chr633250 2788 2693 21142 250 ----
NM_138576chr1444569 4520 1236 1226 24780 3173 11577 --
NM_138609chr51404 ------
NM_138610chr51404 ------
NM_138621chr263831 3280 2877 2716 2612 837 --13141 13731
NM_138633chr641617 1488 1442 573 ------
NM_138638chr1422368 2284 1704 11571 --
NM_138694chr663693 3470 2253 1312 740 543 23351 257 ----
NM_138701chr72225 81 ------
NM_138713chr16138230 7919 7468 6643 6154 5514 5499 5115 3136 2817 2444 1492 131 16777 25708 1610 47989 7459 2118 683
NM_138714chr16138230 7919 7468 6643 6154 5514 5499 5115 3136 2817 2444 1492 131 16777 25708 1610 47989 7459 2118 683
NM_138730chr61314 1130 --193
NM_138731chr14103873 3569 3524 3464 3394 3361 2977 2649 1336 295 11244 1747 1221
NM_138771chr721456 339 --11591 --
NM_138782chr552391 2042 1701 670 51 ------
NM_138798chr2132 ----1111
NM_138799chr221944 1470 ------
NM_138927chr214806 756 346 187 ------
NM_138929chr122569 489 --1265 --
NM_138930chr122569 489 --1265 --
NM_138959chr156792 6374 5294 4760 915 35909 5434 1124 15122 --
NM_138970chr1442266 1885 1590 348 1861 146 12315
NM_138971chr1163440 3122 903 883 269 136 --11087 1861
NM_138971chr1163440 3122 903 883 269 136 --11087 1861
NM_138972chr1163440 3122 903 883 269 136 --11087 1861
NM_138972chr1163440 3122 903 883 269 136 --11087 1861
NM_138973chr1163440 3122 903 883 269 136 --11087 1861
NM_138973chr1163440 3122 903 883 269 136 --11087 1861
NM_139015chr1241424 1245 1105 1098 ------
NM_139035chrX2585 289 --1302 --
NM_139045chr93598 286 102 --161 --
NM_139048chr33859 851 226 ------
NM_139057chr1562828 2316 1057 518 463 198 --22248 959 --
NM_139062chr171131 --1439 --
NM_139072chr22701 138 ----1238
NM_139076chr461167 1007 928 109 71 62 --11191 --
NM_139131chr112603 160 ------
NM_139132chr112849 112 1219 ----
NM_139164chr551299 1211 978 585 87 --31432 1424 299 --
NM_139168chr521341 399 ------
NM_139169chr1062296 2150 1677 1577 400 165 21825 130 11517 --
NM_139201chr122701 178 ------
NM_139207chr122724 718 --1159 1185
NM_139239chr191121 --1196 --
NM_139246chr952226 2162 859 844 431 2425 176 1353 --
NM_139276chr1732385 1549 139 1704 1394 159
NM_139283chr1241001 628 543 195 31716 758 415 ----
NM_139312chr102349 68 2604 316 ----
NM_139321chr2063693 1586 846 717 658 199 11444 23332 1700 --
NM_144563chr22213 96 1280 ----
NM_144563chr22213 96 1280 ----
NM_144568chr14----1599 --
NM_144570chr1622376 683 --2588 489 --
NM_144571chr456669 6382 6133 2166 1383 36594 5687 4568 16617 --
NM_144574chr142542 176 ------
NM_144578chr1475427 4487 3769 3564 1562 1140 381 15323 25264 4307 14091
NM_144582chr272055 1999 1928 1755 1013 562 538 12139 12019 --
NM_144590chr1042266 2166 2106 765 2787 683 22379 54 --
NM_144595chr131900 ------
NM_144599chr1544875 4026 1455 370 --14591 --
NM_144600chr1641510 303 212 115 ------
NM_144609chr1711144 --21279 943 --
NM_144610chr171391 --1455 --
NM_144628chr202860 698 1254 1868 --
NM_144632chr252039 805 367 193 134 12122 ----
NM_144635chr321256 1220 ------
NM_144643chr41392 ------
NM_144664chr1152483 1956 669 468 368 12389 ----
NM_144721chr452163 2075 509 420 404 22135 68 ----
NM_144726chr511028 ------
NM_144732chr194984 444 436 75 ------
NM_144736chr21259 --123 --
NM_144767chr1574289 4183 3917 3414 3080 1240 812 ------
NM_144778chr1332187 757 480 ----12634
NM_144963chr832515 2089 662 12540 2222 35 12251
NM_144973chr1274971 4557 4391 3559 2060 896 500 11746 1528 14140
NM_144979chr4--1527 1270 --
NM_145000chr54398 169 162 89 ------
NM_145025chr6255 21 1262 1286 --
NM_145052chrX51063 861 430 67 58 1392 ----
NM_145055chr1862693 1099 1013 407 295 264 11471 1561 --
NM_145112chr1431004 447 144 ------
NM_145113chr1431276 416 188 ------
NM_145115chr732289 1593 673 --1715 --
NM_145117chr11103020 2919 2855 2681 2648 2620 2588 2566 2060 827 --1858 --
NM_145170chr102160 27 --167 --
NM_145176chr632241 2154 1042 --3498 417 275 13328
NM_145203chr133841 810 246 ------
NM_145206chr1042075 595 251 163 --12106 --
NM_145235chr10----1151 --
NM_145251chr1461272 470 444 198 174 35 1529 ----
NM_145259chr2197011 6142 6041 5770 5277 5182 4993 4423 2820 2277 2072 1800 1790 1672 1649 1334 1205 580 322 16923 31419 1266 94 24531 2409
NM_145263chr432404 191 81 1358 22111 843 --
NM_145268chr7192 21027 110 ----
NM_145284chrX42388 1803 501 102 --11929 --
NM_145291chr42464 366 ------
NM_145296chr191616 187 ----
NM_145303chr62474 364 ------
NM_145313chr10----1298 --
NM_145316chr62753 699 ------
NM_145331chr61184 --1633 --
NM_145332chr61332 --2781 76 --
NM_145333chr61332 --2781 76 --
NM_145341chr1021245 587 ------
NM_145647chr81187 ------
NM_145649chr622528 815 12252 1869 --
NM_145655chr622528 815 12252 1869 --
NM_145686chr233374 3094 2875 ----31185 901 250
NM_145687chr233374 3094 2875 ----31185 901 250
NM_145690chr871921 1720 1456 565 132 120 24 ------
NM_145693chr211011 ------
NM_145698chr1051455 858 634 309 251 21752 223 12007 --
NM_145714chr162376 265 ------
NM_145728chr1562086 672 600 282 229 112 11796 --12148
NM_145735chr1332131 1868 340 12156 12376 --
NM_145753chr341572 1424 1091 1028 ------
NM_145793chr106915 880 849 770 612 374 ------
NM_145808chr782941 2633 2528 2074 1102 481 357 208 186 1463 --
NM_147150chr963798 3444 2949 2471 942 659 --13325 --
NM_147156chr1031318 1243 1209 --1486 --
NM_147157chr92884 790 ------
NM_147171chr7----1392 --
NM_147175chrX31470 1381 682 --2667 660 --
NM_147181chr41531 1998 --150
NM_147182chr41531 1998 --150
NM_147183chr41531 1998 --150
NM_147185chr7----1392 --
NM_147188chr1541273 1258 516 463 --143 --
NM_147189chr842021 1953 1714 627 1208 12252 --
NM_148174chr872253 2218 2140 1917 1624 1501 565 --22231 1453 --
NM_148414chr162459 348 ------
NM_148415chr162399 288 ------
NM_148416chr161376 ------
NM_148894chr461269 1223 911 476 430 388 ----1843
NM_148898chr74791 766 277 88 ------
NM_148899chr74791 766 277 88 ------
NM_148921chr1711994 1723 11619 11921
NM_148923chr181210 ------
NM_148957chr1352217 893 839 496 377 1265 22491 2178 --
NM_148977chr1031314 478 159 --1403 --
NM_148978chr1031314 478 159 --1403 --
NM_152132chr14----138 --
NM_152233chr1421628 334 ----11235
NM_152253chr2231176 898 126 12656 33613 3394 1432 1921
NM_152261chr1242102 1966 1720 579 ------
NM_152263chr175910 5794 2219 1472 889 707 33 44947 4123 1952 1075 1579 1374
NM_152265chr131075 354 68 --11244 1483
NM_152275chr251877 814 716 704 198 11517 ----
NM_152277chr52866 525 ------
NM_152280chr183481 2834 2302 1244 980 309 225 195 ------
NM_152282chr311408 --1385 --
NM_152296chr192282 241 ------
NM_152305chr352060 2052 1796 603 260 ------
NM_152330chr1472465 2447 2310 2272 2184 1965 865 ----1395
NM_152332chr14122495 2406 2356 2036 1953 939 871 863 721 514 456 307 1406 21139 557 --
NM_152344chr1741172 622 399 304 ------
NM_152388chr243870 3583 3352 2745 --1583 --
NM_152407chr573078 2340 2193 838 804 484 147 --1855 --
NM_152409chr553108 2886 2815 2512 2496 21319 1012 --12336
NM_152411chr71347 2924 620 ----
NM_152414chr811390 ------
NM_152418chr852006 1885 810 688 73 ------
NM_152422chr91611 ----21662 380
NM_152423chrX3595 269 38 --21496 400 --
NM_152424chrX33400 1569 202 14064 --1169
NM_152429chr1041457 1332 1048 407 --11317 --
NM_152437chr1242333 2325 2003 683 --1330 --
NM_152447chr142364 53 ------
NM_152448chr152397 38 ------
NM_152450chr1551947 1440 1390 279 151 12137 --1203
NM_152451chr152807 25 ----1865
NM_152487chr121301 949 1266 21357 496 11403
NM_152512chr222560 471 --1609 --
NM_152519chr251965 1524 1495 1390 102 --22022 1615 22076 853
NM_152522chr25824 683 262 250 79 ------
NM_152527chr231845 583 299 21865 492 22151 851 --
NM_152529chr264034 3942 2731 970 624 173 23172 463 21778 1563 --
NM_152536chr371151 1136 1086 915 878 475 370 ------
NM_152538chr341231 1182 537 226 ----1518
NM_152545chr4----1643 --
NM_152549chr51454 ----1181
NM_152556chr742077 2045 755 738 --21024 145 22484 1853
NM_152574chr9------1135
NM_152581chrX31360 1331 435 175 11193 --
NM_152588chr1211620 ----21450 1185
NM_152594chr1531897 1549 600 ------
NM_152605chr191977 --21110 895 --
NM_152608chr1122531 2381 2105 2036 1832 860 707 563 461 292 279 205 142 --21932 1864
NM_152622chr521383 300 ----12376
NM_152624chr5146901 6537 6121 5539 5141 2975 1853 1681 1511 1321 1019 878 349 203 12282 26854 2444 --
NM_152629chr973652 3587 3328 2850 1049 919 356 --21625 747 13895
NM_152630chrX1452 21143 999 --11332
NM_152636chr1142784 1087 962 83 12425 ----
NM_152641chr1252565 2374 2168 799 757 1597 11161 --
NM_152665chr141299 967 877 74 ------
NM_152667chr2041371 1312 1009 109 11391 ----
NM_152678chr332681 2406 235 12626 ----
NM_152682chr421597 1254 1675 ----
NM_152685chr51389 ------
NM_152688chr63804 199 109 ------
NM_152695chrX62327 782 770 391 182 129 21638 355 1716 --
NM_152699chr393506 3276 3269 2934 2338 1117 926 485 86 2913 492 ----
NM_152704chr131944 --2880 263 --
NM_152716chr1181486 1476 1266 1244 254 239 220 207 --2633 607 --
NM_152723chr113810 332 185 ------
NM_152724chr1012694 12303 --2783 731
NM_152727chr161300 --198 --
NM_152734chr6115491 4768 4043 2202 2142 2130 1778 1768 932 916 452 3829 408 239 15128 13788
NM_152736chr61684 ------
NM_152748chr7156 ----1505
NM_152754chr763876 3776 3172 2746 1157 637 1376 ----
NM_152755chr73586 529 226 ------
NM_152756chr543783 2910 1215 296 ------
NM_152765chr842388 1607 588 261 ------
NM_152774chr732724 880 292 --22304 840 1911
NM_152780chrX51295 1232 843 413 230 ------
NM_152787chrX33633 3422 2761 21399 712 11511 --
NM_152789chr751482 1348 1293 1268 469 ------
NM_152793chr754735 4420 1849 1251 221 --1792 --
NM_152829chr731224 943 358 --158 --
NM_152835chr142699 867 570 100 --12075 --
NM_152838chr2043410 3398 3210 2222 1758 ----
NM_152860chr124457 354 299 87 ------
NM_152896chr91746 1710 ----
NM_152924chr1566908 6758 5861 2735 2047 1955 25497 1876 26250 4360 16831
NM_152989chr1231895 575 337 -