TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4651
miRNA Sequence: CGGGGUGGGUGAGGUCGGGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52997 528 ------
NM_000024chr51380 --1444 --
NM_000034chr162162 54 134 ----
NM_000037chr8122489 2275 2237 2071 2062 1848 1666 1625 1609 665 586 47 --52082 2032 1838 1704 548 --
NM_000038chr511362 1269 11848 1274
NM_000055chr31348 ------
NM_000074chrX--1141 3850 783 77 --
NM_000080chr17126 --2616 596 --
NM_000084chrX106199 5385 5187 5125 4539 4344 2505 2143 1336 1248 --47015 4422 1820 924 14533
NM_000088chr1761205 1132 524 516 378 34 --31122 496 401 --
NM_000092chr274463 3470 2977 2968 2821 2802 985 21254 1161 ----
NM_000093chr962199 1863 320 274 194 119 32093 461 231 1732 1249
NM_000103chr154991 443 66 23 ------
NM_000112chr535026 3970 1924 --11855 14257
NM_000118chr96658 619 329 309 210 21 --189 --
NM_000125chr642717 1306 485 96 13902 21477 1456 --
NM_000129chr64992 459 385 214 ------
NM_000135chr162796 261 ------
NM_000138chr1541851 921 299 169 --12453 --
NM_000151chr1761831 1730 1623 1412 305 108 --11739 11296
NM_000168chr732697 2619 1237 12931 32109 281 242 13256
NM_000176chr533416 3267 1280 12536 --22990 2796
NM_000189chr22391 71 --11581 --
NM_000192chr121119 --2546 253 --
NM_000199chr1761022 1006 973 843 320 114 31086 52 30 1978 --
NM_000216chrX23172 1026 --13222 1343
NM_000217chr1255178 4237 3688 1000 785 --11334 23525 1815
NM_000237chr821558 141 ------
NM_000245chr74741 489 407 233 22020 1670 41674 1384 654 602 1747
NM_000248chr31506 --12577 --
NM_000252chrX--11434 --11008
NM_000260chr112505 203 1516 3208 100 72 --
NM_000264chr943226 1096 860 782 --3249 58 52 --
NM_000267chr1733295 2670 125 13449 13482 --
NM_000276chrX3446 303 269 21981 457 3872 461 431 --
NM_000278chr1071895 1811 1786 1734 843 784 165 1133 61846 1836 346 250 231 73 32139 138 122
NM_000282chr13295 28 ------
NM_000298chr15689 245 96 81 32 142 2465 46 --
NM_000304chr172876 381 ----1426
NM_000314chr1012073 23208 2050 32448 1182 410 12672
NM_000321chr132428 36 ------
NM_000330chrX52273 2181 1990 1513 198 11957 1655 12010
NM_000332chr676391 6154 5873 4947 2586 912 248 25687 2116 ----
NM_000333chr331123 332 59 ------
NM_000335chr331467 1396 564 21709 265 --11577
NM_000337chr566126 5567 5488 1337 681 290 31929 1309 1278 1282 46079 5755 954 278
NM_000346chr17--11342 11372 --
NM_000352chr11------126
NM_000361chr202116 53 21898 606 --11316
NM_000362chr2273121 2813 2412 2301 1390 1207 226 12796 31452 357 187 33177 378 23
NM_000368chr974269 3742 3688 3220 1569 689 204 11610 24373 3693 --
NM_000376chr12112702 2623 2495 2353 1939 1168 1029 591 387 139 95 31162 1061 506 42712 882 483 127 32562 2524 479
NM_000389chr661450 1414 529 413 267 122 1939 31134 974 147 11130
NM_000391chr1121596 393 --21246 472 --
NM_000398chr225801 634 71 62 27 142 4731 286 260 32 --
NM_000399chr102936 153 --185 1324
NM_000404chr33165 144 34 ------
NM_000408chr2180 12248 11201 --
NM_000411chr2142772 2266 547 354 --12540 12547
NM_000425chrX4709 596 166 130 --1556 1607
NM_000430chr1733485 3473 2755 169 ----
NM_000435chr1921006 209 --4995 734 644 214 1640
NM_000442chr173353 161 24 11053 ----
NM_000445chr83247 231 212 --41002 881 869 296 --
NM_000451chrX3467 121 50 --21420 1345 --
NM_000461chr343390 848 428 294 --22892 377 14100
NM_000474chr72259 250 ------
NM_000476chr911128 21260 950 41080 294 90 44 21136 40
NM_000478chr14618 601 567 146 1524 1151 --
NM_000482chr11156 --2130 28 --
NM_000489chrX33318 1218 947 11120 ----
NM_000503chr831390 1335 538 ------
NM_000522chr7------1854
NM_000530chr17771 447 370 364 302 285 251 --2406 202 1211
NM_000533chrX3754 711 587 ------
NM_000539chr331517 1098 1031 --145 175
NM_000540chr191138 --126 133
NM_000546chr1731191 1008 472 11113 21117 41 --
NM_000554chr1933324 2231 682 --2837 157 --
NM_000555chrX117645 7415 6003 5600 4999 4991 2167 1741 1623 514 229 --67659 6983 6788 5168 2688 2579 15762
NM_000557chr202360 58 138 ----
NM_000575chr22937 291 1195 ----
NM_000593chr61331 126 ----
NM_000598chr731039 1009 389 1464 1396 --
NM_000599chr2113643 3633 3555 3514 3316 3106 2989 2873 216 87 29 34067 3217 541 43494 3194 3161 40 54072 3476 1402 1309 76
NM_000602chr771005 996 969 500 320 304 208 --1535 --
NM_000612chr11153747 3570 3462 3173 2934 2414 1535 874 846 819 698 663 497 244 39 23430 373 32924 504 84 --
NM_000615chr11102944 2868 1841 1175 1076 1032 931 813 561 282 21167 835 ----
NM_000618chr1265983 5970 5583 4229 1260 1025 22494 2345 25378 495 15172
NM_000618chr1265983 5970 5583 4229 1260 1025 22494 2345 25378 495 15172
NM_000620chr1251948 1584 837 802 145 11939 21800 250 --
NM_000678chr203579 299 135 1601 1619 --
NM_000682chr281283 1247 1203 754 657 505 423 51 11812 1226 11468
NM_000693chr1521750 1394 11813 ----
NM_000719chr12216567 6455 6447 6437 6354 6347 5948 5237 5010 4300 4251 4066 2606 2267 2110 2004 667 568 554 300 161 45908 5387 5266 5257 24202 2353 16022
NM_000723chr1781230 1073 1057 610 604 477 284 234 31186 1109 547 41224 1204 688 681 1160
NM_000725chr124645 247 188 21 11011 --160
NM_000734chr12411 22 ------
NM_000738chr114947 804 754 21 ----130
NM_000757chr16880 851 610 327 316 87 --174 --
NM_000761chr1531361 973 402 --1450 --
NM_000795chr114431 170 115 65 --3724 269 39 --
NM_000799chr72434 63 1131 276 34 --
NM_000800chr521142 176 11186 --130
NM_000801chr2031061 1013 177 ----1114
NM_000808chrX61055 910 782 739 108 40 11042 ----
NM_000813chr544318 4195 2039 1818 13677 ----
NM_000814chr1553644 3380 1670 1291 393 ------
NM_000817chr21462 154 ----
NM_000827chr551838 1762 1689 455 202 --2574 460 156
NM_000831chr196034 6011 5609 5291 5122 4866 1304 522 112 --86041 5893 5004 4114 3889 3836 1631 1620 1492
NM_000832chr98862 775 756 711 333 131 89 21 --4874 720 140 110 195
NM_000833chr1621214 175 1578 --11163
NM_000836chr195942 756 622 197 143 --5746 640 324 311 26 1768
NM_000842chr113726 706 120 ------
NM_000875chr15135864 5853 2797 2043 1716 1693 1559 1489 1471 977 711 703 430 21977 1353 74964 4776 4630 1933 1478 1332 982 24318 1859
NM_000876chr651325 1314 940 73 51 --1168 --
NM_000891chr1743379 3284 1232 1155 --13489 --
NM_000899chr1253398 3144 3088 629 138 ------
NM_000922chr111220 --1168 --
NM_000934chr174712 525 135 52 --1531 --
NM_000944chr432217 1992 216 ------
NM_000945chr22685 22 ------
NM_000950chrX----21461 686 13040
NM_000957chr1----2213 173 --
NM_000964chr1771278 1269 1234 1072 362 303 97 --41215 1199 1050 40 --
NM_000965chr32928 307 ------
NM_000966chr124818 435 421 168 --31050 760 111 --
NM_000984chr172443 167 ----1177
NM_001001323chr121248 12829 1167 --
NM_001001331chr3102516 1952 1021 306 279 151 91 70 51 26 12651 --12042
NM_001001342chr1011236 --11070 11305
NM_001001344chrX92031 1902 1874 1831 1811 860 581 534 335 --31998 1635 866 --
NM_001001395chr1232709 2621 824 ----12716
NM_001001396chr153659 1777 1683 308 47 34214 589 190 33760 107 67 1594
NM_001001433chr2052707 2634 871 762 69 42591 2319 1023 979 ----
NM_001001502chr53378 236 171 --4569 527 457 57 1465
NM_001001549chr752254 971 907 548 404 ------
NM_001001550chr752254 971 907 548 404 ------
NM_001001555chr752254 971 907 548 404 ------
NM_001001557chr82742 664 --1233 --
NM_001001685chr17102366 2244 1849 1129 969 793 786 735 664 595 --52591 2580 1775 41 29 1911
NM_001001890chr2173917 3170 2898 1496 1421 251 217 21214 1050 ----
NM_001001971chr10267 31 ------
NM_001001994chrX1554 159 ----
NM_001001996chrX1554 159 ----
NM_001002233chr821616 531 ------
NM_001002257chr223017 607 23579 401 --12499
NM_001002762chr1052832 2800 1182 332 221 --82621 2153 2032 961 628 528 247 56 1353
NM_001002838chrX31760 1679 621 21812 1196 1348 --
NM_001002860chr1453580 3393 3118 1086 801 144 ----
NM_001002909chr1731654 586 265 1645 21914 270 11622
NM_001003652chr1888499 7723 7612 6349 5718 5476 2371 1611 16628 11538 1944
NM_001003665chr1113503 3451 3391 3200 2590 2495 2320 2251 782 622 435 11026 43559 3353 3154 2501 23093 524
NM_001003674chr1896907 6412 6210 5027 4917 4805 2275 1799 1398 12474 26470 4893 22678 1210
NM_001003675chr1896907 6412 6210 5027 4917 4805 2275 1799 1398 12474 26470 4893 22678 1210
NM_001003682chr121272 1254 1103 --1522
NM_001003694chr31593 1183 ----
NM_001003698chr641989 1737 1650 1429 21659 1528 ----
NM_001003699chr641989 1737 1650 1429 21659 1528 ----
NM_001003712chr121740 ------
NM_001003789chr2261144 460 434 427 384 119 --2261 94 --
NM_001003800chr931185 1126 186 146 11464 --
NM_001003810chr42691 87 ------
NM_001003940chr1563704 3462 3422 3012 2373 1455 13437 63647 2608 2601 2586 897 618 33643 3248 965
NM_001003942chr1563704 3462 3422 3012 2373 1455 13437 63647 2608 2601 2586 897 618 33643 3248 965
NM_001003943chr1563708 3466 3426 3016 2377 1459 13441 63651 2612 2605 2590 901 622 33647 3252 969
NM_001004317chr633238 931 350 --13496 --
NM_001004419chr1264346 4220 3552 2789 1804 581 24403 4303 11624 --
NM_001005158chr32337 58 ------
NM_001005159chr32337 58 ------
NM_001005209chr23510 504 71 1666 --1688
NM_001005271chr174986 849 89 26 --31102 183 99 --
NM_001005273chr174986 849 89 26 --31102 183 99 --
NM_001005353chr111076 --1368 --
NM_001005353chr111076 --1368 --
NM_001005404chr1793636 2879 1379 1342 1330 810 296 116 96 21600 1027 1134 12857
NM_001005415chr191395 --1438 --
NM_001005416chr191395 --1438 --
NM_001005463chr1011876 --11890 --
NM_001005502chr1241930 1086 471 34 33838 723 57 33969 3414 1852 --
NM_001005505chr371643 1137 536 387 322 212 76 21262 644 361 28 22 2591 35
NM_001005609chrX33356 3039 2320 1368 23552 3218 1609
NM_001005920chr164971 910 737 321 21061 814 3818 108 49 --
NM_001006115chr342664 2442 543 402 --32779 2348 716 1727
NM_001006617chr941333 279 271 74 --31327 296 249 --
NM_001006618chr91177 1224 ----
NM_001006619chr941333 279 271 74 --31327 296 249 --
NM_001006620chr941333 279 271 74 --31327 296 249 --
NM_001006621chr941333 279 271 74 --31327 296 249 --
NM_001006623chr252049 1983 1601 1002 236 22143 660 ----
NM_001006636chr21905 ----1197
NM_001007026chr123410 88 53 1497 2379 59 --
NM_001007097chr974592 4324 4041 3719 3602 1209 902 1238 24700 1349 31345 1340 1335
NM_001007156chr1551852 1673 1319 174 141 ----11858
NM_001007226chr17----11417 --
NM_001007227chr17----11417 --
NM_001007228chr17----11417 --
NM_001007229chr17----11417 --
NM_001007230chr17----11417 --
NM_001007559chr1821860 71 155 ----
NM_001008220chr5143860 3760 3550 3541 1068 1001 839 710 697 604 586 187 164 30 43668 2467 195 175 63658 3529 2572 890 878 199 33448 3348 718
NM_001008222chrX31222 212 131 11120 11137 --
NM_001008223chr123230 50 31 --3457 88 55 284 67
NM_001008392chr373407 2971 2854 2657 1147 678 334 12364 13417 11129
NM_001008410chr262111 2009 1939 851 748 538 --31944 499 408 2657 404
NM_001008529chr172384 362 21285 436 ----
NM_001008541chr1041495 1453 712 317 --1705 --
NM_001008541chr1041495 1453 712 317 --1705 --
NM_001008563chr92869 488 --2303 34 --
NM_001008564chr13--2754 91 ----
NM_001008701chr1952697 1190 1077 336 107 12953 32943 2646 329 12704
NM_001008860chr151252 2643 568 ----
NM_001008892chr151252 2643 568 ----
NM_001008894chr151252 2643 568 ----
NM_001009554chr444733 1425 854 106 ----13298
NM_001009554chr444733 1425 854 106 ----13298
NM_001009555chr4----1678 --
NM_001009566chr161320 1087 377 235 170 52 1325 2958 175 --
NM_001009571chr7----21703 1651 --
NM_001009584chrX2543 36 ----1116
NM_001009899chr3106433 6166 5286 5217 5204 2261 2217 2010 1905 1569 --45852 5291 2222 1414 --
NM_001009955chr11149 ----2425 139
NM_001009955chr11149 ----2425 139
NM_001009992chr131354 378 51 1549 11503 --
NM_001009993chr264431 4386 4379 3519 1206 659 --21476 1471 --
NM_001009996chr3--1147 1196 --
NM_001010861chr142245 860 53 41 ------
NM_001010862chrX43116 2773 2676 304 1312 ----
NM_001010986chrX175 12091 --1974
NM_001011538chr41779 ----1169
NM_001011554chr2052156 1881 531 414 144 --21898 1410 --
NM_001011658chrX1822 --1668 1828
NM_001011666chr776355 5232 5102 4772 1003 782 570 --24779 1441 24459 4454
NM_001011708chr21163 12397 ----
NM_001011885chr1531802 1148 1121 ------
NM_001012264chr149740 660 642 395 388 303 263 217 206 --1223 --
NM_001012329chr171982 1928 1541 734 698 114 23 --31660 1549 99 2141 136
NM_001012393chr11104652 1800 1459 1165 982 943 876 864 488 383 ------
NM_001012643chr19--2460 93 2376 126 182
NM_001012755chrX44516 1427 1044 99 44764 3161 938 206 31432 1269 493 --
NM_001012968chrX3389 322 311 ------
NM_001012977chrX31313 508 214 --4515 219 185 71 --
NM_001013031chr1072959 2949 2651 1337 1109 662 226 12575 1934 1394
NM_001013398chr731039 1009 389 1464 1396 --
NM_001013615chr141167 1098 1080 955 --21072 788 --
NM_001013620chr1277093 5997 5464 3067 2767 2729 1564 21374 988 22910 1074 --
NM_001013624chr173835 348 299 --3232 179 42 21158 988
NM_001013690chr1292375 1951 1720 658 651 497 432 354 252 --41914 1671 519 491 3914 443 380
NM_001013693chr1102491 2448 2393 2329 1980 1931 1921 837 775 241 12758 62644 2256 2161 1882 960 888 11863
NM_001013693chr1102491 2448 2393 2329 1980 1931 1921 837 775 241 12758 62644 2256 2161 1882 960 888 11863
NM_001013839chr1742197 1600 803 484 12548 2940 621 1617
NM_001014435chr165596 579 522 178 138 1455 1613 --
NM_001014796chr13146 79 60 --2160 153 --
NM_001014796chr13146 79 60 --2160 153 --
NM_001014797chr10128141 7891 7661 7302 6284 5846 5398 2814 2513 2210 1005 787 27885 5553 52229 1837 1805 1795 1056 --
NM_001014809chr42890 348 --3762 223 54 --
NM_001014839chr1--2856 119 3891 189 161 --
NM_001014841chr1--2856 119 3891 189 161 --
NM_001015053chr1721488 1176 --31528 514 499 1168
NM_001015877chrX1655 11229 ----
NM_001017368chr1752004 1727 803 331 143 --21720 355 1362
NM_001017371chr2------11328
NM_001017392chr194917 905 861 62 2998 305 --21344 1339
NM_001017395chr3103014 2648 1319 1223 1094 627 535 414 391 30 13362 ----
NM_001017440chr7197284 6918 6669 6520 6005 5947 5937 5894 3127 3014 2771 2461 2173 1689 898 592 517 382 332 47980 7142 4985 3234 76186 5597 3137 2543 698 499 388 1495
NM_001017535chr12112702 2623 2495 2353 1939 1168 1029 591 387 139 95 31162 1061 506 42712 882 483 127 32562 2524 479
NM_001017995chr5134673 4531 4494 3138 1633 861 651 639 473 295 254 175 166 24444 3183 74625 3246 3058 1833 1678 1668 1164 1765
NM_001017999chr131745 1528 931 --42129 1434 547 199 11534
NM_001017999chr131745 1528 931 --42129 1434 547 199 11534
NM_001018000chr131745 1528 931 --42129 1434 547 199 11534
NM_001018000chr131745 1528 931 --42129 1434 547 199 11534
NM_001018001chr131745 1528 931 --42129 1434 547 199 11534
NM_001018004chr152610 68 ------
NM_001018006chr152610 68 ------
NM_001018007chr152610 68 ------
NM_001018020chr152610 68 ------
NM_001018050chr22133303 3272 3223 2831 2407 2375 2364 2347 2244 1186 1133 723 531 22478 1232 12750 23190 1240
NM_001018052chr22133303 3272 3223 2831 2407 2375 2364 2347 2244 1186 1133 723 531 22478 1232 12750 23190 1240
NM_001018054chr141092 1078 978 248 ------
NM_001018057chr111507 --1243 11193
NM_001018064chr921799 1466 21596 397 ----
NM_001018065chr974833 4539 3885 2345 2320 1985 130 43727 3655 2219 2024 --15745
NM_001018066chr974833 4539 3885 2345 2320 1985 130 43727 3655 2219 2024 --15745
NM_001018067chr154329 4279 4004 1813 1747 --14052 --
NM_001018068chr154329 4279 4004 1813 1747 --14052 --
NM_001018069chr154329 4279 4004 1813 1747 --14052 --
NM_001018074chr533416 3267 1280 12536 --22990 2796
NM_001018075chr533416 3267 1280 12536 --22990 2796
NM_001018076chr533416 3267 1280 12536 --22990 2796
NM_001018077chr533416 3267 1280 12536 --22990 2796
NM_001018089chr1532513 2466 187 12566 23711 868 --
NM_001018108chr1531815 1404 211 21872 247 41762 911 515 190 11608
NM_001018111chr752998 2526 902 887 606 --1591 2565 55
NM_001020658chr1----1447 --
NM_001020658chr1----1447 --
NM_001020825chr51891 ----2465 271
NM_001024094chr533416 3267 1280 12536 --22990 2796
NM_001024226chr13882 722 25 1910 1914 --
NM_001024227chr13882 722 25 1910 1914 --
NM_001024228chr13882 722 25 1910 1914 --
NM_001024401chr1672807 1854 1083 865 705 407 350 --62265 1802 783 480 87 46 2460 436
NM_001024455chrX132346 1986 1945 793 564 458 413 348 309 198 48 35 23 1368 32406 2068 55 --
NM_001024649chr532177 1888 456 ------
NM_001024660chr3196 21153 180 11420 --
NM_001024666chrX1164 --1659 1564
NM_001024680chr2--11619 21383 1347 --
NM_001024688chr832153 690 300 ------
NM_001024807chr193304 272 115 1330 ----
NM_001024808chr1242412 2400 598 473 32299 1048 634 22405 847 1523
NM_001024809chr1771278 1269 1234 1072 362 303 97 --41215 1199 1050 40 --
NM_001024845chr13989 769 742 --4994 957 36 30 --
NM_001024858chr14152953 2701 2658 2292 2281 1822 1149 998 754 676 447 441 346 182 82 21022 910 32099 914 311 12212
NM_001024912chr1941647 748 184 38 21424 1294 2478 89 --
NM_001024948chr132878 1224 1077 ------
NM_001024957chr11----4224 56 49 31 --
NM_001024959chr3274 42 --1335 --
NM_001024960chr3274 42 --1335 --
NM_001025076chr1085640 5026 4959 4733 4144 4123 2269 1446 34773 4197 4016 11346 --
NM_001025077chr10116998 6384 6317 6091 5502 5481 2804 1334 437 169 156 46131 5555 5374 1178 32704 1198 459 --
NM_001025107chr1102322 2314 2265 2196 1713 1016 778 636 628 260 21887 907 ----
NM_001025107chr1102322 2314 2265 2196 1713 1016 778 636 628 260 21887 907 ----
NM_001025108chr222642 1085 13673 1720 --
NM_001025109chr13968 942 46 1127 2320 73 --
NM_001025205chr3--1347 3301 38 26 --
NM_001025266chr363751 1818 1489 453 417 97 --53955 3284 1823 107 102 14745
NM_001025366chr62521 345 ----1704
NM_001025366chr62521 345 ----1704
NM_001025367chr62521 345 ----1704
NM_001025367chr62521 345 ----1704
NM_001025368chr62521 345 ----1704
NM_001025368chr62521 345 ----1704
NM_001025369chr62537 361 ----1720
NM_001025369chr62537 361 ----1720
NM_001025370chr62521 345 ----1704
NM_001025370chr62521 345 ----1704
NM_001025580chrX53792 3601 3264 3192 595 --23847 3152 --
NM_001025616chr431675 634 348 ------
NM_001029858chr622375 190 13212 21027 492 --
NM_001029859chr1141625 1546 188 154 22392 894 42404 1523 987 882 12130
NM_001029861chr19384 30 23 --4794 740 173 121 151
NM_001029864chr2082462 2410 2181 2134 2090 718 343 199 12437 41570 1010 723 264 21956 827
NM_001029875chr552798 2588 2570 2274 1946 ----1513
NM_001029882chr12174 140 --2165 126 --
NM_001029882chr12174 140 --2165 126 --
NM_001029891chrX271 37 --1178 --
NM_001030006chr17112525 2407 2262 2234 1735 861 518 296 227 211 109 --32250 1883 218 11729
NM_001030007chr1642559 1536 1234 34 --22754 262 --
NM_001030059chr101298 --150 --
NM_001031690chr7113051 2861 2136 2096 1991 1972 1063 952 472 363 308 12851 32736 839 31 --
NM_001031695chr2285066 4594 4424 3972 3376 1646 1306 874 25170 734 34962 4938 4474 12050
NM_001031711chr551829 1766 1284 1213 1190 2626 328 2630 584 --
NM_001031738chr21150 141 --2141 46
NM_001031740chr171495 1430 1212 676 432 240 37 11660 1688 --
NM_001031801chr22----150 --
NM_001031804chr1674393 4241 1771 576 551 332 209 33105 1314 203 74398 2907 570 345 115 109 30 2341 102
NM_001032280chr641234 450 244 231 --257 22 --
NM_001032288chr2021447 516 --3622 583 404 --
NM_001032394chr652345 1807 929 495 24 ------
NM_001033044chr131325 738 200 147 11773 152
NM_001033045chr221564 1409 23305 597 13142 --
NM_001033056chr131325 738 200 147 11773 152
NM_001033059chr61230 1732 ----
NM_001033081chr131590 1357 1319 11259 1619 --
NM_001033082chr131590 1357 1319 11259 1619 --
NM_001033117chr374479 3576 3031 1922 1336 817 734 11709 21341 786 44738 3464 1714 797
NM_001033507chr141666 1561 1502 617 --11971 --
NM_001033551chr17174037 3937 3628 3599 3461 3213 3123 1439 1328 1277 498 378 366 333 313 82 49 33379 3243 1241 33383 1188 74 44043 3650 3202 1095
NM_001033561chr172320 39 --2839 325 --
NM_001033578chr832028 842 325 11856 ----
NM_001033602chr1352665 2505 959 878 522 11023 32561 2372 54 --
NM_001033677chr123353 128 73 --2158 145 1335
NM_001033756chr62455 279 ----1638
NM_001033756chr62455 279 ----1638
NM_001034025chr122123 46 1721 ----
NM_001034954chr1022295 1087 ------
NM_001034955chr1022295 1087 ------
NM_001034956chr1022295 1087 ------
NM_001034957chr1022295 1087 ------
NM_001035chr141048 378 357 168 11174 140 --
NM_001035003chr41544 --154 1988
NM_001035004chr41544 --154 1988
NM_001035254chr991842 727 698 616 516 409 172 141 92 3624 415 130 1500 --
NM_001035521chr22638 153 1552 ----
NM_001037131chr241163 173 130 96 1146 1120 --
NM_001037132chr731913 1703 384 ------
NM_001037133chr731913 1703 384 ------
NM_001037164chr7------1209
NM_001037317chr142245 860 53 41 ------
NM_001037331chr183864 390 245 ------
NM_001037332chr582006 1809 1633 1029 525 367 293 122 22089 314 22079 142 21570 306
NM_001037333chr582006 1809 1633 1029 525 367 293 122 22089 314 22079 142 21570 306
NM_001037334chr1842285 419 331 144 1111 --1510
NM_001037582chr451146 497 447 288 241 ------
NM_001037872chr21570 ------
NM_001037954chr1133267 840 42 ------
NM_001038493chr26463 426 241 190 52 43 --21252 246 --
NM_001038707chr151883 1531 714 524 344 ------
NM_001038707chr151883 1531 714 524 344 ------
NM_001039348chr231004 784 119 ------
NM_001039349chr231004 784 119 ------
NM_001039538chr242637 872 742 117 12959 ----
NM_001039547chr397622 7459 5447 2853 1859 1212 1078 1003 342 25270 5239 12858 --
NM_001039577chr133768 2838 940 14124 44221 3391 3012 843 1867
NM_001039590chrX43949 3615 1365 448 13626 --11389
NM_001039591chrX43949 3615 1365 448 13626 --11389
NM_001039615chr821760 101 11641 ----
NM_001039618chr1145932 4723 3715 35 --1435 --
NM_001039690chr1631597 908 124 --163 1383
NM_001039711chr15744 219 101 82 41 --4920 908 165 46 --
NM_001039712chr15744 219 101 82 41 --4920 908 165 46 --
NM_001039770chr392067 2037 1981 562 255 119 100 53 23 --11549 --
NM_001039771chr143835 226 196 --3818 205 115 1330
NM_001039802chr131315 378 127 ------
NM_001039840chrX73906 2317 1701 1670 1554 681 45 11711 ----
NM_001039877chr195803 795 755 547 222 1571 --1702
NM_001039888chr13788 752 515 --1655 --
NM_001039937chr1333100 1098 330 --11147 --
NM_001039938chr1321504 165 ------
NM_001040001chr621635 487 134 ----
NM_001040002chr177599 477 380 317 76 70 45 --21342 54 21351 61
NM_001040056chr163751 632 193 --2760 311 2588 45
NM_001040101chr421298 166 --1533 --
NM_001040110chr73490 448 176 ------
NM_001040113chr162950 298 1850 2762 328 --
NM_001040142chr221892 982 ------
NM_001040143chr221892 982 ------
NM_001040144chr1631597 908 124 --163 1383
NM_001040146chr1631597 908 124 --163 1383
NM_001040151chr11154529 4130 4101 3807 3564 3531 3213 3015 3003 1240 789 357 265 176 157 44003 293 92 55 13218 34347 3582 1246
NM_001040152chr795004 1716 1396 1301 1256 967 592 500 109 3942 572 240 25050 2046 --
NM_001040157chr422142 1984 ------
NM_001040167chr72156 34 --31044 1016 288 --
NM_001040181chr3----170 --
NM_001040182chr3----170 --
NM_001040183chr3----170 --
NM_001040199chr3----170 --
NM_001040200chr3----170 --
NM_001040202chr432165 1680 741 165 ----
NM_001040272chr951624 1532 928 124 28 --3920 142 59 1114
NM_001040284chr1655922 4162 2163 1199 997 11298 ----
NM_001040402chr463161 1298 864 842 715 51 ------
NM_001040439chr1661175 355 330 205 60 49 1529 81327 1319 1222 1109 1071 433 408 95 1588
NM_001040441chr144539 4362 3967 473 45256 4701 1879 1025 --15286
NM_001040446chr561734 726 705 576 531 110 --2654 595 11861
NM_001040458chr52731 449 1320 2700 471 11669
NM_001040624chr842447 2165 398 336 12031 1526 12643
NM_001040625chr842447 2165 398 336 12031 1526 12643
NM_001040626chr842447 2165 398 336 12031 1526 12643
NM_001040627chr842447 2165 398 336 12031 1526 12643
NM_001040628chr842447 2165 398 336 12031 1526 12643
NM_001040629chr842447 2165 398 336 12031 1526 12643
NM_001040630chr842447 2165 398 336 12031 1526 12643
NM_001040709chr172428 2072 1662 1564 756 363 41 22228 520 153 12205
NM_001040712chr943321 2700 1124 425 --11149 13343
NM_001040715chr161852 --21027 812 --
NM_001042361chr1021000 82 ------
NM_001042364chr1021000 82 ------
NM_001042365chr1021000 82 ------
NM_001042368chr92192 87 2534 106 1303 --
NM_001042371chr1641516 1456 603 571 11402 31863 1313 580 --
NM_001042387chr1021000 82 ------
NM_001042393chr1021000 82 ------
NM_001042396chr1021000 82 ------
NM_001042397chr1021000 82 ------
NM_001042404chr11281 ------
NM_001042413chr971329 1122 1073 933 817 428 53 1714 21109 759 1878
NM_001042424chr492622 2436 1270 1082 579 433 294 240 164 ----12563
NM_001042425chr641234 450 244 231 --257 22 --
NM_001042481chr1421674 639 1102 1399 --
NM_001042486chr2021149 972 11239 31243 1142 1128 --
NM_001042492chr1733295 2670 125 13449 13482 --
NM_001042494chr1542885 2757 1443 594 12450 3916 910 83 --
NM_001042495chr1542885 2757 1443 594 12450 3916 910 83 --
NM_001042496chr1542885 2757 1443 594 12450 3916 910 83 --
NM_001042497chr1542885 2757 1443 594 12450 3916 910 83 --
NM_001042498chrX1852 --2377 83 --
NM_001042506chrX31151 508 214 --4515 219 185 71 --
NM_001042510chr852129 1934 1398 575 222 ------
NM_001042511chr852129 1934 1398 575 222 ------
NM_001042537chrX22409 1567 ------
NM_001042539chr161980 11052 21063 1056 1950
NM_001042555chr1243933 3531 1268 531 13505 24150 3544 --
NM_001042599chr277608 6129 6034 2459 1935 860 445 37793 6530 5599 25525 55 21760 89
NM_001042601chr322047 406 ------
NM_001042603chr1235330 4500 1364 1602 --24388 1377
NM_001042604chr323001 312 11749 ----
NM_001042632chr2062487 2178 1659 604 507 361 --3615 494 380 --
NM_001042633chr2062487 2178 1659 604 507 361 --3615 494 380 --
NM_001042669chr431675 634 348 ------
NM_001042681chr152377 2080 1673 374 342 12477 --11623
NM_001042682chr152377 2080 1673 374 342 12477 --11623
NM_001042682chr152377 2080 1673 374 342 12477 --11623
NM_001042723chr191138 --126 133
NM_001042728chr124818 435 421 168 --31050 760 111 --
NM_001043318chr14103362 3234 2855 1668 1276 864 758 531 411 284 11424 33456 3436 1060 --
NM_001044305chr631573 1152 36 ----1369
NM_001077628chr12678 478 ----1528
NM_001079874chr131815 1492 23 11685 ----
NM_001080418chr17609 465 248 225 217 123 46 --2449 92 2445 106
NM_001092chr173520 481 163 2208 107 22122 212 --
NM_001094chr173640 339 25 --1313 --
NM_001095chr1291682 1374 1355 1320 1239 1217 660 547 103 11623 --2716 668
NM_001100108chr1126780 6729 6406 5920 5495 5124 2645 2204 1568 1235 1178 1111 37041 6294 5659 58041 6516 6000 5521 297 --
NM_001106chr369226 8234 3482 2956 1635 1132 49735 7233 7122 1446 1307 11145
NM_001111chr1102322 2314 2265 2196 1713 1016 778 636 628 260 21887 907 ----
NM_001113490chrX43385 2651 1090 588 32806 2728 475 ----
NM_001116chr16102805 2281 2252 2196 1127 1011 785 771 629 605 --21022 592 11038
NM_001117chr1822298 1670 ------
NM_001119chr41317 11380 21187 191 2398 187
NM_001122679chr52997 528 ------
NM_001126chr12362 28 ------
NM_001127chr224217 199 146 111 --2399 171 240 23
NM_001128chr1642559 1536 1234 34 --22754 262 --
NM_001130chr19----1167 1186
NM_001148chr441410 857 326 272 11932 1431 --
NM_001157chr102530 31 --2214 139 1210
NM_001167chrX22096 1890 36259 4266 2646 ----
NM_001175chr124416 193 65 33 --2142 25 --
NM_001177chr1231772 1515 43 --12208 --
NM_001191chr2061152 578 449 320 112 21 1198 51171 1136 492 486 35 11413
NM_001194chr197651 499 263 218 198 175 98 1635 1209 --
NM_001204chr236345 5282 105 35128 5073 4813 1115 --
NM_001206chr921215 538 ------
NM_001222chr1051255 360 338 170 150 21623 487 ----
NM_001259chr786312 6094 4872 4558 1728 1550 1200 43 15822 26258 1512 16155
NM_001271chr1523071 549 1212 1195 1217
NM_001273chr12----122 --
NM_001282chr17112525 2407 2262 2234 1735 861 518 296 227 211 109 --32250 1883 218 11729
NM_001292chr1551015 966 854 456 212 ------
NM_001310chr1242379 1895 399 235 ------
NM_001313chr42890 348 --3762 223 54 --
NM_001329chr1031404 394 328 ----11492
NM_001331chr1152016 1850 1834 1106 560 --2929 739 --
NM_001343chr53354 324 27 ------
NM_001346chr342176 2102 1909 199 22461 1738 41955 1015 860 144 12862
NM_001356chrX123 --1251 1258
NM_001364chr1154573 3350 1629 969 627 1301 23622 3260 --
NM_001365chr172314 160 1183 2272 106 --
NM_001387chr562856 2528 1228 1210 914 678 22461 966 22614 2568 --
NM_001390chr1852601 2551 1163 331 25 22332 2251 23190 186 --
NM_001397chr1112518 2089 2081 2028 1902 1798 941 857 225 97 61 2616 205 1510 11004
NM_001399chrX33356 3039 2320 1368 23552 3218 1609
NM_001401chr9163 11515 1216 --
NM_001402chr612007 1733 --127
NM_001406chr1771620 1341 472 342 311 123 82 21722 628 1578 31571 1287 633
NM_001407chr331446 1439 1263 --2588 436 11455
NM_001408chr13651 518 301 1169 11293 11115
NM_001412chrX23225 2930 1746 13153 --
NM_001417chr1221933 461 --142 --
NM_001419chr1973141 3111 3066 1807 1444 928 764 1800 44049 3588 1737 511 23596 3584
NM_001420chr1972718 2706 2589 1159 1072 984 494 11105 72936 2750 2673 347 337 331 26 31132 234 215
NM_001421chrX61664 1593 1333 1189 377 178 --11122 --
NM_001424chr163697 494 245 2710 601 1564 --
NM_001429chr222925 317 --1919 --
NM_001438chr142580 1324 266 27 ------
NM_001453chr611163 --1218 --
NM_001454chr176903 872 860 370 231 89 2854 83 3935 636 23 --
NM_001460chr152748 2405 2312 81 55 --13429 1617
NM_001478chr123867 789 175 2831 697 2928 82 --
NM_001493chrX2305 95 --2742 237 1101
NM_001495chr83486 415 121 11080 ----
NM_001497chr921979 999 2280 257 1493 --
NM_001521chr22638 153 1552 ----
NM_001543chr5134525 1835 1387 1121 877 807 697 690 576 365 345 337 173 24181 50 23214 1917 41530 1525 1239 621
NM_001554chr1--1453 1432 --
NM_001587chrX3446 303 269 21981 457 3872 461 431 --
NM_001610chr112577 493 --129 --
NM_001616chr223463 2981 11097 13522 --
NM_001634chr61230 1732 ----
NM_001635chr71788 --2968 926 1701
NM_001642chr1121262 901 --1907 --
NM_001647chr31132 --162 132
NM_001649chrX32446 1925 613 1730 ----
NM_001650chr182834 63 ------
NM_001654chrX1298 1362 1120 --
NM_001655chr113837 594 156 11470 11769 1600
NM_001658chr13882 722 25 1910 1914 --
NM_001659chr1282280 2173 1775 852 812 282 174 57 129 62498 1085 753 411 74 37 22586 1712
NM_001663chr14175 1669 121 --
NM_001664chr32768 230 1797 ----
NM_001670chr223690 186 157 1131 3580 178 68 1174
NM_001678chr17121761 1616 1354 1285 1131 665 597 442 367 352 301 79 11679 21321 572 185
NM_001683chr3102516 1952 1021 306 279 151 91 70 51 26 12651 --12042
NM_001684chr153376 1653 1494 1400 25 23931 306 23477 1678 1311
NM_001695chr843830 3313 2953 2907 --11218 22988 2738
NM_001703chr1174 160 ----
NM_001706chr3150 2957 85 1879 --
NM_001707chr73767 695 674 2589 233 2755 626 1259
NM_001709chr1141906 1872 772 760 1754 ----
NM_001735chr92278 262 ------
NM_001742chr72487 81 ------
NM_001746chr532177 1888 456 ------
NM_001754chr2173917 3170 2898 1496 1421 251 217 21214 1050 ----
NM_001759chr12114902 4855 4697 4458 4014 3208 1720 1153 559 382 119 23954 3716 ----
NM_001773chr151334 1308 412 125 44 1493 4439 314 90 68 --
NM_001789chr341382 1094 648 151 11319 145 --
NM_001791chr131315 378 127 ------
NM_001792chr1811146 ------
NM_001810chr202715 153 --2801 551 149
NM_001843chr12295 47 ----131
NM_001844chr121386 1122 1126 --
NM_001845chr131152 --1382 --
NM_001851chr62258 71 1618 ----
NM_001859chr953323 1475 248 142 84 23811 759 ----
NM_001874chr1241930 1086 471 34 33838 723 57 33969 3414 1852 --
NM_001894chr2261000 951 484 325 318 94 ------
NM_001895chr2011032 --21170 50 --
NM_001918chr1109061 7732 7721 6935 6684 5984 3680 2856 2750 2522 58680 6073 2603 1870 543 26718 1700 17155
NM_001939chrX103812 3355 2331 1107 952 944 567 437 409 74 1398 1816 2918 497
NM_001940chr123410 88 53 1497 2379 59 --
NM_001941chr1862690 2549 1373 1331 1153 476 ------
NM_001945chr541313 1061 888 544 ----11319
NM_001949chr651247 1134 684 373 294 --1723 --
NM_001954chr65581 242 154 114 83 --2289 275 1567
NM_001962chr5164 1199 2213 203 1209
NM_001964chr53835 398 251 ------
NM_001968chr42270 239 ------
NM_001970chr17----1148 1435
NM_001975chr123875 821 80 --1852 --
NM_001978chr86989 895 808 657 417 36 1291 ----
NM_001981chr142282 1958 352 342 ------
NM_001987chr12114124 3809 3789 3632 3145 3015 1578 803 654 280 180 21386 789 34162 2733 878 --
NM_002006chr445490 5429 5360 640 --11728 --
NM_002014chr122489 240 --2536 60 156
NM_002015chr1323148 2045 12797 ----
NM_002025chrX188878 7852 7809 7579 6522 6499 6482 6403 5882 5696 3724 3449 2899 1860 907 639 308 82 28798 7714 21399 409 18588
NM_002026chr231029 366 168 ------
NM_002035chr1831406 1255 169 13382 ----
NM_002045chr34131 80 63 27 --133 --
NM_002060chr12482 22 1331 ----
NM_002061chr12756 724 31947 1715 1472 ----
NM_002065chr131325 738 200 147 11773 152
NM_002074chr161666 1657 1651 1521 1491 109 1103 21482 1477 --
NM_002077chr951774 549 532 420 229 21824 275 11835 --
NM_002080chr163955 720 661 1629 ----
NM_002081chr251585 1161 699 486 264 179 2561 438 21630 1510
NM_002086chr1741840 1435 627 122 --21699 1418 --
NM_002092chr454786 4187 3936 3377 3255 33946 3628 911 34610 4236 3998 --
NM_002134chr163486 478 208 --155 186
NM_002135chr123407 119 84 ----150
NM_002137chr7----12313 --
NM_002138chr42691 87 ------
NM_002139chrX2520 74 ------
NM_002145chr17----2143 77 --
NM_002160chr91169 --1425 --
NM_002187chr51948 --1955 --
NM_002204chr175318 282 132 114 29 --31292 208 119 11106
NM_002206chr123302 166 147 --141 --
NM_002210chr243465 3305 2878 557 11080 ----
NM_002221chr162882 2810 2223 1156 615 353 ----12769
NM_002227chr131283 970 260 ------
NM_002229chr192143 28 --3354 164 95 --
NM_002232chr12845 468 --1960 --
NM_002245chr12459 224 ------
NM_002247chr10143 --11836 --
NM_002253chr431020 1014 317 ------
NM_002254chr261818 1545 670 530 380 26 21773 391 1936 --
NM_002264chr374898 4490 3309 1547 608 226 44 24816 1007 1613 --
NM_002267chr1332043 739 244 ------
NM_002270chr554842 4648 1384 688 664 1617 ----
NM_002274chr17----145 1318
NM_002285chr222642 1085 13673 1720 --
NM_002289chr123242 40 23 ----269 34
NM_002290chr611379 1975 ----
NM_002293chr152496 2418 609 565 28 12337 2491 100 --
NM_002298chr1331109 484 39 --11067 --
NM_002309chr2272957 2477 2447 2415 2345 2215 642 12376 22782 2522 32928 2168 152
NM_002319chr77972 272 148 116 76 66 26 --2885 215 --
NM_002333chr1951263 900 432 238 68 11044 11052 2887 266
NM_002334chr111252 --1307 1120
NM_002350chr831260 198 154 ------
NM_002355chr1231380 1367 99 --1575 --
NM_002356chr622230 1960 --1868 --
NM_002359chr1743354 3053 1673 954 42957 1503 242 147 74185 3831 3673 2819 1527 391 113 12815
NM_002360chr762596 2571 2453 2215 229 63 1889 1406 --
NM_002373chr1531260 945 475 31144 907 892 41357 1283 494 34 11126
NM_002374chr242637 872 742 117 12959 ----
NM_002375chr352064 1621 648 348 338 11962 2894 171 12159
NM_002382chr142415 408 31053 1025 263 --1335
NM_002383chr162803 294 1875 2886 879 1773
NM_002390chr1792015 1942 1926 1795 1612 1508 1488 221 69 21414 621 21892 226 1280
NM_002397chr51855 1495 ----
NM_002398chr261191 1071 431 197 189 137 --1231 1227
NM_002399chr153229 197 116 1139 2234 189 --
NM_002401chr1732363 1881 799 22048 1726 62347 1976 1887 1767 1690 293 22369 1009
NM_002403chr12381 325 --185 1334
NM_002409chr2283185 2968 2875 2533 902 669 498 402 22447 2098 52807 2525 2120 1269 603 --
NM_002430chr221447 42308 1027 574 77 2745 81 --
NM_002442chr1251709 1359 1346 1262 323 21173 28 81273 714 670 337 304 237 227 99 21597 287
NM_002445chr861574 320 268 252 237 60 1388 ----
NM_002448chr44686 130 60 21 ------
NM_002473chr225951 494 438 193 87 --51277 516 444 143 130 11273
NM_002485chr832153 690 300 ------
NM_002499chr1541758 929 428 167 11750 ----
NM_002501chr19123781 3681 3458 3216 3002 2982 2706 2519 1107 937 566 172 43635 3013 757 665 204077 4072 4067 4062 3941 3670 3537 3529 3421 3384 3225 3115 3017 1229 943 761 674 471 444 370 43662 3380 977 670
NM_002508chr151614 614 356 258 169 --3231 225 199 1284
NM_002515chr1451508 1371 1344 1334 1257 21530 46 21361 705 --
NM_002519chr1111346 --1567 1497
NM_002520chr5----1195 --
NM_002522chr17123292 2546 2530 2443 2391 1538 971 941 884 115 38 27 22478 715 53853 2497 1234 840 736 --
NM_002524chr13281 225 58 ----1291
NM_002545chr11104652 1800 1459 1165 982 943 876 864 488 383 ------
NM_002547chrX44018 2879 629 213 ------
NM_002558chr1761005 970 887 215 200 104 1283 ----
NM_002569chr15101358 1302 978 953 453 384 217 158 150 133 1204 51414 582 460 433 208 --
NM_002570chr154806 431 55 34 11325 ----
NM_002581chr964520 1923 1818 1168 1045 50 45183 4722 691 659 11586 1214
NM_002586chr651405 1093 516 506 126 1336 2528 522 1407
NM_002588chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_002594chr2042064 819 95 28 1784 ----
NM_002596chr151298 1037 1005 949 380 1885 41341 1334 850 293 31322 1075 546
NM_002599chr1131111 990 261 --2382 36 --
NM_002608chr2241497 1338 556 457 --41486 1386 169 149 --
NM_002609chr571626 1485 1331 1271 759 652 456 11440 21502 416 11349
NM_002613chr16134776 4103 3948 3934 3468 1785 1453 1079 816 371 306 87 67 --44043 2137 1532 1516 --
NM_002616chr172232 226 --1379 --
NM_002632chr141800 --2635 553 --
NM_002634chr172733 22 --2727 218 186
NM_002636chr64423 394 60 27 --133 --
NM_002641chrX21892 231 ------
NM_002645chr112902 317 --1923 --
NM_002651chr16900 638 359 103 91 43 --1862 --
NM_002653chr54942 854 676 189 1760 2337 153 --
NM_002655chr834417 3945 841 ------
NM_002657chr20163689 3613 3606 3465 3247 3069 3054 1550 1508 1152 1050 1029 613 544 522 397 1595 73408 2874 2481 2452 1381 1037 60 12913
NM_002662chr331920 756 537 11799 135 --
NM_002698chr1992751 2743 2610 1211 1121 1038 871 640 111 --22720 2711 --
NM_002699chr141262 608 243 56 1517 4521 421 300 282 --
NM_002709chr232688 97 81 1288 13098 --
NM_002710chr121696 2267 187 ----
NM_002714chr64902 860 848 352 2427 287 2915 62 --
NM_002715chr521313 318 ------
NM_002718chr321652 347 12168 --1985
NM_002721chr9--149 1211 1207
NM_002725chr194368 3467 3334 3119 2738 1059 654 314 199 23046 1609 84393 4318 3124 1446 941 894 322 125 --
NM_002730chr19121239 1160 1126 1116 1093 998 867 399 392 210 202 120 --1132 41274 1231 406 128
NM_002731chr13764 166 143 11166 ----
NM_002734chr1721667 262 ------
NM_002739chr194714 667 148 68 1111 3577 295 84 1644
NM_002745chr2254380 3436 3052 1773 221 13615 14401 --
NM_002746chr164582 463 198 24 --2591 142 1419
NM_002748chr15------11112
NM_002768chr163490 286 117 1541 31274 1234 563 1403
NM_002776chr19111934 1922 1854 1774 722 300 270 181 147 137 77 41792 1328 648 170 31581 607 323 --
NM_002779chr102186 85 --1558 --
NM_002819chr194528 370 308 171 1486 21127 534 --
NM_002821chr65731 628 510 335 169 1739 2553 245 --
NM_002827chr2051720 1537 1154 1141 175 31105 335 308 31333 1148 24 1394
NM_002829chr941109 469 294 118 ------
NM_002833chr1541346 1312 1264 48 11389 1361 --
NM_002837chr1253522 3432 3285 2829 1149 --12917 13291
NM_002839chr943321 2700 1124 425 --11149 13343
NM_002840chr12243 183 21122 1113 128 11269
NM_002841chr32634 182 ------
NM_002847chr731319 1198 429 1659 11325 21207 38
NM_002849chr1231013 198 59 ------
NM_002854chr22----3120 71 31 --
NM_002855chr11143665 3439 2939 2869 2280 2272 1095 876 854 439 324 271 204 59 --63548 1294 1279 357 77 70 62829 2689 1395 975 892 85
NM_002859chr1291667 594 546 490 240 233 175 75 44 1314 --31704 1557 273
NM_002866chr195568 236 123 58 44 --1546 1197
NM_002868chr1231582 955 884 --52252 2184 204 69 63 --
NM_002869chr1131711 408 397 ------
NM_002886chr354301 2069 1824 1030 197 --1165 --
NM_002890chr51262 --1856 --
NM_002903chr173322 38 31 --1251 1121
NM_002918chr193836 712 24 --3279 38 29 2806 329
NM_002933chr141208 123 127 --
NM_002941chr31515 ------
NM_002942chr321223 193 ------
NM_002955chr641989 1737 1650 1429 21659 1528 ----
NM_002956chr122305 212 ------
NM_002959chr163656 3417 3311 3244 1119 58 --44014 3156 3066 421 13256
NM_002971chr32273 65 1392 ----
NM_002996chr16121798 1649 1635 1557 1539 1474 1328 505 484 457 448 189 1226 2400 71 1283
NM_003010chr1731752 823 68 ------
NM_003011chr921231 687 11461 1210 --
NM_003013chr43219 152 94 ------
NM_003025chr1961111 921 790 397 118 49 1812 2359 25 2802 248
NM_003026chr911276 2351 87 --1327
NM_003028chr9123823 3797 3680 3637 3279 3123 1556 1222 1087 1018 752 386 --53773 3593 484 230 224 1213
NM_003029chr13554 371 341 --1412 151
NM_003042chr331885 1610 35 1253 ----
NM_003045chr13144913 4187 3570 3339 3286 3194 1370 1150 691 667 199 113 100 48 44117 3675 1098 70 41320 1296 162 74 23292 499
NM_003047chr191431 1340 1263 1239 1111 535 523 503 385 --21068 963 1147
NM_003068chr82836 46 ------
NM_003070chr92706 62 ------
NM_003074chr322147 896 --2155 143 --
NM_003076chr1241355 1197 677 616 1179 31361 1328 193 --
NM_003077chr171111 1677 151 --
NM_003085chr53378 236 171 --4569 527 457 57 1465
NM_003088chr77993 847 287 186 174 158 150 1723 2408 24 --
NM_003107chr662466 523 465 400 227 206 --21932 200 --
NM_003108chr296733 5994 5497 4496 2754 2615 2408 1882 1851 27259 6697 37211 2905 1863 16820
NM_003110chr175838 694 410 316 43 1858 3351 344 112 --
NM_003111chr2------11328
NM_003131chr641929 1915 1512 182 21897 151 41922 1423 327 219 2878 215
NM_003137chr631529 346 47 12095 ----
NM_003139chr114812 781 773 252 --2683 149 --
NM_003150chr1731764 673 425 21873 844 22206 63 --
NM_003153chr1251058 1036 929 387 120 1260 3212 183 46 --
NM_003155chr822315 1135 --32099 2000 295 22432 1048
NM_003156chr1121339 241 --51229 1162 1153 389 297 1466
NM_003161chr1732341 1065 910 1574 --12249
NM_003164chr111373 --3191 172 155 --
NM_003165chr981940 1511 1400 1278 708 166 130 115 139 21481 603 1137
NM_003168chr173979 247 99 1835 138 --
NM_003173chrX61390 1122 231 121 111 55 --21329 1211 --
NM_003178chr31589 1733 21487 438 --
NM_003179chrX71471 1378 1286 1233 1119 255 236 21106 184 61193 1129 391 188 94 73 --
NM_003180chr192307 122 --2345 88 1131
NM_003183chr21636 1864 ----
NM_003185chr20----3534 483 92 --
NM_003194chr6----2485 32 --
NM_003199chr1811787 13965 --15114
NM_003200chr1982178 1861 1805 1670 1657 211 67 29 1100 11840 --
NM_003202chr561720 603 574 169 105 35 11643 2588 257 --
NM_003204chr1751587 1418 621 537 183 1234 1238 --
NM_003214chr681273 1204 1150 335 252 158 139 66 --21261 345 21027 145
NM_003215chr421560 1203 ----11008
NM_003216chr2262530 2054 1269 854 650 307 3462 405 40 ----
NM_003217chr1251748 662 374 343 217 --41566 1326 626 47 --
NM_003220chr641234 450 244 231 --257 22 --
NM_003221chr693869 3767 3405 3397 3390 2808 2585 611 469 32678 1222 483 63467 3119 2884 2841 2657 502 --
NM_003223chr162578 170 1226 2601 587 1628
NM_003227chr74426 296 126 23 --198 --
NM_003240chr11164 --2682 672 198
NM_003243chr121019 156 1171 ----
NM_003247chr62138 101 21458 59 --11463
NM_003253chr211153 1319 21526 62 --
NM_003255chr174749 516 487 76 31811 204 111 31815 736 728 --
NM_003257chr15165 ------
NM_003259chr193133 120 37 --1138 --
NM_003270chrX2478 253 ------
NM_003285chr12342 213 1498 ----
NM_003289chr91154 --1197 125
NM_003292chr122235 1798 ------
NM_003311chr112330 264 ------
NM_003317chr143581 551 75 --1698 --
NM_003319chr211019 --1694 --
NM_003336chrX4890 182 156 63 --1148 --
NM_003337chr521351 1182 11583 ----
NM_003339chr52518 364 --1632 --
NM_003342chr1763024 2482 2029 776 557 82 13244 1712 --
NM_003344chr71151 11582 ----
NM_003347chr2242203 584 365 64 22015 1782 1375 --
NM_003348chr1221316 274 --11423 --
NM_003349chr2021447 516 --3622 583 404 --
NM_003359chr41341 21268 853 ----
NM_003367chr194385 212 176 32 --1428 1424
NM_003369chr1152011 800 554 361 239 1575 ----
NM_003370chr194748 689 208 54 --2242 122 2560 130
NM_003371chr941499 594 420 241 150 1627 --
NM_003376chr62521 345 ----1704
NM_003376chr62521 345 ----1704
NM_003387chr262921 2507 2320 2055 428 23 21100 289 ----
NM_003392chr353597 2931 1721 1301 1016 12833 ----
NM_003399chrX71008 900 384 232 212 202 67 185 1933 --
NM_003405chr222133 34 --142 --
NM_003406chr821587 1570 21608 459 11211 --
NM_003409chr181243 ----1342
NM_003410chrX22005 1177 12026 12043 --
NM_003412chr342476 1161 1041 268 11972 ----
NM_003442chr11--1868 1555 --
NM_003458chr3143769 3750 3204 3003 2972 2749 2740 2620 2564 2538 1266 991 964 294 32673 2648 797 53462 2965 1499 1484 775 11495
NM_003459chr23624 128 105 123 1657 --
NM_003466chr2102474 2383 931 812 710 582 501 488 384 132 22410 1980 11933 2686 558
NM_003468chr21704 --31165 1065 954 13323
NM_003469chr2------142
NM_003471chr312131 1252 ----
NM_003472chr6----11205 --
NM_003480chr122155 135 11409 ----
NM_003482chr1252665 2498 584 309 39 --72656 2417 2410 2043 501 489 175 22406 763
NM_003489chr21----1602 --
NM_003502chr162135 118 --2217 123 --
NM_003507chr221651 1639 ----22023 31
NM_003557chr131364 1233 231 11339 31310 1138 511 1241
NM_003563chr17----11417 --
NM_003574chr1834861 4337 409 21748 914 ----
NM_003598chr194632 259 39 26 2459 70 2452 143 --
NM_003603chr431651 127 70 ------
NM_003607chr194189 3693 3272 3118 1000 899 272 171 45 13776 33780 2820 79 --
NM_003615chr322960 809 12865 --22575 2553
NM_003621chr114362 336 129 30 177 ----
NM_003624chr1991259 1212 1135 1097 472 378 371 318 53 1114 3928 387 66 173
NM_003629chr152862 2764 2650 2442 286 ------
NM_003633chr542217 2169 1762 405 141 11031 --
NM_003634chr2261074 971 910 447 324 65 --121 --
NM_003637chr1----41511 624 407 224 21228 435
NM_003644chr17186477 6341 6335 6149 6119 5975 4077 4030 2154 2140 2132 2034 1796 1249 1183 966 953 732 25350 5262 66493 6384 4007 1036 774 89 --
NM_003654chr111536 1134 3641 227 138 1101
NM_003663chr323253 2145 13075 1588 1158
NM_003671chr932305 963 115 11196 ----
NM_003679chr123265 535 22702 2498 --1874
NM_003680chr13595 75 68 ------
NM_003713chr121217 576 ----1445
NM_003714chr542764 2636 841 385 --22493 1965 --
NM_003722chr332255 314 60 ------
NM_003735chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_003736chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_003737chr113381 284 62 --1136 --
NM_003740chr641750 1717 1283 498 2506 53 11676 123
NM_003741chr3--1333 3337 252 134 --
NM_003743chr242301 1784 1472 574 --11630 22014 483
NM_003760chr11675 ------
NM_003763chr2052707 2634 871 762 69 42591 2319 1023 979 ----
NM_003768chr181783 1510 737 645 468 457 97 60 --31788 322 48 --
NM_003822chr142818 2183 2112 514 ------
NM_003829chr9143 ----1463
NM_003861chr1432880 2329 421 --12437 --
NM_003885chr17112708 1826 1690 906 806 640 575 492 319 217 145 --2985 648 1449
NM_003888chr1531241 405 203 11163 21319 410 --
NM_003893chr103341 113 21 --2327 47 --
NM_003895chr2121379 326 1752 ----
NM_003913chr623494 1055 ------
NM_003924chr4----2194 188 --
NM_003936chr25953 779 482 261 104 2757 232 3886 761 26 134
NM_003938chr196925 778 727 260 234 180 --128 1879
NM_003939chr1054015 3911 3352 674 295 13953 ----
NM_003941chr722258 604 ------
NM_003947chr33317 187 82 --187 --
NM_003949chr1761994 1838 1618 1267 179 104 --31648 1305 419 --
NM_003954chr1761189 974 538 482 399 216 --1200 --
NM_003955chr174584 502 496 209 1594 21473 1195 1508
NM_003957chr115984 422 110 58 24 --2926 119 --
NM_003958chr663755 3121 1472 1140 1002 339 32954 1201 376 2985 881 33853 3224 1012
NM_003968chr32473 127 ------
NM_003969chr192271 47 --2337 329 --
NM_003987chr1071895 1811 1786 1734 843 784 165 1133 61846 1836 346 250 231 73 32139 138 122
NM_003988chr1081972 1888 1863 1811 1442 920 861 242 1210 81923 1913 423 327 308 150 43 28 32216 215 199
NM_003989chr1071831 1747 1722 1670 779 720 101 169 51782 1772 282 186 167 32075 74 58
NM_003990chr1071831 1747 1722 1670 779 720 101 169 51782 1772 282 186 167 32075 74 58
NM_003993chr11100 --1223 1287
NM_003994chr1253398 3144 3088 629 138 ------
NM_004028chr182834 63 ------
NM_004035chr17104871 4546 4343 3957 3729 3595 3235 1792 1594 869 --24551 3735 43788 3622 3454 3215
NM_004040chr221173 175 3383 328 317 1332 1182
NM_004041chr114687 561 549 39 --2463 234 1215
NM_004050chr143877 754 392 12031 22559 865 --
NM_004068chr3--1347 3301 38 26 --
NM_004077chr1231212 954 492 --1857 --
NM_004078chr131109 275 24 21006 281 31010 975 33 2971 178
NM_004083chr12271 41 ------
NM_004090chr17113023 2871 2847 2762 2718 2550 2287 1069 913 497 448 12374 1163 --
NM_004093chr1322714 127 22368 534 --1552
NM_004094chr1442338 874 828 307 11960 12940 --
NM_004096chr1041681 1669 1338 468 --41760 789 324 127 --
NM_004100chr642549 2358 2320 999 --12634 --
NM_004104chr173592 190 166 135 263 42 359 54 49
NM_004105chr231004 784 119 ------
NM_004113chr331982 85 34 11675 ----
NM_004117chr642122 2037 1866 711 ----1206
NM_004169chr175654 618 597 67 27 ------
NM_004172chr551958 1566 723 714 590 1192 ----
NM_004185chr13758 474 24 1749 293 86 --
NM_004186chr32373 110 ----1651
NM_004193chr101348 --2388 368 --
NM_004200chr11122928 2791 2738 2694 2568 2561 2308 2237 2153 2134 2111 1202 22349 1000 92071 1213 1109 1101 1086 770 460 382 181 22934 2541
NM_004227chr742674 2480 1986 322 11177 32524 2026 314 --
NM_004228chr19----1112 --
NM_004229chrX21567 1491 1493 ----
NM_004230chr1962203 1818 1613 913 586 332 --31662 1656 750 2958 108
NM_004242chr61397 ------
NM_004263chr231563 1497 274 ----192
NM_004272chr52342 118 11467 ----
NM_004274chr1442940 2933 344 85 ----12765
NM_004276chr123353 128 73 --2158 145 1335
NM_004277chr62221 74 1690 ----
NM_004283chr194810 698 312 23 --128 --
NM_004293chr922986 957 23023 2443 ----
NM_004296chr14163915 3707 3691 3342 3289 2826 1404 1384 1174 1124 522 502 483 459 448 363 23053 265 32677 1617 630 22446 1610
NM_004302chr1272718 2630 2407 2399 2383 256 161 12553 42622 2577 2526 2507 1840
NM_004309chr174856 826 758 187 1749 31069 976 122 21065 862
NM_004311chr1032890 2823 2546 42998 2832 1175 670 52836 2498 2266 2048 683 22018 675
NM_004316chr122431 388 1261 ----
NM_004319chr182791 2376 2234 2107 1129 1037 916 363 --1447 11199
NM_004321chr2133293 3285 3258 3127 2927 2679 2354 1404 1314 1282 742 519 78 13454 3458 452 42 --
NM_004326chr121209 1020 ------
NM_004331chr8----1108 --
NM_004338chr1896907 6412 6210 5027 4917 4805 2275 1799 1398 12474 26470 4893 22678 1210
NM_004349chr8----11044 --
NM_004352chr162419 214 ------
NM_004370chr63810 766 681 ------
NM_004379chr2--21760 385 1259 --
NM_004380chr1632224 2100 1803 22122 1907 11819 12127
NM_004387chr55393 381 325 272 116 ----142
NM_004391chr361553 1368 647 372 121 66 21916 1481 21431 98 21868 1274
NM_004392chr1321842 904 ------
NM_004395chr54522 152 40 25 --3590 266 111 --
NM_004397chr1143859 3472 2879 609 --12976 --
NM_004399chr124773 622 361 270 ----1669
NM_004418chr22544 95 ------
NM_004419chr101410 1281 1694 --
NM_004420chr11142226 2164 2116 2054 1949 1815 1629 1585 1561 1524 584 433 248 29 12255 41822 1634 1507 438 21513 301
NM_004423chr36990 748 579 418 360 64 32561 1945 471 4675 589 522 292 2436 39
NM_004427chr161168 1161 910 822 791 149 --21011 915 --
NM_004428chr13569 555 217 160 2205 109 1810
NM_004429chrX101258 1220 1064 919 334 323 246 98 73 65 --31263 933 926 11294
NM_004430chr84905 700 401 345 2612 371 2949 628 11029
NM_004433chr151466 1403 470 426 40 --2546 193 --
NM_004437chr173631 2693 1167 1075 750 739 42 23547 993 22785 2773 122
NM_004438chr232440 897 343 --12667 --
NM_004440chr6----11792 11410
NM_004441chr321247 998 ------
NM_004442chr151359 1163 443 99 24 --31596 528 43 11277
NM_004454chr352116 1875 622 532 152 11626 22028 577 --
NM_004458chrX22684 1882 --12034 --
NM_004463chrX2510 494 ----133
NM_004468chr13601 245 147 --2444 71 2440 140
NM_004474chr12861 36 --1749 --
NM_004475chr172395 35 1201 21099 177 --
NM_004481chr182621 2376 2180 2140 2129 894 847 250 22169 1005 22385 1663 1552
NM_004487chr321093 55 1489 128 --
NM_004494chr15858 348 338 195 183 --31178 328 31 2141 105
NM_004500chr1451704 1639 1266 444 125 ------
NM_004501chr133592 3431 926 1482 ----
NM_004504chr213018 11046 22893 61 --
NM_004514chr1762861 1064 870 377 149 108 1478 2676 369 --
NM_004527chr177599 477 380 317 76 70 45 --21342 54 21351 61
NM_004529chr92504 229 ----1514
NM_004535chr2031795 1754 1687 11230 ----
NM_004549chr1131429 256 201 11070 11275 --
NM_004560chr92410 255 1339 ----
NM_004561chr1161520 488 446 339 296 97 21215 642 180 --
NM_004575chr441077 570 374 29 --1257 --
NM_004578chr11977 ------
NM_004579chr112280 79 ----239 34
NM_004583chr172173 63 1624 2613 537 --
NM_004586chrX2441 282 11731 ----
NM_004588chr11103062 2627 2513 968 344 249 186 176 118 52 12559 33229 852 156 13769
NM_004598chr543008 2945 1329 1237 12997 ----
NM_004602chr203316 307 210 --1527 --
NM_004603chr74928 838 111 66 --31046 299 164 4962 42 28 23
NM_004608chr165420 290 155 123 74 --4339 161 128 89 --
NM_004612chr923771 1415 14020 ----
NM_004615chrX3274 176 155 1135 ----
NM_004631chr141092 1078 978 248 ------
NM_004634chr31593 1183 ----
NM_004637chr331167 434 261 1154 1465 --
NM_004640chr6----1136 --
NM_004647chr192264 86 --2134 77 --
NM_004655chr1721167 242 --2940 399 --
NM_004656chr32929 31 ------
NM_004657chr2291 22 --196 --
NM_004660chrY124 ----1256
NM_004686chr821731 490 1236 1345 --
NM_004687chr172512 396 ------
NM_004693chr122353 25 --1297 --
NM_004709chrX41359 569 561 546 1603 1582 --
NM_004711chr22173592 3574 3534 3516 3503 3329 3181 3113 3052 2260 1205 895 849 842 758 667 494 --5863 827 682 672 27 12433
NM_004714chr193345 104 70 1282 ----
NM_004716chr113271 250 114 --1705 1689
NM_004717chr73587 402 347 11017 ----
NM_004719chr1252763 2274 2027 1116 664 11018 1201 --
NM_004726chrX55109 2115 2071 868 658 13552 24581 1915 --
NM_004729chrX31662 104 31 1406 ----
NM_004730chr531388 588 36 --1601 --
NM_004737chr2241267 1159 229 52 ------
NM_004738chr2032041 353 132 --21025 448 11944
NM_004745chr8106782 6245 6038 6009 5988 5029 2030 623 130 69 36099 1687 411 45424 2424 2195 418 11465
NM_004748chr1534040 1327 405 11559 ----
NM_004750chr19----3104 71 23 --
NM_004758chr1751165 839 227 106 88 --51095 1088 880 819 762 11084
NM_004760chr73778 759 665 ------
NM_004762chr1751567 1378 203 110 62 --21383 1317 1780
NM_004763chr25795 739 403 347 291 ------
NM_004766chr3165 ------
NM_004772chr521242 385 --1322 --
NM_004774chr1732370 2291 2231 32165 1157 1060 ----
NM_004788chr111261 1859 1340 --
NM_004796chr1431623 946 864 ------
NM_004798chr2043051 3044 860 740 23251 577 ----
NM_004804chr21529 21712 369 12526 --
NM_004807chr262265 1897 845 683 534 72 22105 98 41772 1673 1645 688 2568 473
NM_004808chr1042847 2591 2370 294 23153 960 --12693
NM_004821chr52768 115 --4733 326 238 41 --
NM_004824chr621143 103 1588 11289 --
NM_004849chr63317 185 62 ------
NM_004857chr1414386 1882 23591 1565 13601
NM_004860chr174385 377 182 135 --1205 1201
NM_004863chr1484199 4139 1682 856 805 527 453 39 24906 4208 45232 789 744 138 --
NM_004872chr11306 --150 --
NM_004879chr113336 328 70 --1352 --
NM_004884chr1551715 1466 534 398 240 21137 515 21472 1169 --
NM_004890chr17181 --2106 95 --
NM_004902chr201847 ------
NM_004904chr776355 5232 5102 4772 1003 782 570 --24779 1441 24459 4454
NM_004922chr103971 216 169 2760 52 ----
NM_004924chr19279 27 --11057 --
NM_004925chr92811 126 1134 398 71 26 --
NM_004926chr1461648 577 570 177 77 43 2141 58 3605 596 588 183
NM_004930chr12257 205 --1172 --
NM_004932chr551398 1331 1323 567 100 1325 ----
NM_004943chr1961169 931 292 265 212 130 1903 61229 1218 1023 1016 949 313 1401
NM_004947chr35792 675 556 541 29 41800 1741 739 56 1128 189
NM_004948chr1821303 1105 11439 ----
NM_004952chr13908 838 387 1895 2157 148 --
NM_004956chr734209 1802 735 ------
NM_004959chr951353 1011 1004 384 267 11482 41409 1383 277 272 1606
NM_004961chrX11308 1474 2565 236 --
NM_004965chr21------1140
NM_004973chr631672 1430 537 --11111 --
NM_004976chr11144982 4859 4719 4674 4625 4420 4319 3778 1975 1486 1439 1105 645 493 31413 889 609 44640 4469 4204 788 33762 1391 1386
NM_004977chr191527 --5550 465 415 408 72 --
NM_004978chr13655 454 375 21194 360 --31290 1224 1199
NM_004979chrX3444 282 99 --1785 1196
NM_004985chr1244419 4111 508 354 ------
NM_004992chrX218497 7848 7592 7437 7337 6714 6674 6540 6432 6179 6012 2966 2880 2526 1563 1300 1279 553 391 331 320 17741 88143 7788 7488 5876 1542 1402 454 445 27746 7367
NM_004992chrX218497 7848 7592 7437 7337 6714 6674 6540 6432 6179 6012 2966 2880 2526 1563 1300 1279 553 391 331 320 17741 88143 7788 7488 5876 1542 1402 454 445 27746 7367
NM_004995chr1441331 1322 1278 154 1432 2380 25 1561
NM_004998chr151330 1184 1989 --
NM_005010chr731913 1703 384 ------
NM_005011chr73490 448 176 ------
NM_005016chr122140 48 ------
NM_005022chr173169 160 47 ------
NM_005028chr1031790 856 792 12186 2740 601 --
NM_005056chr1235574 4744 1608 1846 1188 24632 1621
NM_005057chr121357 115 11702 ----
NM_005065chr1494766 3577 3512 2086 1985 1946 1734 758 96 --24036 1990 --
NM_005068chr61925 163 ----
NM_005073chr13--176 --1580
NM_005078chr1551699 1631 1382 1241 551 --21770 1248 --
NM_005080chr223963 124 99 ------
NM_005094chr95647 577 553 135 109 --3570 474 468 160
NM_005096chrX1128 --31211 433 357 --
NM_005109chr332256 613 203 --11955 --
NM_005110chr54659 588 148 31 196 ----
NM_005116chr20124187 4136 4003 3366 2895 2884 1810 994 975 810 760 327 1113 53956 3025 2792 695 354 --
NM_005121chr1721501 1460 --13326 --
NM_005124chr61171 --2176 162 --
NM_005135chr1542885 2757 1443 594 12450 3916 910 83 --
NM_005144chr881201 1154 974 937 393 379 362 126 --31072 291 228 1958
NM_005151chr1842285 419 331 144 1111 --1510
NM_005155chr62625 486 ----198
NM_005156chr943706 3380 1382 619 34664 4598 1901 23524 1686 --
NM_005166chr193304 272 115 1330 ----
NM_005182chr165596 579 522 178 138 1455 1613 --
NM_005184chr1951168 1087 236 89 77 1649 41420 1338 1331 1318 11327
NM_005187chr1641622 805 113 49 31416 1388 1358 41651 1640 1550 333 --
NM_005188chr1197069 6976 5730 5718 5090 2621 2387 2148 544 35798 5308 822 67659 6732 6614 6492 6450 5095 --
NM_005197chr1454251 4242 2493 2241 2092 ----1454
NM_005202chr13904 714 531 1234 21439 324 --
NM_005206chr1731056 926 433 --1553 --
NM_005211chr53554 228 26 1543 1564 --
NM_005215chr182123 110 --1653 --
NM_005216chr11231 1506 ----
NM_005219chr531782 1623 569 21272 577 31400 115 106 --
NM_005220chr1761405 956 552 222 72 22 11112 21437 1136 1248
NM_005225chr202305 114 1331 1972 --
NM_005227chr11542 127 ----
NM_005229chrX1230 141 2342 25 1948
NM_005231chr1121110 513 11361 ----
NM_005235chr277608 6129 6034 2459 1935 860 445 37793 6530 5599 25525 55 21760 89
NM_005238chr1152551 1206 1101 956 863 ----12685
NM_005241chr31877 2372 307 ----
NM_005256chr111632 1382 ----
NM_005263chr12891 70 --193 1394
NM_005274chr1----136 --
NM_005277chr4267 59 ------
NM_005278chrX1554 159 ----
NM_005281chr12896 94 1937 1941 1848
NM_005311chr752254 971 907 548 404 ------
NM_005312chr981066 982 897 748 713 706 698 315 12040 2953 320 1721
NM_005318chr22293 28 --11216 --
NM_005324chr17--11571 11387 --
NM_005334chrX91622 1317 1079 575 420 319 259 125 104 11646 71650 1229 567 508 264 81 72 11430
NM_005338chr793858 2768 1268 1190 806 696 512 297 174 23691 2877 --13116
NM_005339chr443680 2771 1717 611 --1621 --
NM_005342chrX21934 199 12698 --22693 914
NM_005347chr911684 21338 108 --21368 543
NM_005359chr1866408 5971 5500 2479 2320 1747 --15725 11843
NM_005370chr193492 249 99 --3821 519 90 --
NM_005374chr1762383 2324 1835 1503 438 290 12148 4432 367 222 59 1411
NM_005375chr62996 175 ------
NM_005376chr15785 440 411 402 258 1208 ----
NM_005386chr201679 --1853 2615 327
NM_005397chr752998 2526 902 887 606 --1591 2565 55
NM_005407chr1411302 --2524 406 1537
NM_005413chr21165 1390 2106 47 1172
NM_005418chr111689 --3620 585 132 --
NM_005430chr126928 807 207 113 92 21 1134 41053 781 650 643 --
NM_005436chr1073091 2785 2564 1632 1448 1265 1069 --11648 --
NM_005438chr111408 --2476 121 136
NM_005439chr124504 366 166 55 --4384 356 128 87 --
NM_005440chr1743257 2529 1021 882 --52663 2537 1286 539 329 13241
NM_005458chr972424 2213 1621 838 646 468 130 11767 ----
NM_005460chr51562 ------
NM_005465chr161751 1728 1544 151 144 134 2185 112 ----
NM_005474chr1721488 1176 --31528 514 499 1168
NM_005475chr1242601 1235 808 195 22595 2556 22749 2396 --
NM_005497chr1741649 1550 1423 455 45715 5374 2007 1251 21589 1454 11724
NM_005502chr912968 12577 ----
NM_005503chr1571132 841 722 715 391 144 47 --1405 --
NM_005505chr123729 615 71 --2776 620 --
NM_005507chr111317 1133 2183 157 --
NM_005522chr731397 473 245 ------
NM_005523chr741476 612 369 348 --2600 374 --
NM_005527chr62155 145 --1109 --
NM_005529chr17960 771 754 740 365 300 128 2227 40 2917 159 2760 687
NM_005578chr344836 4081 4035 412 ----1258
NM_005581chr193429 400 355 --3418 406 82 2447 442
NM_005584chr132275 154 --2159 89 --
NM_005587chr152832 247 ------
NM_005596chr922206 2120 15797 --15905
NM_005603chr181372 2697 454 ----
NM_005604chr632311 848 673 ------
NM_005607chr83941 747 29 --1782 --
NM_005614chr71845 --1680 --
NM_005619chr192132 82 --2273 87 --
NM_005634chrX163 --6552 56 50 44 38 25 --
NM_005637chr1821860 71 155 ----
NM_005638chrX21337 1229 ------
NM_005647chrX93375 3365 3232 2776 2743 2659 774 676 299 --32672 2601 785 12331
NM_005652chr1631209 326 123 ------
NM_005660chrX------1176
NM_005665chr174019 4006 3877 1887 1067 738 533 14116 ----
NM_005668chr533939 898 396 1757 ----
NM_005678chr153782 767 712 --3882 744 717 --
NM_005704chr161008 734 407 346 102 53 1390 1236 --
NM_005716chr192450 231 --3564 539 173 --
NM_005718chr3274 42 --1335 --
NM_005725chr121505 167 11756 ----
NM_005730chr1252998 2847 2344 2320 691 22573 357 --21430 31
NM_005736chr1051532 1500 1368 365 23 1536 3399 387 339 11394
NM_005737chr232079 488 329 --3521 389 236 --
NM_005738chr7------1209
NM_005746chr722314 2025 1787 ----
NM_005748chr1213099 12438 ----
NM_005759chr274656 4136 3390 1883 867 692 609 --14718 180
NM_005764chr14270 264 137 65 ------
NM_005768chr122206 67 --2618 254 --
NM_005778chr31151 --1369 --
NM_005785chr1251849 1420 1413 553 79 155 21758 256 --
NM_005789chr1762177 2032 1589 1476 766 113 31583 535 218 31763 1743 1481 --
NM_005803chr61355 --1116 3250 245 240
NM_005808chr373407 2971 2854 2657 1147 678 334 12364 13417 11129
NM_005811chr12192 --166 141
NM_005819chr183071 2536 2408 2359 2295 1357 650 211 --23061 2628 1166
NM_005822chr611886 1459 1706 --
NM_005828chr1795014 4396 4137 3789 1793 1522 1296 942 685 23203 163 24568 61 14598
NM_005834chrX1249 2229 195 ----
NM_005838chr11235 28 ------
NM_005839chr11992 ------
NM_005840chrX137620 6869 5713 5493 4643 2585 2383 2151 2072 1321 844 544 218 17582 27659 199 --
NM_005851chr113346 94 76 ------
NM_005852chr174986 849 89 26 --31102 183 99 --
NM_005853chr161565 --1108 --
NM_005859chr52199 153 1582 ----
NM_005876chr23797 752 563 --1785 1190
NM_005877chr2242318 2135 1712 210 --156 --
NM_005880chr1611505 --11382 --
NM_005892chr172384 96 --1283 1316
NM_005898chr111256 21192 132 11012 --
NM_005901chr1888499 7723 7612 6349 5718 5476 2371 1611 16628 11538 1944
NM_005902chr1554556 3019 1470 362 139 --64283 3461 2910 681 513 508 32968 527 519
NM_005904chr1821020 252 ------
NM_005907chr611535 --21208 1201 --
NM_005909chr574086 3984 3516 2835 1684 842 829 --22699 1595 32695 885 237
NM_005910chr17133933 3775 3705 3226 3201 2992 1366 1201 1144 1047 664 626 86 22592 1646 43716 1245 735 397 --
NM_005911chr21309 11147 ----
NM_005920chr1103694 3687 3191 3078 2751 1211 647 237 222 58 11260 103669 3514 3083 2518 1485 1246 1194 1127 877 397 23205 393
NM_005933chr11152413 2401 2231 2126 2049 1940 1209 1185 809 718 562 520 464 362 48 1863 12801 --
NM_005934chr1982237 2195 2020 1711 908 433 427 166 --2438 223 22261 2256
NM_005937chr1743903 1277 917 688 23447 1225 74068 3921 2920 2869 1229 514 271 21093 927
NM_005938chrX41368 532 352 287 --11323 11268
NM_005941chr822917 831 13508 ----
NM_005943chr641564 1503 667 661 --11508 --
NM_005955chr143892 3404 2172 22 24320 151 14356 --
NM_005957chr1174889 3688 3560 3407 3393 3227 3141 2981 1967 1935 1309 1160 863 495 282 125 84 --4468 118 106 35 --
NM_005962chr1041495 1453 712 317 --1705 --
NM_005962chr1041495 1453 712 317 --1705 --
NM_005967chr123293 218 128 --172 --
NM_005984chr221505 --3518 482 362 130
NM_005986chr1372550 2314 1958 1793 1108 759 166 --42698 548 75 70 --
NM_005990chr511040 11740 21014 970 1141
NM_006007chr943887 3117 2822 449 --13892 --
NM_006011chr15193936 3802 3640 3089 2939 2882 2855 2813 2719 2685 2676 2665 2614 1214 1127 929 905 386 248 23520 2746 34025 2635 1297 21293 1238
NM_006015chr111006 1190 3925 244 171 2240 93
NM_006030chr371643 1137 536 387 322 212 76 21262 644 361 28 22 2591 35
NM_006033chr1841480 849 239 87 --1872 --
NM_006036chr232334 1017 485 ------
NM_006037chr264676 4562 4130 1412 461 158 13281 23331 1965 --
NM_006038chr202500 422 --61862 567 551 511 363 256 --
NM_006047chr20----13368 --
NM_006054chr1131371 329 145 --1512 --
NM_006058chr54552 284 186 28 --1715 --
NM_006077chr104848 641 310 270 1520 132 --
NM_006079chr61221 --3624 615 226 --
NM_006080chr73923 558 201 ------
NM_006085chr11416 2265 180 ----
NM_006091chr15111676 1644 1598 1579 1562 1495 1214 665 522 401 54 11685 3574 486 137 1236
NM_006094chr852055 1931 621 600 534 --32060 1937 589 --
NM_006096chr861542 498 395 348 264 74 --123 --
NM_006099chr12902 358 ------
NM_006106chr1122512 890 ------
NM_006113chr131815 1492 23 11685 ----
NM_006133chr11102119 1774 1560 997 956 905 788 579 312 155 --92238 2197 2124 2102 2018 1707 770 669 451 52234 2169 1986 889 820
NM_006134chr2131463 622 312 ----11644
NM_006145chr191404 --1283 --
NM_006148chr1752379 2302 2123 606 529 --42384 1945 792 123 12710
NM_006154chr1522495 2090 --11952 --
NM_006157chr112134 48 ------
NM_006160chr1751551 1334 518 292 80 --41303 1045 91 46 --
NM_006162chr1851646 1179 608 380 143 --21601 44 --
NM_006176chr112718 152 --3704 699 295 3250 245 240
NM_006180chr921799 1466 21596 397 ----
NM_006182chr13146 79 60 --2160 153 --
NM_006185chr112147 29 1546 ----
NM_006187chr1272996 2431 1057 971 871 311 190 23144 2504 42372 1997 1296 393 --
NM_006190chr221059 352 145 156 --
NM_006191chr123397 89 42 --1149 1132
NM_006194chr144451 297 53 30 182 186 --
NM_006195chr921379 1238 1386 ----
NM_006201chrX6814 740 452 219 177 50 1155 2748 307 31105 893 339
NM_006206chr432361 437 428 --142 --
NM_006224chr1742147 2132 893 812 1756 42152 2081 1972 67 --
NM_006237chr1331671 708 148 --1588 1715
NM_006238chr651832 1445 698 519 59 21551 735 21905 320 --
NM_006245chr61280 1668 2730 672 --
NM_006247chr192443 332 128 --189
NM_006251chr523199 531 --1579 1739
NM_006265chr83986 516 479 1228 ----
NM_006266chr92192 87 2534 106 1303 --
NM_006268chr1141091 1020 972 922 --1175 --
NM_006279chr12597 62 --2911 639 1663
NM_006289chr94389 159 141 103 --2380 304 1300
NM_006293chr153351 185 159 ------
NM_006294chr81356 1453 ----
NM_006298chr653441 3296 2799 2737 1044 31203 1089 622 2848 696 --
NM_006301chr12--1680 --1248
NM_006306chrX94531 4343 2282 638 581 459 279 259 22 22037 1268 34477 4470 1516 --
NM_006317chr52816 357 ------
NM_006321chr351917 1843 1391 454 140 11906 1118 1460
NM_006325chr121620 ----186
NM_006359chrX22409 1567 ------
NM_006371chr384290 4165 3925 3888 3673 3451 781 564 13288 34620 3457 3292 24876 193
NM_006373chr1721259 341 11397 2378 265 11405
NM_006375chrX31918 1591 165 ------
NM_006379chr71306 ----1657
NM_006380chr1763404 2845 2758 555 509 319 11750 1964 --
NM_006387chr194941 882 288 200 1412 --1922
NM_006389chr115902 551 376 241 119 11278 61288 1282 1270 1005 228 35 --
NM_006390chr123739 558 174 --11389 --
NM_006400chr12198 --140 1105
NM_006411chr64708 222 191 56 1936 5921 354 318 236 170 2413 363
NM_006420chr2042385 1346 1306 429 1921 ----
NM_006421chr8135 1157 ----
NM_006424chr431878 1706 78 --31684 1332 89 51884 1448 1431 1343 1328
NM_006434chr1022295 1087 ------
NM_006439chr42535 529 --1366 1362
NM_006451chr5------1871
NM_006458chr111259 1383 5387 288 267 152 146 2354 317
NM_006459chr101620 --1116 --
NM_006464chr2104406 3746 3348 1727 1670 1560 1474 1387 286 164 --1381 14653
NM_006483chr193345 104 70 1282 ----
NM_006484chr193345 104 70 1282 ----
NM_006489chr1451508 1371 1344 1334 1257 21530 46 21361 705 --
NM_006494chr194677 599 280 36 --1645 1653
NM_006516chr191482 1331 1317 545 537 488 461 367 305 1295 11322 --
NM_006517chrX81674 1616 1599 1532 749 426 334 124 31445 925 50 41537 726 249 54 11978
NM_006521chrX71279 1227 1152 413 285 206 35 11254 41297 920 145 83 11210
NM_006526chr201574 1397 ----
NM_006534chr2052622 2427 1125 852 608 12615 21182 257 --
NM_006544chr1425449 2060 --15295 --
NM_006546chr17136524 6496 5986 5518 5348 5136 4438 2365 1472 1080 752 597 190 46609 5905 1025 308 55909 5523 4357 2496 2342 15917
NM_006548chr35641 626 365 273 261 --1233 --
NM_006549chr1222427 2239 --22458 1823 12472
NM_006557chr931231 1202 264 1453 11110 --
NM_006559chr12420 143 1930 ----
NM_006561chr1085640 5026 4959 4733 4144 4123 2269 1446 34773 4197 4016 11346 --
NM_006565chr16------1320
NM_006587chr41649 1483 ----
NM_006589chr11116 --1439 --
NM_006593chr23820 104 87 ------
NM_006599chr1666405 3158 1402 1374 874 328 21322 1190 21772 1766 16265
NM_006606chr2082833 2726 2719 2054 2041 912 497 252 130 1306 12047
NM_006609chr222874 1000 11092 ----
NM_006620chr663704 1932 1854 1846 1509 165 ------
NM_006621chr141550 1337 440 30 --1607 --
NM_006624chr10124 --11720 --
NM_006628chr1534645 3676 1162 24001 3368 14025 --
NM_006650chr5143860 3760 3550 3541 1068 1001 839 710 697 604 586 187 164 30 43668 2467 195 175 63658 3529 2572 890 878 199 33448 3348 718
NM_006651chr4121411 1390 1222 1198 1057 534 525 265 243 172 153 126 11233 4502 318 194 38 --
NM_006653chr6160 --279 24 --
NM_006654chr1243933 3531 1268 531 13505 24150 3544 --
NM_006662chr16----3300 255 42 --
NM_006667chrX2868 61 ------
NM_006675chr1273270 3025 2842 2817 2731 2486 1287 11065 3370 109 26 42339 1030 387 129
NM_006688chr178491 445 431 122 87 77 36 23 ----1305
NM_006690chr2082051 1882 1787 823 406 400 370 271 22230 841 62010 1967 1481 934 470 350 1477
NM_006691chr111461 --1111 --
NM_006698chr2041308 452 360 302 --1266 --
NM_006713chr51216 ------
NM_006717chr922633 1208 2484 315 21151 1137 --
NM_006722chr31506 --12577 --
NM_006735chr7----1108 --
NM_006741chr1211068 --1209 1414
NM_006742chr1651678 1594 743 660 255 --41648 1435 1305 568 --
NM_006749chr841135 867 804 162 1857 --21154 150
NM_006750chr1677377 7233 3156 2189 2091 1729 609 25983 1220 56672 5455 4997 2497 2046 154
NM_006754chr71415 ------
NM_006756chr821399 142 ------
NM_006761chr171733 --257 38 153
NM_006766chr84941 907 755 642 --1625 --
NM_006771chr171221 --1882 --
NM_006772chr6101586 1225 1198 595 572 509 371 348 303 285 145 101705 1662 1567 1425 1323 355 266 193 144 49 41658 1595 1414 444
NM_006775chr621975 33 1272 --1304
NM_006805chr5----2177 84 --
NM_006809chr20161 --1144 --
NM_006814chr201184 124 1147 12399
NM_006822chr17157 --1155 --
NM_006827chr1492570 1336 1292 1123 936 778 458 161 27 2798 558 ----
NM_006833chr74370 344 311 120 ------
NM_006852chr1762844 2536 2115 1028 223 142 11008 ----
NM_006854chr721899 1855 --1419 --
NM_006856chr123286 222 44 --11066 21150 774
NM_006857chr22702 358 ------
NM_006875chrX1354 1342 --148
NM_006885chr16103516 3413 3129 3100 3043 2932 1564 1353 726 412 1359 11110 --
NM_006887chr22521 60 --1179 --
NM_006888chr1432449 2379 591 --13454 --
NM_006892chr206956 917 884 320 155 76 ------
NM_006892chr206956 917 884 320 155 76 ------
NM_006896chr741112 335 260 156 --2424 161 --
NM_006901chr15176 1532 ----
NM_006913chr61378 --3421 345 25 --
NM_006922chr212277 ------
NM_006924chr1723883 3722 13078 ----
NM_006927chr1642077 746 575 465 22020 1783 41629 844 548 296 --
NM_006931chr12--3145 134 125 145 --
NM_006940chr1241863 1448 1398 559 11840 --11880
NM_006941chr2271125 988 461 431 321 168 30 1719 3848 374 24 2174 74
NM_006943chr20122836 2033 1265 1062 911 478 449 325 303 276 233 29 31009 177 95 81073 983 797 526 508 350 198 135 --
NM_006946chr112400 74 --3503 497 236 1524
NM_006950chrX5879 862 734 680 226 1897 3901 287 124 --
NM_006990chr192186 2147 1957 1669 872 610 505 398 23 --21858 710 --
NM_007005chr92381 71 --178 --
NM_007006chr1642876 559 319 128 ------
NM_007008chr2------1598
NM_007011chr1595400 2171 2005 1641 1084 987 950 433 59 45629 4955 4915 4216 34408 4401 4172 12129
NM_007018chr9141 ------
NM_007024chr33423 150 28 --1433 --
NM_007026chr172516 73 ------
NM_007030chr5194317 4299 3286 3253 3244 2072 2041 1948 1886 1630 1466 1214 1142 1100 918 851 547 184 59 21750 1111 24525 4241 44534 4307 4237 4215
NM_007033chr172126 1909 1891 1465 1400 921 866 ----22220 403
NM_007036chr51828 ----1718
NM_007039chr1421773 1665 11428 ----
NM_007040chr1911102 1114 3302 256 240 --
NM_007047chr692203 2078 1789 1769 1595 849 794 250 65 1421 12389 --
NM_007050chr20107665 7149 6862 6144 3125 1182 613 566 301 104 37598 6211 6079 97423 6651 6091 5367 5342 5079 2768 1039 779 17419
NM_007064chr3196 21153 180 11420 --
NM_007067chr1741275 1150 1075 371 1324 21037 123 --
NM_007081chr2261144 460 434 427 384 119 --2261 94 --
NM_007121chr192127 65 1258 141 --
NM_007124chr621597 1256 ------
NM_007129chr131850 --1323 139
NM_007144chr173809 359 103 --71083 1060 1054 966 524 76 44 --
NM_007159chr31385 ----11551
NM_007162chr64487 188 107 65 --2449 76 --
NM_007170chr11330 ----1348
NM_007174chr1262382 1591 953 882 220 149 11705 3791 135 107 --
NM_007185chr171103 724 704 415 405 363 47 1423 1163 --
NM_007192chr1431025 998 423 ------
NM_007207chr12802 195 ------
NM_007213chrX2243 140 1596 2146 46 142
NM_007232chr204831 818 405 79 --4769 301 284 147 --
NM_007236chr1531512 677 285 2985 198 283 77 11587
NM_007245chr164754 736 385 377 --2611 597 --
NM_007249chr1388429 8414 7065 7031 6666 6052 5709 1474 21099 404 37673 3255 408 26634 110
NM_007256chr1121596 543 --11281 11277
NM_007260chr14689 672 307 184 129 1102 --
NM_007271chr621291 539 --1513 11179
NM_007275chr33851 779 29 2873 237 4934 910 822 254 --
NM_007278chr17----198 --
NM_007286chr51566 --31311 613 23 1754
NM_007292chr17104871 4546 4343 3957 3729 3595 3235 1792 1594 869 --24551 3735 43788 3622 3454 3215
NM_007320chr192318 53 1114 166 173
NM_007326chr225801 634 71 62 27 142 4731 286 260 32 --
NM_007327chr9111177 1090 1071 1026 785 774 446 404 336 148 118 --61189 1035 751 455 425 177 2410 259
NM_007350chr1223726 2936 1139 1107 --
NM_007353chr742377 2289 845 716 --33022 743 557 --
NM_007363chrX3725 113 71 1714 1357 --
NM_007365chr152121 2023 1992 1621 1422 --42050 593 508 187 --
NM_007371chr9161 --1485 --
NM_007375chr11376 --11088 --
NM_012064chr1221028 323 11159 1229 1222
NM_012074chr1431134 900 137 --3168 156 37 11140
NM_012081chr553649 2593 2363 2272 605 --1206 1202
NM_012095chr1032792 2773 2304 --1455 1417
NM_012098chr921334 568 --149 --
NM_012101chr114939 756 369 33 1187 1894 --
NM_012102chr152377 2080 1673 374 342 12477 --11623
NM_012104chr1183493 3296 2684 2456 1225 660 120 45 63472 3428 2795 702 247 105 1894 12786
NM_012104chr1183493 3296 2684 2456 1225 660 120 45 63472 3428 2795 702 247 105 1894 12786
NM_012121chr17----21472 306 2516 60
NM_012134chr171750 1597 1388 1244 753 664 54 21614 515 21365 87 2362 83
NM_012137chr152833 959 629 510 160 22036 836 4993 568 166 67 12806
NM_012141chr1333100 1098 330 --11147 --
NM_012153chr1131722 958 269 ------
NM_012156chr20123343 2996 2932 2831 2546 2178 2123 760 754 677 412 349 12619 22925 2731 33378 2404 748
NM_012164chr936257 2448 787 16360 26230 2560 36365 2567 2048
NM_012193chr1154870 3964 3318 1503 566 --1150 15213
NM_012199chr183621 3150 1785 1434 757 661 622 65 31412 878 228 43252 1098 616 220 --
NM_012200chr112355 159 --127 --
NM_012202chr11--198 2151 102 --
NM_012214chr276131 5475 5468 3925 2435 2333 1342 35538 1846 1506 ----
NM_012229chr1011308 11240 ----
NM_012232chr1781899 1575 1428 554 392 344 123 109 1850 1138 125
NM_012234chr372687 1041 947 402 174 79 59 --11501 --
NM_012244chr1461509 1263 1168 303 239 95 1197 51435 1377 1196 1173 630 31524 542 223
NM_012259chr63981 287 73 ------
NM_012261chr202552 21 ------
NM_012262chr155239 4394 3665 1933 419 ----14316
NM_012281chr721524 978 ------
NM_012282chrX4205 172 68 50 2750 678 3226 220 76 --
NM_012287chr344576 3498 3428 1272 --14156 --
NM_012288chr6145043 4912 4127 3585 2250 2223 2171 1948 1910 1269 1115 967 812 253 24454 1603 34902 4687 240 14100
NM_012296chr11143975 3403 3154 3022 2966 2835 1581 1484 881 822 246 201 189 91 1366 32913 2829 96 --
NM_012297chr422165 803 ------
NM_012301chr74585 572 548 26 --21460 31 --
NM_012304chr5101960 1850 1835 1723 1010 890 383 364 322 91 --2931 348 --
NM_012306chr12123484 3475 3393 3135 2245 1196 1130 1016 844 786 770 41 12340 22267 2257 2216 133
NM_012308chr1161684 1636 765 656 356 106 ----2739 648
NM_012309chr1164635 4210 4182 4158 884 273 13825 23973 1389 31417 421 107
NM_012316chr1135333 4196 3947 3648 3637 2167 2147 2133 1794 1553 1341 169 109 24859 3569 31869 1863 148 --
NM_012325chr2031609 1327 157 2636 41 ----
NM_012326chr24767 642 306 289 --3781 703 61 2295 229
NM_012329chr17----11541 --
NM_012330chr1011660 ----1392
NM_012334chr574754 4746 4047 3520 1700 1294 900 --23937 47 13085
NM_012338chr71182 ------
NM_012382chr554390 4232 4188 4164 4050 --14245 --
NM_012396chr12588 35 --2626 546 2489 44
NM_012398chr19102944 2928 2385 1191 1074 804 748 613 496 193 12912 102933 2885 2789 2645 2523 2315 924 656 225 73 32777 2625 115
NM_012402chr1141212 1147 518 512 11386 1276 --
NM_012408chr203740 199 25 ----131
NM_012414chr1----1177 --
NM_012426chr163430 325 70 ------
NM_012456chr11122 135 139 --
NM_012461chr141535 183 1553 --
NM_012464chr422112 1151 ----12909
NM_012473chr223565 503 237 --2576 512 --
NM_012478chr175989 685 268 181 41 --3322 47 28 --
NM_013233chr23190 102 22 --294 49 --
NM_013236chr222828 467 ------
NM_013253chr111507 --1243 11193
NM_013255chr778460 6754 6230 3559 3509 2718 493 38393 6432 1582 17951 17259
NM_013257chr832028 842 325 11856 ----
NM_013261chr423678 2318 13071 22882 1365 1591
NM_013262chr61911 --11122 --
NM_013269chr1254273 4147 3479 1731 508 24330 4230 11551 --
NM_013271chrX2119 25 --2134 52 --
NM_013305chr185607 324 243 230 36 1276 ----
NM_013333chr195346 265 141 129 30 --2162 99 1158
NM_013341chr21163 12397 ----
NM_013354chr8----11259 --
NM_013372chr1522320 225 13363 1891 1277
NM_013377chr12--2539 503 ----
NM_013382chr1432014 1972 75 --22019 605 11739
NM_013403chr195803 795 755 547 222 1571 --1702
NM_013410chr111076 --1368 --
NM_013411chr142729 2110 665 41 12563 22591 2030 --
NM_013433chr1961939 1884 1452 1423 712 166 --11428 21557 704
NM_013446chr721359 499 --11096 --
NM_013448chr142677 301 ------
NM_013449chr1232997 168 44 1899 52943 2357 838 569 562 --
NM_013943chr143099 1064 218 170 21115 251 12179 --
NM_013951chr2102474 2383 931 812 710 582 501 488 384 132 22410 1980 11933 2686 558
NM_013952chr2112551 2460 1008 889 787 659 578 565 461 209 47 22487 2057 12010 2763 635
NM_013953chr2112551 2460 1008 889 787 659 578 565 461 209 47 22487 2057 12010 2763 635
NM_013960chr84739 237 118 98 --145 --
NM_013992chr2112551 2460 1008 889 787 659 578 565 461 209 47 22487 2057 12010 2763 635
NM_013993chr65581 242 154 114 83 --2289 275 1567
NM_013994chr65581 242 154 114 83 --2289 275 1567
NM_013999chr176514 417 354 113 107 82 --21379 91 21388 98
NM_014001chr1721130 27 --1484 --
NM_014016chr311446 ------
NM_014023chr1041939 880 851 247 ------
NM_014030chr178825 818 751 414 308 282 223 126 3366 336 31 41129 1049 370 156 284 65
NM_014042chr113237 217 52 161 ----
NM_014048chr1665126 3892 3661 3333 1041 404 ----11419
NM_014056chr331722 1424 270 --11729 --
NM_014079chr34935 351 116 32 --151 147
NM_014089chr13--2754 91 ----
NM_014112chr833971 3347 664 24457 2015 ----
NM_014141chr774582 4191 3719 1865 1272 1150 72 --65205 4079 3801 3795 3618 1014 --
NM_014154chr32635 505 ------
NM_014155chr1125030 2674 15572 16872 1890
NM_014157chr1683937 3256 3143 2900 2474 1390 868 118 12944 1551 --
NM_014189chr41317 11380 21187 191 2398 187
NM_014190chr43669 312 47 11732 21539 543 2750 539
NM_014212chr125929 866 843 786 296 1148 1936 --
NM_014225chr192275 98 --2333 41 --
NM_014231chr12102093 2035 1964 1911 1696 1578 693 125 88 37 --11916 --
NM_014232chr1741182 447 257 236 --3390 94 67 11642
NM_014232chr1741182 447 257 236 --3390 94 67 11642
NM_014233chr1751709 1522 1421 434 64 --32032 2026 1716 1275
NM_014234chr6242 31 ------
NM_014238chr1741612 1404 655 528 11520 2383 116 --
NM_014240chr383920 3343 3075 2978 2830 1474 1432 665 --12671 13371
NM_014246chr2242039 426 358 38 --22045 932 --
NM_014271chrX121 --1613 1602
NM_014280chr11619 ----188
NM_014284chr1--2856 119 3891 189 161 --
NM_014289chrX41281 566 549 462 1314 21240 40 11270
NM_014292chr2241813 1684 753 213 1292 2185 74 170
NM_014299chr1942163 1925 830 218 1850 1397 1845
NM_014309chr2285056 4584 4414 3962 3366 1636 1296 864 25160 724 34952 4928 4464 12040
NM_014313chr141386 1312 1218 66 11139 --11321
NM_014317chr101197 ------
NM_014331chr435125 840 819 14757 --15983
NM_014333chr1142034 1983 995 198 ----1369
NM_014338chr222154 85 ------
NM_014368chr971968 1874 1864 1665 451 123 94 138 3781 111 99 --
NM_014372chr121756 390 11383 ----
NM_014376chr582006 1809 1633 1029 525 367 293 122 22089 314 22079 142 21570 306
NM_014382chr31285 --11388 --
NM_014392chr421298 166 --1533 --
NM_014415chr321628 1235 --11160 --
NM_014417chr193304 291 67 --2655 57 3750 663 156
NM_014418chr1441786 1323 462 154 1340 21915 1884 --
NM_014423chr534914 4588 82 ------
NM_014426chr201539 ------
NM_014431chr1061580 1204 624 561 319 27 --1194 --
NM_014445chr321554 456 ------
NM_014456chr10----1317 --
NM_014469chr112659 78 ------
NM_014470chr12--1207 --1244
NM_014488chr111194 1243 ----
NM_014491chr7------160
NM_014494chr1641804 679 672 212 --21854 335 --
NM_014506chr921696 155 --11350 --
NM_014507chr2261119 1111 912 484 311 166 --1832 --
NM_014550chr222228 138 1584 4662 588 197 79 --
NM_014554chr1241640 749 229 110 --12206 11589
NM_014562chr23648 119 81 --3653 197 154 1568
NM_014563chrX1822 --1668 1828
NM_014564chr93961 666 175 2717 28 --1722
NM_014571chr1123003 2954 2765 2670 2443 2423 2397 1950 847 542 281 190 --32714 668 643 32301 1177 25
NM_014591chr1041110 941 228 70 21183 837 51199 841 354 300 293 21059 1054
NM_014607chr232044 1652 418 12052 ----
NM_014613chr572978 2540 2463 1993 1198 765 311 1775 1250 131
NM_014614chr221308 52 ------
NM_014622chr112954 714 ------
NM_014623chr62192 67 1228 ----
NM_014630chr1551429 1149 960 639 54 12750 --1952
NM_014634chr2272779 2525 1193 1096 397 148 38 1129 52559 2448 2209 1229 573 2588 107
NM_014636chr9104202 3825 3407 3314 3008 2708 1490 1016 274 180 1409 13014 1152
NM_014661chr10103475 3358 2950 2691 1209 1073 1027 995 147 54 43878 3419 2907 2584 33837 2588 1197 32537 1193 1079
NM_014665chr8153339 3308 3274 2415 925 839 709 653 640 623 608 584 478 470 32 33396 890 144 32942 2484 1053 2854 488
NM_014666chr52431 86 ------
NM_014667chr332108 2078 1701 11511 ----
NM_014676chr1----1447 --
NM_014682chr81544 --11657 --
NM_014683chr172415 203 180 184 --
NM_014686chr1941819 676 665 42 31941 1687 118 --3988 123 72
NM_014690chr7113051 2861 2136 2096 1991 1972 1063 952 472 363 308 12851 32736 839 31 --
NM_014701chr1563251 3120 2266 1357 1283 686 --21373 371 --
NM_014702chr633299 3254 202 ------
NM_014707chr722209 1744 ------
NM_014713chr21355 ------
NM_014715chr111174 1876 1880 --
NM_014721chr697269 6450 6228 5225 4897 2629 2556 1752 1410 35690 5091 4820 12612 --
NM_014726chr1761246 498 390 271 171 48 1987 21236 1132 11117
NM_014727chr192102 34 --1109 --
NM_014729chr831823 1485 145 ------
NM_014730chr1285054 5041 4606 4537 3203 1972 594 179 --45240 5219 4959 3624 35236 906 828
NM_014730chr1285054 5041 4606 4537 3203 1972 594 179 --45240 5219 4959 3624 35236 906 828
NM_014731chr2061605 1577 1478 404 287 154 --21361 374 --
NM_014732chr16175042 4683 4628 4444 4339 4259 2071 1880 1845 1345 1332 1097 482 449 425 255 197 24514 77 45400 3708 891 119 13871
NM_014737chr2093874 3815 3535 2861 1610 1496 1251 1195 641 131 22585 2579 --
NM_014739chr634241 2976 2860 ------
NM_014742chr2051493 1341 1288 531 482 11688 152 31097 418 392
NM_014746chr262761 817 543 390 223 27 11611 33974 3359 3095 23400 3265
NM_014747chr1134105 3862 2183 1868 1832 1336 1306 1284 1214 629 474 327 237 22319 136 35414 3987 1590 34767 821 564
NM_014751chr821464 75 ------
NM_014755chr263608 3448 3401 226 85 30 11492 ----
NM_014758chr1162059 1845 745 720 460 314 12024 22008 711 1707
NM_014761chr162474 134 1395 ----
NM_014764chr123967 481 251 --1470 1487
NM_014765chr152537 2529 2108 816 672 ------
NM_014766chr763573 1360 902 153 72 43 33210 1283 1224 22836 1273 --
NM_014767chr10133564 3300 3061 2943 2691 2344 1305 1183 613 458 436 279 111 33660 3073 1487 43585 2743 1162 1065 --
NM_014770chr1281027 946 260 219 176 104 84 23 --3494 129 29 1110
NM_014772chr1853058 2981 2936 541 278 --63574 2963 2631 595 588 308 --
NM_014774chr182876 2197 2173 1179 1031 978 870 122 22987 2356 ----
NM_014784chr15967 924 914 272 92 2793 294 2818 36 --
NM_014790chr5189 1383 ----
NM_014797chr673177 3058 2722 2419 1143 1070 155 1788 12544 --
NM_014803chr101346 1563 1872 --
NM_014807chr114781 615 587 63 --2127 49 --
NM_014810chr142617 2522 738 261 ------
NM_014812chr11281 ------
NM_014820chr351576 1422 1313 603 44 --11366 --
NM_014824chr1121907 1725 --11394 --
NM_014826chr194189 3693 3272 3118 1000 899 272 171 45 13776 33780 2820 79 --
NM_014827chr131427 1248 471 11089 ----
NM_014828chr1461728 950 740 561 516 129 ------
NM_014829chr52427 168 ------
NM_014830chr1283683 2719 2669 2473 1436 1365 1259 1166 13102 13691 22631 1344
NM_014832chr132716 107 ------
NM_014838chr2242658 1909 478 161 1679 ----
NM_014840chr1263361 2616 2367 1151 829 244 ------
NM_014847chr1----3174 168 114 1129
NM_014848chr1572506 2429 2301 1890 1836 1024 505 --1205 12535
NM_014849chr14932 273 102 80 21269 200 1109 21228 1223
NM_014850chr374479 3576 3031 1922 1336 817 734 11709 21341 786 44738 3464 1714 797
NM_014858chr13923 845 794 11082 1389 --
NM_014869chr341238 1200 356 223 --1232 --
NM_014871chr12------1577
NM_014872chr921789 926 --11794 --
NM_014873chr183552 3048 1604 1239 1074 864 457 368 13932 21448 882 --
NM_014877chr1777579 6448 5595 1859 1164 1127 605 12292 35580 5286 2069 --
NM_014880chr232437 2047 223 2509 400 ----
NM_014891chr72592 527 11485 173 --
NM_014893chrY32143 1534 740 ------
NM_014897chr1722966 2702 --12548 12708
NM_014898chr1922038 607 11580 ----
NM_014901chr542325 377 274 223 1583 41570 1473 1430 607 11438
NM_014902chr2021149 972 11239 31243 1142 1128 --
NM_014903chr1252441 2186 1994 695 96 32174 490 395 1704 --
NM_014904chr10----33197 1232 1183 --
NM_014905chr232030 1597 494 --11702 --
NM_014906chr1733605 3085 264 13258 1303 --
NM_014909chr1453201 2875 2670 53 29 12889 13218 --
NM_014914chr241163 173 130 96 1146 1120 --
NM_014921chr1952697 1190 1077 336 107 12953 32943 2646 329 12704
NM_014925chr121243 2673 299 ----
NM_014926chr33895 122 104 --2806 764 --
NM_014931chr192112 103 --1173 --
NM_014935chr1183742 3477 3259 3187 3167 2941 2814 2768 2404 1510 1361 1300 1135 1066 485 283 122 80 32966 2571 1259 42719 2592 594 101 2925 507
NM_014939chr1821449 1287 ------
NM_014944chr161320 1087 377 235 170 52 1325 2958 175 --
NM_014945chr531909 1484 492 ------
NM_014948chr2092455 2160 2058 2052 1594 553 541 324 75 2359 142 22388 234 1276
NM_014952chr1552032 1328 695 427 28 --2679 632 --
NM_014969chr1--2915 274 ----
NM_014977chr144493 171 150 36 --187 --
NM_014982chr1443702 1508 164 147 14522 21445 189 --
NM_014988chr442029 1883 962 719 ----12668
NM_014989chr622023 1589 11376 ----
NM_014990chr144426 211 46 33 --11123 --
NM_014991chr432751 2649 533 12172 --1788
NM_014994chr1592203 2147 2115 1976 1532 884 832 487 452 11834 31960 796 622 22251 2246
NM_015000chr122337 260 21898 674 ----
NM_015002chr1231759 1590 1522 1336 --1117
NM_015008chr3103014 2648 1319 1223 1094 627 535 414 391 30 13362 ----
NM_015009chr31188 ------
NM_015015chr1962003 814 712 666 619 337 21505 225 31863 755 114 --
NM_015017chr12463 260 --2468 308 --
NM_015020chr1621158 590 --23093 350 12410
NM_015024chr81280 --21342 1129 --
NM_015026chr121393 --13637 --
NM_015027chr1641362 816 776 297 ------
NM_015032chr131555 1670 ----
NM_015033chr9102452 2421 2385 2219 2090 1248 1198 326 294 173 1562 71324 1042 260 219 188 116 100 12228
NM_015035chr20136023 5917 5735 4841 4274 2227 2205 2192 1635 1531 1478 1448 166 15514 1332 11158
NM_015039chr193386 2897 1496 1293 1159 941 510 356 317 --23107 2904 --
NM_015042chr15104267 3297 3073 2835 2745 1479 505 450 384 160 23203 2947 44046 3107 2670 406 14136
NM_015044chr1662868 2455 2232 792 681 393 --22751 2473 --
NM_015045chr1031529 1513 140 ----11519
NM_015052chr731220 525 46 21256 391 ----
NM_015063chr1961339 1218 356 323 246 31 21320 416 51252 1223 442 311 134 1287
NM_015068chr773856 1428 1169 568 248 153 108 --23902 898 --
NM_015069chr16123 --1408 --
NM_015071chr5125359 4968 4712 3996 2486 2323 2108 1953 1249 1088 696 644 34426 4005 948 34973 1105 469 1465
NM_015075chrX121822 1811 1733 847 838 828 775 666 619 584 538 430 --12852 815 803 790 748 739 565 383 365 44 38 32 51773 786 781 342 330
NM_015076chr674316 3204 2821 2774 1811 1387 209 44393 2966 2934 2811 ----
NM_015079chr1553014 3007 2290 1113 613 22832 2451 1781 11214
NM_015082chr541796 456 328 37 42411 1740 919 722 1780 21587 810
NM_015084chr53412 99 23 ------
NM_015086chr1261439 1388 1197 1025 612 40 --1961 11327
NM_015090chr1165789 5750 5378 5294 5206 5173 4785 4310 2402 2329 1563 1474 1306 307 162 97 11500 95925 5848 5808 5516 4354 1058 1006 549 282 14642
NM_015092chr1664374 4039 1596 942 401 360 11762 --1640
NM_015093chr621531 541 1622 ----
NM_015094chr22114503 3771 3662 3644 3197 1855 1638 1357 729 382 33 24124 3563 124339 4252 3841 3671 3254 1868 1862 1631 1510 1338 777 673 44304 3610 3277 226
NM_015097chr312212 --156 --
NM_015099chr172489 165 2483 230 2559 27 --
NM_015100chr151605 1557 821 744 701 --31576 826 129 11572
NM_015101chr132011 1956 758 --22016 880 --
NM_015103chr36934 913 286 201 186 164 --3939 192 75 --
NM_015107chrX62157 1823 317 71 35 26 --3488 437 281 --
NM_015113chr17121971 1912 1879 1829 1822 1683 1673 625 569 456 413 403 11840 1910 31658 703 123
NM_015115chr463161 1298 864 842 715 51 ------
NM_015125chr193455 149 37 ------
NM_015133chr1661175 355 330 205 60 49 1529 81327 1319 1222 1109 1071 433 408 95 1588
NM_015134chr173576 475 174 2441 56 ----
NM_015138chr1592827 2416 992 816 803 411 307 216 54 --22780 2323 --
NM_015144chr1653624 3222 3160 415 396 --1249 --
NM_015150chr33371 311 105 --1286 --
NM_015155chr1062957 2772 2762 1272 532 65 1674 --1624
NM_015171chr164348 190 99 43 ----1422
NM_015176chr111210 ------
NM_015191chr1142713 2096 665 125 ------
NM_015193chr871316 1292 1040 1025 444 218 211 31503 1134 285 31093 944 254 --
NM_015194chr1771415 613 595 542 396 230 39 1267 51471 1464 1364 419 128 1493
NM_015199chr312092 1901 --12508
NM_015200chr411765 ----12157
NM_015205chr13204530 4484 4361 1908 1841 1264 1235 1206 1190 1177 1169 1115 1086 870 660 553 439 298 117 62 24182 3642 41882 1575 1153 392 1156
NM_015209chr131745 1528 931 --42129 1434 547 199 11534
NM_015215chr132219 932 743 ------
NM_015219chr1742197 1600 803 484 12548 2940 621 1617
NM_015229chr1721121 315 1122 41005 944 464 131 1127
NM_015233chr1352665 2505 959 878 522 11023 32561 2372 54 --
NM_015254chr893149 2856 2469 2286 2266 1192 930 458 434 --52481 1253 631 534 482 --
NM_015272chr16--11968 1207 --
NM_015278chr611294 --139 1978
NM_015282chr232869 2295 641 12069 32696 2640 70 22265 696
NM_015285chr187896 742 581 387 347 227 116 22308 2263 --1107
NM_015288chr563867 3792 3377 2821 2571 2481 1452 102829 2528 1163 1131 1111 634 626 399 251 116 23016 1159
NM_015299chr1463515 1431 1276 819 105 28 1768 23189 308 13032
NM_015305chr142556 108 11723 --1199
NM_015310chr8107969 7394 6751 5267 2754 2726 2486 1758 884 831 26926 5340 37556 2964 2759 12773
NM_015313chr1164381 4093 1673 705 690 123 21401 616 14821 --
NM_015315chr5133267 3097 2825 2346 1242 1231 1064 992 836 750 663 194 172 11341 33163 647 385 --
NM_015317chr212883 ----12596
NM_015319chr123341 107 70 155 1164 --
NM_015327chr12497 379 21303 87 21307 861 11196
NM_015328chr732482 2292 120 ----12094
NM_015335chr123796 522 108 ------
NM_015338chr2011400 --1398 --
NM_015349chr662462 2303 2247 2035 1007 250 --455 42 29 24 --
NM_015355chr171735 ----11769
NM_015360chr5142 ------
NM_015361chr21361 1180 ----
NM_015365chrX53792 3601 3264 3192 595 --23847 3152 --
NM_015367chr2271594 599 581 416 354 333 244 ------
NM_015375chr144653 4056 1518 99 44364 3310 1982 939 ----
NM_015385chr1022295 1087 ------
NM_015392chr92196 25 ------
NM_015396chr321386 1129 133 137 --
NM_015397chr931391 742 332 21476 1436 --11610
NM_015401chr124768 742 338 24 ----1824
NM_015436chr422493 2164 ------
NM_015443chr1751024 948 580 502 424 --1318 --
NM_015457chr112998 64 ----11011
NM_015460chr32200 96 --21508 578 --
NM_015481chr1281063 926 893 802 304 280 257 91 1193 6937 751 214 123 76 38 1424
NM_015488chr281433 1309 1164 619 545 479 412 122 164 3550 95 31 --
NM_015493chr195630 603 489 481 101 ----191
NM_015497chr151753 1728 ----
NM_015503chr16----2628 601 --
NM_015509chr1241110 667 611 164 ------
NM_015526chr195510 425 349 199 74 21086 293 11134 --
NM_015527chr162629 605 1297 2703 77 1797
NM_015537chr95768 411 334 294 220 1128 3755 463 39 1831
NM_015545chr73626 201 78 2695 256 1306 --
NM_015550chr763555 2462 1133 858 433 418 22657 747 33548 2524 830 22566 826
NM_015557chr1113322 3032 2857 2673 2265 1281 1009 276 121 100 66 32867 1242 937 21286 1019 1207
NM_015564chr532882 2424 215 ----22888 399
NM_015567chr131914 21164 470 3505 405 394 --
NM_015575chr253103 2321 1308 623 58 43630 2620 2352 480 126 --
NM_015576chr34884 813 680 134 12495 1925 1221
NM_015605chr1021000 82 ------
NM_015609chr1132878 2670 2606 2586 2145 2018 2000 1907 954 879 672 406 145 22628 719 62931 2920 2098 1883 828 411 22927 1091
NM_015630chr2------1908
NM_015635chr931744 1534 371 --31827 1788 1590 --
NM_015640chr154329 4279 4004 1813 1747 --14052 --
NM_015649chr192127 45 --3363 355 97 --
NM_015651chr9102112 2079 1727 1710 910 730 549 354 245 214 1239 2867 540 12127
NM_015652chr101590 --1427 --
NM_015657chr21664 ----1279
NM_015678chr1311424 1374 ----
NM_015686chrX82200 2080 1829 947 739 518 348 134 22167 1869 62376 2229 1873 1808 308 148 62214 2206 2177 612 410 155
NM_015691chrX52343 1977 1035 550 36 12593 21982 825 --
NM_015695chr64726 486 351 211 1373 2720 42 --
NM_015726chr141343 660 582 420 2654 134 21421 497 2558 513
NM_015831chr74935 778 294 75 --3864 853 164 1860
NM_015840chr1102322 2314 2265 2196 1713 1016 778 636 628 260 21887 907 ----
NM_015841chr1102322 2314 2265 2196 1713 1016 778 636 628 260 21887 907 ----
NM_015848chr12364 40 29 --1154 --
NM_015850chr8102432 1889 1813 380 267 242 191 169 77 52 21528 156 21958 181 --
NM_015872chr181754 1501 1469 1326 1299 1212 686 593 --41796 1236 714 379 21783 579
NM_015878chr81390 --1234 --
NM_015881chr111507 --1243 11193
NM_015896chr34195 60 48 29 ------
NM_015898chr19152507 2488 2439 2337 2141 2021 1861 1785 1717 1709 1698 837 815 541 65 12355 62264 1840 1817 823 803 73 31853 644 264
NM_015905chr71438 ----1529
NM_015906chr133763 1351 119 --13376 11362
NM_015912chr822186 710 ------
NM_015955chr22479 27 ------
NM_015981chr5122770 2689 2581 2358 2231 2078 1272 1266 690 458 213 47 1116 82347 2115 1277 1257 681 655 220 207 22637 677
NM_015982chr172393 77 ----1326
NM_015994chr14------1667
NM_015995chr15185219 4644 4547 4388 4361 3930 3887 3812 3772 3707 3593 3557 2037 1742 681 665 288 186 34253 624 124 24899 34 --
NM_016019chr71769 ------
NM_016021chr642756 2095 2080 989 --1657 11857
NM_016022chr161070 870 312 295 239 33 1380 --2920 118
NM_016025chr1631888 237 36 21316 258 21754 757 --
NM_016032chrX31222 212 131 11120 11137 --
NM_016038chr72657 22 ------
NM_016041chr17----1256 --
NM_016045chr201334 --1372 --
NM_016047chr2153 ------
NM_016057chr1241278 948 247 166 1401 ----
NM_016073chr151391 ------
NM_016076chr15714 668 604 595 222 21978 653 --1969
NM_016081chr412131 ----11822
NM_016083chr623225 3112 11270 11274 --
NM_016096chr852129 1934 1398 575 222 ------
NM_016107chr521066 451 11060 ----
NM_016124chr12363 163 11236 ----
NM_016125chr171439 --1166 --
NM_016131chr23129 69 29 --137 1810
NM_016144chr5------143
NM_016147chr1141086 1078 929 133 1902 21102 92 --
NM_016152chr32928 307 ------
NM_016174chr95397 362 165 127 112 ----1355
NM_016206chr3113345 2816 2326 2156 1918 1829 1611 1123 955 886 319 28255 7461 17472 13078
NM_016210chr36613 577 455 289 246 152 --21147 66 11154
NM_016221chr542291 315 267 194 --1828 --
NM_016223chr111344 --137 --
NM_016231chr171544 1266 ----
NM_016235chr1641402 1031 406 396 --1197 --
NM_016250chr143734 146 41 ------
NM_016255chr633292 3180 842 23191 110 --1501
NM_016257chr153076 2616 2242 993 118 22176 97 43442 444 224 48 1174
NM_016260chr252172 2162 734 644 76 16386 12181 --
NM_016261chr172774 94 1259 ----
NM_016272chr22112438 1980 1960 1939 1018 617 541 508 482 373 191 --21851 569 1705
NM_016284chr161718 2807 642 1707 --
NM_016287chr121409 1362 11368 1801 1504
NM_016316chr21570 ------
NM_016320chr113371 222 113 1813 3851 840 316 --
NM_016329chr32337 58 ------
NM_016339chr1771718 1244 641 588 393 336 141 --31667 1263 633 --
NM_016356chr632395 1965 544 22606 1979 ----
NM_016376chr1794174 3634 3370 3176 1177 865 689 78 41 14211 33010 2937 556 23312 349
NM_016396chr1521116 105 ------
NM_016418chr22133711 3465 2978 1374 1312 1295 1209 835 633 590 462 399 142 1380 83621 3075 2399 2326 1422 1282 1248 468 43426 3389 802 80
NM_016436chr2022501 759 22396 615 ----
NM_016441chr21501 ----1547
NM_016453chr34552 490 462 133 1275 1496 --
NM_016496chr191395 --1438 --
NM_016507chr1752942 2407 2346 52 44 --32414 2286 2122 13059
NM_016510chr210842 690 649 301 287 273 259 245 231 149 --3657 354 24 --
NM_016522chr1121477 22 ----21313 382
NM_016530chr154931 611 90 71 ------
NM_016532chr1731089 1057 965 --2837 294 --
NM_016548chr931483 1338 346 --11424 --
NM_016559chr331543 1523 1122 ------
NM_016574chr114431 170 115 65 --3724 269 39 --
NM_016577chr3154387 4245 4145 3864 3163 1771 1679 1064 999 959 890 516 427 392 34 22863 1151 44392 2762 1472 695 --
NM_016588chr62352 32 144 --1283
NM_016591chr521207 418 1457 ----
NM_016596chr124768 742 338 24 ----1824
NM_016598chr36926 541 486 192 62 25 --11083 11109
NM_016603chr521544 226 --1819 --
NM_016604chr53234 140 100 ----1477
NM_016605chr572583 2414 2080 2050 939 828 512 21938 1060 22518 717 11694
NM_016607chrX21600 59 --1387 --
NM_016613chr422361 465 ------
NM_016621chr11144346 4272 4085 4079 4055 4034 3805 3563 3075 2823 1788 1745 1630 597 --84317 4309 3756 3383 3115 1529 887 694 13107
NM_016626chr182714 68 ------
NM_016628chr101763 ------
NM_016639chr164391 354 136 35 ------
NM_016641chr1631558 1329 1322 ------
NM_016652chr2031571 1338 395 --11786 --
NM_016823chr172926 303 --1423 --
NM_016827chr34600 569 530 46 --2494 197 --
NM_016829chr34655 624 585 101 --2549 252 --
NM_016830chr123455 397 58 ------
NM_016834chr17133933 3775 3705 3226 3201 2992 1366 1201 1144 1047 664 626 86 22592 1646 43716 1245 735 397 --
NM_016835chr17133933 3775 3705 3226 3201 2992 1366 1201 1144 1047 664 626 86 22592 1646 43716 1245 735 397 --
NM_016841chr17133933 3775 3705 3226 3201 2992 1366 1201 1144 1047 664 626 86 22592 1646 43716 1245 735 397 --
NM_016929chr633865 378 226 24426 453 44330 177 48 23 23417 1830
NM_016940chr21----1478 --
NM_016952chr1163635 2915 1583 1395 1233 669 --33749 3602 2929 --
NM_016953chr234619 4362 1790 1213 11795 --
NM_017409chr123614 606 283 --2594 48 --
NM_017412chr821048 279 ------
NM_017413chrX31789 301 104 32231 696 331 31667 700 34 --
NM_017415chr5104567 4392 4213 3149 1695 1603 1582 1249 1058 236 24167 1011 1181 --
NM_017420chr1432343 496 21 ------
NM_017444chr841568 1531 1336 1262 1167 1237 153
NM_017449chr151359 1163 443 99 24 --31596 528 43 11277
NM_017452chr203316 307 210 --1527 --
NM_017453chr203316 307 210 --1527 --
NM_017454chr203316 307 210 --1527 --
NM_017456chr1751567 1378 203 110 62 --21383 1317 1780
NM_017457chr19----1112 --
NM_017459chr12381 325 --185 1334
NM_017488chr261504 1373 1310 1272 477 348 ------
NM_017514chrX5791 692 236 125 54 --3375 279 242 2761 220
NM_017515chr1111189 --125 --
NM_017519chr61480 1474 ----
NM_017522chr141092 1078 978 248 ------
NM_017541chr31183 197 ----
NM_017548chr351707 1422 1398 545 111 ------
NM_017550chr195733 328 236 207 115 11037 21029 93 --
NM_017551chr1042498 455 405 35 12429 128 --
NM_017569chr13------128
NM_017577chr32293 189 ------
NM_017582chr141612 1602 1581 228 21154 498 21516 507 1503
NM_017590chr2261972 1845 1000 746 619 104 1941 72116 2079 1655 956 416 237 162 --
NM_017594chr983395 3315 2799 1325 579 555 235 175 23167 45 --12276
NM_017596chr1133967 3757 3729 3681 2976 2925 2887 1729 1591 749 494 363 278 53312 2993 1616 558 357 64325 3459 1741 1455 957 375 44128 953 573 515
NM_017602chrX1842 --3251 236 156 2232 64
NM_017607chr195557 479 350 175 57 --1343 --
NM_017610chr1541916 1485 544 42 ------
NM_017626chr1031670 1638 171 --21459 394 --
NM_017633chr61222 1428 13310 --
NM_017637chr979178 8355 6012 5919 2267 1505 268 --18242 27997 6828
NM_017644chr344897 3892 3874 1190 34134 4129 976 33940 3897 3751 --
NM_017650chr795502 4805 4258 4008 1688 431 347 329 206 15487 34125 537 51 --
NM_017660chr1982756 2548 2531 2177 1239 587 362 45 22846 523 52875 977 750 659 80 1113
NM_017662chr941575 1484 1441 214 21986 407 ----
NM_017670chr115772 720 684 600 98 --2788 677 1690
NM_017679chr173137 109 77 1179 1710 1482
NM_017686chr121138 967 --1118 --
NM_017693chr1321151 625 11419 ----
NM_017703chr19------130
NM_017709chr123355 3276 ------
NM_017724chr32833 121 ------
NM_017730chr32682 526 ------
NM_017737chr111587 1759 1428 1826
NM_017739chr13171 69 42 ------
NM_017740chr1651184 542 421 408 189 11454 ----
NM_017744chr141534 952 760 644 31685 849 613 ----
NM_017754chr695045 4928 4347 3924 1981 1896 1468 399 60 21098 322 33913 1175 388 --
NM_017762chr1522123 278 --22050 295 --
NM_017772chr651511 1382 1207 1094 128 21357 310 21100 100 1159
NM_017778chr831492 1223 528 123 ----
NM_017779chr132500 953 846 --12463 --
NM_017784chr32915 158 ----11117
NM_017797chr195912 849 665 135 23 --3922 901 869 1127
NM_017798chr202995 349 ------
NM_017813chr895685 5388 5353 4901 4868 2184 1574 1308 1084 --22189 105 25740 5527
NM_017826chr134814 512 97 35 ------
NM_017831chr1824157 2996 21200 787 ----
NM_017845chr41535 ------
NM_017848chrX43762 3582 762 501 11342 34459 540 519 14495
NM_017849chr2102949 2810 2722 2640 2519 2311 2055 2010 497 454 --21114 487 --
NM_017873chr982164 2146 2083 1118 1045 829 769 597 3342 225 161 42869 931 926 434 12039
NM_017893chr1061474 1312 560 459 315 97 --51327 1144 528 400 83 21334 104
NM_017902chr10104615 4276 3969 3772 3710 3564 3551 1673 1549 1348 35253 1778 173 35387 4212 177 11269
NM_017907chr112505 354 2392 42 2330 57 153
NM_017910chr2------1286
NM_017911chr2231388 1191 439 ----11525
NM_017921chr1762118 1781 585 463 433 353 --22084 2052 --
NM_017938chrX----2418 284 1369
NM_017954chr7----21703 1651 --
NM_017966chr1151389 1073 978 266 38 --1966 --
NM_017994chr752919 2869 2645 790 238 ------
NM_018026chr1191262 1202 1104 1056 553 515 456 311 94 11225 1187 --
NM_018027chr1042982 955 517 193 1155 ----
NM_018028chr1951230 907 333 286 177 --1307 1303
NM_018031chr31517 ----1498
NM_018036chr1454267 4198 4083 3334 1487 --11610 --
NM_018045chr182770 2753 2746 2531 2426 2156 1242 1220 --22330 1197 12537
NM_018061chr141668 1509 184 93 ----11746
NM_018070chr11149 ----2425 139
NM_018071chr142305 277 --1664 --
NM_018084chr223003 2323 ----12678
NM_018086chr211341 --11583 11565
NM_018107chr141101 --2862 143 --
NM_018110chr1641265 381 282 179 1290 1892 --
NM_018114chr3--1147 1196 --
NM_018121chr1011029 13038 ----
NM_018128chr1731468 372 223 ----1482
NM_018155chr363282 3151 2691 806 323 235 ------
NM_018171chr121189 --3891 883 849 --
NM_018172chr1181450 1418 1206 583 531 479 427 375 11059 --21195 1190
NM_018178chr13711 639 279 ----1206
NM_018179chr12292 42 178 ----
NM_018181chr1821594 143 21424 565 ----
NM_018182chr1792153 2143 2131 1961 1711 775 290 264 43 12221 31967 1779 413 --
NM_018184chr321629 838 ------
NM_018205chr1042091 1684 756 22 22216 1856 22043 839 --
NM_018206chr162613 146 1217 ----
NM_018207chr171627 1352 653 428 399 284 44 --1533 31699 1667 1571
NM_018225chr944269 1265 631 162 35310 4410 2003 14249 --
NM_018227chr423178 446 ------
NM_018234chr262111 2009 1939 851 748 538 --31944 499 408 2657 404
NM_018237chr101203 ------
NM_018239chr1042091 1684 756 22 22216 1856 22043 839 --
NM_018240chr12628 156 --1336 --
NM_018244chr202927 269 ------
NM_018246chr862656 2254 2003 927 707 120 ------
NM_018263chr232279 2125 1732 --32113 1752 728 11748
NM_018286chr173291 68 59 ------
NM_018302chr431994 1878 517 ----1462
NM_018312chr1151913 1683 1537 275 49 21945 1423 --11873
NM_018320chr1141242 399 283 117 --1404 132
NM_018327chr2041642 1413 445 431 ----11311
NM_018330chr101535 ------
NM_018340chr1664777 4728 4716 4006 3796 825 11777 --23871 785
NM_018351chr1274087 3952 3795 3275 2894 1334 1092 11521 21838 1213 13415
NM_018361chr823874 646 ------
NM_018362chr1122478 749 --13320 23253 2771
NM_018365chr151244 --1292 --
NM_018371chr81211 ----11240
NM_018374chr754673 3230 2071 1648 168 13694 11419 --
NM_018381chr193805 717 371 --1879 --
NM_018383chr231804 1464 1274 1461 1206 --
NM_018400chr11154529 4130 4101 3807 3564 3531 3213 3015 3003 1240 789 357 265 176 157 44003 293 92 55 13218 34347 3582 1246
NM_018403chr3------23024 412
NM_018409chr412179 143 1223 11143
NM_018416chr1252552 2481 1018 417 306 --21658 956 12487
NM_018440chr8117977 7695 7385 6494 5770 5611 5593 1780 1018 261 253 26388 476 27285 1911 27983 5543
NM_018444chr822237 609 ------
NM_018452chr6_random13731 22505 646 23025 853 --
NM_018464chr10----174 --
NM_018482chr821652 230 --1667 1124
NM_018489chr111467 --1872 3464 432 314
NM_018566chr131340 258 113 ------
NM_018571chr22640 140 ------
NM_018602chr1551689 1455 1275 1262 215 ------
NM_018639chr1221211 377 11053 ----
NM_018640chr1232709 2621 824 ----12716
NM_018644chr11101843 1685 1653 842 730 670 289 210 108 52 --21517 847 11471
NM_018650chr122267 1385 ------
NM_018660chr852457 2299 2233 851 300 22920 640 22312 2071 --
NM_018667chr16122554 2442 2299 2268 2104 2095 1110 1036 994 777 461 394 --21884 52 32160 1125 201
NM_018704chr11697 1220 ----
NM_018715chr172088 1791 515 474 347 335 32 11686 --11469
NM_018718chr72835 404 ----2519 175
NM_018841chr163081 1256 1226 1206 1185 885 --23504 900 --
NM_018898chr51214 1873 3730 617 597 --
NM_018899chr51214 1873 3730 617 597 --
NM_018900chr51214 1873 3730 617 597 --
NM_018901chr51214 1873 3730 617 597 --
NM_018902chr51214 1873 3730 617 597 --
NM_018903chr51214 1873 3730 617 597 --
NM_018904chr51214 1873 3730 617 597 --
NM_018905chr51214 1873 3730 617 597 --
NM_018906chr51214 1873 3730 617 597 --
NM_018907chr51214 1873 3730 617 597 --
NM_018908chr51214 1873 3730 617 597 --
NM_018909chr51214 1873 3730 617 597 --
NM_018910chr51214 1873 3730 617 597 --
NM_018911chr51214 1873 3730 617 597 --
NM_018912chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018913chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018914chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018915chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018916chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018917chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018918chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018919chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018920chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018921chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018922chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018923chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018924chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018925chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018926chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018927chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018928chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018929chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_018945chr623344 780 23021 192 ----
NM_018952chr174676 215 207 154 --1443 --
NM_018970chr732701 2382 1020 ------
NM_018977chrX41101 347 315 147 2913 133 ----
NM_018979chr1262177 1604 476 451 432 398 --12079 --
NM_018999chr1044516 1104 358 254 1610 2996 529 --
NM_019001chr323001 312 11749 ----
NM_019007chrX2543 36 ----1116
NM_019008chr2253115 1207 1029 601 122 23156 2350 1223 --
NM_019027chr432036 1685 772 21962 351 1758 --
NM_019032chr14695 455 65 49 --2670 648 --
NM_019046chr102610 136 1776 ----
NM_019050chr421530 563 12070 ----
NM_019071chr71200 ------
NM_019072chr523491 75 --11411 --
NM_019074chr152628 24 --2856 643 --
NM_019084chr1011752 ------
NM_019096chr65867 843 835 401 299 1851 ----
NM_019106chr22113211 2996 2969 2958 2565 2178 2121 1224 688 658 72 22241 52 53195 3016 2392 2192 619 22809 2520
NM_019114chr942547 2267 2223 2107 ------
NM_019116chr1673302 3139 2721 2307 1445 842 73 ------
NM_019593chr2062824 2771 2719 2680 2048 1278 --32728 2685 2062 --
NM_019596chr2112642 3717 677 253 ----
NM_019624chr125916 723 713 192 185 1307 2760 728 --
NM_019625chr125916 723 713 192 185 1307 2760 728 --
NM_019850chr22137 94 1298 2535 256 --
NM_019859chr1021000 591 --11113 --
NM_019860chr1021048 639 --11161 --
NM_019884chr191166 1501 3505 440 140 --
NM_019885chr272440 1991 1908 976 683 432 150 11116 4761 697 547 217 --
NM_019895chr3----170 --
NM_020039chr1291682 1374 1355 1320 1239 1217 660 547 103 11623 --2716 668
NM_020122chr276014 5880 5695 5546 1493 1113 610 44943 3741 2212 1561 ----
NM_020137chrX1469 --240 24 --
NM_020142chr124545 502 91 50 --4581 158 100 64 --
NM_020147chr153784 193 182 1971 ----
NM_020163chr392351 2089 1868 1588 1579 537 463 227 69 12050 ----
NM_020178chr171389 ----2997 29
NM_020179chr112336 122 1390 ----
NM_020182chr2052997 2927 2775 2308 53 22704 2286 1127 --
NM_020184chr262106 1976 1901 1540 861 765 11553 31631 771 30 --
NM_020198chr17134 --11026 --
NM_020205chr152459 2316 1135 719 292 32360 2355 194 12423 --
NM_020211chr1561156 1117 988 280 249 69 21217 477 2303 254 --
NM_020214chr151230 136 2206 26 --
NM_020226chr43210 96 52 --2140 132 --
NM_020228chr11------136
NM_020235chr32320 42 ------
NM_020239chr151883 1531 714 524 344 ------
NM_020248chr171982 1928 1541 734 698 114 23 --31660 1549 99 2141 136
NM_020251chr114687 561 549 39 --2463 234 1215
NM_020309chr195943 863 339 239 48 --21094 700 --
NM_020310chr17132229 2172 2020 1941 1793 1723 568 342 291 241 112 66 58 1709 52521 1962 1834 177 117 22509 1821
NM_020336chr2032705 208 100 1764 11043 --
NM_020337chr422725 1022 --32732 1112 785 --
NM_020338chr10133299 2823 2735 2352 1426 1352 1331 1319 913 537 527 232 71 1631 72765 1041 765 273 224 97 24 147
NM_020341chr20----1768 --
NM_020348chr1052688 2355 2221 307 135 32198 1851 1034 52672 2638 1718 1020 63 12695
NM_020384chrX61681 1587 1520 1173 586 60 21709 361 41724 1713 1405 339 1525
NM_020416chr441037 809 49 29 2634 378 ----
NM_020418chr33409 136 130 2483 63 186 --
NM_020428chr1921123 833 1907 121 --
NM_020429chr7102778 2728 2415 2290 2150 1023 228 215 182 70 1497 22567 2035 12341
NM_020432chr71522 ------
NM_020440chr142873 2306 735 466 --42497 777 532 460 22493 528
NM_020443chr186297 6026 5772 5457 2047 1682 777 23 25580 1396 36940 6746 2721 14919
NM_020444chr521326 1277 2351 46 150 --
NM_020455chr652345 1807 929 495 24 ------
NM_020456chr1321668 853 11493 21871 150 --
NM_020473chrX21892 231 ------
NM_020475chr8112426 2212 2174 2008 1999 1785 1603 1562 1546 602 523 --52019 1969 1775 1641 485 --
NM_020476chr8112426 2212 2174 2008 1999 1785 1603 1562 1546 602 523 --52019 1969 1775 1641 485 --
NM_020477chr8112426 2212 2174 2008 1999 1785 1603 1562 1546 602 523 --52019 1969 1775 1641 485 --
NM_020478chr8122489 2275 2237 2071 2062 1848 1666 1625 1609 665 586 47 --52082 2032 1838 1704 548 --
NM_020480chr8112426 2212 2174 2008 1999 1785 1603 1562 1546 602 523 --52019 1969 1775 1641 485 --
NM_020524chr11626 1620 1776 1652
NM_020526chr171806 1554 1526 1276 721 708 564 --51339 661 635 390 201 41666 1661 1150 42
NM_020532chr2------1598
NM_020647chr83689 521 303 ----194
NM_020651chr221661 483 --11257 1570
NM_020672chr1----182 --
NM_020673chr2096577 6511 6206 6083 6001 5631 2295 1463 1109 16877 26112 1946 --
NM_020676chr32302 72 --148 --
NM_020689chr2051387 1202 199 166 66 1629 2204 181 --
NM_020698chr1263020 3000 2786 2485 2185 256 13146 43150 2929 1953 487 1913
NM_020699chr1125304 3881 3796 3433 3402 2037 1556 1331 1164 744 416 28 51899 1831 1452 954 634 134123 3896 3875 3827 3801 3785 3766 3415 3409 3370 1336 958 181 14119
NM_020702chr951610 1584 1349 1167 110 --41557 1138 229 100 --
NM_020708chr2061706 1623 729 179 124 67 22043 975 51664 993 781 474 371 --
NM_020713chr20103056 2611 2241 573 495 468 456 392 142 45 --63095 2467 631 625 105 98 1377
NM_020717chrX124766 3631 3560 3503 3071 605 561 491 346 200 121 28 14930 33296 702 141 24395 754
NM_020718chr1645975 5103 1941 709 25752 523 ----
NM_020728chr7162 32858 2355 2038 23076 45 --
NM_020732chr61480 1474 ----
NM_020738chr2171 21312 262 ----
NM_020739chr1534040 1327 405 11559 ----
NM_020742chrX42212 2010 801 38 1161 1165 1280
NM_020750chr611140 --2493 315 2441 93
NM_020752chr1011981 22866 467 ----
NM_020753chr173720 183 138 ----178
NM_020764chr1661228 946 413 280 221 32 ----1952
NM_020766chrX53859 3448 3131 1408 549 ------
NM_020769chrX3786 176 107 1135 ----
NM_020770chr151161 530 484 428 245 --174 --
NM_020772chr1767833 6717 3422 3081 2446 1287 --21567 488 16524
NM_020778chr15134242 3906 3588 1913 1573 1499 1212 988 696 683 558 220 28 43922 949 826 343 53285 1839 1725 776 252 14022
NM_020783chr1832258 1697 937 11679 ----
NM_020795chr1751758 1350 598 550 112 1396 61333 571 428 416 347 51 11983
NM_020796chr532928 2682 715 1245 32829 326 319 21156 315
NM_020800chr321126 287 ------
NM_020804chr6162520 2506 2415 2350 2215 1823 1786 979 962 579 523 505 336 180 60 31 --42192 441 326 47 32150 356 351
NM_020805chr1821337 648 1596 1113 --
NM_020807chr165706 684 288 228 107 --21505 1391 --
NM_020810chr1443148 2624 1111 455 ------
NM_020814chr25999 910 412 198 75 --11228 --
NM_020834chr143615 457 413 --21549 350 --
NM_020841chr121740 ------
NM_020845chr12122458 2278 2263 1883 1770 1732 762 653 638 373 355 253 12272 72327 2252 2216 2032 502 367 348 12362
NM_020850chr1662916 2790 2554 1251 850 515 2712 589 62932 2837 2389 861 176 114 1857
NM_020858chr15----11505 --
NM_020870chr422194 679 1152 ----
NM_020888chr13424 293 217 1335 41640 1402 684 483 21636 37
NM_020897chr131183 364 208 --21220 912 --
NM_020898chr12--1154 2790 305 1560
NM_020899chr1751689 1604 1022 817 501 --31613 259 39 --
NM_020921chr1431239 1205 601 --12692 --
NM_020922chrX31760 1679 621 21812 1196 1348 --
NM_020935chr214309 ----158
NM_020946chr9101585 1562 1518 1499 1417 1349 1307 324 259 79 21639 591 3674 420 235 1231
NM_020947chr1621950 236 1954 21966 601 --
NM_020951chr1921567 404 --11719 --
NM_020956chr19104429 4057 3210 3104 1391 1121 1014 496 378 144 34757 3703 2923 54639 1182 538 149 70 23187 127
NM_020962chr156970 915 777 686 517 167 --21716 378 --
NM_020964chr18103881 3612 3564 3408 3332 3152 1477 847 627 281 14090 23617 3325 13321
NM_020967chr203368 134 37 1508 ----
NM_020971chr193760 540 215 1160 3735 616 223 1230
NM_020972chr44882 799 365 30 ----1416
NM_020977chr441410 857 326 272 11932 1431 --
NM_020983chr1252250 2185 1666 488 345 1130 --1519
NM_020993chr1242412 2400 598 473 32299 1048 634 22405 847 1523
NM_021003chr143707 83 36 ------
NM_021007chr221892 982 ------
NM_021020chr883306 3283 2945 2889 1207 859 763 65 22956 372 23311 106 22638 1220
NM_021032chr331982 85 34 11675 ----
NM_021035chr2061120 1042 859 528 470 447 21113 351 ----
NM_021038chr322685 2607 23171 2601 ----
NM_021064chr621453 70 --1572 1644
NM_021069chr431651 127 70 ------
NM_021078chr171165 1110 144 --
NM_021090chr2274702 3927 3059 617 201 112 57 --21124 801 --
NM_021097chr272577 2568 1919 856 470 416 165 --22391 864 1834
NM_021101chr3------11742
NM_021103chr22242 68 --123 --
NM_021116chr7168556 8532 8415 8396 8252 8100 8080 7525 7515 7208 6741 6669 6576 2649 831 588 46856 6491 3035 357 68516 8499 8023 5806 784 447 47140 3603 2933 259
NM_021120chrX53189 3038 2717 2565 934 12170 --12304
NM_021132chr1031331 265 54 ------
NM_021149chr161154 11009 2135 24 --
NM_021159chr431317 210 56 128 11134 --
NM_021168chr1661587 1567 1467 1179 1095 56 11331 11064 --
NM_021174chr84609 581 238 24 ------
NM_021189chr12122 26 1752 4993 947 127 98 --
NM_021200chr1171116 923 744 234 155 79 69 --2993 149 --
NM_021202chr20172915 2880 2793 1950 1152 953 923 904 435 392 379 298 258 201 194 187 138 11045 3910 857 280 23002 1101
NM_021220chr201116 ----180
NM_021222chr131166 237 183 ----11243
NM_021235chr19----128 124
NM_021238chr1221670 1656 --21973 383 --
NM_021239chr14----2419 48 --
NM_021242chrX3758 667 48 --3704 692 678 2711 674
NM_021249chr1431268 442 325 ------
NM_021253chr631138 246 92 11012 11132 11356
NM_021255chr1422892 1002 --23598 2590 --
NM_021267chr197932 528 384 358 205 167 47 --81255 1010 308 135 118 83 75 38 --
NM_021569chr9111177 1090 1071 1026 785 774 446 404 336 148 118 --61189 1035 751 455 425 177 2410 259
NM_021643chr221652 453 --1259 1289
NM_021647chr444733 1425 854 106 ----13298
NM_021784chr204168 145 131 39 1213 --1138
NM_021813chr6125325 5251 5164 3565 1681 1276 1091 1081 735 290 41 33 24662 1468 34666 1509 204 11879
NM_021905chr682191 2039 1972 1965 1916 906 895 699 ----11420
NM_021911chr544318 4195 2039 1818 13677 ----
NM_021912chr1553644 3380 1670 1291 393 ------
NM_021940chr631573 1152 36 ----1369
NM_021943chr651796 1637 674 436 139 --21889 1631 --
NM_021946chrX71395 1338 1188 1036 985 935 399 --61313 1059 1009 1003 944 57 --
NM_021947chr1721061 880 --1277 --
NM_021949chrX102326 2197 2169 2126 2106 1155 876 829 630 102 --42293 1930 1161 161 11764
NM_021961chr1195285 5278 2415 2239 2138 2078 1746 736 134 12601 16417 15938
NM_021962chr173520 481 163 2208 107 22122 212 --
NM_021964chr346348 4054 513 255 12059 11764 --
NM_021977chr642988 2766 2389 1390 22908 2533 1611 --
NM_021984chrX11308 1474 2565 236 --
NM_021987chrX11308 1474 2565 236 --
NM_021988chr2021447 516 --3622 583 404 --
NM_021990chrX11308 1474 2565 236 --
NM_021999chr13----155 --
NM_022006chr195312 299 276 267 148 --1254 2127 118
NM_022048chr1586159 5609 5174 3876 2355 2209 1924 1307 31133 556 361 45179 4350 4194 365 --
NM_022060chr143463 250 69 1444 51315 1197 431 259 215 1449
NM_022073chr142590 132 ------
NM_022075chr12243 145 --153 --
NM_022085chr651290 1174 519 44 22 --11295 --
NM_022114chr1134184 4177 3842 3691 3424 3311 3205 3188 1599 1330 1070 887 122 14339 33100 1064 104 11001
NM_022150chr72450 346 ------
NM_022152chr22262 23 --1390 --
NM_022166chr16135597 5157 5007 4855 3888 2405 1964 1949 1763 1391 1296 790 236 --115065 5034 4866 4522 4251 1757 1711 1352 1012 295 88 11518
NM_022169chr1161516 1459 1440 1217 1177 313 124 41225 1065 613 546 --
NM_022171chr321531 174 11574 1338 --
NM_022334chr25795 739 403 347 291 ------
NM_022338chr11------1234
NM_022343chr92840 208 --1330 --
NM_022351chr8----1481 13453
NM_022367chr15664 638 556 458 103 --1238 --
NM_022369chr154413 183 60 23 ------
NM_022442chr2021447 516 --3622 583 404 --
NM_022459chr1345845 4542 2186 1384 1544 15272 15428
NM_022461chr31191 ------
NM_022463chr1781571 1446 1397 1062 520 165 106 70 ------
NM_022465chr1282890 2882 2055 1890 1150 1054 447 115 1236 72816 2250 2167 994 790 323 315 134
NM_022469chr162723 672 394 376 282 216 1385 1713 --
NM_022470chr3--11249 --2474 268
NM_022473chr1584296 4119 3524 1704 1681 1664 130 72 22932 1519 1977 --
NM_022475chr4192 ------
NM_022477chr2021336 37 --1165 154
NM_022497chr32723 458 11210 ----
NM_022566chr152393 106 --131 --
NM_022572chr281433 1309 1164 619 545 479 412 122 164 3550 95 31 --
NM_022574chr761620 834 569 494 284 158 --52138 2127 1940 1934 1794 --
NM_022640chr17------1200
NM_022648chr2124443 4139 4090 3660 3641 1390 1311 633 447 294 286 75 23825 540 44600 4402 3679 1060 14462
NM_022650chr51262 --1856 --
NM_022716chr121055 307 22382 746 2738 312 --
NM_022719chr22103660 3325 3276 3070 2835 1509 1476 939 696 572 23348 191 13064 --
NM_022726chr6----1519 --
NM_022728chr72785 36 ----1749
NM_022733chr1180 11107 2837 68 1213
NM_022735chr1--3665 478 305 ----
NM_022737chr1981206 955 908 324 304 232 210 48 11055 3949 121 105 --
NM_022739chr1721017 103 ------
NM_022748chr752066 1111 1004 974 467 1262 1266 1647
NM_022750chr74743 720 627 602 ------
NM_022758chr653136 2634 803 607 127 13064 23068 2619 --
NM_022776chr3----1605 --
NM_022802chr1031404 394 328 ----11492
NM_022821chr14390 181 81 28 ----1399
NM_022823chr21138 1394 1112 --
NM_022829chr2052156 1881 531 414 144 --21898 1410 --
NM_022831chr15546 525 292 81 43 11253 ----
NM_022832chr452404 1952 414 109 56 12256 ----
NM_022836chr121365 547 ------
NM_022841chr1532294 1084 991 ------
NM_022844chr162950 298 1850 2762 328 --
NM_022893chr2241 28 12665 285 56 --
NM_022898chr1484364 3548 3212 3180 2980 1068 100 21 2791 135 33204 328 93 14082
NM_022912chr242899 2843 672 380 1802 ----
NM_022977chrX22684 1882 --12034 --
NM_023012chr12----1586 --
NM_023067chr361148 993 424 240 215 104 ------
NM_023076chr16136 11199 22307 22 --
NM_023079chr1751262 675 304 226 30 ----164
NM_023105chr8102432 1889 1813 380 267 242 191 169 77 52 21528 156 21958 181 --
NM_023106chr8102432 1889 1813 380 267 242 191 169 77 52 21528 156 21958 181 --
NM_023110chr8102432 1889 1813 380 267 242 191 169 77 52 21528 156 21958 181 --
NM_023111chr8102432 1889 1813 380 267 242 191 169 77 52 21528 156 21958 181 --
NM_023927chr561276 1200 1164 374 352 86 1324 1328 --
NM_023929chr81407 11936 ----
NM_023930chr111835 1856 --2571 164
NM_023940chr43969 940 216 ------
NM_024003chrX4709 596 166 130 --1556 1607
NM_024007chr512677 --1605 --
NM_024036chr112279 232 ------
NM_024046chr321320 1215 1123 1887 1921
NM_024050chr194115 108 80 54 ----1616
NM_024072chr1221113 110 21306 1126 11336 --
NM_024085chr24953 767 295 227 --3947 308 59 --
NM_024090chr41208 ----1751
NM_024095chr1221330 154 ------
NM_024103chr1951451 1391 1356 299 34 61846 1284 729 483 331 45 91850 1824 1577 1381 1347 1302 1288 349 224 21511 1343
NM_024117chr941333 279 271 74 --31327 296 249 --
NM_024294chr653136 2634 803 607 127 13064 23068 2619 --
NM_024306chr165818 350 341 168 61 --2803 762 --
NM_024345chr965760 5711 4619 4565 1854 1710 11788 1686 --
NM_024348chr91143 --2310 243 --
NM_024408chr131108 1008 487 ------
NM_024494chr13758 474 24 1749 293 86 --
NM_024501chr2--1497 159 --
NM_024519chr163262 206 95 --1241 --
NM_024522chr151765 1546 1343 1280 339 31775 1361 530 21327 21 41620 1612 393 388
NM_024535chr163184 118 109 157 --126
NM_024563chr521946 592 2616 281 ----
NM_024594chr531863 1547 522 --11267 --
NM_024595chr11832 21223 772 11059 --
NM_024602chr17850 734 704 650 623 239 205 1895 ----
NM_024611chr1532513 2466 187 12566 23711 868 --
NM_024612chr173987 843 820 ------
NM_024617chr93577 197 34 ------
NM_024624chr2------1551
NM_024631chr111505 --173 --
NM_024639chr6--1188 22634 437 --
NM_024659chr21905 ----1197
NM_024665chr323364 165 ------
NM_024670chr10--2534 376 ----
NM_024686chr1--1149 ----
NM_024698chr1161157 1054 979 381 349 282 1401 31105 1002 878 122
NM_024699chr81844 --1678 --
NM_024704chr20----1382 1143
NM_024721chr822415 698 1306 ----
NM_024742chr1681459 644 559 546 469 456 428 50 2601 193 ----
NM_024761chr994571 3643 3454 3369 2078 1327 584 570 154 1649 31082 575 77 11069
NM_024762chr192666 180 --1627 --
NM_024770chr275654 4643 4590 4330 4159 1664 1221 26640 5620 46396 5624 1501 1311 --
NM_024779chr122143 129 1607 31334 1172 1065 --
NM_024784chr118979 922 715 393 180 127 77 37 --1404 --
NM_024786chr53303 110 43 --157 --
NM_024787chr82233 147 --1306 --
NM_024798chr1542335 1067 701 137 1825 ----
NM_024811chr111194 11666 51886 1644 1638 756 91 187
NM_024816chr16----4145 52 28 22 --
NM_024830chr531608 1357 94 --21856 288 --
NM_024852chr1193 --1595 --
NM_024874chr131265 864 466 1239 1852 --
NM_024875chr105682 464 275 150 66 --41643 458 452 77 11639
NM_024884chr1411165 2792 289 --12855
NM_024885chrX2209 43 ------
NM_024887chr182088 1584 1570 611 564 539 398 83 11428 2722 55 --
NM_024889chr10161221 1206 1169 1155 1140 1125 724 709 695 680 665 651 624 610 595 276 1188 ----
NM_024909chr661482 1387 620 556 496 435 --21319 465 --
NM_024911chr11683 141 ----
NM_024915chr872329 1923 1908 399 361 260 178 22441 2367 22155 386 --
NM_024922chr16111922 1753 1598 1546 1320 781 436 428 352 280 38 --41513 1467 586 179 --
NM_024923chr351235 1199 1073 67 51 ----1914
NM_024939chr1661397 1068 554 503 153 78 ------
NM_024947chr399022 8293 8161 8088 7542 2484 919 827 397 --38136 7386 2654 18299
NM_024949chr474309 4015 3953 3367 3099 1777 508 34045 3109 311 --14434
NM_024953chr1222246 644 ------
NM_024954chr102444 241 --2422 55 --
NM_024963chr7135659 5265 4762 3739 2216 2208 2108 1886 1806 1513 736 585 36 55039 1396 1318 1164 121 44007 1826 1645 1432 45378 4147 742 562
NM_024991chr1022295 1087 ------
NM_025045chr22--124 2270 141 --
NM_025054chr844244 3649 3419 1007 ------
NM_025057chr1441108 323 316 218 ----1337
NM_025075chr3----123 --
NM_025079chr17621 604 551 539 226 190 30 ----1102
NM_025083chr151241 --2782 776 11761
NM_025115chr8--1381 --146
NM_025126chr124729 237 146 30 ------
NM_025134chr1642603 1944 1749 459 2777 72 ----
NM_025138chr132423 176 ------
NM_025146chr312208 1483 1901 177
NM_025151chr821616 531 ------
NM_025160chr123372 1519 --23788 3305 --
NM_025164chr1152004 1672 522 470 106 --31573 477 441 --
NM_025176chr202265 129 ------
NM_025179chr1124913 4683 4490 4361 3892 3185 1983 1018 742 411 212 123 11115 24720 1271 --
NM_025182chr97883 857 427 411 259 173 44 --1709 2928 916
NM_025184chrX--2786 777 --1791
NM_025191chr1--1260 21259 249 1926
NM_025221chr41544 --154 1988
NM_025222chr392892 2749 2499 1966 1222 1215 440 371 363 --22040 973 22559 2247
NM_025224chr2082112 1997 1775 1653 929 447 95 45 11869 42044 1884 788 135 --
NM_025237chr1771275 1133 1103 984 403 321 36 156 ----
NM_025248chr17153042 3033 2900 2718 2214 1300 1194 1182 612 364 347 330 262 158 44 --33047 2125 553 52253 2082 91 86 81
NM_025251chr821188 1170 --4899 383 120 39 3906 895 222
NM_025257chr6152 3354 269 32 136 --
NM_025261chr6_qbl_hap24415 167 150 33 1398 1402 1161
NM_025263chr651899 634 537 335 104 --1442 1127
NM_030576chr1752593 2075 694 467 412 42499 2108 1023 264 62211 2001 666 529 224 22 32030 972 259
NM_030594chr152852 491 --171 --
NM_030621chr1433211 1700 1511 1915 12617 --
NM_030625chr1052193 2159 2077 1976 101 22461 974 --12530
NM_030627chr523308 1651 --1514 --
NM_030629chr1691853 1553 1446 1280 1266 633 620 442 436 --41235 1226 642 93 21459 1222
NM_030647chr752522 1447 720 706 167 --13838 --
NM_030648chr464864 3472 1805 1378 1341 559 --14539 --
NM_030650chr223701 3668 13561 ----
NM_030651chr68706 563 526 292 275 208 33 25 ----1712
NM_030653chr124773 622 361 270 ----1669
NM_030661chr791637 1536 1494 1209 590 288 273 137 43 --1130 --
NM_030665chr1731184 926 49 ----2416 256
NM_030674chr1265640 4584 4018 2312 647 26 ----23851 1503
NM_030761chr1112639 2559 2228 2219 1921 742 718 424 275 77 32 --22498 706 32654 655 83
NM_030762chr122229 197 11727 1212 1208
NM_030763chrX1804 --2874 868 --
NM_030766chr123991 962 260 ------
NM_030795chr81181 --1469 --
NM_030806chr1168909 8877 8612 8507 8353 8213 8120 6627 6340 3468 3293 3263 2113 1011 976 881 78947 8896 7350 7146 6580 136 56 49266 7981 7756 2107 28365 1950
NM_030810chr651290 1174 519 44 22 --11295 --
NM_030816chr153680 3215 3162 2632 372 ------
NM_030884chr352064 1621 648 348 338 11962 2894 171 12159
NM_030915chr252410 1943 1692 963 550 1680 1560 1556
NM_030918chr1105401 5074 4169 3990 1939 1689 1662 848 814 187 24232 3962 44999 4437 3616 3300 --
NM_030922chr151252 2643 568 ----
NM_030927chr1061219 1053 348 226 212 97 --31320 1288 1002 --
NM_030937chr1--11088 21185 355 --
NM_030957chr193601 543 479 --5560 468 414 406 211 2533 512
NM_030962chr1151606 1422 311 291 206 ------
NM_030964chr553086 2966 2542 2276 1107 33550 563 518 73539 2846 1376 1001 377 130 123 43588 2494 2283 523
NM_030981chr1161063 944 918 882 841 805 --2848 323 --
NM_031205chr123353 128 73 --2158 145 1335
NM_031212chr101243 ----184
NM_031226chr154991 443 66 23 ------
NM_031243chr7----12313 --
NM_031268chr16134776 4103 3948 3934 3468 1785 1453 1079 816 371 306 87 67 --44043 2137 1532 1516 --
NM_031289chr1251039 993 984 703 128 ------
NM_031305chr431675 634 348 ------
NM_031307chr11134 ------
NM_031309chr8132228 2134 2102 1976 1752 1643 865 762 630 622 582 504 357 32146 2051 796 72263 1476 781 394 204 144 139 32151 2141 1763
NM_031314chr1451704 1639 1266 444 125 ------
NM_031369chr42691 87 ------
NM_031370chr42691 87 ------
NM_031411chr51214 1873 3730 617 597 --
NM_031417chr1971117 860 795 246 238 222 66 2789 376 ----
NM_031422chr181438 ------
NM_031432chr961106 1058 938 914 74 34 1104 --1852
NM_031438chr52648 580 ------
NM_031442chrX3544 430 38 13130 ----
NM_031444chr2281802 1733 1676 1607 921 581 530 522 42141 598 236 205 21668 41 148
NM_031445chr232879 851 375 21152 668 128 --
NM_031450chr11191 --2532 30 --
NM_031453chr1032248 573 519 135 ----
NM_031455chr1031734 1666 1390 1460 ----
NM_031459chr141480 470 250 145 1406 21202 93 11209
NM_031468chr7197284 6918 6669 6520 6005 5947 5937 5894 3127 3014 2771 2461 2173 1689 898 592 517 382 332 47980 7142 4985 3234 76186 5597 3137 2543 698 499 388 1495
NM_031478chr162251 214 --3560 40 34 --
NM_031483chr2033163 2197 1305 ------
NM_031492chr11----1540 --
NM_031844chr133592 3431 926 1482 ----
NM_031845chr242637 872 742 117 12959 ----
NM_031847chr242637 872 742 117 12959 ----
NM_031849chr51214 1873 3730 617 597 --
NM_031857chr51214 1873 3730 617 597 --
NM_031860chr51214 1873 3730 617 597 --
NM_031866chr101675 --2418 94 --
NM_031886chr1932266 1951 33 22116 1703 ----
NM_031892chrX1164 1781 1659 --
NM_031918chr1992005 1995 1904 1652 1473 1310 381 115 46 --61897 532 473 393 306 21 2480 469
NM_031936chr13610 602 62 --1305 --
NM_031954chr1292803 2770 2662 2256 2101 1023 691 378 23 --4890 492 44 38 1844
NM_031989chr122140 48 ------
NM_031990chr194528 370 308 171 1486 21127 534 --
NM_031991chr194528 370 308 171 1486 21127 534 --
NM_032012chr955127 4535 4406 4312 503 11677 --14990
NM_032013chr2021336 37 --1165 154
NM_032017chr131527 1507 677 2530 327 21476 614 1332
NM_032041chr842447 2165 398 336 12031 1526 12643
NM_032042chr542463 2421 44 30 1536 22715 498 --
NM_032052chr2221022 539 1887 --21029 521
NM_032088chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_032092chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_032102chr111759 12263 ----
NM_032108chr194877 700 183 123 ------
NM_032109chr551205 376 253 150 117 1166 7307 295 237 105 53 41 29 --
NM_032148chr12----1469 --
NM_032153chr382553 2206 2143 1855 1082 1064 781 52 1861 21946 1018 11100
NM_032181chr21205 ----1579
NM_032192chr175542 238 165 75 64 --1214 --
NM_032208chr283042 2500 2252 1420 1312 464 451 240 11237 2408 402 12258
NM_032211chr102948 280 11194 ----
NM_032217chr421375 1325 ------
NM_032221chr203685 311 80 --1288 --
NM_032242chr3103220 3046 2811 2805 2767 2264 929 916 594 149 1653 52103 1164 885 647 562 --
NM_032246chr1521069 915 --160 --
NM_032268chr1683073 2677 2432 2171 400 229 119 46 --32438 1083 804 --
NM_032272chr85422 415 177 162 61 1330 1428 --
NM_032281chr1972718 2706 2589 1159 1072 984 494 11105 72936 2750 2673 347 337 331 26 31132 234 215
NM_032283chr1101814 1447 1368 1353 1255 1238 259 130 77 23 31736 1663 216 21585 1244 --
NM_032287chr22123210 2720 1670 1507 1038 934 694 629 405 255 180 36 --23006 946 --
NM_032294chr1761748 461 301 224 43 26 --51709 123 117 82 64 --
NM_032298chr193506 435 51 --1417 --
NM_032316chr352265 1992 1735 236 43 2934 248 22002 1668 --
NM_032345chr12195 --2400 118 --
NM_032353chr17137 1160 1359 --
NM_032375chr196759 721 649 631 54 21 --5728 714 654 65 37 161
NM_032382chr162405 108 ------
NM_032403chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_032420chr53812 575 303 --184 --
NM_032431chr113688 136 110 1714 1306 --
NM_032440chr1022529 651 ------
NM_032444chr1631080 887 217 --149 124
NM_032445chr153921 796 204 ------
NM_032452chr144618 347 221 48 --1556 1234
NM_032457chr443416 3341 365 196 11374 1258 12587
NM_032491chr1221233 507 --2529 73 --
NM_032499chr154530 379 222 180 --11197 --
NM_032512chrX3716 353 264 1846 21135 293 --
NM_032538chr6152805 2776 2734 2698 2053 2030 1903 1085 755 664 417 265 169 111 51 12501 52437 2110 470 302 33 32798 2793 1763
NM_032547chr421372 913 ------
NM_032558chr951217 1202 964 486 63 ------
NM_032561chr224616 239 90 74 2581 144 154 --
NM_032569chr163163 100 24 1315 1474 --
NM_032575chr16101708 1692 1577 1562 1366 1331 732 342 323 253 2700 646 51715 1526 1437 691 315 21296 687
NM_032582chr1731401 688 268 ------
NM_032590chr1221112 155 ------
NM_032595chr1741410 1264 995 544 2333 75 91478 1365 1337 1167 1001 553 137 124 79 31270 588 133
NM_032622chr4--2293 156 ----
NM_032638chr33475 118 32 --191 --
NM_032673chr2----128 124
NM_032689chr1951489 1444 1118 1061 445 11504 ----
NM_032711chr1743354 3053 1673 954 42957 1503 242 147 74185 3831 3673 2819 1527 391 113 12815
NM_032737chr1972285 1699 1681 1091 1061 1003 569 22727 1956 22218 227 21979 223
NM_032741chr64708 222 191 56 1936 5921 354 318 236 170 2413 363
NM_032765chr51392 1998 --1198
NM_032772chr104213 206 185 152 --1454 --
NM_032777chr841444 1339 304 162 1294 1323 1985
NM_032784chr62943 752 ------
NM_032786chr122175 66 --185 --
NM_032800chr162584 2568 1770 1760 290 80 --22400 572 --
NM_032804chr104932 388 277 45 --3360 353 71 --
NM_032808chr155925 216 167 99 63 --189 1820
NM_032826chr775277 4874 1923 1571 1067 992 94 23382 449 34774 4486 4021 --
NM_032833chr142099 1884 1837 156 12317 ----
NM_032836chr194797 769 727 32 --1381 1658
NM_032837chr1731899 816 588 22000 703 12027 --
NM_032840chr125760 740 483 267 39 1341 --11163
NM_032842chr721284 622 --1627 --
NM_032873chr1124241 3360 13006 ----
NM_032924chr721063 868 1235 2911 899 1783
NM_032971chrY1687 1851 1958 --
NM_032972chrY1687 1851 1958 --
NM_032975chr1852601 2551 1163 331 25 22332 2251 23190 186 --
NM_032980chr1852601 2551 1163 331 25 22332 2251 23190 186 --
NM_032982chr751974 1793 1759 585 435 --32566 1966 801 --
NM_032995chr241248 1203 1180 640 --21366 277 --
NM_032998chr15744 219 101 82 41 --4920 908 165 46 --
NM_033008chr33409 136 130 2483 63 186 --
NM_033009chr33409 136 130 2483 63 186 --
NM_033010chr33409 136 130 2483 63 186 --
NM_033016chr2241497 1338 556 457 --41486 1386 169 149 --
NM_033018chrX6814 740 452 219 177 50 1155 2748 307 31105 893 339
NM_033020chr133763 1351 119 --13376 11362
NM_033025chr193977 381 362 --1887 --
NM_033027chr33938 127 105 --2738 390 --
NM_033055chr1284 54 1743 ----
NM_033103chr1921331 1077 --1920 11083
NM_033121chr1221351 168 1699 ----
NM_033129chr20162074 1994 1751 1602 1532 1317 772 755 722 663 619 584 498 472 295 47 2672 307 62020 2009 727 676 528 231 11342
NM_033132chr1321477 643 ------
NM_033133chr1783516 3334 2395 1512 932 796 697 170 32446 819 375 33595 3566 2607 12661
NM_033136chr521323 357 11367 --1211
NM_033137chr521323 357 11367 --1211
NM_033143chr474427 4354 3881 541 281 244 164 --12916 14360
NM_033150chr121386 1122 1126 --
NM_033161chr951620 1484 1252 807 667 ------
NM_033181chr623225 3112 11270 11274 --
NM_033201chr1621098 415 1810 3420 165 45 --
NM_033221chr981164 990 950 887 591 537 93 40 22559 47 3995 778 583 1373
NM_033224chr798022 7551 7135 6564 5794 5716 461 76 31 47265 5322 3197 2998 143 11545
NM_033225chr83970 93 81 1260 ----
NM_033226chr163450 254 117 1175 ----
NM_033244chr1571084 855 826 439 412 353 324 --5226 182 116 101 86 21151 493
NM_033246chr152328 103 ------
NM_033267chr53569 219 38 ------
NM_033274chr583532 3407 2350 2298 2205 612 378 369 --43141 592 467 112 12212
NM_033278chr111259 1383 5387 288 267 152 146 2354 317
NM_033285chr853570 2871 1475 1148 829 --1822 --
NM_033290chrX23690 444 13533 ----
NM_033300chr141092 1078 978 248 ------
NM_033309chr161329 1754 1156 --
NM_033315chr1792110 1875 1695 1652 772 670 440 401 135 --22078 489 22045 407
NM_033326chr11143 11950 1873 --
NM_033331chr932305 963 115 11196 ----
NM_033360chr1244540 4232 629 475 ------
NM_033375chr1781427 1399 1304 545 461 355 119 108 1940 41143 575 145 134 1182
NM_033387chr9142571 2553 2417 2367 2361 2344 2313 2119 1653 1046 1012 936 464 104 --32014 959 770 --
NM_033389chr1764126 3828 3337 1731 1420 306 ----14650
NM_033396chr112168 25 2399 370 1124 --
NM_033421chr2051831 1522 645 620 603 ----1411
NM_033425chr1133267 840 42 ------
NM_033429chr1532192 1005 330 23076 726 1900 --
NM_033449chr561850 1573 1439 780 284 126 --61477 785 327 315 175 120 1346
NM_033503chr1563704 3462 3422 3012 2373 1455 13437 63647 2608 2601 2586 897 618 33643 3248 965
NM_033515chr62399 377 ------
NM_033542chr2041737 659 378 276 11542 ----
NM_033551chr5133267 3097 2825 2346 1242 1231 1064 992 836 750 663 194 172 11341 33163 647 385 --
NM_033624chr1231759 1590 1522 1336 --1117
NM_033626chrX51491 1358 1351 717 399 --61758 1386 1266 1150 423 329 --
NM_033631chr183719 3450 3050 831 678 581 430 200 2928 459 23183 995 13179
NM_033637chr1054015 3911 3352 674 295 13953 ----
NM_044472chr13679 122 86 ------
NM_052834chr187896 742 581 387 347 227 116 22308 2263 --1107
NM_052840chr1521641 152 11120 2587 579 11467
NM_052845chr12113160 2933 2301 2146 2121 1229 547 537 158 149 98 13111 ----
NM_052849chr15------1163
NM_052855chr172180 49 ------
NM_052864chr432031 1915 1362 ------
NM_052872chr6----146 --
NM_052874chr162100 59 4672 656 269 78 3127 82 68 --
NM_052875chr1171945 1647 601 589 567 43 35 --1554 --
NM_052876chr1992539 2523 2348 2328 2056 1846 1817 540 487 22309 1897 142617 2599 2566 2427 2362 2356 2320 2063 1646 920 447 383 359 148 41885 1880 895 890
NM_052880chr221298 --3210 108 54 --
NM_052882chr192590 513 158 ----
NM_052896chr182207 2146 2136 2022 1972 1850 486 339 2637 541 52165 2051 2044 1834 1819 22239 492
NM_052897chr125288 187 155 117 78 --2209 201 --
NM_052898chr831826 502 205 11677 ----
NM_052900chr82679 467 ------
NM_052905chr231577 1390 333 ------
NM_052910chr1351721 1624 1435 1354 65 --62001 1726 1372 1360 601 562 21736 1368
NM_052918chr1063158 3148 2850 1308 861 425 12774 11133 1593
NM_052925chr191331 1282 1132 1362
NM_052926chrX41245 364 351 22 1929 11077 --
NM_052928chr171452 2617 319 11343 11417
NM_052934chr171463 606 592 244 237 206 107 1286 21759 299 1291
NM_052938chr12482 34 1844 ----
NM_052948chr193329 261 39 ----1104
NM_052953chr32201 80 ------
NM_053016chr987199 7139 6119 5766 2753 2733 1349 50 --15596 16833
NM_053023chr1142791 2285 560 154 --4616 439 169 161 --
NM_053056chr1192886 2761 923 804 751 736 664 402 32 1304 32852 2842 814 22848 725
NM_053064chr14--13064 2511 499 --
NM_054016chr11170 1734 ----
NM_054016chr11170 1734 ----
NM_054016chr11170 1734 ----
NM_054025chr11101843 1685 1653 842 730 670 289 210 108 52 --21517 847 11471
NM_054027chr53750 366 247 12257 ----
NM_054033chr23175 80 38 --295 69 --
NM_054035chr173764 325 236 1142 2798 51 --
NM_057159chr9163 11515 1216 --
NM_057175chr442287 2133 835 266 ------
NM_057178chr1752004 1727 803 331 143 --21720 355 1362
NM_058172chr421634 1178 ------
NM_058240chr1421213 135 --2636 256 1263
NM_058243chr193720 286 209 --1217 --
NM_078467chr661450 1414 529 413 267 122 1939 31134 974 147 11130
NM_078471chr174259 122 94 58 133 21161 766 21084 762
NM_078485chr62258 71 1618 ----
NM_080391chr12585 128 ------
NM_080491chr11143975 3403 3154 3022 2966 2835 1581 1484 881 822 246 201 189 91 1366 32913 2829 96 --
NM_080616chr204714 682 637 608 1137 ----
NM_080617chr20----148 --
NM_080645chr63810 766 681 ------
NM_080717chr121119 --2546 253 --
NM_080723chr631395 1222 1154 ------
NM_080738chr141969 1941 1378 470 1596 ----
NM_080759chr1321842 904 ------
NM_080760chr1321842 904 ------
NM_080797chr20123427 3097 2902 2842 2445 1407 1195 890 883 300 157 22 53111 2545 1400 963 905 --1935
NM_080881chr54522 152 40 25 --3590 266 111 --
NM_100264chr101763 ------
NM_100486chr101763 ------
NM_130385chr1163031 2653 2207 1156 1121 99 21060 438 153 42713 2229 975 105
NM_130386chr183624 154 58 ------
NM_130391chr943321 2700 1124 425 --11149 13343
NM_130392chr943321 2700 1124 425 --11149 13343
NM_130393chr943321 2700 1124 425 --11149 13343
NM_130438chr212257 212 1839 11002 1248
NM_130439chr1041495 1453 712 317 --1705 --
NM_130439chr1041495 1453 712 317 --1705 --
NM_130440chr12243 183 21122 1113 128 11269
NM_130446chr373405 2763 1197 960 250 62 56 11679 1628 2406 256
NM_130459chr931556 1366 1105 11393 11501 11550
NM_130766chr1731089 1057 965 --2837 294 --
NM_130830chr3103645 3136 3111 2664 1333 1280 1059 899 298 254 22676 719 23378 75 13788
NM_130846chr1231013 198 59 ------
NM_133170chr20107665 7149 6862 6144 3125 1182 613 566 301 104 37598 6211 6079 97423 6651 6091 5367 5342 5079 2768 1039 779 17419
NM_133171chr2031078 321 156 1512 1147 1218
NM_133177chr161008 734 407 346 102 53 1390 1236 --
NM_133178chr161008 734 407 346 102 53 1390 1236 --
NM_133264chr1763775 3286 1117 809 229 153 33397 3329 759 11156 2602 594
NM_133265chrX43385 2651 1090 588 32806 2728 475 ----
NM_133328chr192745 47 --3217 76 29 --
NM_133330chr492622 2436 1270 1082 579 433 294 240 164 ----12563
NM_133331chr492622 2436 1270 1082 579 433 294 240 164 ----12563
NM_133335chr492622 2436 1270 1082 579 433 294 240 164 ----12563
NM_133378chr211019 --1694 --
NM_133432chr211019 --1694 --
NM_133437chr211019 --1694 --
NM_133445chr993512 3432 2348 1404 1105 1093 975 617 503 1649 ----
NM_133452chr1921055 834 11031 4974 825 772 457 31184 1156 755
NM_133457chr721073 184 125 31275 229 223 --
NM_133478chr2--22170 975 22275 195 --
NM_133499chrX6949 932 804 750 296 29 2967 77 3971 357 194 --
NM_133507chr123946 124 43 ------
NM_133631chr31515 ------
NM_133633chr226800 391 381 124 75 28 ------
NM_133642chr2241267 1159 229 52 ------
NM_133647chr1542885 2757 1443 594 12450 3916 910 83 --
NM_134268chr1761149 1107 925 845 230 36 --1963 1959
NM_134442chr2--21760 385 1259 --
NM_138270chrX33318 1218 947 11120 ----
NM_138281chr175547 509 164 72 65 1247 ----
NM_138286chr1911349 --21354 1194 --
NM_138319chr154806 431 55 34 11325 ----
NM_138338chr22133303 3272 3223 2831 2407 2375 2364 2347 2244 1186 1133 723 531 22478 1232 12750 23190 1240
NM_138357chr1051569 1512 1130 537 523 21141 357 11593 --
NM_138409chr631362 915 454 --1942 --
NM_138415chr2241262 581 560 370 11283 21340 269 --
NM_138426chr7------2492 26
NM_138444chr1344991 4491 146 80 --2297 251 3265 247 26
NM_138468chr296069 5773 5665 4901 1807 1441 1137 705 643 33966 2433 1605 25311 1267 --
NM_138471chr113505 401 81 1497 1464 --
NM_138473chr1285000 4993 4628 4555 1234 701 290 40 1282 ----
NM_138479chr141354 552 503 330 --21403 201 1464
NM_138565chr1121110 513 11361 ----
NM_138576chr1484364 3548 3212 3180 2980 1068 100 21 2791 135 33204 328 93 14082
NM_138578chr2061152 578 449 320 112 21 1198 51171 1136 492 486 35 11413
NM_138619chr1721130 27 --1484 --
NM_138620chr92327 113 ------
NM_138694chr632717 485 355 11376 --12381
NM_138713chr1666405 3158 1402 1374 874 328 21322 1190 21772 1766 16265
NM_138714chr1666405 3158 1402 1374 874 328 21322 1190 21772 1766 16265
NM_138717chr62625 486 ----198
NM_138727chr141534 952 760 644 31685 849 613 ----
NM_138728chr141534 952 760 644 31685 849 613 ----
NM_138730chr61422 ------
NM_138731chr14--22590 120 12794 --
NM_138774chr192866 631 1755 3759 221 32 1202
NM_138795chr171190 1141 587 243 216 104 67 --41255 288 95 72 11526
NM_138802chr2291 56 ------
NM_138819chrX1136 ----1142
NM_138931chr3150 2957 85 1879 --
NM_138961chr11299 60 1333 3353 337 126 1367
NM_138969chr81490 --2451 117 --
NM_138970chr1431623 946 864 ------
NM_138971chr1183493 3296 2684 2456 1225 660 120 45 63472 3428 2795 702 247 105 1894 12786
NM_138971chr1183493 3296 2684 2456 1225 660 120 45 63472 3428 2795 702 247 105 1894 12786
NM_138972chr1183493 3296 2684 2456 1225 660 120 45 63472 3428 2795 702 247 105 1894 12786
NM_138972chr1183493 3296 2684 2456 1225 660 120 45 63472 3428 2795 702 247 105 1894 12786
NM_138973chr1183493 3296 2684 2456 1225 660 120 45 63472 3428 2795 702 247 105 1894 12786
NM_138973chr1183493 3296 2684 2456 1225 660 120 45 63472 3428 2795 702 247 105 1894 12786
NM_139014chr652043 1961 872 479 337 1511 21511 54 --
NM_139015chr1231657 1173 618 ----11561
NM_139045chr92706 62 ------
NM_139057chr15132379 2298 2254 2080 2040 2020 1884 894 671 379 275 86 52 1946 ----
NM_139058chrX5184 97 63 36 25 2365 50 ----
NM_139071chr1241355 1197 677 616 1179 31361 1328 193 --
NM_139132chr113371 222 113 1813 3851 840 316 --
NM_139135chr111006 1190 3925 244 171 2240 93
NM_139157chr111689 --3620 585 132 --
NM_139159chr1931060 954 114 --31239 1124 155 11131
NM_139168chr52731 468 ------
NM_139239chr193269 262 197 ------
NM_139276chr1731764 673 425 21873 844 22206 63 --
NM_139278chr85956 863 467 211 151 --1483 11327
NM_139280chr1711038 --11391 11116
NM_139283chr1221791 957 138 ----
NM_139316chr71788 --2968 926 1701
NM_139321chr20113786 3620 3567 3461 3248 2646 1340 1054 948 743 175 43832 3696 3577 1079 33116 1345 1067 --
NM_144571chr466142 4304 4295 2676 2260 89 --16598 --
NM_144578chr1475233 4489 3861 3417 1678 970 126 11007 25083 926 1933
NM_144582chr262375 2294 1781 1659 1626 100 --42491 2082 145 139 --
NM_144583chr241673 1200 1112 54 --11681 --
NM_144586chr23418 239 51 --3346 65 21 --
NM_144590chr1022867 2220 12602 12402 --
NM_144599chr1535187 1653 916 13398 1552 14153
NM_144609chr1731388 1350 237 ------
NM_144617chr197261 200 186 144 115 74 27 --5904 830 823 763 120 1700
NM_144628chr2083030 2974 2581 2374 2310 1058 997 45 32507 761 357 2258 124 12981
NM_144631chr23261 205 49 ------
NM_144635chr32461 32 --2390 208 11038
NM_144664chr111692 ------
NM_144667chr123978 234 41 171 --1762
NM_144691chr193152 103 87 --3481 475 57 --
NM_144723chr51245 1348 1332 --
NM_144726chr52168 157 --1473 --
NM_144728chr12802 195 ------
NM_144729chr12802 195 ------
NM_144732chr1911102 1114 3302 256 240 --
NM_144778chr1322745 897 1727 ----
NM_144963chr832383 792 761 ------
NM_144967chrX4752 412 265 122 ------
NM_144973chr1264820 4280 3974 1478 943 454 --2963 948 --
NM_144994chr25995 463 345 76 49 11572 31085 1068 62 --
NM_145008chr111158 2594 185 2350 94 --
NM_145013chr1162697 2680 2071 648 125 71 --22688 791 --
NM_145056chr19253 45 --2696 135 --
NM_145065chr1151097 415 91 41 33 1278 154 1187
NM_145071chr36798 700 680 316 295 41 --125 --
NM_145112chr142415 408 31053 1025 263 --1335
NM_145113chr142279 82 31325 1297 535 1137 1607
NM_145117chr11103156 1301 1236 1193 1041 489 167 68 57 50 --1494 21209 677
NM_145173chr19132481 2467 2338 964 946 925 873 754 565 512 112 70 28 --92564 2527 2372 675 545 211 164 139 33 12390
NM_145176chr642766 1077 1053 920 ------
NM_145185chr1991773 1555 1440 801 453 182 147 113 72 --81870 1784 1778 501 377 192 161 152 --
NM_145206chr1042047 377 298 211 12109 --32858 2590 2585
NM_145239chr164834 314 240 200 --3401 103 61 --
NM_145259chr224722 1206 35047 937 230 14729 --
NM_145296chr193807 663 641 1130 1668 --
NM_145307chr1022902 448 13193 ----
NM_145313chr1011707 11027 --1477
NM_145320chr763555 2462 1133 858 433 418 22657 747 33548 2524 830 22566 826
NM_145321chr763555 2462 1133 858 433 418 22657 747 33548 2524 830 22566 826
NM_145322chr763555 2462 1133 858 433 418 22657 747 33548 2524 830 22566 826
NM_145341chr10----1317 --
NM_145349chr1741992 640 440 377 --3631 600 122 1529
NM_145351chr1742484 932 869 465 1402 31092 614 79 11021
NM_145690chr821587 1570 21608 459 11211 --
NM_145716chr11149 ----2425 139
NM_145730chr224217 199 146 111 --2399 171 240 23
NM_145733chr2241000 785 758 354 130 3984 805 181 1309
NM_145799chrX53006 2106 1026 277 64 1258 2500 287 1496
NM_145800chrX3672 359 194 2986 393 ----
NM_145802chrX3621 308 143 2935 342 ----
NM_145804chr1141216 352 269 152 --1323 1382
NM_145808chr731938 1123 595 --11050 --
NM_145861chr141969 1941 1378 470 1596 ----
NM_145868chr102530 31 --2214 139 1210
NM_145869chr102530 31 --2214 139 1210
NM_145888chr19111934 1922 1854 1774 722 300 270 181 147 137 77 41792 1328 648 170 31581 607 323 --
NM_145891chr1641691 1340 1213 669 --31308 1200 653 --
NM_145892chr1641691 1340 1213 669 --31308 1200 653 --
NM_145893chr1631813 1462 1335 --21430 1322 --
NM_145894chr19145 --229 23 --
NM_145912chr22144564 4287 3913 3775 3765 1327 1234 1187 962 908 856 491 272 119 34528 375 108 43831 1437 809 305 24030 1368
NM_146388chr1941088 1043 487 403 --81145 1062 994 875 870 864 859 506 11035
NM_147156chr10182 ------
NM_147161chr141173 467 280 124 --2148 31 138
NM_147181chr41544 --154 1988
NM_147182chr41544 --154 1988
NM_147183chr41544 --154 1988
NM_147189chr821818 94 --11856 1775
NM_147192chr12305 179 31689 478 148 4592 486 451 428 --
NM_147193chr1256 28 --273 48 1151
NM_147202chr9152617 2590 2161 2148 1847 1836 1806 624 583 497 476 277 269 214 107 21771 854 82561 2228 2140 2003 1996 1793 768 757 2753 378
NM_147223chr242484 1967 1655 757 11513 11813 22197 666
NM_147233chr242301 1784 1472 574 --11630 22014 483
NM_148174chr81390 --1234 --
NM_148414chr16124 --3159 145 48 --
NM_148898chr7------160
NM_148899chr7------160
NM_148918chr175654 618 597 67 27 ------
NM_152221chr2261000 951 484 325 318 94 ------
NM_152227chr201539 ------
NM_152233chr1431268 442 325 ------
NM_152240chr3--11249 --2474 268
NM_152253chr2283606 3183 3127 3092 2627 1363 527 88 53745 1337 1015 649 272 31493 1485 1467 32764 1201 901
NM_152261chr1212118 2951 840 ----
NM_152263chr176122 5318 5240 4916 4092 2377 67 13728 2204 158 32383 2248 165
NM_152264chr113286 271 22 --1408 1982
NM_152265chr111114 11547 ----
NM_152272chr841169 1031 873 314 --21065 384 --
NM_152277chr53686 614 31 ------
NM_152280chr11467 32776 2477 145 32411 775 768 --
NM_152287chr1661752 499 432 109 65 25 12360 ----
NM_152296chr192234 118 --3265 131 57 1257
NM_152330chr1421674 639 1102 1399 --
NM_152341chr1641117 466 166 135 21465 370 --11171
NM_152344chr1721341 300 11149 --11154
NM_152345chr1721006 433 1875 31115 834 828 2953 391
NM_152346chr1761058 985 937 739 375 86 178 3456 362 236 --
NM_152352chr1822690 2237 22557 715 --12764
NM_152375chr142485 2404 1996 272 --32181 780 462 --
NM_152376chr121837 1585 11520 11668 11387
NM_152384chr251616 1579 1567 1440 1392 --101706 1666 1629 1531 1453 1405 1356 1278 797 735 --
NM_152414chr821444 177 --21498 67 --
NM_152424chrX84631 4157 3969 3046 1895 1644 1421 1279 54530 4312 1659 667 232 24610 604 23329 1240
NM_152437chr121965 --1556 --
NM_152442chr1221431 1399 1286 ----
NM_152450chr1541704 679 244 101 1417 ----
NM_152470chr1883634 3452 3408 2773 2728 1218 662 212 21022 27 23168 187 11591
NM_152475chr1952390 1936 1814 171 38 1709 22017 1019 --
NM_152493chr141378 1099 570 549 11030 21276 273 122
NM_152496chr161151 1086 868 380 332 88 11316 1344 --
NM_152519chr22536 473 --32033 509 78 12107
NM_152520chr24888 126 105 95 ----1244
NM_152523chr22256 65 ----1238
NM_152529chr221564 1409 23305 597 13142 --
NM_152553chr62404 204 ------
NM_152554chr64520 513 241 108 ------
NM_152563chr1181450 1418 1206 583 531 479 427 375 11059 --21195 1190
NM_152581chrX21215 585 ------
NM_152586chr104911 766 725 143 1306 1660 --
NM_152600chr193331 288 93 --181 --
NM_152622chr52935 329 --1287 --
NM_152624chr547484 5306 1532 1097 ------
NM_152629chr971329 1122 1073 933 817 428 53 1714 21109 759 1878
NM_152636chr1142469 2088 673 84 12539 ----
NM_152641chr1232048 474 313 ----12341
NM_152666chr12829 316 1633 ----
NM_152671chr22144 122 ------
NM_152682chr411715 1365 ----
NM_152716chr1121077 43 1479 --1332
NM_152723chr1121072 265 ------
NM_152733chr6166271 6002 5890 5725 5706 5144 4986 4978 4658 2446 1856 1678 1583 962 492 399 1267 36079 6069 96 14761
NM_152739chr72732 91 --1113 199
NM_152749chr74964 798 303 262 ------
NM_152756chr521599 357 ------
NM_152769chr194658 640 589 192 --4669 177 123 117 --
NM_152780chrX2174 100 ------
NM_152787chrX53606 2550 1497 1290 86 --11583 --
NM_152838chr20----13368 --
NM_152857chr6----1258 --
NM_152858chr6----1258 --
NM_152860chr1261341 1164 347 333 256 102 2993 90 31376 1347 1035 125
NM_152888chr81849 1631 1273 1640
NM_152903chr1322290 694 21811 772 ----
NM_152924chr1595400 2171 2005 1641 1084 987 950 433 59 45629 4955 4915 4216 34408 4401 4172 12129
NM_152989chr1241863 1448 1398 559 11840 --11880
NM_152996chr132044 696 687 11904 ----
NM_153029chr16184018 3964 3700 3583 3443 3363 3181 3082 2916 2910 2794 2719 2706 2626 1559 1253 487 463 23142 1378 53788 3524 2684 687 669 --
NM_153035chr152922 2012 1199 315 264 23241 636 42112 513 416 367 --
NM_153040chr15180 1458 ----
NM_153050chr2274702 3927 3059 617 201 112 57 --21124 801 --
NM_153051chr2274702 3927 3059 617 201 112 57 --21124 801 --
NM_153184chr32188 97 ------
NM_153188chr554842 4648 1384 688 664 1617 ----
NM_153235chr62879 584 1947 1926 --
NM_153257chr1941241 1031 802 413 ------
NM_153271chr1541273 1246 1168 370 156 1188 --
NM_153273chr342664 2442 543 402 --32779 2348 716 1727
NM_153321chr172876 381 ----1426
NM_153322chr172876 381 ----1426
NM_153334chr223583 65 50 --2564 198 159
NM_153342chr21150 141 --3211 141 46
NM_153343chr441682 871 429 366 11654 21690 471 --
NM_153350chr1681295 1106 628 621 614 283 176 110 --31096 440 191 31245 696 222
NM_153367chr1081243 1202 1104 1066 775 551 456 420 12473 43783 1209 749 31 --
NM_153371chr1332055 504 285 ----1579
NM_153449chr12--3146 135 126 145 --
NM_153487chr6144783 4722 4716 4413 4401 4204 3350 1597 1589 1489 1258 1250 1070 701 23702 648 64630 4318 3760 3322 3154 21 54750 4621 4314 771 766
NM_153498chr103652 303 91 1816 --177
NM_153499chr1222525 2337 --32556 1921 40 12570
NM_153500chr1222525 2337 --32556 1921 40 12570
NM_153607chr512095 33156 2361 1945 ----
NM_153616chr15----11505 --
NM_153617chr15----11505 --
NM_153618chr15----11505 --
NM_153619chr156776 592 519 391 266 129 --42743 2303 1027 868 1463
NM_153620chr731788 636 179 --31170 1151 282 --
NM_153631chr791637 1536 1494 1209 590 288 273 137 43 --1130 --
NM_153632chr791637 1536 1494 1209 590 288 273 137 43 --1130 --
NM_153635chr3146 --1177 --
NM_153675chr204168 145 131 39 1213 --1138
NM_153685chr1281108 1037 982 918 300 263 142 132 --1228 162
NM_153686chr411655 --12284 12072
NM_153705chr1121953 21 11723 1766 --
NM_153712chr252775 2761 2484 429 323 --2897 434 --
NM_153756chr141891 1789 1730 1293 1210 21913 1742 --
NM_153810chr1095071 4861 4481 4345 4335 3468 1493 680 468 34207 4192 1364 13390 --
NM_153812chr131800 1522 476 22206 880 ----
NM_153828chr2------1598
NM_153831chr83941 747 29 --1782 --
NM_170674chr153229 197 116 1139 2234 189 --
NM_170677chr153229 197 116 1139 2234 189 --
NM_170696chr1531241 405 203 11163 21319 410 --
NM_170697chr1531241 405 203 11163 21319 410 --
NM_170706chr193386 2897 1496 1293 1159 941 510 356 317 --23107 2904 --
NM_170707chr11938 157 4979 593 384 67 --
NM_170708chr11938 157 4979 593 384 67 --
NM_170709chr832028 842 325 11856 ----
NM_170719chr132423 176 ------
NM_170731chr1141906 1872 772 760 1754 ----
NM_170732chr1141906 1872 772 760 1754 ----
NM_170733chr1141906 1872 772 760 1754 ----
NM_170734chr1141906 1872 772 760 1754 ----
NM_170735chr1141906 1872 772 760 1754 ----
NM_170740chr682879 2531 1115 974 829 592 449 65 --2363 158 1837
NM_170751chr621143 103 1588 11289 --
NM_170752chr621143 103 1588 11289 --
NM_170754chr123341 107 70 155 1164 --
NM_170768chr1131721 1289 492 21679 272 ----
NM_171825chr5122770 2689 2581 2358 2231 2078 1272 1266 690 458 213 47 1116 82347 2115 1277 1257 681 655 220 207 22637 677
NM_172016chr631138 246 92 11012 11132 11356
NM_172058chr831390 1335 538 ------
NM_172059chr831390 1335 538 ------
NM_172060chr831390 1335 538 ------
NM_172071chr176362 6298 5520 2977 2910 2805 425 --26794 2280 35999 5831 453
NM_172103chr642549 2358 2320 999 --12634 --
NM_172105chr642549 2358 2320 999 --12634 --
NM_172159chr312131 1252 ----
NM_172160chr312131 1252 ----
NM_172169chr1051255 360 338 170 150 21623 487 ----
NM_172170chr1051255 360 338 170 150 21623 487 ----
NM_172171chr1051255 360 338 170 150 21623 487 ----
NM_172173chr1051255 360 338 170 150 21623 487 ----
NM_172206chr1761748 461 301 224 43 26 --51709 123 117 82 64 --
NM_172208chr65985 884 848 415 381 1943 41019 947 925 910 2935 368
NM_172211chr16880 851 610 327 316 87 --174 --
NM_172216chr1222427 2239 --22458 1823 12472
NM_172225chr12305 179 31689 478 148 4592 486 451 428 --
NM_172226chr1222525 2337 --32556 1921 40 12570
NM_172230chr113688 136 110 1714 1306 --
NM_172315chr153229 197 116 1139 2234 189 --
NM_172316chr153229 197 116 1139 2234 189 --
NM_172375chr142854 81 1813 --1846
NM_172387chr1851599 1132 561 333 96 --11554 --
NM_172388chr1851646 1179 608 380 143 --21601 44 --
NM_172389chr1851646 1179 608 380 143 --21601 44 --
NM_173076chr21664 ----1279
NM_173157chr123407 119 84 ----150
NM_173191chr1041110 941 228 70 21183 837 51199 841 354 300 293 21059 1054
NM_173192chr1041110 941 228 70 21183 837 51199 841 354 300 293 21059 1054
NM_173193chr1041110 941 228 70 21183 837 51199 841 354 300 293 21059 1054
NM_173194chr1041110 941 228 70 21183 837 51199 841 354 300 293 21059 1054
NM_173195chr1041110 941 228 70 21183 837 51199 841 354 300 293 21059 1054
NM_173214chr1666405 3158 1402 1374 874 328 21322 1190 21772 1766 16265
NM_173359chr31335 ----11541
NM_173465chr571013 954 848 812 759 217 137 1392 1982 --
NM_173468chr423709 462 --21265 677 --
NM_173469chr15----1252 --
NM_173470chrX32950 1870 72 21837 551 11899 11895
NM_173475chr16----11298 --
NM_173477chr1731934 1461 243 21472 554 31797 1516 386 2559 493
NM_173510chr222934 121 --1967 11065
NM_173511chr242451 1216 831 346 12942 ----
NM_173546chr34613 559 271 241 ------
NM_173570chr321468 1419 12133 --1864
NM_173582chr1176012 5751 5580 5522 5030 4102 672 25342 1483 ----
NM_173595chr12205192 5079 4998 4872 4813 4234 4128 4116 3635 3610 3341 3248 1987 1388 1085 1046 592 280 219 149 21294 204 145135 4879 4479 4334 4218 4133 3728 2069 2000 1702 1516 1427 733 443 --
NM_173602chr1211475 13394 1381 1911
NM_173614chr163172 166 64 1132 ----
NM_173642chr1169043 8577 6687 6151 5750 3689 3155 2685 2650 2035 1705 1559 1479 1265 772 665 47747 5587 2932 1007 13694 --
NM_173654chr351515 690 483 399 317 144 ----
NM_173681chr741604 739 287 228 22032 1525 41835 1515 452 264 1595
NM_173694chrX1141 12157 --11040
NM_173808chr133303 1331 939 ------
NM_173809chr1011236 --11070 11305
NM_173822chr2--176 2662 592 --
NM_173825chr352833 2781 1190 1151 116 21979 991 --1458
NM_173833chr861612 1472 1236 105 54 43 1139 21534 83 11353
NM_173854chr172081 1813 1597 748 584 461 89 --52062 1705 1485 95 28 32069 1971 83
NM_174911chr852510 1343 1290 1140 739 --31132 1116 744 1965
NM_174916chr1562308 1697 787 697 538 525 ------
NM_174921chr42748 279 ------
NM_174934chr1193360 3345 1269 957 905 895 676 403 315 13214 63354 2358 1145 1135 652 165 22354 842
NM_174955chr1741457 1315 1225 937 --51174 295 109 34 27 1517
NM_174963chr12597 62 --2911 639 1663
NM_174964chr12597 62 --2911 639 1663
NM_174965chr12616 81 --2930 658 1682
NM_174966chr12597 62 --2911 639 1663
NM_174967chr12616 81 --2930 658 1682
NM_174968chr12597 62 --2911 639 1663
NM_174969chr12597 62 --2911 639 1663
NM_174970chr12616 81 --2930 658 1682
NM_174971chr12597 62 --2911 639 1663
NM_175038chr12295 47 ----131
NM_175058chr112437 77 1125 --1908
NM_175060chr142161 24 ------
NM_175610chr15165 ------
NM_175624chr1287844 6489 6444 6426 5823 5026 4941 1388 57790 7431 7371 6464 5477 25093 529 --
NM_175625chr1287844 6489 6444 6426 5823 5026 4941 1388 57790 7431 7371 6464 5477 25093 529 --
NM_175634chr8----11044 --
NM_175635chr8----11044 --
NM_175636chr8----11044 --
NM_175709chr2272676 2611 2412 1906 1225 1215 151 2905 829 42682 2518 2094 232 1366
NM_175733chr1131706 186 80 ----11955
NM_175736chr12227697 7672 6592 6413 6367 6040 5847 5464 5397 5378 4928 4800 3142 2471 2333 1742 1680 1395 1372 1299 627 30 37684 4963 2774 57649 6424 5263 1978 819 21378 120
NM_175747chr6----4912 825 819 419 --
NM_175767chr551277 758 484 323 204 ------
NM_175847chr194528 370 308 171 1486 21127 534 --
NM_175848chr206956 917 884 320 155 76 ------
NM_175848chr206956 917 884 320 155 76 ------
NM_175849chr206956 917 884 320 155 76 ------
NM_175849chr206956 917 884 320 155 76 ------
NM_175850chr206956 917 884 320 155 76 ------
NM_175850chr206956 917 884 320 155 76 ------
NM_175852chr142975 2244 1201 739 12878 21152 905 32739 1935 918
NM_175861chr1255415 5369 2231 1958 678 11509 12242 25311 1650
NM_175863chr61480 1474 ----
NM_175884chr741313 536 465 57 ------
NM_175898chr1571424 590 349 288 116 103 36 21417 418 1327 --
NM_175913chr202848 826 ------
NM_175922chr661183 592 461 440 428 271 --21304 64 2248 44
NM_175931chr1641622 805 113 49 31416 1388 1358 41651 1640 1550 333 --
NM_176792chr1061423 1224 1188 1108 352 236 ------
NM_176801chr43669 312 47 11732 21539 543 2750 539
NM_176863chr1762177 2032 1589 1476 766 113 31583 535 218 31763 1743 1481 --
NM_176871chr883059 2693 2364 2194 836 747 404 31 --33024 1231 412 12974
NM_177398chr141666 1561 1502 617 --11971 --
NM_177399chr141666 1561 1502 617 --11971 --
NM_177414chr121217 576 ----1445
NM_177422chr1193 --1595 --
NM_177424chr131282 751 685 1264 ----
NM_177438chr1433211 1700 1511 1915 12617 --
NM_177553chr111632 1382 ----
NM_177559chr2011032 --21170 50 --
NM_177560chr2011032 --21170 50 --
NM_177937chr931483 1338 346 --11424 --
NM_177947chrX21600 59 --1387 --
NM_177948chrX21600 59 --1387 --
NM_177952chr143707 83 36 ------
NM_177968chr221981 1608 12144 ----
NM_177977chr1761994 1838 1618 1267 179 104 --31648 1305 419 --
NM_177990chr20----1768 --
NM_177996chr20123343 2996 2932 2831 2546 2178 2123 760 754 677 412 349 12619 22925 2731 33378 2404 748
NM_177999chr992727 2709 2646 1392 1332 1160 447 229 87 3905 788 724 63432 1494 1489 997 420 347 22602 2409
NM_178010chr1241863 1448 1398 559 11840 --11880
NM_178013chr1422399 793 42316 604 597 536 42376 1934 1007 401 22384 240
NM_178014chr63780 749 203 1995 ----
NM_178120chr23285 248 63 --21074 68 --
NM_178123chr21879 ------
NM_178126chr1742058 1833 1516 166 11491 11822 155
NM_178138chr93961 666 175 2717 28 --1722
NM_178148chr61183 --2488 51 --
NM_178151chrX117645 7415 6003 5600 4999 4991 2167 1741 1623 514 229 --67659 6983 6788 5168 2688 2579 15762
NM_178152chrX117645 7415 6003 5600 4999 4991 2167 1741 1623 514 229 --67659 6983 6788 5168 2688 2579 15762
NM_178153chrX117645 7415 6003 5600 4999 4991 2167 1741 1623 514 229 --67659 6983 6788 5168 2688 2579 15762
NM_178229chr161028 945 682 395 128 21 1334 1424 --
NM_178313chr232005 74 29 --1731 --
NM_178314chr122746 249 --1159 --
NM_178423chr71496 --1285 161
NM_178425chr71496 --1285 161
NM_178450chr51275 1143 ----
NM_178493chr171313 ----166
NM_178500chr174774 747 582 569 1701 2783 194 1213
NM_178502chr121450 --2201 163 --
NM_178509chr1774177 3911 3872 2967 1504 828 677 1390 ----
NM_178557chr48629 548 507 499 253 233 66 36 11713 31633 599 25 --
NM_178568chr1761125 669 530 503 428 256 1281 11108 --
NM_178578chr201184 124 1147 12399
NM_178585chr432751 2649 533 12172 --1788
NM_178835chr43813 804 797 1736 2765 72 194
NM_178860chr171112 1758 2366 97 2694 625
NM_180976chr61280 1668 2730 672 --
NM_180977chr61280 1668 2730 672 --
NM_181050chr162135 118 --2217 123 --
NM_181332chrX42212 2010 801 38 1161 1165 1280
NM_181349chr7102778 2728 2415 2290 2150 1023 228 215 182 70 1497 22567 2035 12341
NM_181351chr11102944 2868 1841 1175 1076 1032 931 813 561 282 21167 835 ----
NM_181356chr61856 --1706 --
NM_181481chr1896907 6412 6210 5027 4917 4805 2275 1799 1398 12474 26470 4893 22678 1210
NM_181482chr1896907 6412 6210 5027 4917 4805 2275 1799 1398 12474 26470 4893 22678 1210
NM_181483chr1896907 6412 6210 5027 4917 4805 2275 1799 1398 12474 26470 4893 22678 1210
NM_181486chr121119 --2546 253 --
NM_181504chr532851 2811 546 --142 1878
NM_181505chr175542 238 165 75 64 --1214 --
NM_181523chr532851 2811 546 --142 1878
NM_181524chr532851 2811 546 --142 1878
NM_181659chr2052622 2427 1125 852 608 12615 21182 257 --
NM_181659chr2052622 2427 1125 852 608 12615 21182 257 --
NM_181670chr12184 --3454 445 268 1296
NM_181671chr174143 97 74 36 --2256 148 --
NM_181672chrX2687 27 ------
NM_181673chrX2687 27 ------
NM_181689chr201679 --1853 2615 327
NM_181746chr12243 145 --153 --
NM_181762chrX4890 182 156 63 --1148 --
NM_181777chrX4890 182 156 63 --1148 --
NM_181782chr611474 1102 --1107
NM_181784chr272117 2081 1925 839 704 193 29 --22135 182 192
NM_181828chr22133711 3465 2978 1374 1312 1295 1209 835 633 590 462 399 142 1380 83621 3075 2399 2326 1422 1282 1248 468 43426 3389 802 80
NM_181829chr22133711 3465 2978 1374 1312 1295 1209 835 633 590 462 399 142 1380 83621 3075 2399 2326 1422 1282 1248 468 43426 3389 802 80
NM_181830chr22133711 3465 2978 1374 1312 1295 1209 835 633 590 462 399 142 1380 83621 3075 2399 2326 1422 1282 1248 468 43426 3389 802 80
NM_181832chr22133726 3480 2993 1389 1327 1310 1224 850 648 605 477 414 157 1395 83636 3090 2414 2341 1437 1297 1263 483 43441 3404 817 95
NM_181838chr52518 364 --1632 --
NM_181843chr114317 295 88 33 ----1338
NM_181844chr171303 --31380 396 127 --
NM_181846chr1992728 2651 2583 2010 1034 693 254 240 160 2849 642 32872 2703 453 1483
NM_181871chr15689 245 96 81 32 142 2465 46 --
NM_181876chr441037 809 49 29 2634 378 ----
NM_181897chr321652 347 12168 --1985
NM_182314chrX31918 1591 165 ------
NM_182470chr155566 537 503 220 56 1527 3531 497 39 --
NM_182471chr155566 537 503 220 56 1527 3531 497 39 --
NM_182485chr433068 2414 631 1113 --12516
NM_182493chr1664231 1938 1675 1599 926 616 44591 3547 1363 962 45016 4856 3582 622 1448
NM_182503chr665061 4676 4651 4569 1645 1005 --2724 380 --
NM_182509chr1451647 1250 568 243 76 11506 21039 573 --
NM_182511chr1841222 426 68 55 11262 11091 --
NM_182515chr1955269 4154 2641 2363 1954 24792 456 ----
NM_182526chr1482955 2878 2083 2045 887 821 809 80 12680 22945 895 1759
NM_182527chr2282043 1961 1858 751 364 274 148 22 --51871 1848 1692 240 229 2805 51
NM_182528chr25494 460 79 51 40 --2212 206 --
NM_182546chr7----1116 --
NM_182551chr223017 607 23579 401 --12499
NM_182553chr113564 516 54 --2444 164 --
NM_182557chr11142092 2079 2046 1898 1824 1814 1440 1398 862 850 745 463 316 299 21725 1605 61938 1609 829 531 438 251 --
NM_182580chr142452 2435 2305 631 ----1879
NM_182643chr852055 1931 621 600 534 --32060 1937 589 --
NM_182646chr433068 2414 631 1113 --12516
NM_182648chr142677 301 ------
NM_182685chr13569 555 217 160 2205 109 1810
NM_182689chr11358 --192 --
NM_182690chr11420 --1154 --
NM_182697chr71151 11582 ----
NM_182715chr71415 ------
NM_182728chr1461509 1263 1168 303 239 95 1197 51435 1377 1196 1173 630 31524 542 223
NM_182762chr732062 565 492 12226 11919 --
NM_182764chr2031078 321 156 1512 1147 1218
NM_182789chr5------1871
NM_182830chr1421996 590 11625 --1603
NM_182895chr223583 65 50 --2564 198 159
NM_182898chr776355 5232 5102 4772 1003 782 570 --24779 1441 24459 4454
NM_182899chr776355 5232 5102 4772 1003 782 570 --24779 1441 24459 4454
NM_182915chr262111 2009 1939 851 748 538 --31944 499 408 2657 404
NM_182920chr321083 65 ------
NM_182936chr1421213 135 --2636 256 1263
NM_182948chr13764 166 143 11166 ----
NM_182964chr11103156 1301 1236 1193 1041 489 167 68 57 50 --1494 21209 677
NM_182970chr20134214 4171 4083 3986 3556 2814 2684 1290 952 587 297 160 45 13949 83793 3158 2784 1712 1516 1260 957 179 --
NM_182972chr122652 2088 1873 ----
NM_183002chr1421213 135 --2636 256 1263
NM_183006chr2021149 972 11239 31243 1142 1128 --
NM_183047chr203740 199 25 ----131
NM_183048chr203740 199 25 ----131
NM_183078chr663661 3027 1378 1046 908 245 32860 1107 282 2891 787 33759 3130 918
NM_183323chr5------1871
NM_183377chr173640 339 25 --1313 --
NM_183425chr2051455 1264 1078 202 138 1611 21445 61 --
NM_184041chr162162 54 134 ----
NM_184043chr162162 54 134 ----
NM_184231chr34552 490 462 133 1275 1496 --
NM_184234chr201847 ------
NM_194071chr795032 3812 1624 1559 501 482 216 60 50 23573 842 33577 2026 1564 --
NM_194249chr5126 ----163
NM_194271chr124729 237 146 30 ------
NM_194278chr14103362 3234 2855 1668 1276 864 758 531 411 284 11424 33456 3436 1060 --
NM_194282chr4--22845 2264 ----
NM_194285chr1143295 2228 1018 292 12953 ----
NM_194286chr12104252 2352 1636 1622 1393 1234 1050 1029 764 61 45948 3786 2433 1254 44820 1076 1059 399 11566
NM_194291chr822222 1900 11035 12727 --
NM_194292chr1----11292 --
NM_194301chr142254 39 --1951 --
NM_194313chr921502 1244 2798 137 11813 --
NM_194314chr134629 4170 1424 14384 ----
NM_194317chr262570 2402 2172 2088 1817 786 12283 ----
NM_194356chr1232031 1877 730 ----1736
NM_194358chr1251849 1420 1413 553 79 155 21758 256 --
NM_194359chr1251849 1420 1413 553 79 155 21758 256 --
NM_194434chr1834861 4337 409 21748 914 ----
NM_194452chr1141242 399 283 117 --1404 132
NM_194453chr1141242 399 283 117 --1404 132
NM_197941chr522371 69 --22527 2271 --
NM_198040chr161168 1161 910 822 791 149 --21011 915 --
NM_198053chr12411 22 ------
NM_198056chr331467 1396 564 21709 265 --11577
NM_198066chr1433036 2453 780 11192 12519 42447 2368 2239 2095
NM_198081chr642749 2650 859 247 --12754 12009
NM_198123chr82679 467 ------
NM_198124chr82679 467 ------
NM_198158chr31506 --12577 --
NM_198159chr31506 --12577 --
NM_198177chr31506 --12577 --
NM_198178chr31506 --12577 --
NM_198195chr32473 127 ------
NM_198215chr10267 31 ------
NM_198232chr141208 123 127 --
NM_198234chr141208 123 127 --
NM_198235chr141208 123 127 --
NM_198236chr15967 924 914 272 92 2793 294 2818 36 --
NM_198240chr122305 212 ------
NM_198261chr12----1586 --
NM_198262chr12----1586 --
NM_198264chr11116 --1439 --
NM_198316chr123341 107 70 155 1164 --
NM_198320chr1241930 1086 471 34 33838 723 57 33969 3414 1852 --
NM_198324chr1231212 954 492 --1857 --
NM_198334chr113683 303 192 ----1202
NM_198335chr113683 303 192 ----1202
NM_198390chr1691853 1553 1446 1280 1266 633 620 442 436 --41235 1226 642 93 21459 1222
NM_198392chr651534 561 508 252 39 22302 308 12096 1322
NM_198400chr1522495 2090 --11952 --
NM_198440chr2282464 2392 2376 1823 305 275 237 200 --42492 755 180 33 11627
NM_198511chrX2568 161 ------
NM_198513chr81521 1245 ----
NM_198560chr383849 1496 1306 1080 960 579 390 124 33702 991 71 11140 --
NM_198573chr92301 280 ----144
NM_198597chr103971 216 169 2760 52 ----
NM_198679chr981066 982 897 748 713 706 698 315 12040 2953 320 1721
NM_198686chr1462548 2529 1049 1004 880 174 22422 163 62502 761 708 682 428 344 --
NM_198712chr1----2213 173 --
NM_198713chr1----2213 173 --
NM_198834chr1731886 485 405 --32020 1547 249 1208
NM_198836chr1731886 485 405 --32020 1547 249 1208
NM_198837chr1731886 485 405 --32020 1547 249 1208
NM_198838chr1731886 485 405 --32020 1547 249 1208
NM_198839chr1731886 485 405 --32020 1547 249 1208
NM_198841chr911047 --151 --
NM_198859chr374245 3959 3685 1614 1558 711 558 23597 1818 43295 1267 846 730 13800
NM_198880chr32682 526 ------
NM_198889chr421375 1325 ------
NM_198896chr1131711 408 397 ------
NM_198900chr12227697 7672 6592 6413 6367 6040 5847 5464 5397 5378 4928 4800 3142 2471 2333 1742 1680 1395 1372 1299 627 30 37684 4963 2774 57649 6424 5263 1978 819 21378 120
NM_198904chr531625 1349 384 --1823 --
NM_198935chr2033055 2808 366 12332 1269 --
NM_198969chr19----1167 1186
NM_198970chr19----1167 1186
NM_198991chr18------1613
NM_198993chr1761527 1133 392 372 265 30 1282 41504 562 548 501 21188 90
NM_198995chr183515 149 130 ------
NM_199000chr71589 11821 ----
NM_199050chr2163289 3278 2850 2571 465 53 --13331 --
NM_199054chr1991699 1596 615 582 506 494 304 294 33 --31817 1601 191 1592
NM_199129chr203966 490 218 2974 133 2284 142 --
NM_199141chr193876 725 268 2807 613 4921 718 184 60 2637 173
NM_199144chr2021447 516 --3622 583 404 --
NM_199160chr971909 1815 1805 1606 392 64 35 --3722 52 40 --
NM_199168chr103577 508 38 --11083 --
NM_199169chr2052997 2927 2775 2308 53 22704 2286 1127 --
NM_199170chr2052997 2927 2775 2308 53 22704 2286 1127 --
NM_199171chr2052997 2927 2775 2308 53 22704 2286 1127 --
NM_199185chr5----1195 --
NM_199203chr2021447 516 --3622 583 404 --
NM_199205chr84609 581 238 24 ------
NM_199245chr12102499 2441 2370 2317 2102 1984 531 494 443 329 --32322 1669 420 --
NM_199320chr4----12845 --
NM_199320chr4----12845 --
NM_199324chr443106 3003 1323 132 ------
NM_199415chr2092455 2160 2058 2052 1594 553 541 324 75 2359 142 22388 234 1276
NM_199437chr11------136
NM_199438chr11------136
NM_199439chr11------136
NM_199454chr1134184 4177 3842 3691 3424 3311 3205 3188 1599 1330 1070 887 122 14339 33100 1064 104 11001
NM_199461chr1073401 3108 888 741 556 72 22 53135 2536 2486 2234 965 43262 1295 1186 39 --
NM_199462chr144653 4056 1518 99 44364 3310 1982 939 ----
NM_199478chrX3754 711 587 ------
NM_199487chr202927 269 ------
NM_201280chr6147 11328 ----
NM_201348chr194368 3467 3334 3119 2738 1059 654 314 199 23046 1609 84393 4318 3124 1446 941 894 322 125 --
NM_201378chr83247 231 212 --41002 881 869 296 --
NM_201379chr83247 231 212 --41002 881 869 296 --
NM_201380chr83247 231 212 --41002 881 869 296 --
NM_201381chr83247 231 212 --41002 881 869 296 --
NM_201382chr83247 231 212 --41002 881 869 296 --
NM_201383chr83247 231 212 --41002 881 869 296 --
NM_201384chr83247 231 212 --41002 881 869 296 --
NM_201428chr1131371 329 145 --1512 --
NM_201429chr1131371 329 145 --1512 --
NM_201430chr1141297 600 255 71 --1438 --
NM_201432chr17186477 6341 6335 6149 6119 5975 4077 4030 2154 2140 2132 2034 1796 1249 1183 966 953 732 25350 5262 66493 6384 4007 1036 774 89 --
NM_201433chr17186477 6341 6335 6149 6119 5975 4077 4030 2154 2140 2132 2034 1796 1249 1183 966 953 732 25350 5262 66493 6384 4007 1036 774 89 --
NM_201434chr172173 63 1624 2613 537 --
NM_201437chr821399 142 ------
NM_201520chr1781628 1118 739 716 562 492 463 169 --41797 1248 729 511 --
NM_201535chr143734 146 41 ------
NM_201536chr143734 146 41 ------
NM_201537chr143734 146 41 ------
NM_201538chr143734 146 41 ------
NM_201539chr143734 146 41 ------
NM_201540chr143734 146 41 ------
NM_201541chr143734 146 41 ------
NM_201548chr221301 958 --187 1162
NM_201567chr341382 1094 648 151 11319 145 --
NM_201591chr4267 59 ------
NM_201592chr4267 59 ------
NM_201599chrX1128 --31211 433 357 --
NM_201624chr12463 260 --2468 308 --
NM_201628chr1103141 2345 2160 1116 866 658 600 390 274 191 1428 23093 2362 1296
NM_201632chr561720 603 574 169 105 35 11643 2588 257 --
NM_201634chr561819 702 673 268 204 134 11742 2687 356 --
NM_202002chr12--3157 68 51 2603 41 1884
NM_202467chr192450 231 --3564 539 173 --
NM_202468chr192450 231 --3564 539 173 --
NM_202469chr192450 231 --3564 539 173 --
NM_202470chr192450 231 --3564 539 173 --
NM_202494chr192450 231 --3564 539 173 --
NM_203305chr991842 727 698 616 516 409 172 141 92 3624 415 130 1500 --
NM_203318chr174259 122 94 58 133 21161 766 21084 762
NM_203327chr20124187 4136 4003 3366 2895 2884 1810 994 975 810 760 327 1113 53956 3025 2792 695 354 --
NM_203342chr173631 2693 1167 1075 750 739 42 23547 993 22785 2773 122
NM_203343chr173631 2693 1167 1075 750 739 42 23547 993 22785 2773 122
NM_203351chr1732363 1881 799 22048 1726 62347 1976 1887 1767 1690 293 22369 1009
NM_203364chr112935 406 ------
NM_203394chr121453 --178 --
NM_203413chr1751112 1004 754 374 285 --1255 --
NM_203444chr125916 723 713 192 185 1307 2760 728 --
NM_203446chr2142189 1136 786 732 --1712 1138
NM_203454chr131035 935 900 ----1912
NM_203458chr142544 1397 1102 132 --12728 12701
NM_203459chr112522 --11989 --
NM_203463chr254958 4103 3997 902 306 13118 14213 --
NM_203464chr111076 --1368 --
NM_203504chr422165 803 ------
NM_203505chr422165 803 ------
NM_203506chr1741840 1435 627 122 --21699 1418 --
NM_205848chr142793 2422 2413 41 22261 242 32315 1776 112 12382
NM_205860chr142818 2183 2112 514 ------
NM_205861chr182088 1584 1570 611 564 539 398 83 11428 2722 55 --
NM_205864chr6------145
NM_206594chr142580 1324 266 27 ------
NM_206595chr142580 1324 266 27 ------
NM_206853chr622823 795 ------
NM_206854chr634084 2056 987 ------
NM_206855chr635049 1952 300 ----1285
NM_206876chr232688 97 81 1288 13098 --
NM_206900chr192132 82 --2273 87 --
NM_206901chr192132 82 --2273 87 --
NM_206907chr523199 531 --1579 1739
NM_206909chr8107969 7394 6751 5267 2754 2726 2486 1758 884 831 26926 5340 37556 2964 2759 12773
NM_206914chr1241853 378 274 164 1520 12140 --
NM_207012chr1032792 2773 2304 --1455 1417
NM_207043chr11204 1372 ----
NM_207044chr11204 1372 ----
NM_207047chr11204 1372 ----
NM_207111chr741042 559 519 250 --42337 903 819 137 --
NM_207113chr721069 139 ----11104
NM_207116chr741042 559 519 250 --42337 903 819 137 --
NM_207119chr1042091 1684 756 22 22216 1856 22043 839 --
NM_207171chr151605 1557 821 744 701 --31576 826 129 11572
NM_207291chr194385 212 176 32 --1428 1424
NM_207292chr322685 2607 23171 2601 ----
NM_207293chr322685 2607 23171 2601 ----
NM_207294chr322685 2607 23171 2601 ----
NM_207295chr322685 2607 23171 2601 ----
NM_207296chr322685 2607 23171 2601 ----
NM_207297chr322710 2632 23196 2626 ----
NM_207304chr1322632 784 1614 ----
NM_207306chr174368 3664 3555 3471 3217 2986 2784 24275 3783 2408 191 --
NM_207313chr1751005 966 865 820 813 1737 1664 2978 973
NM_207343chr112490 425 ------
NM_207348chr161887 1628 1523 197 165 148 41953 1907 478 258 11374 --
NM_207362chr22544 35 ------
NM_207371chr1021387 97 11274 ----
NM_207372chr1052249 1564 651 548 461 1181 12290 --
NM_207406chr485936 5251 4593 4125 2358 2151 1081 1051 11072 ----
NM_207444