TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-466
miRNA Sequence: AUACACAUACACGCAACACACAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX96925 5994 5815 5254 4581 2156 1442 1125 117 --1573 11112
NM_000176chr573808 3617 3555 3302 3293 2781 1378 31473 669 332 11289 13675
NM_000216chrX33968 2494 950 --22970 1269 2527 40
NM_000337chr576628 4245 1829 155 145 127 112 --1120 --
NM_000875chr1566838 5748 5521 4275 2557 2534 12565 35760 2647 2549 --
NM_000899chr122865 855 13467 44314 4299 4293 3464 11211
NM_000926chr1179161 7020 5985 2995 2795 1946 1504 49468 2105 471 128 18665 --
NM_001003652chr18118604 8361 8071 5324 2738 1705 1692 620 469 383 65 22732 2297 27892 306 --
NM_001004317chr654266 4158 892 330 259 23166 497 13735 2725 234
NM_001008220chr5183830 3355 3125 2907 2825 1554 1522 1485 1454 1430 1414 1308 1293 1280 1255 1237 1196 1103 33359 2911 1406 52803 1566 1360 1314 1221 --
NM_001010908chr102755 112 ----2721 204
NM_001013620chr1248321 5956 2406 453 25555 1479 26120 5887 12644
NM_001014380chr1365808 4954 4695 1335 807 773 24450 4156 13887 14051
NM_001018074chr573808 3617 3555 3302 3293 2781 1378 31473 669 332 11289 13675
NM_001018075chr573808 3617 3555 3302 3293 2781 1378 31473 669 332 11289 13675
NM_001018076chr573808 3617 3555 3302 3293 2781 1378 31473 669 332 11289 13675
NM_001018077chr573808 3617 3555 3302 3293 2781 1378 31473 669 332 11289 13675
NM_001024094chr573808 3617 3555 3302 3293 2781 1378 31473 669 332 11289 13675
NM_001024401chr1632869 2820 2466 --42489 2481 2473 1140 --
NM_001025076chr1086117 6049 2420 2285 1171 1126 1024 422 36120 4054 3901 ----
NM_001025077chr1067475 7407 2529 2484 2382 1780 47478 5412 5259 1373 ----
NM_001025108chr243555 1234 806 190 1199 53657 3635 196 166 154 --
NM_001033507chr11692 31798 415 407 1400 --
NM_001037174chr262182 1392 699 470 459 262 ----12103
NM_001039590chrX33248 3002 1488 11332 11329 23903 227
NM_001039591chrX33248 3002 1488 11332 11329 23903 227
NM_001039618chr1154968 4821 4776 505 365 1372 35552 4540 3828 --
NM_001039840chrX75497 5381 5285 4842 4333 1756 231 --25275 1736 12227
NM_001040020chr731160 460 110 1465 11476 2294 77
NM_001040110chr711502 11485 41482 321 287 271 1298
NM_001040429chr1352658 2416 1301 1087 1000 11072 --12712
NM_001042537chrX32042 370 251 --11708 2843 100
NM_001042604chr344004 3353 1431 173 11801 31615 1099 517 1111
NM_002025chrX119171 9099 8291 8253 8173 7896 7080 6460 3301 782 470 11644 39120 9077 3672 --
NM_002254chr252125 1949 1921 1663 117 --21935 1927 --
NM_002285chr243555 1234 806 190 1199 53657 3635 196 166 154 --
NM_002594chr20----61936 1928 1877 1865 1814 1806 1229
NM_002736chr742135 336 76 69 --12114 12199
NM_002886chr354877 4437 908 887 875 14440 1900 --
NM_003199chr1885671 5198 4456 4165 2160 1977 1933 1178 14867 34862 4385 965 --
NM_003298chr384094 4057 3954 2045 1319 997 591 490 --44886 4103 1245 352 1443
NM_003994chr122865 855 13467 44314 4299 4293 3464 11211
NM_004100chr62679 648 1487 --21083 62
NM_004171chr11129654 8903 8381 8328 8069 8015 3721 3451 2624 2560 2498 883 1661 ----
NM_004430chr84572 546 522 506 1540 2888 533 --
NM_004999chr674518 3358 1750 1635 1069 467 59 --1675 13458
NM_005011chr711502 11485 41482 321 287 271 1298
NM_005188chr11158080 7350 6773 6434 3302 3276 2375 2326 2283 977 722 525 427 396 368 45750 1634 1497 725 ----
NM_005197chr1465181 4846 4038 1798 1729 1685 25230 5066 25688 5063 14824
NM_005238chr1132250 2216 296 43568 2240 2222 828 32237 2229 825 --
NM_005359chr1875739 5712 1624 1482 651 426 128 25716 1669 11491 15209
NM_005587chr152165 151 --2224 158 --
NM_005613chr132047 515 442 --2623 456 31907 532 136
NM_005665chr134857 995 403 14080 11281 1237
NM_005668chr544579 4395 3811 3528 --14033 14005
NM_005901chr18118604 8361 8071 5324 2738 1705 1692 620 469 383 65 22732 2297 27892 306 --
NM_006047chr2083229 2896 2626 2393 2298 1339 861 709 ----12668
NM_006359chrX32042 370 251 --11708 2843 100
NM_006561chr1086117 6049 2420 2285 1171 1126 1024 422 36120 4054 3901 ----
NM_006650chr5183830 3355 3125 2907 2825 1554 1522 1485 1454 1430 1414 1308 1293 1280 1255 1237 1196 1103 33359 2911 1406 52803 1566 1360 1314 1221 --
NM_006729chrX2258 217 1261 31826 1117 241 21108 351
NM_006750chr1646149 3007 2783 1626 --27298 2567 28051 5050
NM_006924chr171354 3876 282 256 24224 3286 23068 780
NM_007007chr1234102 3367 1267 1227 --3847 786 442
NM_012081chr562527 2502 1502 749 659 366 --53449 3356 1045 767 545 --
NM_012097chr262182 1392 699 470 459 262 ----12103
NM_012164chr956039 5712 5454 5116 4854 16389 27437 6944 1880
NM_012214chr245755 4885 2450 759 25265 4729 16389 1806
NM_012287chr374277 3304 1049 546 487 475 427 --1739 --
NM_013261chr473419 2723 2706 1313 1037 336 299 12574 3363 328 312 --
NM_014043chr31435 --21165 1115 21298 237
NM_014767chr1053499 2800 2405 1153 242 13359 4212 204 192 148 --
NM_014877chr1796568 6417 6285 5671 1732 752 588 247 196 22648 1767 --1880
NM_014888chr731160 460 110 1465 11476 2294 77
NM_014936chr662616 2362 2249 799 789 782 12878 12848 --
NM_014947chr141943 1920 1907 887 32385 1923 242 22892 2778 1359
NM_015138chr152615 593 42272 2043 786 609 1600 --
NM_015310chr878050 5727 5602 5242 2129 942 932 18244 26307 917 13219
NM_015397chr96747 489 472 455 424 414 3463 431 87 ----
NM_015458chr865026 1941 1391 1052 938 783 35244 5092 1700 34835 926 920 --
NM_015569chr194206 4148 3243 3113 3104 3080 1497 1334 633 --44242 3310 3155 96 14251
NM_015879chr1878138 3182 2665 1813 1153 1032 604 15633 --16997
NM_015886chr835671 3605 339 25692 1616 21593 368 14915
NM_015906chr134771 1812 314 14688 34225 1448 1045 1946
NM_016083chr642446 1506 1068 899 11071 41098 1090 551 451 --
NM_016206chr368867 8065 7990 7881 6304 3321 27328 2119 --18325
NM_016248chr1353571 1372 1359 684 232 33818 1390 724 21365 226 --
NM_016260chr2117425 7387 6892 6492 6172 5122 5116 4771 4752 2316 447 37248 5569 1448 27438 7395 17419
NM_016376chr17103499 2992 2979 2775 2763 1538 1377 1203 1118 184 33797 3641 1589 23612 1586 11479
NM_017633chr643473 2809 1143 106 --42917 1037 1020 1014 23260 305
NM_017714chr203780 206 197 2290 200 4325 248 237 231 --
NM_017813chr874302 3730 2277 2269 685 644 385 --25577 652 --
NM_017848chrX84421 3160 3111 1732 1013 912 889 837 1874 41036 1024 936 881 --
NM_017902chr10155145 4707 3880 3715 3510 2032 952 934 912 874 864 852 336 299 263 --21727 329 13915
NM_018374chr765227 4862 4545 4225 4128 3419 22022 696 --11996
NM_019001chr344004 3353 1431 173 11801 31615 1099 517 1111
NM_019072chr533879 940 143 13821 --23965 116
NM_020718chr1686445 5174 4379 2028 1569 1231 147 122 31572 1092 133 ----
NM_020734chr1211306 --52285 1120 1102 1096 273 12719
NM_020772chr1787799 7213 6760 3111 2238 1335 1308 1119 46879 3151 2938 2256 57818 7805 6334 3192 3146 --
NM_020917chr1943607 3374 1363 68 1734 11375 12922
NM_020951chr1922393 877 3744 729 455 3884 741 715 1680
NM_021961chr1197233 6823 5867 5572 5267 5248 1311 893 179 16572 21208 1198 17306
NM_021964chr386242 6089 5262 4800 4707 2593 1982 481 34886 348 72 14883 --
NM_022781chr982502 2025 1133 567 490 452 244 81 4468 446 273 137 22475 528 --
NM_024947chr386436 3671 3528 3154 2991 1846 1742 275 26577 6439 19336 13002
NM_024989chr288061 7974 7741 7478 5707 5142 1977 37 15721 38151 2665 1290 17965
NM_025090chr1717606 392 376 357 321 297 279 270 256 241 227 212 185 159 131 108 64 --3349 146 80 --
NM_030629chr1641910 1659 1647 1188 11653 ----
NM_031427chr1485540 4960 4856 4122 801 670 265 21 23974 1337 --14569
NM_032116chr1365808 4954 4695 1335 807 773 24450 4156 13887 14051
NM_032826chr7105131 4237 4228 4179 1954 1674 1532 1523 1513 1404 35406 1535 1294 11696 23588 1301
NM_033020chr134771 1812 314 14688 34225 1448 1045 1946
NM_033181chr642446 1506 1068 899 11071 41098 1090 551 451 --
NM_138731chr1423444 492 171 24054 684 12770
NM_144973chr1265132 4987 1992 1009 696 209 24990 222 24263 219 13844
NM_206909chr878050 5727 5602 5242 2129 942 932 18244 26307 917 13219
NM_213589chr22426 174 --6404 313 209 203 136 130 --