TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4661-3p
miRNA Sequence: CAGGAUCCACAGAGCUAGUCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000090chr21927 --1808 --
NM_000110chr13752 72 56 ------
NM_000111chr7----125 --
NM_000112chr535521 3869 2227 --14814 --
NM_000115chr13------11780
NM_000125chr642785 1199 266 204 23047 760 1897 --
NM_000129chr641223 971 932 534 ------
NM_000141chr10--11401 11154 --
NM_000163chr511567 ----1124
NM_000167chrX121 --1320 21132 658
NM_000217chr124969 953 712 622 --13797 15382
NM_000245chr722144 541 ----1146
NM_000259chr1575523 5188 4797 4638 3991 1903 1585 22119 1953 25825 3905 --
NM_000276chrX42047 776 351 343 --11749 12214
NM_000346chr1711810 142 ----
NM_000353chr1641230 826 197 175 ------
NM_000378chr112913 109 11204 ----
NM_000379chr261324 1192 1065 574 363 82 ------
NM_000390chrX33275 2090 257 1291 1347 --
NM_000406chr421993 1040 22672 872 ----
NM_000435chr19124 ------
NM_000555chrX76586 5852 5802 5017 4840 1942 452 15757 1614 --
NM_000575chr21886 ------
NM_000618chr1286222 5635 5396 4852 2389 2207 227 201 14024 147 15624
NM_000618chr1286222 5635 5396 4852 2389 2207 227 201 14024 147 15624
NM_000633chr1853941 3592 3434 1922 1014 13842 13964 --
NM_000663chr16102992 1153 711 687 637 588 562 279 235 37 ------
NM_000684chr10--11034 ----
NM_000719chr1285501 5304 5279 5029 4108 1679 580 221 --25751 2254 --
NM_000788chr411136 --1497 --
NM_000794chr5--2993 702 ----
NM_000809chr438458 3416 439 11883 12373 --
NM_000810chr15--1542 ----
NM_000814chr1532647 1470 785 --11256 --
NM_000831chr185251 5117 4177 2336 2056 1682 900 203 1546 35859 1590 681 12283
NM_000834chr1231096 947 415 11126 1137 --
NM_000845chr7--145 ----
NM_000875chr1542177 2020 1295 1099 14586 36959 5222 114 --
NM_000899chr1233887 1111 474 --13233 --
NM_000901chr422069 205 --1759 --
NM_000933chr2011373 11616 11674 --
NM_000945chr2--11308 12057 --
NM_001001395chr1212163 --12794 12150
NM_001001419chr534106 1643 402 1260 14504 --
NM_001001420chr534106 1643 402 1260 14504 --
NM_001001481chr82475 298 33226 3079 535 --1520
NM_001001502chr51106 ------
NM_001001664chr213270 --1359 164
NM_001001787chr12481 121 ------
NM_001001995chrX1519 --11442 --
NM_001002269chr91159 ------
NM_001002838chrX3690 647 437 11426 1491 --
NM_001002843chr152843 195 --11213 --
NM_001003652chr1897496 5707 5676 5508 5296 2538 2532 2206 1372 --16413 --
NM_001004023chr1--150 ----
NM_001004065chr963607 3285 3111 2523 1035 270 12976 ----
NM_001004106chr5179 ------
NM_001004360chr21394 --11430 --
NM_001004419chr1234432 4296 1268 ------
NM_001004720chr21781 ------
NM_001004722chr21950 ------
NM_001005158chr3----128 --
NM_001005159chr3----128 --
NM_001005335chr19190 ------
NM_001005386chr222206 1725 --1231 11741
NM_001005473chr566508 5548 5151 5095 1267 81 ----12472
NM_001005474chr32506 224 --11002 --
NM_001005502chr1265236 4546 3992 3920 381 116 14783 ----
NM_001005732chr211162 ------
NM_001005733chr211162 ------
NM_001006600chr51712 --12214 --
NM_001007466chr664602 1323 1104 1025 968 177 24094 3222 ----
NM_001008388chr42267 132 --1312 --
NM_001008408chr796298 5409 5293 4627 4149 4048 1630 1517 598 24257 1536 22388 2135 --
NM_001008539chr844043 1578 1548 1257 22108 747 25323 3576 --
NM_001008738chr532323 1906 82 --12595 --
NM_001008744chr14----21543 572 --
NM_001008925chr432469 2168 337 12903 1662 --
NM_001009554chr464632 4321 3638 1824 952 904 --23615 1500 --
NM_001009554chr464632 4321 3638 1824 952 904 --23615 1500 --
NM_001009555chr411685 ----1218
NM_001009880chr2244675 4281 3674 450 13290 43564 1825 1213 743 --
NM_001009899chr366372 5946 5725 5197 1432 1235 --12038 --
NM_001009909chr1173171 2483 2444 1501 1297 1197 170 ------
NM_001009960chr732350 902 528 ------
NM_001009996chr3----1512 --
NM_001010846chr121768 1301 --11408 --
NM_001011513chr411611 --13978 --
NM_001011537chr321587 331 ------
NM_001011551chrX130 ------
NM_001011658chrX31698 646 355 21976 1463 ----
NM_001011885chr1521321 523 ------
NM_001012393chr1123936 1857 ------
NM_001012751chr102423 28 1770 ----
NM_001013415chr421417 359 ------
NM_001013438chr311012 --1300 --
NM_001013620chr1277993 7794 7556 6842 5990 2888 112 ------
NM_001014283chr1311875 --21961 476 --
NM_001014380chr1354764 4220 2033 1308 824 ----25509 2195
NM_001014797chr1022956 270 --26753 2290 --
NM_001015045chr41780 12295 ----
NM_001015882chr91689 ------
NM_001017395chr353637 1431 1232 518 478 13579 ----
NM_001017970chr1442033 1017 592 293 22152 1704 ----
NM_001018037chr911101 ----11186
NM_001018065chr936006 5683 5453 --23936 1567 45367 3765 2236 653
NM_001018066chr936006 5683 5453 --23936 1567 45367 3765 2236 653
NM_001018067chr145275 3276 1285 72 ----11675
NM_001018068chr145275 3276 1285 72 ----11675
NM_001018069chr145275 3276 1285 72 ----11675
NM_001024218chr141724 ------
NM_001024649chr522355 328 161 ----
NM_001024660chr31652 ------
NM_001024668chr12----1731 --
NM_001024948chr122651 146 ------
NM_001025077chr1025185 1367 --11223 --
NM_001025266chr321684 1644 13681 167 --
NM_001025580chrX53896 3716 2903 2800 193 13128 ----
NM_001025777chr241070 229 142 128 --1173 --
NM_001029858chr642718 1286 939 717 ----13226
NM_001029875chr522455 1113 ------
NM_001029997chr19134 ----1545
NM_001031623chr62480 149 11525 ----
NM_001031684chr22496 119 ----1403
NM_001031695chr2275313 4710 4456 4377 3849 2040 459 11124 15139 --
NM_001031732chr423117 267 12620 23607 341 --
NM_001031812chr521689 21 ------
NM_001032380chr102441 126 11614 ----
NM_001033117chr354649 4575 3696 1941 1397 --14850 13527
NM_001033564chr6----11779 --
NM_001034025chr12--1329 ----
NM_001034845chr41959 ----1342
NM_001034852chr1441728 1309 742 258 --11975 11416
NM_001035521chr2121 1578 ----
NM_001037172chr331335 1236 1138 ------
NM_001037631chr21432 ------
NM_001038702chr541877 217 206 200 ------
NM_001038707chr112169 ------
NM_001038707chr112169 ------
NM_001039547chr337101 6110 1852 17800 25279 289 --
NM_001039618chr1122057 297 --13874 --
NM_001039697chr961403 1362 633 623 458 95 11108 ----
NM_001039762chr1042248 1835 1510 931 11604 ----
NM_001039840chrX45809 3876 1996 1179 24777 3846 15177 --
NM_001039937chr1332969 137 74 ------
NM_001040101chr42315 237 ------
NM_001040110chr721568 1529 --11835 --
NM_001040142chr222097 1998 11952 ----
NM_001040143chr222097 1998 11952 ----
NM_001040152chr763482 1703 1173 977 422 134 --13849 --
NM_001040284chr1645271 1585 1254 1223 ------
NM_001040441chr131248 461 314 14157 ----
NM_001040624chr832077 453 53 1351 --12578
NM_001040625chr832077 453 53 1351 --12578
NM_001040626chr832077 453 53 1351 --12578
NM_001040627chr832077 453 53 1351 --12578
NM_001040628chr832077 453 53 1351 --12578
NM_001040629chr832077 453 53 1351 --12578
NM_001040630chr832077 453 53 1351 --12578
NM_001040665chr744814 4271 4042 732 --24162 921 --
NM_001040666chr71516 ------
NM_001042357chr1021404 199 ------
NM_001042358chr1021404 199 ------
NM_001042360chr1021404 199 ------
NM_001042363chr1021404 199 ------
NM_001042389chr1021404 199 ------
NM_001042390chr1021404 199 ------
NM_001042392chr1021404 199 ------
NM_001042395chr1021404 199 ------
NM_001042404chr121539 298 ------
NM_001042453chrX21246 312 --1107 --
NM_001042494chr1543479 2817 2610 2496 ----12382
NM_001042495chr1543479 2817 2610 2496 ----12382
NM_001042496chr1543479 2817 2610 2496 ----12382
NM_001042497chr1543479 2817 2610 2496 ----12382
NM_001042510chr821956 808 11847 ----
NM_001042511chr821956 808 11847 ----
NM_001042517chr131729 ------
NM_001042537chrX2539 216 ------
NM_001042543chr42981 186 ----1221
NM_001042550chr921701 550 1286 1270 --
NM_001042599chr277399 6481 5581 5232 2561 2336 1487 25661 5592 17707 14777
NM_001042603chr1264861 4266 3885 1392 795 415 --1695 --
NM_001042604chr333927 3434 3190 24606 1027 21581 1071 --
NM_001043351chr121498 98 ------
NM_001044722chr521689 21 ------
NM_001044723chr521689 21 ------
NM_001045556chr8--11490 21357 65 --
NM_001045557chr8--11490 21357 65 --
NM_001100108chr1117996 7890 7761 7544 6650 5877 5298 5158 3275 2194 2005 21264 1072 --17029
NM_001106chr398357 8070 3869 3659 3035 2697 573 323 38 18612 69676 9578 7397 6124 3372 2197 --
NM_001113490chrX13358 --32688 982 643 --
NM_001167chrX95008 2715 1956 1664 1510 1351 1246 1192 1171 26352 5942 1502 --
NM_001204chr235511 2253 1931 11868 12669 --
NM_001206chr923010 448 --13111 --
NM_001257chr161259 ------
NM_001270chr51101 ------
NM_001280chr191133 ------
NM_001346chr332814 2399 2116 12305 ----
NM_001356chrX32145 1845 118 11698 ----
NM_001385chr81421 --1111 --
NM_001389chr211245 ------
NM_001390chr1833225 2918 879 --1642 --
NM_001401chr911064 --11300 --
NM_001419chr1993804 3299 1937 1920 1883 1783 1756 1467 547 11301 --13866
NM_001423chr1262072 1461 1292 821 229 24 --1160 --
NM_001438chr113599 22633 2495 ----
NM_001497chr942736 2076 601 421 --12373 --
NM_001498chr611166 ------
NM_001521chr2121 1578 ----
NM_001527chr6104858 4157 4117 3902 3436 3222 1904 1782 1092 652 --14579 --
NM_001533chr19190 ------
NM_001546chr611326 --21052 1012 --
NM_001560chrX42281 519 316 46 ----1467
NM_001587chrX42047 776 351 343 --11749 12214
NM_001609chr1074407 4014 3862 1641 1570 1175 370 --34335 2799 141 --
NM_001616chr212781 --1284 --
NM_001662chr71274 --1375 --
NM_001668chr122130 1948 ------
NM_001677chr121119 759 ------
NM_001690chr332374 724 684 12422 ----
NM_001699chr1921231 35 51559 1290 1270 1248 1225 --11348
NM_001701chr9--11443 11320 --
NM_001746chr522355 328 161 ----
NM_001755chr1641843 1729 921 765 ------
NM_001759chr1284534 4284 3656 3570 1592 827 588 139 1164 --24542 1240
NM_001806chr191270 11011 --11878
NM_001839chr11582 ------
NM_001859chr954018 3518 2984 2824 824 12516 ----
NM_001873chr41500 ------
NM_001874chr1265236 4546 3992 3920 381 116 14783 ----
NM_001981chr11612 ------
NM_002024chrX11783 ------
NM_002025chrX88483 6074 3053 2745 2209 1484 1410 953 16598 36858 3427 2362 --
NM_002026chr21427 1269 ----
NM_002039chr42664 97 --1679 --
NM_002040chr2122672 208 --1162 --
NM_002074chr121579 138 --21355 1290 --
NM_002078chr3149 ------
NM_002082chr5142 ------
NM_002092chr433751 1612 247 ------
NM_002128chr13--12060 ----
NM_002137chr71714 21820 949 ----
NM_002187chr51806 11018 ----
NM_002202chr51310 1253 ----
NM_002214chr724467 282 13667 ----
NM_002264chr374954 4688 4405 3551 2021 982 970 21199 1093 ----
NM_002265chr171837 ------
NM_002270chr544642 2265 1724 1121 11433 35345 1571 40 --
NM_002310chr586105 5849 4609 2271 2115 1652 1498 1020 15091 191 14643
NM_002336chr1254782 4464 3559 3097 1844 11626 11420 --
NM_002375chr392287 2056 1700 1613 1466 1412 575 547 454 1476 22151 212 --
NM_002387chr545024 1758 740 333 ------
NM_002397chr51375 ------
NM_002515chr1411620 ------
NM_002545chr1123936 1857 ------
NM_002576chr111141 --1906 --
NM_002581chr985606 5383 4250 1551 1261 1002 816 206 24575 2254 1110 --
NM_002655chr813993 1320 ----
NM_002706chr2131 ------
NM_002709chr222357 1390 11420 --1143
NM_002710chr122746 310 ------
NM_002718chr32530 277 ----1664
NM_002719chr1421856 666 --2336 51 --
NM_002734chr1711809 ------
NM_002764chrX3899 801 677 --1625 --
NM_002834chr1253676 3644 3378 1537 331 ------
NM_002837chr1294367 4241 3912 3561 3538 3150 1714 819 627 ------
NM_002848chr121378 --11051 --
NM_002874chr91140 ----12503
NM_002894chr18194 ------
NM_002956chr121142 ------
NM_002970chrX1327 1242 ----
NM_002971chr32761 402 ------
NM_002977chr21190 --23353 1168 --
NM_002998chr82698 79 ------
NM_003043chr374137 3766 3299 3146 2700 380 57 1717 11482 --
NM_003046chr844043 1578 1548 1257 22108 747 25323 3576 --
NM_003085chr51106 ------
NM_003128chr222245 495 ----12811
NM_003137chr642083 2077 641 115 --11663 --
NM_003199chr1834999 4638 4073 ----1613
NM_003253chr2121572 376 1294 ----
NM_003255chr1792039 1637 788 337 246 197 189 134 118 --12135 --
NM_003262chr374624 4512 4148 3918 878 496 149 1944 11863 --
NM_003274chr2152498 2046 910 487 103 12414 12846 --
NM_003337chr5--21663 563 1101 --
NM_003338chr101598 1791 ----
NM_003342chr1752305 2185 2096 1287 428 12760 ----
NM_003344chr721291 161 11234 ----
NM_003390chr111916 ------
NM_003392chr363414 1282 1101 800 770 66 --1234 --
NM_003432chr5----1191 --
NM_003453chr13162 ------
NM_003471chr311879 --1133 1726
NM_003478chr1112764 --22716 382 --
NM_003483chr12----144 --
NM_003489chr213925 684 608 --129 --
NM_003503chr12380 201 ------
NM_003506chr811327 1286 ----
NM_003507chr221795 1498 --11581 --
NM_003581chr21781 ------
NM_003582chr1--150 ----
NM_003597chr252180 2081 784 546 69 ------
NM_003603chr431667 1489 216 --11429 --
NM_003607chr154249 1470 1420 992 134 23235 2724 24276 1608 --
NM_003615chr3--22826 2731 ----
NM_003618chr221262 1001 ------
NM_003622chr124869 770 646 162 ------
NM_003644chr1785447 5141 5127 4822 4718 2014 1773 292 24218 1439 22542 28 --
NM_003679chr11262 --12533 --
NM_003722chr32557 182 12103 --1576
NM_003750chr101845 --196 --
NM_003861chr1432740 1829 1130 1826 ----
NM_003873chr1021831 75 --1327 --
NM_003902chr11631 192 1531 --
NM_003913chr61647 --12795 11461
NM_003919chr71247 ------
NM_003953chr142854 1034 667 356 1227 ----
NM_003966chr535846 1575 1335 26998 6737 67139 7100 6785 2958 2230 523 12109
NM_003994chr1233887 1111 474 --13233 --
NM_004035chr1784931 4865 3877 3613 3301 3201 1571 1480 ------
NM_004100chr632395 753 376 --11696 --
NM_004114chrX11055 ------
NM_004136chr151315 11041 ----
NM_004171chr1186759 6182 3804 3376 3309 2870 2419 2045 1450 29279 2462 --
NM_004225chr81240 11026 ----
NM_004232chr1812380 --1978 12629
NM_004235chr9----1215 --
NM_004272chr5----1135 --
NM_004274chr1442221 1190 542 268 ------
NM_004317chr19--1213 ----
NM_004319chr151108 723 646 142 54 --11144 --
NM_004384chr521689 21 ------
NM_004392chr13--1993 21868 485 --
NM_004397chr1123074 41 ------
NM_004438chr242330 831 569 350 ------
NM_004450chr14----1151 --
NM_004457chr221400 579 ------
NM_004500chr1431476 1259 82 ------
NM_004501chr143174 813 742 439 --11080 --
NM_004504chr222712 2064 191 ----
NM_004513chr1563511 3370 1478 1358 610 67 ----13036
NM_004575chr421006 634 ------
NM_004586chrX25134 3836 14376 ----
NM_004595chrX2379 325 ------
NM_004598chr522489 2269 --1162 --
NM_004612chr9--21830 1628 44072 1269 424 188 1488
NM_004615chrX1892 ------
NM_004645chr171186 --2729 569 --
NM_004660chrY21775 117 --1935 --
NM_004685chr1332736 2286 840 11139 1506 --
NM_004703chr172742 645 --12484 --
NM_004719chr1232805 2563 407 ------
NM_004726chrX53624 1437 1056 457 49 35144 4517 3857 ----
NM_004738chr203237 185 40 ------
NM_004739chr111591 --1618 --
NM_004742chr32698 170 ------
NM_004755chr142451 67 ------
NM_004772chr511534 ------
NM_004779chr52410 398 --1878 --
NM_004798chr2083524 3470 2938 2809 2591 592 531 81 13643 ----
NM_004801chr221392 390 ------
NM_004808chr1032320 2178 638 12564 ----
NM_004815chr174523 3734 3056 1065 1002 440 254 13104 ----
NM_004857chr1454006 1717 1543 1273 1179 13706 ----
NM_004866chr524789 663 ----11617
NM_004926chr1421670 1278 ------
NM_004929chr81575 11139 --11007
NM_004956chr754419 3410 3226 3038 814 13714 12873 1292
NM_004985chr1243107 2884 1160 476 ------
NM_004993chr1431206 178 69 --1305 --
NM_004998chr15--1196 1723 --
NM_005006chr23927 269 64 1733 ----
NM_005011chr721568 1529 --11835 --
NM_005045chr71742 ------
NM_005056chr1265105 4510 4129 1636 1039 659 --1939 1230
NM_005063chr1063083 2705 2541 1544 1283 1241 12830 13522 --
NM_005066chr1----1693 --
NM_005121chr1733064 1276 1100 ------
NM_005124chr61215 --1846 --
NM_005135chr1543479 2817 2610 2496 ----12382
NM_005156chr974582 4477 3510 1706 810 507 328 ------
NM_005171chr1211048 1940 ----
NM_005178chr19122 ------
NM_005197chr1455733 2235 1713 1258 982 --15416 --
NM_005201chr31404 --1238 --
NM_005214chr21395 ------
NM_005233chr322254 1594 ------
NM_005235chr277399 6481 5581 5232 2561 2336 1487 25661 5592 17707 14777
NM_005254chr152994 492 ------
NM_005277chr41200 ------
NM_005339chr433839 3601 3088 --2424 75 --
NM_005370chr192909 177 ------
NM_005399chr143564 2730 1636 28 23993 384 1366 23752 3067
NM_005436chr1023242 701 ------
NM_005465chr131652 1403 344 1389 1129 --
NM_005475chr1273174 2367 2146 1246 601 263 80 --1895 --
NM_005506chr442529 2285 1985 550 ------
NM_005517chr13993 934 273 --1523 --
NM_005546chr531729 966 36 1791 12031 --
NM_005566chr111392 ----2444 50
NM_005578chr355077 4509 3774 1791 1113 --24758 201 --
NM_005587chr151631 ------
NM_005593chr121504 ------
NM_005598chr1--1656 ----
NM_005650chr2231156 535 410 ------
NM_005665chr123047 1425 1560 ----
NM_005694chr31144 ------
NM_005715chr642590 702 651 440 12450 --11135
NM_005722chr222206 1725 --1231 11741
NM_005756chrX31554 1407 1025 ------
NM_005759chr234401 3741 73 --43020 906 323 184 13003
NM_005778chr3--1111 ----
NM_005832chr311101 ------
NM_005840chrX77523 7355 6116 5907 5543 2320 615 26500 6311 22841 2493 --
NM_005871chr102422 277 ------
NM_005898chr1113083 12649 --1536
NM_005899chr1721388 47 ------
NM_005901chr1897496 5707 5676 5508 5296 2538 2532 2206 1372 --16413 --
NM_005903chr534106 1643 402 1260 14504 --
NM_005907chr621247 488 ------
NM_005909chr543692 3219 1716 29 ----13136
NM_005920chr153834 3011 1441 1111 630 11377 43714 3584 1550 193 --
NM_005923chr6157 ------
NM_005935chr465208 5182 3965 3710 1930 226 ------
NM_005937chr17148 --34099 3596 3272 164
NM_005955chr145166 2081 1606 1162 --24716 3924 --
NM_006016chr6----1108 --
NM_006017chr431014 898 725 1365 ----
NM_006023chr10--1202 ----
NM_006054chr1131504 1140 1007 --1337 --
NM_006079chr61100 ------
NM_006106chr1132893 2502 40 12586 ----
NM_006154chr1532421 1910 113 ----12205
NM_006178chr1751486 1474 1444 613 450 --166 --
NM_006203chr565234 5208 4588 4252 3618 2227 ------
NM_006243chr111041 ------
NM_006251chr523112 597 ----12226
NM_006254chr31348 ------
NM_006275chr201329 --1818 --
NM_006282chr2054232 2990 2951 1665 1129 --21785 1227 --
NM_006330chr82215 172 ------
NM_006359chrX2539 216 ------
NM_006375chrX----128 1153
NM_006380chr1733544 715 39 23117 785 12907 --
NM_006415chr9----1106 --
NM_006457chr411611 --13978 --
NM_006489chr1411620 ------
NM_006496chr121717 1575 1683 11917 11597
NM_006504chr1022846 2296 ------
NM_006565chr1621264 1025 --1979 --
NM_006579chrX1251 ------
NM_006609chr262977 2335 2271 2052 1959 138 22074 536 ----
NM_006624chr102642 312 ----1694
NM_006626chr942632 1831 489 289 1275 21995 194 --
NM_006628chr1554684 4483 3498 1847 1417 ------
NM_006706chr51706 ------
NM_006729chrX65001 4433 4139 2215 1921 588 --24049 3653 --
NM_006748chr8--11490 21357 65 --
NM_006750chr1677888 6351 6209 5517 2064 1437 575 --27720 7343 --
NM_006766chr81160 ------
NM_006777chrX11975 12030 ----
NM_006791chr152639 31 ------
NM_006794chr2------124
NM_006807chr171326 ------
NM_006828chr6--1601 ----
NM_006838chr1211777 ------
NM_006852chr1752375 1121 338 166 94 12013 1940 --
NM_006873chr222610 725 --12439 --
NM_006915chrX21814 1618 ------
NM_006920chr22685 408 ------
NM_006948chr211182 1204 1284 --
NM_006980chr72326 203 --1159 --
NM_006997chr10----1481 --
NM_007007chr1233172 1417 109 1964 14244 --
NM_007008chr21126 ------
NM_007011chr1596566 6342 6005 1732 1698 1445 1282 721 99 16828 26691 6670 --
NM_007050chr20127047 6821 6377 5938 5932 5823 5503 5122 2885 2214 2100 326 12472 17531 --
NM_007057chr102661 164 135 1750 --
NM_007064chr31652 ------
NM_007073chr643755 660 345 51 13394 ----
NM_007145chr1931320 1194 306 ------
NM_007147chr1911053 11036 ----
NM_007157chrX1155 ------
NM_007175chr843409 2921 912 42 --1825 --
NM_007178chr12--1352 ----
NM_007203chr963607 3285 3111 2523 1035 270 12976 ----
NM_007236chr1541976 1713 1538 809 ------
NM_007246chr411014 ------
NM_007249chr1359172 7811 2706 681 39 28834 3216 ----
NM_007255chr51542 --1577 --
NM_007270chr711552 ------
NM_007292chr1784931 4865 3877 3613 3301 3201 1571 1480 ------
NM_007350chr1234222 3976 157 --23437 1171 --
NM_007375chr122148 1793 --12376 --
NM_012081chr552669 2514 338 256 189 23133 78 ----
NM_012086chr21155 ------
NM_012095chr1042936 2540 2436 1327 1408 1159 --
NM_012137chr112589 1134 1433 --
NM_012141chr1332969 137 74 ------
NM_012193chr1174891 4441 4030 3990 3654 1590 293 --15201 14762
NM_012214chr246338 2157 1222 943 --24737 1647 --
NM_012223chr21955 ------
NM_012224chr41415 1176 --1881
NM_012262chr135082 3472 1248 44962 3643 3305 1220 125 --
NM_012281chr71807 11810 ----
NM_012287chr323439 308 23617 3581 13557 --
NM_012301chr7--2794 199 11660 --
NM_012307chr1821017 172 ------
NM_012316chr164112 2038 1308 1067 971 408 14556 31654 1329 743 --
NM_012420chr1042091 1646 1498 628 ------
NM_012482chr1--190 1690 --
NM_013249chr111164 ------
NM_013261chr422300 914 13518 ----
NM_013269chr1234359 4223 1195 ------
NM_013283chr51258 --1116 --
NM_013292chr16182 ------
NM_013354chr811403 2491 170 ----
NM_013374chr363176 3047 1962 1228 748 512 ------
NM_013377chr121197 ------
NM_013448chr141282 ------
NM_014021chr112863 ------
NM_014048chr1645234 5054 4372 658 31570 852 54 1337 --
NM_014056chr321853 1747 ----1607
NM_014106chr1532175 1154 673 141 ----
NM_014112chr814906 --34362 3624 1151 --
NM_014117chr1672715 2535 2527 1845 642 367 50 ------
NM_014155chr1176771 3019 3007 2180 1830 1488 53 22892 1888 ----
NM_014157chr1653427 3388 3316 978 683 13447 --13513
NM_014265chr81778 ------
NM_014283chr1--1531 1552 --
NM_014288chr11253 ------
NM_014309chr2275303 4700 4446 4367 3839 2030 449 11114 15129 --
NM_014329chr16----1300 --
NM_014331chr467224 7201 7087 6085 3003 2685 25797 2965 27514 2937 --
NM_014363chr13130 --1451 --
NM_014372chr12248 55 ------
NM_014392chr42315 237 ------
NM_014415chr32532 423 ------
NM_014423chr545567 4449 3868 2127 ----13497
NM_014454chr63735 399 27 --1760 --
NM_014469chr111339 ------
NM_014491chr71160 1749 1962 --
NM_014494chr16--11507 21876 289 --
NM_014563chrX31698 646 355 21976 1463 ----
NM_014574chr142452 296 ------
NM_014608chr15----1392 --
NM_014612chr91959 11155 --11413
NM_014615chr1643241 3205 2723 135 13152 --13051
NM_014616chr3----1827 --
NM_014649chr19----182 --
NM_014660chr72982 932 ------
NM_014674chr31458 13656 23930 963 --
NM_014682chr8158 1218 ----
NM_014707chr7------191
NM_014730chr1254429 1961 1618 1434 934 11291 43800 686 289 272 13706
NM_014730chr1254429 1961 1618 1434 934 11291 43800 686 289 272 13706
NM_014733chr522114 146 ------
NM_014737chr2053395 3354 1261 800 21 14224 1751 --
NM_014746chr284375 3680 3648 3436 3216 3175 2995 1175 11536 ----
NM_014751chr82637 189 ------
NM_014764chr121352 --11085 --
NM_014781chr811078 ------
NM_014795chr211236 ------
NM_014812chr121539 298 ------
NM_014819chr511549 --12131 --
NM_014826chr154249 1470 1420 992 134 23235 2724 24276 1608 --
NM_014828chr1462164 1952 1930 1751 1723 1016 --11616 12214
NM_014835chr2021748 547 --1434 --
NM_014836chr102441 126 11614 ----
NM_014846chr8144 ------
NM_014848chr1512704 --22177 268 --
NM_014850chr354649 4575 3696 1941 1397 --14850 13527
NM_014877chr1767120 6441 6316 6007 5401 2512 --27240 7022 12478
NM_014883chr41780 12295 ----
NM_014897chr1732566 2526 712 ----12809
NM_014912chr1042867 2184 654 343 --22788 600 --
NM_014924chr1472698 2307 2189 1039 528 424 357 ------
NM_014926chr31114 ----2836 340
NM_014932chr311769 ------
NM_014945chr52663 199 11779 21757 242 --
NM_014946chr22268 58 ------
NM_014962chr2012873 ------
NM_014970chr1----171 --
NM_014988chr432319 635 247 ------
NM_014991chr422625 52 ------
NM_015000chr1221176 1100 ------
NM_015008chr353637 1431 1232 518 478 13579 ----
NM_015009chr31295 ------
NM_015020chr1632841 714 688 --11083 --
NM_015025chr222750 1850 --12277 1825
NM_015026chr1214426 11458 ----
NM_015027chr1641937 1779 1693 1681 ------
NM_015032chr1322687 355 1390 ----
NM_015045chr1012177 ------
NM_015074chr164896 4378 1561 873 316 75 --13675 --
NM_015076chr673868 2840 2800 1602 634 393 187 ------
NM_015090chr135964 2205 1625 --24427 459 --
NM_015092chr1643906 3480 3105 467 1864 ----
NM_015107chrX22440 1834 ----180
NM_015132chr741717 1418 495 60 11535 ----
NM_015138chr1542499 1020 750 469 ------
NM_015149chr121449 212 ------
NM_015153chr61661 1720 ----
NM_015176chr1------1326
NM_015187chr43932 686 82 --1326 1604
NM_015198chr72416 257 ------
NM_015206chr1543808 3677 798 590 ------
NM_015208chr1822492 2455 ----1178
NM_015226chr1623197 646 ------
NM_015264chr2244675 4281 3674 450 13290 43564 1825 1213 743 --
NM_015265chr212389 ------
NM_015275chr1241843 1530 555 345 ------
NM_015293chr6192 ------
NM_015308chr11--1109 ----
NM_015310chr887979 7339 7238 6519 2999 2586 2431 59 ------
NM_015313chr111108 --11779 --
NM_015314chr7--1162 ----
NM_015338chr2011336 163 ----
NM_015339chr2021000 944 ------
NM_015349chr652779 2111 1223 203 124 ----12423
NM_015365chrX53896 3716 2903 2800 193 13128 ----
NM_015367chr2211563 11225 ----
NM_015382chr141295 ------
NM_015394chr1281936 1768 1684 1621 1579 1564 942 140 ------
NM_015416chr12----1731 --
NM_015435chr8------1167
NM_015457chr11------1341
NM_015460chr321968 328 ------
NM_015464chr7----1874 --
NM_015508chr3------1392
NM_015534chr1186 1255 ----
NM_015553chr674138 3838 3728 3617 2001 1929 664 --14787 --
NM_015554chr1532204 1153 135 ----1115
NM_015555chr62480 149 11525 ----
NM_015564chr531183 1117 1058 --12819 --
NM_015569chr134678 1915 1887 ------
NM_015570chr71194 11771 ----
NM_015576chr351840 1077 423 290 191 12194 12064 --
NM_015635chr951718 1568 1448 333 136 1560 ----
NM_015640chr145275 3276 1285 72 ----11675
NM_015850chr821778 221 --11922 --
NM_015888chr143247 2709 2493 2386 ------
NM_015891chr631998 1843 783 ----1326
NM_015906chr164577 4179 4052 3516 2989 277 1491 ----
NM_015948chr63474 397 90 ------
NM_015967chr12805 358 --1730 --
NM_015975chrX182 2488 311 11392 --
NM_015984chr12357 147 ------
NM_015995chr1595283 4290 3908 3878 3642 3525 2192 1394 566 25478 4270 34747 3467 1382 13410
NM_016018chr862352 2132 1761 882 728 704 11850 ----
NM_016040chr121845 656 12082 ----
NM_016041chr17----161 --
NM_016091chr221143 --1157 --
NM_016096chr821956 808 11847 ----
NM_016107chr511046 ------
NM_016120chrX1338 ------
NM_016121chr11991 ------
NM_016131chr211473 --12278 --
NM_016133chr221408 1256 11149 ----
NM_016172chr9--1149 ----
NM_016206chr378465 8048 7489 2762 1896 1400 171 17111 18594 --
NM_016221chr512331 --1688 --
NM_016227chr1--1531 1552 --
NM_016248chr1353992 3807 3168 2923 1149 ------
NM_016252chr21153 ------
NM_016275chr342727 2576 1974 434 ------
NM_016281chr121964 ------
NM_016289chr21212 ------
NM_016322chr932637 1138 928 12383 ----
NM_016329chr3----128 --
NM_016441chr212402 --1954 --
NM_016448chr121882 1171 11381 ----
NM_016486chr11172 ------
NM_016542chrX21246 312 --1107 --
NM_016591chr5--1236 --1367
NM_016605chr522040 700 --1521 --
NM_016607chrX21528 1308 ------
NM_016620chr121346 1200 ------
NM_016621chr1163865 1648 917 396 174 31 --44367 3408 2875 1577 --
NM_016654chr152994 492 ------
NM_016929chr654214 3871 3480 3054 1676 23309 2823 11611 --
NM_017489chr831231 1201 467 ------
NM_017519chr61295 ------
NM_017541chr31210 ------
NM_017594chr912217 ------
NM_017599chr1242055 1829 621 183 ------
NM_017633chr61546 --1197 1234
NM_017635chr111444 ------
NM_017637chr988799 8257 2595 2290 2223 2184 1546 1103 13001 1240 --
NM_017644chr344200 3337 1460 1204 13278 13769 12023
NM_017658chr1443769 1364 1161 893 13815 14404 --
NM_017661chr152843 195 --11213 --
NM_017666chrX21365 589 2731 712 11933 --
NM_017693chr1331319 608 109 --2567 527 --
NM_017709chr144204 1570 1478 118 --1417 --
NM_017719chr3------11728
NM_017746chr9180 ------
NM_017768chr11112 1844 ----
NM_017811chr962946 2694 2682 340 250 149 ------
NM_017813chr865377 3774 3531 2044 1111 1010 23742 898 --14344
NM_017831chr1844740 4134 286 201 11446 ----
NM_017848chrX42965 1742 1718 669 2337 236 11645 --
NM_017896chr2083444 2527 1336 1169 374 301 81 24 ------
NM_017906chr61279 ------
NM_017919chr975018 4467 4111 2133 2007 1747 722 ------
NM_017922chr141653 ------
NM_017925chr9----21819 264 --
NM_017988chr12----1329 --
NM_017994chr742909 2578 301 293 32778 2388 938 12893 --
NM_018011chr13------1248
NM_018027chr1032171 2093 32 22440 2164 23163 2799 --
NM_018061chr1----1443 --
NM_018085chr157624 7277 2374 1053 690 12429 25567 2449 17929
NM_018114chr3----1512 --
NM_018131chr101807 ------
NM_018133chr3--11964 ----
NM_018227chr442424 2236 1163 755 ------
NM_018257chr2042561 2456 1690 852 11022 ----
NM_018299chr82475 298 33226 3079 535 --1520
NM_018315chr421417 359 ------
NM_018319chr14----21543 572 --
NM_018362chr11----12695 23715 2450
NM_018374chr72886 700 24993 4980 1199 --
NM_018409chr432858 2690 2265 1735 ----
NM_018416chr121948 --11050 --
NM_018424chr951541 1265 1165 492 393 ----11683
NM_018439chr1842173 809 458 382 ------
NM_018464chr10------1101
NM_018482chr822234 2213 12241 ----
NM_018490chr11------1256
NM_018553chr1721400 1328 --11391 11626
NM_018557chr211114 ------
NM_018638chr1241441 1297 1138 314 11034 12178 --
NM_018640chr1212163 --12794 12150
NM_018653chr17----1349 --
NM_018658chr17--12250 ----
NM_018682chr72633 269 ------
NM_018695chr51712 --12214 --
NM_018704chr141340 792 469 420 ------
NM_018834chr51967 1706 ----
NM_018983chr41105 ------
NM_019001chr333927 3434 3190 24606 1027 21581 1071 --
NM_019004chr711733 ----12354
NM_019022chr1852527 2008 307 234 84 22426 2252 12444 --
NM_019027chr452565 2030 1722 633 85 ------
NM_019053chr1021054 54 ------
NM_019071chr71143 ------
NM_019072chr553912 2829 1596 1429 1419 1905 ----
NM_019114chr922570 264 21006 468 22099 327 --
NM_019555chr311674 1511 1548 --
NM_019590chr101516 ------
NM_019610chr132066 2060 340 ------
NM_019843chr22------1167
NM_020120chr241070 229 142 128 --1173 --
NM_020133chr686062 5596 5295 4486 4299 3927 1872 986 23937 541 21771 792 --
NM_020141chr11444 --1344 --
NM_020148chr1812796 12780 ----
NM_020150chr10--31429 335 49 ----
NM_020205chr152587 2137 534 287 266 12631 ----
NM_020225chr42394 22 ------
NM_020239chr112169 ------
NM_020240chr541877 217 206 200 ------
NM_020245chr664508 1229 1010 931 874 83 24000 3128 ----
NM_020336chr2063884 3816 3452 2837 2804 1203 ----1944
NM_020337chr413041 ------
NM_020341chr2031903 1264 588 ------
NM_020374chr1211347 11442 11896 --
NM_020440chr143235 2902 905 300 --13267 --
NM_020443chr1106041 5838 4991 4719 4603 2713 2670 2396 371 270 24426 1460 36328 2655 2607 --
NM_020456chr1321734 1694 ------
NM_020475chr812117 --12379 --
NM_020476chr812117 --12379 --
NM_020477chr812117 --12379 --
NM_020480chr812117 --12379 --
NM_020532chr21126 ------
NM_020673chr2084730 2834 2322 2256 1925 125 70 44 22926 2219 ----
NM_020686chr16102992 1153 711 687 637 588 562 279 235 37 ------
NM_020689chr2011682 1284 11439 --
NM_020715chr1432264 2078 1760 1265 ----
NM_020718chr1675023 4981 4887 4773 2389 1416 1121 2914 766 ----
NM_020732chr61295 ------
NM_020762chr121113 ------
NM_020771chr611216 1309 11050 --
NM_020772chr1798532 6596 6054 5609 2864 1524 1357 500 86 --38504 6710 5598 --
NM_020774chr1885526 5090 4880 4612 1347 1033 519 328 152 15162 --
NM_020775chr11143 ------
NM_020803chr421707 892 --21934 1495 --
NM_020806chr141724 ------
NM_020809chr1121632 240 ----1541
NM_020810chr1421422 734 --13372 --
NM_020834chr1431339 544 252 --1385 11878
NM_020839chr311013 --21126 1063 --
NM_020868chr21394 --11430 --
NM_020899chr171784 --2607 191 --
NM_020918chr1053444 3175 1393 165 157 ------
NM_020922chrX3690 647 437 11426 1491 --
NM_020948chr143600 2995 2579 666 ------
NM_020964chr1844493 1530 1436 925 --13081 --
NM_021007chr222097 1998 11952 ----
NM_021069chr431667 1489 216 --11429 --
NM_021072chr542557 2116 633 353 163 11814 --
NM_021101chr352455 2339 1974 1762 1733 ------
NM_021116chr7127686 6296 5736 3133 2770 2310 2282 2080 1642 1434 1263 1193 12158 38164 3501 905 --
NM_021144chr9188 1153 ----
NM_021145chr731060 451 443 ------
NM_021190chr121267 1208 ------
NM_021222chr11107 --1339 --
NM_021238chr122181 141 ------
NM_021629chr325034 499 --23818 1331 --
NM_021637chrX21057 414 ------
NM_021647chr464632 4321 3638 1824 952 904 --23615 1500 --
NM_021814chr6--1664 ----
NM_021828chr101340 1172 ----
NM_021912chr1532647 1470 785 --11256 --
NM_021913chr1921231 35 51559 1290 1270 1248 1225 --11348
NM_021914chr14--11569 11823 129
NM_021960chr121705 579 ----12389
NM_021977chr653494 3227 1062 335 47 --1815 --
NM_022036chr17----1349 --
NM_022048chr1566108 5699 4560 1681 1438 884 ------
NM_022058chr21102 --1345 --
NM_022075chr11595 ------
NM_022118chr131159 ------
NM_022130chr521483 1431 --1162 --
NM_022131chr311332 ------
NM_022133chr811684 ------
NM_022137chr1441728 1309 742 258 --11975 11416
NM_022138chr631289 1010 521 21470 1255 ----
NM_022462chr1963044 2386 1354 987 688 519 63015 2716 2709 2684 2526 1463 12458 --
NM_022465chr1241146 745 374 199 ------
NM_022474chr1442117 1935 713 595 ----1235
NM_022719chr2222676 1384 ------
NM_022726chr611655 11141 1266 --
NM_022730chr21827 11054 ----
NM_022735chr121891 1169 ------
NM_022739chr171436 11167 ----
NM_022763chr332417 1204 1192 ------
NM_022771chr121741 ------
NM_022781chr932914 2433 315 2755 501 ----
NM_022784chr152171 143 1314 ----
NM_022817chr221419 70 ------
NM_022818chr1611338 --21625 459 --
NM_022841chr1532282 1027 286 1902 ----
NM_022843chr13----151 --
NM_022845chr1641797 1683 875 719 ------
NM_022893chr223007 736 ------
NM_022902chr5------1277
NM_022970chr10--11401 11154 --
NM_023010chrX--1723 ----
NM_023016chr211040 --1820 --
NM_023033chr12----2567 430 --
NM_023037chr13----1721 --
NM_023071chr1231059 442 202 ------
NM_023105chr821778 221 --11922 --
NM_023106chr821778 221 --11922 --
NM_023110chr821778 221 --11922 --
NM_023111chr821778 221 --11922 --
NM_023929chr812598 ----1292
NM_024345chr944906 1410 126 111 191 12343 --
NM_024423chr1854111 3723 2969 1168 100 ----11354
NM_024424chr112913 109 11204 ----
NM_024425chr112913 109 11204 ----
NM_024426chr112913 109 11204 ----
NM_024491chr31173 170 ----
NM_024501chr21482 ------
NM_024520chr2182 ------
NM_024529chr1191 ------
NM_024539chrX21242 799 ------
NM_024556chr111459 ------
NM_024557chr1111064 ------
NM_024569chr142931 1111 744 433 1304 ----
NM_024594chr521605 541 ------
NM_024595chr11409 --1418 --
NM_024686chr12584 358 ------
NM_024713chr1511054 ------
NM_024740chr1164117 3623 2581 2534 1538 1112 ------
NM_024749chr131506 543 120 1245 1665 --
NM_024779chr121288 --11581 --
NM_024831chr82247 167 ------
NM_024841chr1132443 599 273 1624 1947 --
NM_024947chr368154 8114 7924 3357 3106 124 16567 ----
NM_024948chr10--2785 30 1504 --
NM_024949chr464249 3876 1969 1267 700 693 --14617 --
NM_024989chr277896 6838 5775 1558 1458 813 94 37633 6161 2612 33194 2052 546 --
NM_025104chr1721484 637 11510 11194 --
NM_025134chr1632101 2011 1954 ------
NM_025137chr153398 82 44 ------
NM_025160chr143124 1533 920 502 --13923 1525
NM_025191chr1------12508
NM_025235chr1041677 1450 745 547 1301 ----
NM_030621chr1453277 1615 900 705 405 --13458 --
NM_030627chr533428 263 168 --11609 --
NM_030647chr784855 4378 4290 4060 2348 2031 1208 902 ------
NM_030660chr1431206 178 69 --1305 --
NM_030667chr121378 --11051 --
NM_030668chr121378 --11051 --
NM_030669chr121378 --11051 --
NM_030674chr1275442 5335 5039 3760 1805 700 364 13823 ----
NM_030786chr1--2656 170 --1214
NM_030797chr22251 24 ------
NM_030806chr1108067 7480 7234 7056 6994 6476 5968 2517 2391 817 29338 7403 1774 --
NM_030884chr392287 2056 1700 1613 1466 1412 575 547 454 1476 22151 212 --
NM_030885chr3147 --31682 1496 1469 --
NM_031243chr71714 21820 949 ----
NM_031271chr841609 1246 278 129 ------
NM_031314chr1431476 1259 82 ------
NM_031419chr32506 224 --11002 --
NM_031427chr1444086 2020 1314 87 ----15199
NM_031431chr1311670 ------
NM_031844chr143174 813 742 439 --11080 --
NM_031858chr1721388 47 ------
NM_031862chr1721388 47 ------
NM_031936chr11199 ------
NM_032012chr984526 3929 3323 3305 2084 1902 1195 1172 --14355 --
NM_032041chr832077 453 53 1351 --12578
NM_032116chr1354764 4220 2033 1308 824 ----25509 2195
NM_032153chr312682 --11886 --
NM_032186chr121346 1200 ------
NM_032199chr1022651 477 22944 810 ----
NM_032211chr1041176 1143 1136 308 ------
NM_032217chr421019 359 1137 ----
NM_032226chr9----1825 --
NM_032229chr132805 40 ------
NM_032288chr321587 331 ------
NM_032328chr1183 1351 ----
NM_032368chr12205 96 1452 ----
NM_032408chr72276 95 ------
NM_032424chr1121349 1193 ------
NM_032466chr841572 252 110 79 ------
NM_032468chr841572 252 110 79 ------
NM_032511chr62329 96 --1365 --
NM_032663chr1241808 821 372 288 --1768 --
NM_032765chr51672 1904 ----
NM_032780chr1121172 882 ------
NM_032788chr21350 181 11166 --
NM_032804chr1021943 91 ------
NM_032833chr131698 1008 122 --11866 12165
NM_032837chr1721801 652 11650 2375 219 --
NM_032842chr71358 1445 ----
NM_032859chr13--12492 1185 12481
NM_032876chr1471961 709 479 473 376 328 284 ------
NM_032900chr1023556 2897 23883 3061 ----
NM_032932chr17126236 5298 4954 3929 2418 1823 1546 1450 1077 547 440 365 24937 346 22566 1197 14736
NM_032975chr1833225 2918 879 --1642 --
NM_032980chr1833225 2918 879 --1642 --
NM_032993chr41105 ------
NM_032997chr103852 593 355 135 1941 --
NM_033020chr164577 4179 4052 3516 2989 277 1491 ----
NM_033058chr8158 1341 ----
NM_033071chr6192 ------
NM_033081chr20--185 ----
NM_033087chr931429 486 101 ------
NM_033132chr131570 1660 ----
NM_033224chr797940 7851 6697 2991 1197 730 640 485 328 25987 1930 16589 --
NM_033225chr852554 1171 683 150 114 --11956 --
NM_033281chr52752 328 ------
NM_033285chr8------11220
NM_033296chr41731 --132 --
NM_033305chr911101 ----11186
NM_033360chr1243228 3005 1281 597 ------
NM_033429chr1552993 2223 2141 358 184 12165 ----
NM_033505chr275784 4872 4433 4323 4301 605 102 --26628 2217 --
NM_033631chr133362 3153 75 --42779 2416 2381 1283 1363
NM_033632chr421417 359 ------
NM_033642chrX11055 ------
NM_033656chr2135133 4720 431 15807 24603 4099 14256
NM_052832chr822670 956 22229 95 1703 --
NM_052851chr1332127 2009 1836 --11959 11856
NM_052855chr17----1481 1520
NM_052900chr811683 ------
NM_052918chr1053198 2766 2760 1454 1083 --12590 --
NM_052927chr5----1602 --
NM_052954chr2151837 1630 506 332 40 ----1726
NM_053001chr8141 --1333 --
NM_053016chr936985 5873 2933 --1432 --
NM_053043chr796298 5409 5293 4627 4149 4048 1630 1517 598 24257 1536 22388 2135 --
NM_053064chr1452620 2216 1044 699 205 ------
NM_054016chr121286 245 11680 ----
NM_054016chr121286 245 11680 ----
NM_054016chr121286 245 11680 ----
NM_057159chr911064 --11300 --
NM_080617chr20------2134 125
NM_080632chrX--1723 ----
NM_080654chr111978 --1189 --
NM_080670chr5--1912 ----
NM_080723chr621346 916 --11098 --
NM_080759chr13--1993 21868 485 --
NM_080760chr13--1993 21868 485 --
NM_080867chr1423094 281 ------
NM_080872chr831071 1005 391 ----12584
NM_080927chr332976 2665 836 12591 ----
NM_130435chr1022846 2296 ------
NM_133170chr20127047 6821 6377 5938 5932 5823 5503 5122 2885 2214 2100 326 12472 17531 --
NM_133265chrX13358 --32688 982 643 --
NM_133370chr423117 267 12620 23607 341 --
NM_133372chr532323 1906 82 --12595 --
NM_133468chr721687 95 ----1234
NM_133493chr664572 4389 4338 1267 341 184 2831 148 1991 --
NM_133647chr1543479 2817 2610 2496 ----12382
NM_133650chr6192 ------
NM_138286chr1932669 1172 900 --11212 --
NM_138316chr1021237 155 ------
NM_138391chr13961 772 306 ------
NM_138426chr73293 143 40 12085 ----
NM_138453chr5--1186 ----
NM_138494chr732350 902 528 ------
NM_138635chr752641 634 595 339 162 164 ----
NM_138638chr14--11569 11823 129
NM_138731chr1423174 886 12577 ----
NM_138735chr221374 390 ------
NM_138782chr54936 555 240 186 ------
NM_138959chr145281 4927 4562 2088 14435 36746 2306 1642 --
NM_139169chr102561 262 ------
NM_139239chr191293 ------
NM_139283chr1252587 2356 541 154 66 ------
NM_139321chr2043983 3586 3437 1603 ------
NM_144498chr2021748 547 --1434 --
NM_144571chr455737 5370 2144 474 30 24837 4494 ----
NM_144590chr1031017 888 439 ----22392 52
NM_144599chr1554227 4047 3656 1276 85 --15014 --
NM_144610chr171161 ------
NM_144660chr102117 39 ------
NM_144664chr1122273 722 --11772 --
NM_144672chr161181 ------
NM_144778chr1312365 2670 453 ----
NM_145013chr1132755 2082 613 --22278 1853 --
NM_145178chr101129 --1232 195
NM_145307chr1024651 1292 14557 --13074
NM_145715chr4183 --1255 --
NM_145735chr1312640 ------
NM_145805chr15--1620 ----
NM_145808chr722102 216 22940 356 ----
NM_147147chr643755 660 345 51 13394 ----
NM_147150chr963607 3285 3111 2523 1035 270 12976 ----
NM_147156chr103596 472 153 ------
NM_147166chr71180 --1620 --
NM_148414chr161337 ------
NM_148898chr71160 1749 1962 --
NM_148899chr71160 1749 1962 --
NM_148977chr1021237 155 ------
NM_148978chr1021237 155 ------
NM_152261chr1221819 325 --1665 --
NM_152263chr155663 5623 4775 80 30 22048 371 ----
NM_152265chr1------11155
NM_152282chr331335 1236 1138 ------
NM_152520chr2163 --1399 --
NM_152527chr2--1199 ----
NM_152594chr1511935 ------
NM_152608chr141847 1828 884 253 1927 ----
NM_152641chr1231957 1858 612 ------
NM_152678chr3----12303 --
NM_152692chrX130 ------
NM_152716chr1141372 1261 1144 360 --1511 --
NM_152756chr531449 903 640 --11353 --
NM_152763chr13186 57 25 ------
NM_152774chr732358 2012 1959 1838 ----
NM_152787chrX23631 244 --12581 --
NM_152836chr811684 ------
NM_152837chr811684 ------
NM_152924chr1596566 6342 6005 1732 1698 1445 1282 721 99 16828 26691 6670 --
NM_152999chr744814 4271 4042 732 --24162 921 --
NM_153013chr531848 1759 785 --2893 153 --
NM_153183chrX11109 --11066 1939
NM_153184chr3--2788 688 ----
NM_153188chr544642 2265 1724 1121 11433 35345 1571 40 --
NM_153226chr101417 ----1946
NM_153234chr542656 2597 569 74 --12589 12443
NM_153456chr1364961 4875 4135 2352 1205 691 15346 26115 5122 --
NM_153635chr31209 ------
NM_153649chr121498 98 ------
NM_153686chr452398 2309 2278 1925 78 ------
NM_153810chr1045049 4623 419 251 --14013 --
NM_153828chr21126 ------
NM_170664chr161181 ------
NM_170724chr611018 ------
NM_170741chr17--12250 ----
NM_170742chr17--12250 ----
NM_170774chr2053395 3354 1261 800 21 14224 1751 --
NM_172037chr811218 --1215 194
NM_172070chr252283 2191 1751 1578 294 --1718 --
NM_172071chr196979 5244 4523 2636 2471 2400 2298 1725 299 22817 359 ----
NM_172103chr632395 753 376 --11696 --
NM_172105chr632395 753 376 --11696 --
NM_172159chr311879 --1133 1726
NM_172160chr311879 --1133 1726
NM_172217chr1563511 3370 1478 1358 610 67 ----13036
NM_172373chr131322 174 ----
NM_173054chr71742 ------
NM_173082chr611132 --1607 --
NM_173468chr435090 4770 4163 --12433 --
NM_173470chrX2611 104 ------
NM_173473chr102530 176 12719 ----
NM_173500chr152100 37 ------
NM_173515chr6------1191
NM_173552chr31571 22503 134 ----
NM_173602chr1253822 2804 2542 1145 961 13030 1138 --
NM_173642chr133386 3297 1186 --18672 --
NM_173808chr133575 369 58 14066 134 --
NM_175624chr1236692 5943 5288 25766 2057 26115 5132 --
NM_175625chr1236692 5943 5288 25766 2057 26115 5132 --
NM_175767chr511513 --1643 21865 218
NM_175863chr61295 ------
NM_175921chr552803 2718 1681 866 197 12678 --14105
NM_176824chr42447 401 ------
NM_177402chr11635 --2965 665 --
NM_177438chr1453277 1615 900 705 405 --13458 --
NM_177947chrX21528 1308 ------
NM_177948chrX21528 1308 ------
NM_177966chr31430 1696 11913 --
NM_177969chr2131 ------
NM_177990chr2031903 1264 588 ------
NM_178006chr1332127 2009 1836 --11959 11856
NM_178007chr1332127 2009 1836 --11959 11856
NM_178123chr21796 ------
NM_178126chr1731809 864 496 11714 12220 --
NM_178151chrX76586 5852 5802 5017 4840 1942 452 15757 1614 --
NM_178152chrX76586 5852 5802 5017 4840 1942 452 15757 1614 --
NM_178153chrX76586 5852 5802 5017 4840 1942 452 15757 1614 --
NM_178426chr122230 2048 ------
NM_178427chr122130 1948 ------
NM_178496chr331461 1342 31 2382 269 ----
NM_178505chr1023031 396 1127 165 --
NM_178509chr1733744 1148 291 11210 ----
NM_178549chr11170 ------
NM_178565chr8--11193 ----
NM_178582chr202419 147 ------
NM_178585chr422625 52 ------
NM_178586chr1421856 666 --2336 51 --
NM_178812chr8--1250 1340 1390
NM_178818chr1642403 1702 617 332 --122 --
NM_181358chr174178 4147 3196 2801 1380 660 80 ------
NM_181361chr311101 ------
NM_181442chr2021000 944 ------
NM_181443chr2012873 ------
NM_181492chr2231094 473 348 ------
NM_181504chr534189 2625 2600 ------
NM_181521chr16117184 6483 5398 5113 2842 1153 975 658 622 456 164 --14803 14611
NM_181523chr534189 2625 2600 ------
NM_181524chr534189 2625 2600 ------
NM_181672chrX42073 1554 1314 439 ------
NM_181673chrX42073 1554 1314 439 ------
NM_181705chr534247 1029 851 23655 306 ----
NM_181746chr11595 ------
NM_181897chr32530 277 ----1664
NM_182314chrX----128 1153
NM_182503chr631931 525 422 14152 --14378
NM_182569chr17--1278 ----
NM_182648chr141282 ------
NM_182697chr721291 161 11234 ----
NM_182717chr1021196 1061 ------
NM_182720chr1021196 1061 ------
NM_182721chr1021196 1061 ------
NM_182722chr1021196 1061 ------
NM_182723chr1021196 1061 ------
NM_182763chr121694 568 ----12378
NM_182796chr51258 --1116 --
NM_182797chr2011393 11636 11694 --
NM_182853chr1021196 1061 ------
NM_182854chr161329 ------
NM_182896chr32538 530 ------
NM_182931chr72633 269 ------
NM_182961chr6192 ------
NM_182978chr183778 680 635 ------
NM_183011chr1021196 1061 ------
NM_183012chr1021196 1061 ------
NM_183013chr1021196 1061 ------
NM_183061chr31122 --1108 --
NM_183353chrX1338 ------
NM_183419chr8------1167
NM_184085chr8--1229 ----
NM_184086chr8--1229 ----
NM_184087chr8--1229 ----
NM_194292chr141242 317 302 80 ------
NM_194314chr155675 4915 3946 3469 1084 15108 ----
NM_194328chr932914 2433 315 2755 501 ----
NM_194329chr932914 2433 315 2755 501 ----
NM_194330chr932914 2433 315 2755 501 ----
NM_194332chr932914 2433 315 2755 501 ----
NM_194463chrX21242 799 ------
NM_197968chr13162 ------
NM_198047chr22485 475 --1518 --
NM_198086chr1471961 709 479 473 376 328 284 ------
NM_198123chr811683 ------
NM_198124chr811683 ------
NM_198225chr102441 126 11614 ----
NM_198240chr121142 ------
NM_198268chr174178 4147 3196 2801 1380 660 80 ------
NM_198269chr174178 4147 3196 2801 1380 660 80 ------
NM_198270chrX12363 12463 ----
NM_198281chr433396 769 149 ------
NM_198320chr1265236 4546 3992 3920 381 116 14783 ----
NM_198400chr1532421 1910 113 ----12205
NM_198465chrX12633 --12861 --
NM_198484chr3125989 5788 5680 5553 4428 4292 2147 1568 1376 794 159 119 --11266 --
NM_198584chr852694 1684 1644 733 272 ------
NM_198859chr344796 3585 3342 3147 13631 24402 1101 --
NM_198889chr421019 359 1137 ----
NM_199189chr51967 1706 ----
NM_199421chr1423094 281 ------
NM_199436chr22268 58 ------
NM_201269chr121346 1200 ------
NM_201432chr1785447 5141 5127 4822 4718 2014 1773 292 24218 1439 22542 28 --
NM_201433chr1785447 5141 5127 4822 4718 2014 1773 292 24218 1439 22542 28 --
NM_201591chr41200 ------
NM_201592chr41200 ------
NM_201613chr122320 254 ------
NM_203291chr18194 ------
NM_203292chr18187 ------
NM_203304chr191326 ------
NM_203372chr221400 579 ------
NM_203391chrX121 --1320 21132 658
NM_203458chr163778 1525 1474 791 714 580 --1266 --
NM_205852chr121867 ------
NM_206594chr113599 22633 2495 ----
NM_206595chr113599 22633 2495 ----
NM_206839chr152639 31 ------
NM_206854chr621738 177 14391 13716 --
NM_206855chr611142 15356 14681 --
NM_206860chr10----1481 --
NM_206861chr10----1481 --
NM_206862chr10----1481 --
NM_206876chr222357 1390 11420 --1143
NM_206907chr523112 597 ----12226
NM_206909chr887979 7339 7238 6519 2999 2586 2431 59 ------
NM_207012chr1042936 2540 2436 1327 1408 1159 --
NM_207123chr42664 97 --1679 --
NM_207303chr1032896 2548 1396 --22781 904 12698
NM_207304chr1312252 2557 340 ----
NM_207406chr496228 6196 5531 5002 2367 1864 997 927 34 15572 15983 --
NM_207422chrX1122 --11121 --
NM_207429chr112715 354 --2108 94 --
NM_207520chr21126 ------
NM_207521chr21126 ------
NM_212471chr1711809 ------
NM_212472chr1711809 ------
NM_212474chr21427 1269 ----
NM_212475chr21427 1269 ----
NM_212476chr21427 1269 ----
NM_212478chr21427 1269 ----
NM_212482chr21427 1269 ----
NM_212539chr31348 ------
NM_212558chr943896 3041 2938 1602 ----13216
NM_213589chr234132 1925 870 --13783 --
NM_213606chr102545 58 1688 ----