TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4661-5p
miRNA Sequence: AACUAGCUCUGUGGAUCCUGAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX32971 1211 1134 11343 --22651 2626
NM_000084chrX56652 2639 1564 305 197 2799 681 --1769
NM_000092chr214010 ------
NM_000112chr561981 1898 1175 1053 180 115 13676 14571 --
NM_000115chr131247 ----11671
NM_000129chr611067 --21356 197 --
NM_000138chr1512514 1426 1535 --
NM_000163chr542028 1918 1635 1548 --2956 653 --
NM_000168chr732594 883 814 --21289 537 --
NM_000176chr533261 1149 420 --1620 1981
NM_000217chr1221715 1059 ------
NM_000237chr821278 149 ------
NM_000248chr332514 2206 646 ------
NM_000264chr92813 757 --23038 1233 --
NM_000267chr171414 13197 13150 --
NM_000276chrX42205 1773 1580 501 ----12055
NM_000289chr122275 151 ------
NM_000297chr441284 788 322 106 ------
NM_000304chr172828 88 ------
NM_000314chr1012028 1962 ----
NM_000321chr1331380 636 182 --11578 --
NM_000332chr642345 2285 861 330 --16439 --
NM_000338chr15--21039 837 ----
NM_000378chr111244 1850 ----
NM_000480chr1121688 1371 1180 ----
NM_000489chrX22875 551 ------
NM_000493chr61211 ------
NM_000536chr11----1537 --
NM_000555chrX97608 6878 6811 5374 5043 4869 3102 2992 266 12234 ----
NM_000582chr4----1373 --
NM_000617chr1212243 21860 752 ----
NM_000618chr1286568 5422 4886 4543 2117 1455 1156 479 ------
NM_000618chr1286568 5422 4886 4543 2117 1455 1156 479 ------
NM_000627chr2--1715 ----
NM_000663chr1663109 2570 835 370 285 178 ----12635
NM_000684chr1021222 1213 ------
NM_000686chrX21232 581 ------
NM_000720chr3176 ------
NM_000724chr102519 306 ------
NM_000793chr1454127 3964 1353 1066 704 --14893 11901
NM_000806chr521898 1336 ------
NM_000814chr1533473 493 422 --13818 --
NM_000816chr51179 ------
NM_000817chr21165 ------
NM_000824chr4----1283 --
NM_000826chr41455 ------
NM_000827chr51353 ------
NM_000829chr1132152 1539 326 ------
NM_000831chr195756 4892 4206 2294 2230 1861 1223 1114 1000 14922 11084 --
NM_000833chr1621439 1100 ------
NM_000875chr1577019 5811 4706 2358 2305 2287 380 --35016 4271 668 --
NM_000891chr17------12583
NM_000908chr51489 ----1120
NM_000926chr1169387 9227 7827 7734 7711 3064 18694 1811 --
NM_000949chr51222 ------
NM_001001323chr1211283 ----1375
NM_001001419chr543919 1947 1431 33 14438 35036 1680 754 --
NM_001001420chr543919 1947 1431 33 14438 35036 1680 754 --
NM_001001481chr832456 1285 174 ------
NM_001001484chr1011613 ------
NM_001001521chr2137 --1210 --
NM_001001668chr1964075 3891 1533 1181 815 562 ------
NM_001001701chr442098 1550 1515 604 ------
NM_001001971chr102446 313 ------
NM_001002026chr352402 2341 1572 111 104 1470 11605 --
NM_001002295chr1021101 777 ------
NM_001003652chr1848212 7071 6924 1438 --38456 7239 6244 13328
NM_001003674chr1897015 5873 5405 5393 4370 1774 1568 532 26 ------
NM_001003675chr1897015 5873 5405 5393 4370 1774 1568 532 26 ------
NM_001003696chr21158 ------
NM_001003697chr21158 ------
NM_001003701chr21158 ------
NM_001003703chr21158 ------
NM_001003800chr933239 2896 1200 12702 12784 --
NM_001003940chr1583483 2467 2425 1189 1153 787 695 327 ------
NM_001003942chr1583483 2467 2425 1189 1153 787 695 327 ------
NM_001003943chr1583487 2471 2429 1193 1157 791 699 331 ------
NM_001004317chr664141 3935 3569 2820 1383 1237 ------
NM_001004342chr166031 5305 5175 5167 3848 2196 ------
NM_001005366chr121155 ------
NM_001005375chrY41140 750 607 126 ------
NM_001005386chr231603 799 317 12011 ----
NM_001005404chr1744089 3445 3033 950 11214 ----
NM_001005463chr1021931 624 ------
NM_001005473chr546166 5432 4231 1225 21214 119 16437 --
NM_001005474chr341557 1022 45 25 ------
NM_001005612chrX--1173 ----
NM_001006600chr531695 528 337 --12310 --
NM_001007023chr1454127 3964 1353 1066 704 --14893 11901
NM_001007097chr984633 4163 3353 1860 1452 1427 809 68 ------
NM_001007246chr2111851 11315 ----
NM_001007257chr111239 ------
NM_001008225chr72292 139 ------
NM_001008272chr3----174 --
NM_001008273chr3----174 --
NM_001008408chr755982 4703 4340 1813 726 14649 15113 --
NM_001008495chr821865 1756 ------
NM_001008925chr442939 2425 1350 150 --12356 --
NM_001009880chr2211135 --13582 13711
NM_001009881chr11429 --126 --
NM_001009882chr11429 --126 --
NM_001009899chr365802 5316 2187 1458 519 275 --24974 797 --
NM_001009993chr264448 4167 3398 3198 531 164 11675 2646 62 --
NM_001010000chr1822899 1235 ------
NM_001010854chr141262 ------
NM_001010867chr1136429 6015 5492 5465 5415 5362 4791 4501 2111 1822 1411 1343 1142 --22422 1646 --
NM_001010888chrX94278 3778 3078 2819 1710 624 542 211 107 --14174 --
NM_001010891chr545464 4365 2712 2628 ----15852
NM_001010908chr102529 241 ------
NM_001010986chrX2730 230 ------
NM_001011515chr431077 324 178 ------
NM_001011516chr431077 324 178 ------
NM_001011663chr101311 ------
NM_001011720chr821126 1098 151 ----
NM_001011885chr15----21686 540 --
NM_001012756chr1953132 2674 2547 2466 242 ------
NM_001012968chrX32558 1971 876 ------
NM_001013031chr1032544 2368 491 ------
NM_001013438chr31910 ------
NM_001013439chr31756 ------
NM_001013620chr1287789 7688 7592 6894 5963 3393 3037 373 ------
NM_001013703chr151448 ------
NM_001014797chr1088122 7641 7459 6797 6132 2469 2425 2110 --12685 --
NM_001014831chr19----1797 --
NM_001014832chr19----1797 --
NM_001014834chr19----1797 --
NM_001014835chr19----1797 --
NM_001015877chrX32915 2023 463 12566 ----
NM_001017368chr1722158 529 --12253 192
NM_001017395chr332875 2302 59 ------
NM_001017396chr221649 394 1476 --1656
NM_001017405chr4----1887 --
NM_001017963chr14----1721 1192
NM_001018067chr154757 4588 4093 1662 1056 14368 --14792
NM_001018068chr154757 4588 4093 1662 1056 14368 --14792
NM_001018069chr154757 4588 4093 1662 1056 14368 --14792
NM_001018074chr533261 1149 420 --1620 1981
NM_001018075chr533261 1149 420 --1620 1981
NM_001018076chr533261 1149 420 --1620 1981
NM_001018077chr533261 1149 420 --1620 1981
NM_001018111chr753552 2858 1516 1384 1248 1829 1957 --
NM_001024094chr533261 1149 420 --1620 1981
NM_001024808chr1242251 1949 1775 1137 --1968 --
NM_001024948chr122609 1061 ----22984 682
NM_001025076chr1075753 5745 5517 5261 1992 694 64 ------
NM_001025077chr1077111 7103 6875 6619 2052 1422 959 ------
NM_001025079chr332741 2684 156 ------
NM_001025108chr262936 2848 2763 821 418 256 12635 ----
NM_001025266chr364591 3843 1710 1022 874 844 --14623 --
NM_001025356chr1232351 404 152 ------
NM_001025389chr1121688 1371 1180 ----
NM_001025390chr1121688 1371 1180 ----
NM_001025580chrX53557 1680 1357 1115 717 13808 ----
NM_001025777chr251567 1255 577 362 61 ------
NM_001029875chr51750 12665 ----
NM_001029884chr622034 1952 22001 550 --12730
NM_001030055chr1423472 1240 ----14273
NM_001031684chr241243 974 927 504 21357 531 ----
NM_001031695chr2295308 5284 4803 4772 4288 3981 2115 1948 665 ------
NM_001031710chr72947 188 ------
NM_001031804chr1643531 1562 75 23 ----13011
NM_001032283chr123851 732 701 ------
NM_001032284chr123851 732 701 ------
NM_001032296chr1362769 2445 2353 2252 889 401 22599 2076 ----
NM_001033025chr11195 11274 ----
NM_001033047chr412622 12678 1488 --
NM_001033059chr61181 ------
NM_001033087chr2042939 2600 2444 2135 --1364 12703
NM_001033112chr52775 128 ------
NM_001033117chr354880 4751 4670 4581 1190 --13210 13123
NM_001033506chr111283 ------
NM_001033551chr1763105 1628 1550 1427 1162 635 11171 13993 --
NM_001033557chr221114 538 ------
NM_001033566chr175865 617 368 334 172 ------
NM_001033568chr175865 617 368 334 172 ------
NM_001033602chr133292 225 87 ------
NM_001034841chr16104979 4611 4502 4229 4147 3958 3916 3399 1398 828 ------
NM_001035511chr131941 454 434 --1459 --
NM_001035512chr142048 1406 561 541 --1566 --
NM_001035513chr142048 1406 561 541 --1566 --
NM_001037132chr71510 1120 1885 --
NM_001037133chr71510 1120 1885 --
NM_001037164chr711711 --1298 --
NM_001039350chr731700 1547 1353 ------
NM_001039459chr72996 169 ------
NM_001039538chr233624 2993 711 --13634 --
NM_001039937chr1323758 3514 ------
NM_001040057chr73599 520 375 ------
NM_001040058chr4----1373 --
NM_001040060chr4----1373 --
NM_001040092chr8--1100 ----
NM_001040101chr411122 ------
NM_001040142chr222422 1647 ------
NM_001040143chr222422 1647 ------
NM_001040152chr713938 ------
NM_001040159chr411229 1943 1322 --
NM_001040402chr4----12856 --
NM_001040424chr2111194 ------
NM_001040429chr1323297 2884 ------
NM_001040440chr5--1444 ----
NM_001040450chr152981 192 12002 --1319
NM_001040453chr152981 192 12002 --1319
NM_001040613chr83554 487 352 ------
NM_001042413chr953312 841 782 771 163 ------
NM_001042492chr171414 13197 13150 --
NM_001042537chrX1261 ------
NM_001042555chr1231308 1017 273 --13021 14495
NM_001042599chr267694 7240 7151 6724 5789 256 17110 ----
NM_001042603chr1242032 1358 627 363 1299 ----
NM_001042604chr354788 4300 3368 3185 367 11362 13447 --
NM_001042683chr621218 651 1449 ----
NM_001042749chrX21306 252 ------
NM_001042750chrX21306 252 ------
NM_001042751chrX21306 252 ------
NM_001044385chr243988 3455 1307 1257 --12992 --
NM_001083620chr41454 ------
NM_001099678chr344464 4446 3977 982 --12123 --
NM_001100108chr1107109 6884 6580 5547 2269 1909 1483 1062 609 445 13294 37674 2133 621 16615
NM_001106chr367635 3634 3351 2606 2104 1504 --16016 --
NM_001113490chrX73675 3534 3517 1469 516 458 405 --13611 --
NM_001117chr1832391 2272 2209 ------
NM_001149chr1011037 ----11142
NM_001167chrX96147 5816 5690 5606 5312 4154 1982 1211 452 22067 1467 ----
NM_001173chr1423472 1240 ----14273
NM_001204chr277364 7167 4820 3097 1956 1907 1876 --24694 439 --
NM_001257chr1611405 1349 11162 --
NM_001293chr111459 ------
NM_001298chr211293 ------
NM_001329chr1031427 429 153 ------
NM_001331chr11------1884
NM_001351chr33612 509 38 ------
NM_001356chrX31782 985 790 12038 ----
NM_001412chrX22682 2284 --11242 --
NM_001418chr111132 ------
NM_001418chr111132 ------
NM_001419chr1953972 3340 1373 1254 69 ------
NM_001439chr11195 11274 ----
NM_001530chr142292 122 ------
NM_001584chr111257 ------
NM_001587chrX42205 1773 1580 501 ----12055
NM_001616chr232843 2448 2212 ------
NM_001634chr61181 ------
NM_001663chr141847 ------
NM_001682chr121997 ----189
NM_001685chr21158 ------
NM_001701chr9----1534 --
NM_001709chr1112030 1437 12194 --
NM_001730chr131656 ------
NM_001730chr131656 ------
NM_001731chr121809 ------
NM_001759chr1241442 1293 370 303 ------
NM_001766chr141823 1737 1480 681 ------
NM_001777chr332741 2684 156 ------
NM_001792chr182873 76 ------
NM_001802chr164807 640 342 161 ------
NM_001858chr664696 4350 3330 1625 1498 282 ------
NM_001901chr61408 1300 ----
NM_001931chr111938 ------
NM_001936chr731700 1547 1353 ------
NM_001949chr633100 2209 1277 12432 ----
NM_001964chr51489 ------
NM_001967chr32202 153 ------
NM_001981chr12938 295 ------
NM_001987chr1263889 3341 3294 3045 1094 863 1303 1463 --
NM_002006chr455608 4256 3569 593 401 ----15467
NM_002009chr1552492 2454 1877 1718 142 1272 ----
NM_002013chr14178 ------
NM_002024chrX41922 1845 894 867 ------
NM_002025chrX58593 6979 6452 6276 721 11539 29242 9058 --
NM_002029chr19160 ------
NM_002051chr1021101 777 ------
NM_002063chrX1402 --1824 --
NM_002069chr741664 1469 1340 229 11491 ----
NM_002092chr474654 4569 4362 4280 3862 3518 774 11903 ----
NM_002140chr91801 ------
NM_002154chr51173 ------
NM_002210chr213056 11289 13532 1962
NM_002211chr10163 --21013 441 --
NM_002214chr795664 4909 4535 1956 1483 1292 940 490 117 ------
NM_002223chr1222919 1000 ------
NM_002226chr141597 ------
NM_002228chr1--11110 ----
NM_002232chr11336 ------
NM_002233chr11--1348 ----
NM_002247chr102462 330 11594 ----
NM_002264chr334435 3433 1449 35061 1244 815 ----
NM_002270chr533524 1829 1319 14997 14579 --
NM_002271chr1332014 1626 225 11858 ----
NM_002285chr262936 2848 2763 821 418 256 12635 ----
NM_002293chr132585 2234 1956 --22318 888 --
NM_002310chr545832 2639 2426 53 --15472 --
NM_002312chr131863 ------
NM_002336chr122918 567 ------
NM_002374chr233624 2993 711 --13634 --
NM_002430chr221267 ------
NM_002519chr1111521 ------
NM_002547chrX63875 3847 3072 2660 1675 258 ------
NM_002556chr113254 175 66 11642 ----
NM_002577chr364063 2699 1178 879 551 401 ------
NM_002578chrX1356 ------
NM_002611chr17----1837 --
NM_002641chrX11458 --11726 --
NM_002655chr834830 4036 906 ------
NM_002660chr2041157 945 470 453 ------
NM_002667chr621271 848 ------
NM_002670chr321259 155 --1162 11073
NM_002699chr111003 ------
NM_002709chr222414 1067 11310 ----
NM_002713chr11959 ------
NM_002719chr141895 1561 --12129
NM_002731chr123118 611 ------
NM_002734chr17--2741 255 1796 --
NM_002736chr721456 54 ------
NM_002745chr2264386 3358 2855 1814 1197 923 ------
NM_002750chr101179 ------
NM_002828chr181650 ------
NM_002834chr1294036 2774 1423 1388 1227 1045 893 883 870 ------
NM_002886chr344812 4367 3766 561 --34006 3701 3154 --
NM_002897chr2----2691 650 --
NM_002938chr412001 --11543 --
NM_002956chr121178 ------
NM_003001chr142048 1406 561 541 --1566 --
NM_003034chr1286807 6801 6567 6486 3042 2585 2553 242 11785 ----
NM_003059chr51262 ------
NM_003107chr652646 1820 1633 864 786 --1420 --
NM_003112chr72806 73 ------
NM_003113chr21264 ------
NM_003129chr81216 ------
NM_003133chr12182 160 ------
NM_003155chr832406 2067 380 --1516 --
NM_003234chr322330 343 11522 1476 --
NM_003246chr15--146 --11843
NM_003257chr151225 1113 ----
NM_003262chr335015 4538 503 24952 1878 14085 --
NM_003286chr2021070 382 ------
NM_003305chr41134 ------
NM_003319chr22959 194 ------
NM_003339chr511065 ------
NM_003342chr1722423 2122 --12387 --
NM_003350chr8----1706 1111
NM_003369chr1121024 183 ----12335
NM_003373chr1021916 1518 ------
NM_003385chr2--1368 ----
NM_003400chr2----1596 --
NM_003412chr352802 2560 2029 1913 934 11924 ----
NM_003418chr32863 672 ------
NM_003439chr733056 1276 779 ------
NM_003442chr112807 751 ------
NM_003462chr121287 251 --1105 --
NM_003463chr632484 1142 143 ------
NM_003468chr264179 3654 3286 2748 827 738 ------
NM_003470chr1641751 384 285 116 ------
NM_003478chr1122994 167 --23031 488 --
NM_003483chr1212723 ------
NM_003489chr2122318 1366 ------
NM_003566chr1222468 2364 32527 2414 2335 --11048
NM_003576chr1362769 2445 2353 2252 889 401 22599 2076 ----
NM_003580chr8--194 ----
NM_003663chr322399 1240 --12210 --
NM_003684chr11934 ------
NM_003716chr3166 ------
NM_003758chr1521306 124 ------
NM_003758chr1521306 124 ------
NM_003783chr1161 ------
NM_003825chr1521316 1235 ------
NM_003872chr262913 2650 2555 2123 1904 1872 ----12262
NM_003884chr3--1684 --11615
NM_003958chr683510 3009 1110 1029 944 752 489 135 12448 ----
NM_003966chr5106463 6398 6063 5287 2897 2880 1314 1099 661 655 --12172 --
NM_004004chr13----1247 --
NM_004052chr10132 ------
NM_004081chrY41140 750 607 126 ------
NM_004085chrX1776 --1780 --
NM_004098chr1011075 ------
NM_004124chr1453521 2810 2336 1022 594 --1821 --
NM_004157chr3--1726 ----
NM_004227chr732897 2555 2277 ------
NM_004272chr5----21647 191 --
NM_004293chr963059 2696 2575 607 440 74 ------
NM_004330chr1511026 ------
NM_004331chr832629 1903 1641 --12012 --
NM_004338chr1897015 5873 5405 5393 4370 1774 1568 532 26 ------
NM_004370chr611632 --11917 --
NM_004389chr21818 1853 ----
NM_004442chr1----11723 --
NM_004481chr152464 2350 2231 1653 807 11087 12446 --
NM_004487chr31933 ------
NM_004491chr1953371 1258 1112 959 209 14008 24127 1472 --
NM_004501chr134038 825 756 --14032 --
NM_004535chr202658 541 --11086 --
NM_004537chr121408 --11102 --
NM_004538chrX1260 ------
NM_004586chrX64049 3446 1809 1619 363 186 --24273 811 1112
NM_004593chr32105 36 ------
NM_004612chr924641 288 1407 11298 --
NM_004620chr112439 263 ------
NM_004622chr251590 825 385 267 82 ------
NM_004642chr121203 ------
NM_004703chr1721880 433 --11012 --
NM_004726chrX54506 2294 2035 1959 706 14760 ----
NM_004774chr1763006 2932 2454 2186 1103 140 --12893 --
NM_004779chr51983 --11092 11282
NM_004824chr611193 1311 ----
NM_004827chr411567 1356 ----
NM_004834chr212206 --1232 --
NM_004836chr22227 146 ------
NM_004840chrX32018 937 424 ------
NM_004859chr17--1635 12840 --
NM_004863chr1495255 5160 5042 4271 3504 1652 1183 1131 975 ------
NM_004898chr422866 2665 1341 ----
NM_004929chr821188 27 ------
NM_004985chr1221333 1092 ------
NM_004992chrX128237 8160 8044 7569 6738 6666 5886 5661 3390 1770 1596 659 ------
NM_004992chrX128237 8160 8044 7569 6738 6666 5886 5661 3390 1770 1596 659 ------
NM_004999chr632965 1320 26 11078 ----
NM_005010chr71510 1120 1885 --
NM_005057chr131828 1431 620 --1720 --
NM_005063chr1033340 557 424 33258 3033 2608 1294 --
NM_005065chr1445370 4895 3859 1537 15193 11678 --
NM_005087chr31756 ------
NM_005088chrX1709 ------
NM_005095chr111979 ------
NM_005096chrX31142 909 220 ------
NM_005109chr341934 1570 450 114 1219 1664 --
NM_005114chr41624 --1614 --
NM_005116chr2033804 2860 1238 14245 ----
NM_005126chr312123 12101 ----
NM_005156chr914905 --13980 --
NM_005188chr1145528 5259 5061 5055 13195 28293 7727 21592 181
NM_005206chr1711159 ----11133
NM_005229chrX----1475 --
NM_005235chr267694 7240 7151 6724 5789 256 17110 ----
NM_005245chr4--1519 ----
NM_005261chr82122 90 ------
NM_005324chr1731845 1603 1548 --1824 --
NM_005339chr434096 3888 3239 13629 12693 --
NM_005348chr14----1721 1192
NM_005358chr13----1322 --
NM_005359chr1856088 4929 4340 2290 2209 ----11283
NM_005388chr931587 656 173 ------
NM_005397chr753552 2858 1516 1384 1248 1829 1957 --
NM_005436chr101509 ------
NM_005461chr201560 ------
NM_005493chr61579 ------
NM_005497chr1775927 4740 4114 1831 1741 830 425 11886 14826 --
NM_005504chr1276037 5216 4331 4186 4170 2221 636 --24082 908 --
NM_005537chr13--1114 ----
NM_005566chr111146 ------
NM_005570chr181935 11081 ----
NM_005575chr52752 131 1845 ----
NM_005578chr334444 2019 579 --13618 13672
NM_005596chr926223 523 --25408 451 --
NM_005604chr632145 1749 292 ------
NM_005610chr12582 333 --1828 --
NM_005627chr6158 ------
NM_005648chr8------164
NM_005665chr134255 1543 708 --11334 11957
NM_005667chr22102 62 ------
NM_005668chr534301 3706 787 --13819 --
NM_005721chr22897 81 ------
NM_005722chr231603 799 317 12011 ----
NM_005734chr11------1798
NM_005738chr711711 --1298 --
NM_005766chr1311302 --1233 1533
NM_005779chr563106 3060 2401 876 746 708 --11030 13171
NM_005789chr1731888 1698 128 ------
NM_005813chr22755 380 --11616 11811
NM_005822chr621489 150 --12064 --
NM_005840chrX57352 6431 2418 1156 106 --26785 1421 --
NM_005843chr2----31533 1257 241 --
NM_005870chr131136 ------
NM_005882chr4----1887 --
NM_005884chr19----1797 --
NM_005898chr1143052 2739 1204 1171 ------
NM_005901chr1848212 7071 6924 1438 --38456 7239 6244 13328
NM_005903chr543919 1947 1431 33 14438 35036 1680 754 --
NM_005909chr543644 2955 2795 623 ------
NM_005917chr21177 ------
NM_005938chrX51163 1028 921 409 111 ------
NM_005941chr853043 1497 1393 148 89 --12727 --
NM_005964chr17142 ------
NM_005966chr2--11842 ----
NM_005969chr1121213 1065 ------
NM_006007chr954425 4073 4035 1383 369 --11231 --
NM_006011chr1531518 916 100 ------
NM_006016chr622006 1782 ------
NM_006033chr1822311 276 ------
NM_006036chr221712 69 ------
NM_006041chr171155 ------
NM_006042chr17------1424
NM_006047chr2053311 1083 1061 795 419 ------
NM_006089chrX21554 1443 1245 ----
NM_006094chr822125 115 ------
NM_006095chr423991 3200 11259 ----
NM_006100chr32394 37 --1240 --
NM_006107chr17--1374 1153 --
NM_006108chr11198 --21853 686 1530
NM_006136chr71964 11094 ----
NM_006139chr252480 459 438 392 274 11816 ----
NM_006141chr161360 1381 ----
NM_006154chr152808 225 ------
NM_006156chr141195 ------
NM_006162chr1811757 ------
NM_006197chr812197 --1406 --
NM_006203chr523527 1389 11755 --14713
NM_006209chr8--1100 ----
NM_006223chrX2442 73 ------
NM_006241chr322167 1685 ----12433
NM_006251chr543092 2541 706 623 --11313 1447
NM_006265chr811468 --124 --
NM_006282chr2064190 1849 1717 1195 1097 286 ------
NM_006283chr844175 3392 855 791 ------
NM_006298chr61136 ------
NM_006306chrX105687 5405 5111 5048 4169 3881 1478 758 682 467 --25714 4425 --
NM_006323chr42650 287 ------
NM_006335chr11927 --1374 --
NM_006352chr1--11400 ----
NM_006359chrX1261 ------
NM_006366chr62353 75 ------
NM_006373chr1721277 1094 ------
NM_006377chr941278 794 356 65 ------
NM_006386chr2262328 2283 2162 981 677 167 ------
NM_006390chr1211540 ------
NM_006420chr2032958 642 206 --23265 947 --
NM_006451chr531026 691 289 ------
NM_006467chr52960 361 ------
NM_006475chr131189 ------
NM_006517chrX51763 1703 1431 489 329 ------
NM_006522chr2--1364 ----
NM_006527chr42607 581 ------
NM_006544chr1445433 4377 1496 962 ------
NM_006546chr1786564 6372 4194 2580 2128 2085 1936 1051 14267 14328 --
NM_006557chr911523 --1506 --
NM_006559chr11340 --11018 --
NM_006561chr1075753 5745 5517 5261 1992 694 64 ------
NM_006599chr1676803 6238 5757 5483 666 628 254 25740 837 12237 16213
NM_006603chrX21306 252 ------
NM_006628chr1564391 3646 3564 1688 642 438 ------
NM_006654chr1231308 1017 273 --13021 14495
NM_006667chrX1899 ----1260
NM_006696chr51219 --1234 --
NM_006717chr9------1263
NM_006722chr332514 2206 646 ------
NM_006727chr5--1438 ----
NM_006729chrX44075 703 630 128 --11980 --
NM_006734chr611419 ------
NM_006738chr1553306 1531 1132 1057 1048 --11339 --
NM_006750chr1666437 5867 2159 2153 2077 873 ------
NM_006759chr2137 --1210 --
NM_006766chr812294 ------
NM_006775chr632953 2146 952 ------
NM_006777chrX52808 2454 1918 661 514 --1219 --
NM_006786chr1122 ------
NM_006791chr15195 --1596 --
NM_006806chr211100 ------
NM_006811chr201855 ------
NM_006838chr1231541 1483 259 ------
NM_006851chr1242226 2070 1151 977 ------
NM_006856chr122948 440 ------
NM_006868chr1843107 2901 473 463 ------
NM_006873chr243052 2994 2338 470 ------
NM_006874chr421190 35 ------
NM_006885chr1623369 3231 ------
NM_006888chr1453182 2521 2491 2277 852 --1440 --
NM_006908chr741339 942 511 414 ------
NM_006930chr511359 ----11733
NM_006940chr121117 ------
NM_006951chr101195 ------
NM_006988chr212325 53 --2996 202 11147
NM_006996chr11718 11224 ----
NM_007008chr22663 344 ------
NM_007011chr1545875 5517 5132 1974 12726 ----
NM_007013chr81988 ------
NM_007034chr12756 176 ------
NM_007036chr52808 316 ------
NM_007038chr2155401 4603 1401 1138 748 14272 ----
NM_007039chr14----12319 --
NM_007054chr542857 2770 1303 1030 ----11579
NM_007124chr621478 1449 ------
NM_007129chr133783 737 64 ------
NM_007146chr1722247 981 --1440 --
NM_007174chr12----1303 --
NM_007200chr1553306 1531 1132 1057 1048 --11339 --
NM_007207chr12714 708 ------
NM_007238chr2064847 3262 1312 1056 973 372 ----11841
NM_007249chr13117217 3334 3038 2261 1667 1632 1507 1348 454 363 35 --15888 --
NM_007358chr1--11429 ----
NM_007363chrX2286 105 ------
NM_007365chr14901 613 580 225 11379 ----
NM_007373chr101313 ------
NM_012081chr532493 2414 653 ------
NM_012096chr323047 404 --12641 12881
NM_012104chr1153559 2846 1492 1481 637 13012 ----
NM_012104chr1153559 2846 1492 1481 637 13012 ----
NM_012129chr73798 713 152 --11611 --
NM_012141chr1323758 3514 ------
NM_012158chr1321653 1188 11303 ----
NM_012164chr986396 2806 2418 2336 1595 1562 1428 745 --1682 --
NM_012180chr42500 87 ------
NM_012193chr1154137 4056 3859 2031 221 11378 ----
NM_012218chr1982473 2305 2294 2230 705 298 217 88 ----22723 1143
NM_012224chr421073 936 ------
NM_012244chr1421781 439 ----11725
NM_012257chr7----1683 --
NM_012259chr6----11075 --
NM_012290chr22566 547 ------
NM_012294chr763541 3244 2833 2602 565 258 --1550 13969
NM_012307chr182988 763 ------
NM_012319chr181356 --1101 --
NM_012325chr201179 ------
NM_012330chr102638 472 ------
NM_012333chr131471 1180 415 11451 ----
NM_012345chr1321305 301 160 ----
NM_012347chr632088 1148 634 ------
NM_012417chr171498 ------
NM_012465chr1043000 2321 2315 603 ------
NM_013230chrY11422 ------
NM_013231chr1421332 725 11086 ----
NM_013259chr3----174 --
NM_013277chr121209 1262 ----
NM_013354chr821336 496 ------
NM_013374chr321997 143 13072 ----
NM_013399chr1641578 1532 381 279 --1390 --
NM_013436chr21729 ------
NM_013438chr91660 ------
NM_013937chr621054 428 ------
NM_013989chr1454127 3964 1353 1066 704 --14893 11901
NM_014000chr1021916 1518 ------
NM_014011chr2--1123 --1646
NM_014016chr321382 199 ------
NM_014043chr331227 1203 649 ------
NM_014071chr20------1100
NM_014106chr153987 699 614 12736 1945 --
NM_014110chr11959 ------
NM_014112chr811292 --14002 --
NM_014117chr1622345 659 ------
NM_014153chr161680 ------
NM_014155chr1167470 6581 5018 2872 1462 587 ------
NM_014240chr333809 3750 2885 --11290 --
NM_014243chr431573 642 22 ------
NM_014253chrX21649 699 ------
NM_014309chr2295298 5274 4793 4762 4278 3971 2105 1938 655 ------
NM_014323chr222856 299 21077 817 ----
NM_014333chr1111115 ------
NM_014372chr11634 --11954 --
NM_014392chr411122 ------
NM_014393chr8--3453 352 89 --11885
NM_014397chr92949 248 1413 ----
NM_014423chr575333 5160 4289 4241 1304 980 340 --11830 1582
NM_014445chr331787 420 378 ----12009
NM_014455chr1------1162
NM_014491chr71395 ------
NM_014494chr161553 ------
NM_014503chr122309 50 --1414 --
NM_014548chr151413 ----1459
NM_014554chr1222258 885 --12181 --
NM_014575chr32103 31 ------
NM_014585chr21305 ------
NM_014633chr11--1588 ----
NM_014701chr1562947 2636 1271 774 631 600 ------
NM_014707chr732136 1672 722 11770 ----
NM_014717chr191803 ------
NM_014729chr811678 1754 11720 --
NM_014730chr12105183 4401 4214 3310 2126 2076 1863 1549 1517 412 ------
NM_014730chr12105183 4401 4214 3310 2126 2076 1863 1549 1517 412 ------
NM_014737chr2093507 3421 1524 1465 1342 1052 890 146 68 --1915 --
NM_014739chr623652 3410 --1530 12905
NM_014747chr185713 5014 4797 2248 1924 1145 531 141 ------
NM_014751chr812068 11907 ----
NM_014774chr183013 2887 1218 1166 903 854 634 318 ------
NM_014781chr8----11120 --
NM_014784chr11114 ------
NM_014800chr72996 169 ------
NM_014802chr122886 391 ------
NM_014819chr521643 624 1675 21581 844 --
NM_014824chr1121750 512 ------
NM_014829chr5133 12290 ----
NM_014840chr1273351 2133 1201 641 455 435 73 ----12472
NM_014841chr61276 11161 ----
NM_014850chr354880 4751 4670 4581 1190 --13210 13123
NM_014873chr154750 4119 1331 1015 625 11622 34869 1038 448 --
NM_014881chr10--155 ----
NM_014904chr1043781 2537 577 370 1267 ----
NM_014905chr241419 1323 739 724 1548 ----
NM_014906chr1733546 2783 25 --31264 334 216 --
NM_014912chr1042484 2348 739 595 13113 ----
NM_014916chr71718 ------
NM_014934chr1333920 2992 671 1437 1482 --
NM_014942chr622583 1780 ------
NM_014946chr21247 --12414 --
NM_014949chr12692 118 --1923 --
NM_014953chr1333887 3500 2972 --14128 --
NM_014961chr4------1679
NM_014974chr10--1593 --1613
NM_014982chr1434805 3734 220 1717 11047 --
NM_014988chr432131 708 672 1626 12516 --
NM_014989chr621500 220 ------
NM_015000chr1231937 1006 184 --22789 2785 --
NM_015002chr1221410 131 --1482 --
NM_015008chr332875 2302 59 ------
NM_015017chr12432 352 1981 11014 --
NM_015026chr1234644 3651 678 ------
NM_015042chr1564010 3961 3599 3348 3041 207 --34116 3150 762 1217
NM_015045chr1021607 346 ------
NM_015049chr2135 ------
NM_015054chr12177 ------
NM_015068chr712790 ------
NM_015071chr576099 5872 4981 1372 889 666 505 16371 34089 2204 1750 --
NM_015074chr134974 3285 3108 1212 --14358
NM_015076chr663845 3308 2948 2866 2781 1509 ------
NM_015090chr184413 4241 3887 1991 1097 642 244 222 11908 --15048
NM_015092chr1634149 3663 1781 --13608 --
NM_015115chr4----12856 --
NM_015125chr191397 ------
NM_015137chr81502 --12616 --
NM_015144chr1653566 3166 2891 423 234 13024 13092 --
NM_015150chr3178 1662 2974 66 --
NM_015156chr1443952 2937 1031 1024 --13087 --
NM_015185chrX22676 1876 --1893 --
NM_015197chr1483349 3229 3028 2997 2761 2380 1230 1221 ------
NM_015208chr1832692 2477 725 1107 ----
NM_015225chr921131 371 ------
NM_015233chr133292 225 87 ------
NM_015264chr2211135 --13582 13711
NM_015265chr222047 78 ------
NM_015267chr1232065 1578 814 ------
NM_015269chr11429 --126 --
NM_015272chr162835 115 ------
NM_015278chr631386 488 424 ----12895
NM_015299chr1443383 2485 1442 321 13636 1502 --
NM_015310chr867925 6218 2253 418 147 28 --16627 --
NM_015313chr1133335 3021 719 13135 ----
NM_015347chr12----12961 --
NM_015361chr21218 ------
NM_015365chrX53557 1680 1357 1115 717 13808 ----
NM_015387chr2----1776 --
NM_015397chr91673 ------
NM_015409chr1232644 2504 1011 ----1807
NM_015435chr81385 --153 --
NM_015444chr31101 ------
NM_015446chr111281 ------
NM_015455chr523684 3252 ------
NM_015475chr2----1845 --
NM_015535chr273784 2642 1504 1088 1006 510 296 11377 ----
NM_015542chr10152 ------
NM_015554chr1522830 2220 ----1906
NM_015564chr573309 3296 2785 2756 2530 1375 1095 1574 ----
NM_015607chr1136 ------
NM_015626chr171393 ------
NM_015635chr921633 458 ------
NM_015640chr154757 4588 4093 1662 1056 14368 --14792
NM_015695chr621597 250 ------
NM_015713chr862684 1417 1411 1087 812 672 --11056 --
NM_015866chr111239 ------
NM_015886chr874818 4639 4035 3768 1655 1384 742 --15397 --
NM_016006chr3----1169 --
NM_016018chr81942 11002 --1183
NM_016021chr642089 1094 1050 961 ------
NM_016073chr151742 --11134 --
NM_016090chr112734 342 ------
NM_016100chr201168 ------
NM_016106chr14166 ------
NM_016131chr21348 ------
NM_016132chr1513038 11052 23192 749 --
NM_016201chr31558 ------
NM_016205chr42951 307 --1273 --
NM_016221chr532140 2113 948 --12049 22008 1839
NM_016234chr102758 629 ------
NM_016248chr1313212 13053 ----
NM_016255chr622628 1300 --1729 --
NM_016260chr234855 4809 1940 ----12511
NM_016272chr2232508 1107 425 ------
NM_016289chr221648 722 --11866 --
NM_016306chr31107 ------
NM_016322chr9----11977 --
NM_016356chr641935 1852 1037 610 12919 ----
NM_016357chr12138 ------
NM_016424chr1711240 21879 488 21658 1457 --
NM_016448chr1------11802
NM_016467chr21130 166 ----
NM_016472chr14129 136 --11538
NM_016480chr52775 128 ------
NM_016484chrX1246 ------
NM_016488chr1221724 448 ------
NM_016507chr1722892 1984 ------
NM_016530chr1531069 993 939 ----12806
NM_016603chr51608 2588 76 --12105
NM_016607chrX21628 528 ------
NM_016620chr11989 ------
NM_016621chr11104185 3580 3539 3513 3227 3202 2863 2795 1667 233 ----12917
NM_016626chr18--2640 139 ----
NM_016823chr1711029 ----11003
NM_016836chr2----2691 650 --
NM_016839chr2----2691 650 --
NM_016950chr411229 1943 1322 --
NM_016953chr254840 4454 1678 1143 774 15650 --15517
NM_017447chr2153272 3086 2921 1740 1216 ------
NM_017449chr1----11723 --
NM_017563chr374364 3921 2514 1999 1723 1492 260 16146 24707 852 --
NM_017628chr464706 4195 3538 1973 783 245 ------
NM_017635chr1141197 1187 350 225 ------
NM_017637chr988878 8832 8790 6173 2974 2237 1979 650 --27031 1709 --
NM_017641chr1221166 426 ------
NM_017643chr171439 --12120 --
NM_017650chr766029 4188 4100 3747 1073 952 --15526 11030
NM_017658chr1444480 3409 1460 1060 11697 ----
NM_017676chr511782 ------
NM_017714chr201152 ------
NM_017736chr1632544 2352 2295 --12388 --
NM_017737chr11474 ----11693
NM_017744chr152310 2126 2107 1690 1627 12093 ----
NM_017752chrX21897 429 ------
NM_017753chr91114 ------
NM_017769chr1432501 628 101 ------
NM_017779chr112190 --1921 11780
NM_017813chr865052 4989 4217 2154 2070 1841 1341 15643 1598
NM_017831chr1894179 3678 3525 3215 2966 1870 1791 806 675 ------
NM_017848chrX53830 3324 3156 1510 73 ----13630
NM_017866chr8181 1237 ----
NM_017902chr1055595 5335 4681 1145 308 189 45022 4344 2056 500 --
NM_017915chr121787 1131 ----
NM_017919chr965349 4942 4618 4607 4021 402 13714 21133 1041 --
NM_017933chr211051 ------
NM_017943chr1421003 724 ------
NM_017944chr1112809 32989 1915 339 ----
NM_017994chr762564 2257 2133 870 758 641 11853 1308 --
NM_018011chr131119 ------
NM_018025chr19------1195
NM_018027chr1012646 ------
NM_018045chr163136 3088 2356 1135 758 22 ------
NM_018061chr11392 --1606 --
NM_018092chr16--11567 1542 --
NM_018105chr81972 1877 ----
NM_018121chr1022990 1055 ----1147
NM_018133chr31145 12157 ----
NM_018157chr124935 596 202 103 ----1421
NM_018176chr41125 --11447 --
NM_018225chr9105107 5026 4359 4040 3559 2041 1647 1565 601 516 --14864 12121
NM_018247chr622727 2408 22457 87 ----
NM_018254chr12917 207 ------
NM_018299chr832456 1285 174 ------
NM_018302chr41609 --22294 32 --
NM_018307chr175865 617 368 334 172 ------
NM_018323chr42426 250 ------
NM_018327chr2031598 652 462 ------
NM_018360chrX--159 ----
NM_018362chr1123298 41 23825 3095 ----
NM_018364chr123473 1590 21139 199 ----
NM_018367chr1161815 798 580 536 435 313 ------
NM_018374chr731358 573 504 --11969 --
NM_018424chr911627 ------
NM_018431chr202563 248 ------
NM_018440chr858412 5929 5788 5567 1199 ------
NM_018448chr1231074 469 266 ------
NM_018482chr8----12049 --
NM_018489chr111697 --22184 160 --
NM_018490chr1141349 644 487 283 ------
NM_018602chr151348 --11417 11726
NM_018638chr1253692 3484 2223 1809 1292 23761 2287 ----
NM_018667chr16--1294 --11958
NM_018689chr1552603 2522 511 386 365 --22586 996 --
NM_018695chr531695 528 337 --12310 --
NM_018834chr5189 ------
NM_018846chr72947 188 ------
NM_018890chr741339 942 511 414 ------
NM_018898chr512300 ------
NM_018899chr512300 ------
NM_018900chr512300 ------
NM_018901chr512300 ------
NM_018902chr512300 ------
NM_018903chr512300 ------
NM_018904chr512300 ------
NM_018905chr512300 ------
NM_018906chr512300 ------
NM_018907chr512300 ------
NM_018908chr512300 ------
NM_018909chr512300 ------
NM_018910chr512300 ------
NM_018911chr512300 ------
NM_018945chr633039 2909 889 ------
NM_018947chr794966 4266 3751 3226 1967 1891 1751 1656 1286 1262 23177 1577 --
NM_019001chr354788 4300 3368 3185 367 11362 13447 --
NM_019002chr21227 ------
NM_019022chr1842951 2857 2315 545 ------
NM_019050chr411633 ------
NM_019071chr71229 1571 ----
NM_019072chr552735 1622 1455 1372 431 --11157 --
NM_019087chr5152 ------
NM_019114chr92435 128 ------
NM_019116chr1633414 2681 822 1498 12642 --
NM_019605chr12470 47 ------
NM_019848chrX1147 ------
NM_020117chr52745 390 ------
NM_020120chr251567 1255 577 362 61 ------
NM_020122chr255500 4832 4769 1862 642 --15375 --
NM_020150chr1082032 1952 1898 1726 669 525 240 209 ------
NM_020177chr523163 1289 ------
NM_020180chr1821112 357 ------
NM_020199chr521174 241 ------
NM_020235chr32153 71 ------
NM_020337chr423107 2319 ------
NM_020338chr1023573 1477 ------
NM_020346chr1121543 559 ------
NM_020354chr10--1780 ----
NM_020366chr14169 ------
NM_020390chr373813 3110 1451 1132 1048 316 140 --21956 659 --
NM_020403chr132493 358 1693 ----
NM_020420chrY41140 750 607 126 ------
NM_020440chr131222 967 930 ------
NM_020443chr185864 5780 5209 2346 1744 1330 959 617 16206 ----
NM_020463chr211142 1194 ----
NM_020466chr664445 3641 3371 1038 779 699 ------
NM_020473chrX11458 --11726 --
NM_020525chr121151 ------
NM_020532chr22663 344 ------
NM_020651chr22536 354 ------
NM_020676chr3----1859 --
NM_020686chr1663109 2570 835 370 285 178 ----12635
NM_020714chr19124096 4011 3955 3785 1700 1349 1133 1051 959 791 576 495 --24325 4129 --
NM_020717chrX93047 1932 1916 1337 997 947 660 446 169 --11449 --
NM_020734chr1233251 817 748 1164 12378 --
NM_020755chr611322 ----1230
NM_020772chr1797310 7052 6675 6624 6082 2687 2012 557 282 11381 27565 713 --
NM_020774chr1866219 5220 2353 1607 1465 1027 24229 2135 ----
NM_020778chr1594029 3683 3306 1883 1594 1490 1248 1013 476 --1885 --
NM_020781chr732572 823 802 ------
NM_020830chr232221 424 282 12739 11032 --
NM_020854chr1811365 --11042 --
NM_020870chr441853 1842 415 193 --1644 --
NM_020873chr32865 105 ------
NM_020918chr1023627 424 ------
NM_020925chr121117 206 ------
NM_020940chr1032630 2158 678 ------
NM_020987chr1011037 ----11142
NM_020993chr1242251 1949 1775 1137 --1968 --
NM_021007chr222422 1647 ------
NM_021012chr1783005 2200 985 974 661 539 371 351 12630 12049 --
NM_021025chr51527 ------
NM_021038chr322670 2594 1749 23177 317 --
NM_021072chr552588 2431 1951 1922 708 ------
NM_021076chr221374 ------
NM_021088chr221649 394 1476 --1656
NM_021140chrX2459 410 --1388 --
NM_021159chr4----1175 --
NM_021165chr11752 ------
NM_021202chr2062615 2272 2003 1167 936 667 ----1893
NM_021215chr20----12088 --
NM_021627chr32415 32 ------
NM_021633chr121189 487 --252 29 --
NM_021637chrX21176 1150 11076 ----
NM_021728chr14189 ------
NM_021813chr655808 5259 2335 1263 417 --14322 --
NM_021818chr1421453 538 ------
NM_021912chr1533473 493 422 --13818 --
NM_021914chr1412316 11596 ----
NM_021956chr621366 1350 ------
NM_021961chr1196030 6023 5513 5339 5171 4580 2392 2328 1699 ------
NM_021964chr344553 4519 1264 168 ------
NM_021970chr41138 1716 1262 --
NM_021995chr1122 ------
NM_022037chr21925 ------
NM_022048chr1566277 5526 2539 2089 1878 561 23954 3921 ----
NM_022090chr5----1490 --
NM_022173chr21925 ------
NM_022337chr111499 ------
NM_022351chr8--12888 --23058 536
NM_022373chr71985 1780 --1655
NM_022443chr3------149
NM_022444chr721331 787 --1682 --
NM_022451chr101593 ------
NM_022458chr733125 2933 2176 12751 ----
NM_022483chr541798 1198 743 90 ------
NM_022484chr741354 1343 1034 923 ------
NM_022739chr171290 ------
NM_022745chr162495 2290 1006 597 564 410 ------
NM_022748chr762782 719 710 701 692 246 ----12402
NM_022756chr1--11073 11357 --
NM_022763chr33435 250 125 --1745 --
NM_022781chr932569 2498 894 ------
NM_022787chr131954 1822 981 --11011 --
NM_022802chr1031427 429 153 ------
NM_022841chr153830 705 409 --1304 --
NM_022918chr1131857 706 108 ------
NM_023009chr12239 233 ------
NM_023011chr13------1307
NM_023012chr123565 167 77 ------
NM_023071chr12177 --1334 --
NM_024007chr52562 502 ------
NM_024016chr172662 161 ------
NM_024345chr965231 5115 4130 3857 2033 188 24738 4047 12022 --
NM_024420chr11167 ------
NM_024424chr111244 1850 ----
NM_024425chr111244 1850 ----
NM_024426chr111244 1850 ----
NM_024496chr14----2225 140 --
NM_024524chr332109 943 559 ----12026
NM_024612chr171947 ----1953
NM_024646chr173287 3204 2868 2656 2577 1424 715 --23715 1416 --
NM_024713chr1521460 1240 11104 ----
NM_024721chr82391 311 ------
NM_024740chr1153141 3056 1254 224 140 13747 11217 --
NM_024757chr91904 ------
NM_024770chr286621 6534 6528 4881 4177 2501 2417 1545 ----1287
NM_024772chr12464 450 ------
NM_024806chr111228 ------
NM_024884chr1441135 1052 681 452 13715 ----
NM_024947chr388180 7511 7430 7346 7008 2010 1276 779 --27235 580 11681
NM_024969chr21721 ------
NM_024989chr272875 2743 2389 2383 2307 1797 514 11403 15156 12111
NM_025040chr19--11890 11558 --
NM_025054chr832802 1572 1017 ------
NM_025134chr16----1601 --
NM_025138chr1321176 84 ------
NM_025146chr382451 2251 1711 772 742 673 592 267 --12312 --
NM_025160chr122807 95 12750 12927 --
NM_025191chr111029 --12749 --
NM_025222chr322634 628 --31001 615 602 --
NM_025238chr15----21483 337 --
NM_025264chr2143 ------
NM_030579chr1631480 725 447 --33634 2639 2574 --
NM_030621chr14192 --12771 --
NM_030623chr211063 ------
NM_030625chr103842 254 34 1577 ----
NM_030627chr564062 3511 2787 1578 849 719 ------
NM_030629chr161688 ------
NM_030648chr444342 2096 1740 191 1906 ----
NM_030650chr233718 2599 1050 11143 ----
NM_030664chr1011613 ------
NM_030751chr1021196 252 ------
NM_030751chr1021196 252 ------
NM_030806chr198108 7619 6960 3236 2834 2658 2629 2616 229 ------
NM_030881chr2262328 2283 2162 981 677 167 ------
NM_031212chr10195 ------
NM_031216chr1811453 ------
NM_031262chr91744 ------
NM_031263chr91801 ------
NM_031291chr43636 254 116 ------
NM_031411chr512300 ------
NM_031419chr341557 1022 45 25 ------
NM_031469chr643327 941 548 458 ------
NM_031844chr134038 825 756 --14032 --
NM_031845chr233624 2993 711 --13634 --
NM_031847chr233624 2993 711 --13634 --
NM_031849chr512300 ------
NM_031857chr512300 ------
NM_031860chr512300 ------
NM_031935chr11746 ------
NM_032042chr532311 2159 986 ------
NM_032050chr222856 299 21077 817 ----
NM_032052chr2211241 21462 1202 ----
NM_032121chrX51081 1021 853 770 307 ------
NM_032124chr1821265 166 --1843 --
NM_032153chr322274 132 ------
NM_032154chr101311 ------
NM_032186chr11989 ------
NM_032199chr1043487 3114 200 82 ------
NM_032208chr22770 69 --13092 --
NM_032217chr42290 208 ------
NM_032228chr1112162 1743 ----
NM_032239chr431388 1349 1302 --11251 --
NM_032242chr333098 2565 485 ------
NM_032289chr551292 706 398 300 113 ------
NM_032291chr121369 270 ------
NM_032321chr223036 40 --12241 --
NM_032373chr1065855 2092 1402 1029 698 262 --13979 --
NM_032445chr1532058 889 111 --22101 765 --
NM_032446chr553667 2411 223 197 97 --11080 --
NM_032458chrX43245 2353 793 349 12896 ----
NM_032494chr21174 --1437 --
NM_032505chr342246 2018 725 719 ------
NM_032547chr42557 181 ------
NM_032626chr16------1300
NM_032632chr1431850 1739 613 1171 ----
NM_032682chr332669 2604 71 12706 ----
NM_032689chr1931327 586 489 --11074 11599
NM_032765chr52231 206 ------
NM_032833chr152566 2328 1946 1724 25 ------
NM_032854chr173958 658 228 ------
NM_032900chr1063527 2980 1560 1075 1052 510 ------
NM_032961chr4----199 --
NM_032968chrX33248 515 140 --13638 --
NM_032969chrX33248 515 140 --13638 --
NM_032973chrY33243 515 140 --13630 --
NM_033030chr22118 88 ------
NM_033201chr1621067 443 ------
NM_033211chr53258 238 50 ------
NM_033224chr788013 7272 6806 6723 6345 5488 2259 52 --188 --
NM_033225chr822729 2592 ------
NM_033285chr814131 ------
NM_033360chr1221454 1213 ------
NM_033394chr231591 1067 171 ------
NM_033421chr2071630 1320 744 593 302 165 84 ----1517
NM_033429chr1563059 2353 1039 1011 451 354 --22431 2256 --
NM_033480chr632088 1148 634 ------
NM_033481chr632088 1148 634 ------
NM_033503chr1583483 2467 2425 1189 1153 787 695 327 ------
NM_033515chr61411 1522 ----
NM_033540chr31336 --11102 --
NM_033624chr1221410 131 --1482 --
NM_033656chr2145320 2166 172 60 25830 674 24892 4144 --
NM_052854chr11----1499 --
NM_052879chr1233590 2990 1098 21545 576 ----
NM_052880chr2241343 1280 986 65 1566 ----
NM_052907chr1231122 300 167 --12836 --
NM_052918chr1032743 2567 690 ------
NM_052953chr31245 ------
NM_053016chr947872 6670 2319 484 --12279 --
NM_053023chr1112264 --22385 1046 --
NM_053025chr331464 224 196 ------
NM_053026chr331464 224 196 ------
NM_053027chr331464 224 196 ------
NM_053028chr331464 224 196 ------
NM_053031chr331464 224 196 ------
NM_053032chr331464 224 196 ------
NM_053043chr755982 4703 4340 1813 726 14649 15113 --
NM_054016chr121501 113 ------
NM_054016chr121501 113 ------
NM_054016chr121501 113 ------
NM_057175chr412607 ------
NM_057178chr1722158 529 --12253 192
NM_078469chr1011110 --1182 --
NM_078470chr1042287 1739 816 735 --42550 1770 902 452 --
NM_080599chr10152 ------
NM_080645chr611632 --11917 --
NM_080669chr1794401 4075 3551 3533 1292 876 819 461 71 ------
NM_080676chr2042939 2600 2444 2135 --1364 12703
NM_080836chr2074376 3981 3934 3668 896 595 136 --14544 14605
NM_080867chr1443773 3203 1503 1436 ----1840
NM_080872chr813942 --11509 --
NM_130442chr72996 169 ------
NM_130773chr22818 706 ------
NM_130797chr731700 1547 1353 ------
NM_130798chr1521316 1235 ------
NM_130809chr532953 1940 465 22715 901 --12891
NM_133265chrX73675 3534 3517 1469 516 458 405 --13611 --
NM_133367chr643167 2866 2501 381 --12756 --
NM_133378chr22959 194 ------
NM_133432chr22959 194 ------
NM_133437chr22959 194 ------
NM_133443chr1621402 111 11747 11890 11692
NM_134265chr171393 ------
NM_134428chr91336 ------
NM_138270chrX22875 551 ------
NM_138285chr2370 57 42 ------
NM_138286chr1944331 2677 1319 1238 --23082 2743 --
NM_138288chr14--12144 ----
NM_138300chr111319 ------
NM_138340chr181539 ------
NM_138444chr1354149 3763 904 485 129 14505 ----
NM_138473chr1223748 1328 --11126 --
NM_138558chr11959 ------
NM_138638chr1412316 11596 ----
NM_138713chr1676803 6238 5757 5483 666 628 254 25740 837 12237 16213
NM_138714chr1676803 6238 5757 5483 666 628 254 25740 837 12237 16213
NM_138727chr152310 2126 2107 1690 1627 12093 ----
NM_138728chr152310 2126 2107 1690 1627 12093 ----
NM_138773chr51830 --1237 --
NM_138782chr5----22203 677 --
NM_138971chr1153559 2846 1492 1481 637 13012 ----
NM_138971chr1153559 2846 1492 1481 637 13012 ----
NM_138972chr1153559 2846 1492 1481 637 13012 ----
NM_138972chr1153559 2846 1492 1481 637 13012 ----
NM_138973chr1153559 2846 1492 1481 637 13012 ----
NM_138973chr1153559 2846 1492 1481 637 13012 ----
NM_139046chr101179 ------
NM_139076chr451404 970 521 357 350 ------
NM_139168chr531577 376 271 11847 ----
NM_139207chr121647 --21776 369 --
NM_139321chr2023314 578 --23041 36 1831
NM_144579chr2102811 2712 2695 2025 1821 1808 903 720 639 449 1467 ----
NM_144599chr1541448 787 448 342 ------
NM_144664chr1111733 1822 ----
NM_144728chr12714 708 ------
NM_144729chr12714 708 ------
NM_144767chr1553306 1531 1132 1057 1048 --11339 --
NM_144949chr2--1123 --1646
NM_144963chr81339 ------
NM_144967chrX1693 1199 1773 --
NM_145012chr101378 --11022 --
NM_145115chr752116 1904 641 340 303 ----1793
NM_145117chr1112654 ------
NM_145159chr141597 ------
NM_145176chr642591 2491 523 260 1767 ----
NM_145259chr236569 765 461 12517 ----
NM_145274chr171674 ------
NM_145307chr1053494 1838 1805 1303 934 --14017 --
NM_145313chr102531 411 ----11390
NM_145686chr212206 --1232 --
NM_145687chr212206 --1232 --
NM_145735chr13------12453
NM_145800chrX3687 313 111 ------
NM_145802chrX3636 262 60 ------
NM_145803chr112439 263 ------
NM_146388chr193918 349 220 ------
NM_147175chrX11662 ----11857
NM_148571chr172775 445 ------
NM_148898chr71395 ------
NM_148899chr71395 ------
NM_152261chr1221947 491 1565 12221 --
NM_152271chr831016 991 89 --1796 --
NM_152277chr511340 ------
NM_152287chr1662492 959 919 784 336 330 12544 12467 --
NM_152388chr243988 3455 1307 1257 --12992 --
NM_152417chr831054 400 375 1384 ----
NM_152437chr1221700 866 --12312 --
NM_152549chr5--1444 ----
NM_152622chr522836 2483 --12197 12258
NM_152629chr953312 841 782 771 163 ------
NM_152638chr1211185 --1976 --
NM_152682chr431573 1488 1155 1500 ----
NM_152688chr6--1937 ----
NM_152699chr373419 3200 2894 2812 2309 453 337 ------
NM_152756chr543466 2649 1338 859 1494 ----
NM_152758chr812998 ------
NM_152765chr842307 2209 2086 2060 198 1104 1490
NM_152773chr3--194 --122
NM_152787chrX12666 --23096 2676 11484
NM_152789chr73599 520 375 ------
NM_152835chr142703 2332 523 92 1370 12558 --
NM_152838chr2053311 1083 1061 795 419 ------
NM_152860chr1221294 523 ------
NM_152890chr11327 11070 ----
NM_152924chr1545875 5517 5132 1974 12726 ----
NM_152989chr121117 ------
NM_153020chr621361 354 ------
NM_153035chr162641 2507 2344 2198 830 204 ----11019
NM_153042chr611584 --11825 --
NM_153184chr311599 ------
NM_153188chr533524 1829 1319 14997 14579 --
NM_153207chr12--11042 ----
NM_153321chr172828 88 ------
NM_153322chr172828 88 ------
NM_153371chr131596 1108 21747 173 --
NM_153456chr13105199 4189 3870 2480 2293 1879 1810 1542 1035 159 ------
NM_153499chr1252860 2844 1949 1057 542 --11107 --
NM_153500chr1252860 2844 1949 1057 542 --11107 --
NM_153607chr522715 88 ------
NM_153687chr1211490 ------
NM_153704chr8169 ------
NM_153705chr11----12362 1997
NM_153810chr1044488 3602 3165 1462 14803 ----
NM_153828chr22663 344 ------
NM_170606chr71703 ------
NM_170679chr5------11038
NM_170686chr732572 823 802 ------
NM_170710chr4------12678
NM_170719chr1321176 84 ------
NM_170731chr1112030 1437 12194 --
NM_170732chr1112030 1437 12194 --
NM_170733chr1112030 1437 12194 --
NM_170734chr1112030 1437 12194 --
NM_170735chr1112030 1437 12194 --
NM_170751chr611193 1311 ----
NM_170752chr611193 1311 ----
NM_170774chr2093507 3421 1524 1465 1342 1052 890 146 68 --1915 --
NM_172069chr22912 134 ------
NM_172070chr212091 ------
NM_172128chr431619 1330 834 ------
NM_172226chr1252860 2844 1949 1057 542 --11107 --
NM_172337chr14189 ------
NM_172387chr1811710 ------
NM_172388chr1811757 ------
NM_172389chr1811757 ------
NM_173065chr193484 3123 3039 2722 2372 1187 631 304 223 ------
NM_173082chr61388 1186 ----
NM_173172chr211534 ------
NM_173214chr1676803 6238 5757 5483 666 628 254 25740 837 12237 16213
NM_173359chr331650 520 101 11532 11321 --
NM_173469chr151109 ------
NM_173470chrX42214 1152 1139 42 --12577 --
NM_173475chr1611664 ------
NM_173582chr1156062 2120 1837 409 153 --14612 --
NM_173602chr1233717 752 412 ------
NM_173642chr1117012 6605 6072 6050 2449 2353 2342 2227 2198 1306 742 18798 37093 6777 764 --
NM_173694chrX2796 296 ------
NM_173698chrX21833 521 150 ----
NM_173808chr124133 4022 ----11097
NM_173814chr15176 ------
NM_173829chr565514 5459 4416 1768 1466 285 26039 723 ----
NM_174916chr1542117 1781 1666 641 1226 ----
NM_174938chr92139 42 ------
NM_175061chr7------1479
NM_175610chr151225 1113 ----
NM_175733chr1172140 1806 1782 1764 784 731 602 ------
NM_175854chr1362605 2180 866 755 642 556 ------
NM_175920chr52752 131 1845 ----
NM_176863chr1731888 1698 128 ------
NM_177424chr12644 122 --1585 --
NM_177438chr14192 --12771 --
NM_177947chrX21628 528 ------
NM_177948chrX21628 528 ------
NM_177968chr222032 326 ------
NM_178010chr121117 ------
NM_178123chr2--1412 ----
NM_178151chrX97608 6878 6811 5374 5043 4869 3102 2992 266 12234 ----
NM_178152chrX97608 6878 6811 5374 5043 4869 3102 2992 266 12234 ----
NM_178153chrX97608 6878 6811 5374 5043 4869 3102 2992 266 12234 ----
NM_178170chr173644 260 254 ------
NM_178454chr1--1765 ----
NM_178498chr1123926 659 186 12553 --
NM_178509chr1743827 3154 1404 787 13109 11536 1508
NM_178539chr1231517 721 428 --1273 --
NM_178566chr911534 --21453 1163 --
NM_178586chr141895 1561 --12129
NM_181054chr142438 268 ------
NM_181265chr4------12678
NM_181354chr8------11556
NM_181358chr133941 3265 414 23874 722 ----
NM_181457chr22445 190 --11208 --
NM_181458chr22578 323 --11341 --
NM_181459chr22344 89 --11107 --
NM_181460chr22391 136 --11154 --
NM_181481chr1897015 5873 5405 5393 4370 1774 1568 532 26 ------
NM_181482chr1897015 5873 5405 5393 4370 1774 1568 532 26 ------
NM_181483chr1897015 5873 5405 5393 4370 1774 1568 532 26 ------
NM_181504chr533456 1419 208 --43623 3498 3392 3285 --
NM_181523chr533456 1419 208 --43623 3498 3392 3285 --
NM_181524chr533456 1419 208 --43623 3498 3392 3285 --
NM_181527chr201168 ------
NM_181645chr111141 1638 ----
NM_181671chr171809 ------
NM_181672chrX2520 288 11427 ----
NM_181673chrX2520 288 11427 ----
NM_181702chr82122 90 ------
NM_181782chr62418 64 11677 ----
NM_181836chr52841 503 1906 1969 --
NM_181838chr511065 ------
NM_182620chr1771972 1687 1604 930 721 544 104 ------
NM_182643chr822125 115 ------
NM_182728chr1421781 439 ----11725
NM_182765chr1022116 737 ------
NM_182789chr531026 691 289 ------
NM_182811chr2041157 945 470 453 ------
NM_182835chr14166 ------
NM_182848chr13----1164 --
NM_182920chr321046 496 ------
NM_182948chr123118 611 ------
NM_182964chr1112654 ------
NM_182976chr1--1297 ----
NM_183078chr683416 2915 1016 935 850 658 395 41 12354 ----
NM_183323chr531026 691 289 ------
NM_183393chr3166 ------
NM_183394chr3166 ------
NM_183397chr2085071 3486 3140 1536 1280 1197 596 85 ----12065
NM_183419chr81385 --153 --
NM_194071chr765247 4971 1992 1819 830 801 11928 ----
NM_194298chr1011252 21753 464 ----
NM_194314chr165194 4092 4028 3955 1855 1847 ------
NM_194328chr932569 2498 894 ------
NM_194329chr932569 2498 894 ------
NM_194330chr932569 2498 894 ------
NM_194332chr932569 2498 894 ------
NM_197970chr22118 88 ------
NM_198081chr662544 2534 2038 773 735 259 ------
NM_198097chr7----168 --
NM_198158chr332514 2206 646 ------
NM_198159chr332514 2206 646 ------
NM_198177chr332514 2206 646 ------
NM_198178chr332514 2206 646 ------
NM_198215chr102446 313 ------
NM_198217chr13--1114 ----
NM_198218chr13--1114 ----
NM_198219chr13--1114 ----
NM_198236chr11114 ------
NM_198240chr121178 ------
NM_198261chr123565 167 77 ------
NM_198262chr123565 167 77 ------
NM_198268chr133941 3265 414 23874 722 ----
NM_198269chr133941 3265 414 23874 722 ----
NM_198270chrX12414 ------
NM_198273chr532486 1933 26 ------
NM_198390chr161688 ------
NM_198400chr152808 225 ------
NM_198490chr383228 2693 1129 1023 686 663 443 221 ------
NM_198504chr31886 ------
NM_198513chr81265 --11265 --
NM_198581chr287096 6538 5678 5595 5266 4969 2880 2230 31265 964 123 ----
NM_198715chr146179 6090 5284 5204 12252 ----
NM_198793chr332737 2680 152 ------
NM_198829chr741339 942 511 414 ------
NM_198889chr42290 208 ------
NM_198903chr51179 ------
NM_198904chr521999 179 ----11681
NM_198968chr1333920 2992 671 1437 1482 --
NM_199000chr7----1428 --
NM_199003chr821256 99 11161 ----
NM_199005chr91918 --1831 --
NM_199168chr1021560 461 --1310 --
NM_199188chr1233590 2990 1098 21545 576 ----
NM_199189chr5189 ------
NM_199190chr1233590 2990 1098 21545 576 ----
NM_199320chr422557 2129 --12372 --
NM_199320chr422557 2129 --12372 --
NM_199324chr423442 833 ------
NM_199421chr1443773 3203 1503 1436 ----1840
NM_199436chr21247 --12414 --
NM_199482chr2----1776 --
NM_201266chr262913 2650 2555 2123 1904 1872 ----12262
NM_201269chr11989 ------
NM_201279chr262913 2650 2555 2123 1904 1872 ----12262
NM_201280chr62563 266 ------
NM_201570chr102519 306 ------
NM_201571chr102519 306 ------
NM_201572chr102519 306 ------
NM_201590chr102519 306 ------
NM_201593chr102519 306 ------
NM_201596chr102519 306 ------
NM_201597chr102519 306 ------
NM_201599chrX31142 909 220 ------
NM_201624chr12432 352 1981 11014 --
NM_201999chr421190 35 ------
NM_203282chr19----11250 --
NM_203327chr2033804 2860 1238 14245 ----
NM_203374chr193961 147 26 ------
NM_203379chr102758 629 ------
NM_203380chr102758 629 ------
NM_203394chr1232557 1707 191 ------
NM_203406chr51157 ----12448
NM_203446chr2112841 ------
NM_203458chr153679 1551 1347 1237 238 23402 1225 ----
NM_203459chr111741 1683 ----
NM_203487chr132493 358 1693 ----
NM_205768chr1--11400 ----
NM_205842chr21729 ------
NM_206839chr15195 --1596 --
NM_206853chr624020 830 ------
NM_206854chr625281 2091 ------
NM_206876chr222414 1067 11310 ----
NM_206907chr543092 2541 706 623 --11313 1447
NM_206909chr867925 6218 2253 418 147 28 --16627 --
NM_206937chr131863 ------
NM_206943chr2--1715 ----
NM_207292chr322670 2594 1749 23177 317 --
NM_207293chr322670 2594 1749 23177 317 --
NM_207294chr322670 2594 1749 23177 317 --
NM_207295chr322670 2594 1749 23177 317 --
NM_207296chr322670 2594 1749 23177 317 --
NM_207297chr322695 2619 1774 23202 342 --
NM_207299chr91114 ------
NM_207306chr1192958 2876 1502 1401 1329 1293 1257 1221 1185 1149 1113 1077 1005 969 865 793 757 721 433 ------
NM_207332chr8----179 --
NM_207372chr1022278 2025 ------
NM_207406chr444383 2115 681 250 15033 131 --
NM_207418chr1_random179 ------
NM_207520chr22663 344 ------
NM_207521chr22663 344 ------
NM_207645chr1111006 ------
NM_212460chr711711 --1298 --
NM_212471chr17--2741 255 1796 --
NM_212472chr17--2741 255 1796 --
NM_212554chr1041249 1041 1007 509 ------
NM_213609chr32439 388 ------