TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4666a-3p
miRNA Sequence: CAUACAAUCUGACAUGUAUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX96842 4275 2558 2337 2059 1574 1298 1088 58 --14580 12156
NM_000176chr563807 3716 3301 3015 2723 595 43574 1472 1021 785 --158
NM_000210chr252053 1822 1718 1446 641 22095 826 21436 25 12154
NM_000245chr772129 1914 1840 670 448 442 122 22044 812 ----
NM_000264chr973243 2762 2581 2314 1292 913 590 33148 2440 384 1150 1371
NM_000267chr1763400 3354 3255 817 301 91 23465 3063 13122 13270
NM_000332chr686927 6866 5316 4909 4357 1591 1557 47 15280 14870 1647
NM_000390chrX73292 2747 2446 2285 2268 1116 222 --12924 23401 1210
NM_000489chrX42871 2311 1179 1043 22893 2341 32656 2519 584 22321 650
NM_000555chrX147513 7209 7161 7027 6912 6853 6425 2940 2554 1545 593 386 143 52 26632 5506 12635 --
NM_000719chr12106506 6494 5536 5355 1893 1723 1636 1445 1437 890 11691 --26649 970
NM_000809chr499116 8594 8521 8317 6841 2968 1759 1737 1236 --1656 --
NM_000813chr575652 4772 4004 1797 1559 772 53 14519 11284 11388
NM_000926chr11149436 8834 7550 6874 6715 6350 6267 6101 3441 1220 675 469 404 147 17264 12794 17438
NM_001001395chr1272566 2485 776 372 353 304 255 22572 943 1341 1292
NM_001001419chr5135172 5093 5068 4975 4951 4912 4539 1160 950 207 172 144 128 14645 13224 --
NM_001001420chr5135172 5093 5068 4975 4951 4912 4539 1160 950 207 172 144 128 14645 13224 --
NM_001001549chr782801 2371 2309 2144 2116 2038 439 384 --1426 --
NM_001001550chr782801 2371 2309 2144 2116 2038 439 384 --1426 --
NM_001001555chr782801 2371 2309 2144 2116 2038 439 384 --1426 --
NM_001001664chr2103415 2991 2493 1384 1253 1005 864 624 446 266 22963 1594 31229 925 718 13866
NM_001003652chr18168603 8181 8099 6792 6669 6501 3444 3235 2772 2730 2717 2495 1691 1236 468 343 37434 2296 910 164 --
NM_001003674chr1895939 5680 1839 1333 663 557 506 418 330 14730 11344 26678 5895
NM_001003675chr1895939 5680 1839 1333 663 557 506 418 330 14730 11344 26678 5895
NM_001003679chr172092 2021 1778 1540 672 574 471 --22164 1929 11935
NM_001005473chr5126629 6394 5904 5477 4557 4484 4461 4420 2575 2001 1571 1490 1441 36597 2176 49 14402
NM_001007466chr675183 5056 4638 4615 4448 4351 1406 45046 4534 3955 3534 14059 11447
NM_001009899chr396488 6356 6210 5991 5599 5482 4612 4009 801 26503 5749 26407 95 11064
NM_001010891chr5116877 6104 5756 5252 4804 4577 4482 2272 1560 772 167 14252 ----
NM_001010922chr184155 3751 3681 2762 1710 1700 656 429 24220 2701 ----
NM_001011537chr332275 2155 728 ----32098 1908 1474
NM_001012755chrX74826 4745 3763 1644 1621 1566 1353 --24333 3416 24946 4843
NM_001012968chrX82818 2729 2325 2295 1810 1740 126 56 12781 32411 2221 865 --
NM_001013620chr12198056 7502 7450 7330 7310 6619 5955 5699 2695 2511 2463 2261 2168 2149 1838 1531 1145 388 294 55870 5554 1765 1478 1292 68008 7653 2405 1092 744 693 --
NM_001013659chr19115195 4729 4644 3917 953 941 767 739 577 431 213 11464 ----
NM_001018067chr1135194 5160 5030 4946 4875 3611 3327 2077 2038 1209 363 279 205 34902 4503 3859 ----
NM_001018068chr1135194 5160 5030 4946 4875 3611 3327 2077 2038 1209 363 279 205 34902 4503 3859 ----
NM_001018069chr1135194 5160 5030 4946 4875 3611 3327 2077 2038 1209 363 279 205 34902 4503 3859 ----
NM_001018074chr563807 3716 3301 3015 2723 595 43574 1472 1021 785 --158
NM_001018075chr563807 3716 3301 3015 2723 595 43574 1472 1021 785 --158
NM_001018076chr563807 3716 3301 3015 2723 595 43574 1472 1021 785 --158
NM_001018077chr563807 3716 3301 3015 2723 595 43574 1472 1021 785 --158
NM_001024094chr563807 3716 3301 3015 2723 595 43574 1472 1021 785 --158
NM_001024956chr11105844 5800 5709 4581 4304 2251 1038 726 375 244 35895 5016 274 34542 3620 1217 --
NM_001025076chr10106116 5892 5813 3972 3842 2405 1030 1008 970 669 24053 1179 25062 3899 11315
NM_001025077chr10137474 7250 7171 5330 5200 5065 4795 2388 2366 2328 2027 1240 1063 25411 2537 26420 5257 12673
NM_001029882chr12656 231 ----2472 441
NM_001029882chr12656 231 ----2472 441
NM_001030055chr14134493 4399 4325 3873 3643 3554 3008 1592 1504 1129 1102 931 307 21325 741 14113 --
NM_001031695chr2285340 5291 4748 4650 4627 3782 2093 229 35055 4397 1854 --15226
NM_001037174chr23806 622 458 22182 33 --3699 470 262
NM_001037334chr1882051 2023 1972 1849 936 647 581 196 11581 2621 486 --
NM_001039618chr11115860 5468 4956 4775 4016 3667 2262 1004 661 364 251 64968 3999 3795 1994 1980 1240 14272 --
NM_001040157chr452913 1868 1025 855 201 1385 --2682 53
NM_001040159chr41526 1121 2971 542 21248 1170
NM_001040665chr784832 4615 4482 4213 3826 3209 958 214 35016 3442 1207 2682 547 --
NM_001042492chr1763400 3354 3255 817 301 91 23465 3063 13122 13270
NM_001042510chr862164 2049 1766 571 487 251 11510 --1276
NM_001042511chr862164 2049 1766 571 487 251 11510 --1276
NM_001042555chr1264549 3758 3723 1256 1110 209 34112 3834 924 34014 3770 1398 23913 3750
NM_001042603chr12115344 5242 5233 5154 4291 4282 3781 1557 1509 1436 1079 12079 25104 4353 --
NM_001099678chr396174 6121 5877 5715 5541 5466 5052 773 143 21631 1539 11245 14610
NM_001100108chr1128350 8203 7686 7405 6952 5245 5227 3049 3030 2370 1441 1245 27166 3085 18156 --
NM_001106chr379016 7602 7522 6832 2683 1509 64 49785 9183 9005 6194 39550 3544 2880 16379
NM_001167chrX126730 6596 5905 5775 5650 4454 2503 1754 1682 1366 491 423 --36586 5989 5214 --
NM_001173chr14134493 4399 4325 3873 3643 3554 3008 1592 1504 1129 1102 931 307 21325 741 14113 --
NM_001204chr2167585 7534 7251 7224 7111 6061 5720 5573 5552 3005 2858 2519 2313 2295 1980 496 27497 1834 47694 7148 2583 1315 15636
NM_001310chr1242519 2262 2066 2040 --3854 370 299 11904
NM_001412chrX52904 2811 2451 1161 1096 22702 2336 --2391 378
NM_001438chr173180 3157 2459 2452 2361 1162 629 13543 23282 3133 23567 3492
NM_001695chr892846 2754 1563 1391 653 543 326 42 36 11556 --14257
NM_001858chr674935 4290 4283 1743 1536 918 753 13892 64870 4865 4803 4436 4330 1089 --
NM_001918chr199194 9179 5788 2121 2027 743 256 107 95 11228 28149 2679 --
NM_002006chr465826 4662 1352 748 606 182 14339 25755 5716 12300
NM_002009chr153255 243 233 2830 697 ----
NM_002015chr1353017 2529 1002 905 364 22157 335 32625 2367 358 13254
NM_002025chrX168816 8547 8212 8172 8010 7909 7033 6908 6107 2958 2934 1812 1642 1222 533 157 38096 1795 470 1980 17200
NM_002092chr4104938 4557 4321 4164 4094 4008 3917 3151 1590 319 13096 1973 --
NM_002137chr772386 2230 1700 1508 1496 482 231 1606 --1523
NM_002158chr253750 3535 3447 3246 1012 22920 1278 22495 1329 11433
NM_002210chr253259 2978 2728 1341 208 42920 752 678 425 13329 12745
NM_002270chr5155649 5637 5620 5367 4767 4750 4742 4613 3800 3681 1728 1340 985 340 320 14496 21151 1146 --
NM_002310chr595535 5484 4789 4558 2625 1822 1354 1309 383 25256 2437 11553 16418
NM_002480chr1251461 1454 491 374 357 --21496 1484 11502
NM_002655chr855096 5058 1869 927 181 55066 4958 3758 1045 111 24846 3420 1407
NM_002709chr273579 3379 3170 2719 1146 753 183 22428 1138 ----
NM_002719chr1422362 623 --12374 22172 1792
NM_002731chr172983 2937 2904 2862 2038 1953 1107 12030 11219 12492
NM_002737chr17116665 6399 6187 4849 4431 4351 2004 1756 1351 128 98 16615 15190 --
NM_002886chr3104728 4436 3628 3471 3193 1978 1764 1501 1403 1337 --14221 --
NM_003108chr257097 5717 1993 1672 66 26858 5321 17326 24567 1282
NM_003199chr1865447 5033 4455 4244 1019 409 --11992 11933
NM_003274chr21112992 2431 2248 1890 1174 1033 1021 934 831 496 450 12636 12966 --
NM_003342chr1783234 2841 2769 1027 694 535 250 106 --23194 1150 --
NM_003463chr663294 3151 2306 882 660 244 1376 --12213
NM_003566chr1263268 3146 3057 1389 1160 707 13164 23273 2993 23090 843
NM_003574chr1885577 4989 3968 2304 2149 1579 627 112 1204 23532 1536 15699
NM_003590chr273694 3045 2663 809 756 734 641 --13009 2781 405
NM_003663chr393353 3312 2895 2662 2452 1060 611 80 22 1540 165 12701
NM_003759chr4104236 3815 3766 3466 3114 3018 1286 1225 723 141 33742 1690 1295 1989 1995
NM_003822chr153015 2035 1950 261 202 1333 --12044
NM_003887chr251982 1862 1433 543 95 11493 --12228
NM_003966chr567391 7290 5758 5352 2427 365 --37830 7777 243 17762
NM_004136chr1572754 2459 2391 2166 1272 435 305 --23303 658 23258 3216
NM_004171chr1179297 8829 8126 3720 2113 1025 225 59654 8069 8015 6692 6660 29327 7969 --
NM_004232chr1853108 1164 1155 869 718 12468 --23865 3256
NM_004338chr1895939 5680 1839 1333 663 557 506 418 330 14730 11344 26678 5895
NM_004392chr1362519 2292 2233 2204 1946 546 31674 1041 117 12637 1279
NM_004397chr1184234 3977 3701 3693 3687 3584 2932 1679 22942 987 ----
NM_004432chr9112396 2313 2246 1928 1877 1625 845 576 426 381 358 11815 ----
NM_004505chr1751751 1738 1729 1425 281 --2580 167 11950
NM_004598chr5113194 3147 2911 2663 2519 2073 806 427 201 182 68 12621 ----
NM_004612chr923052 634 1578 44229 4058 939 570 24223 3902
NM_004650chrX61860 1752 1223 606 246 121 21280 495 1100 11836
NM_004815chr1114800 3745 3698 1857 1496 1217 892 646 136 55 38 198 ----
NM_004985chr1264524 4316 4171 3665 1748 311 14281 13472 13804
NM_005056chr12125588 5486 5477 5398 4535 4526 4025 1801 1753 1680 1323 93 --25348 4597 --
NM_005065chr1494666 3909 3866 3667 3629 1605 1503 1323 378 11594 --25306 3957
NM_005151chr1882051 2023 1972 1849 936 647 581 196 11581 2621 486 --
NM_005156chr9125372 4491 4456 4274 4264 4209 3925 3854 1314 1119 552 162 25315 5111 --11577
NM_005160chr2286615 6577 6522 6105 5355 2253 1390 860 25653 5207 1966 15348
NM_005311chr782801 2371 2309 2144 2116 2038 439 384 --1426 --
NM_005497chr17104865 4668 2282 1502 1445 1043 652 348 297 237 --15841 --
NM_005504chr12176652 6522 6212 6185 5680 5514 5345 4151 4129 2239 2213 2194 1151 691 631 373 79 --56548 5595 1652 1573 936 --
NM_005639chr1231533 326 320 2313 277 1263 --
NM_005668chr5124620 4349 4333 4083 3907 3786 3767 3330 3291 2841 1144 829 44579 4395 3811 3019 11528 23558 3542
NM_005746chr792706 2037 702 549 542 365 72 52 26 --11041 1388
NM_005751chr7179 2439 169 --2184 126
NM_005779chr543567 3341 2836 814 12712 23509 1367 12698
NM_005901chr18168603 8181 8099 6792 6669 6501 3444 3235 2772 2730 2717 2495 1691 1236 468 343 37434 2296 910 164 --
NM_005903chr5135172 5093 5068 4975 4951 4912 4539 1160 950 207 172 144 128 14645 13224 --
NM_005966chr282340 1759 1753 1677 1471 558 414 281 1319 21916 730 12198
NM_006007chr963818 1774 1203 1101 1037 678 13255 33427 3167 1461 --
NM_006037chr274790 4759 4601 4334 3892 3880 1538 --23985 1822 13706
NM_006106chr1183223 2913 2823 2721 2549 1034 846 827 ----13070
NM_006252chr1167114 7037 6983 6949 6855 6784 6168 5953 5262 4688 3011 2415 1605 1396 1369 201 11805 ----
NM_006287chr24490 472 149 127 --1693 22560 2349
NM_006379chr732159 580 165 2499 389 --11991
NM_006393chr1084419 4379 3858 3765 3749 2877 1490 214 --34027 3614 241 --
NM_006538chr264091 4066 2800 2791 2640 382 1280 23847 2706 12865
NM_006561chr10106116 5892 5813 3972 3842 2405 1030 1008 970 669 24053 1179 25062 3899 11315
NM_006599chr1697765 6850 6838 2883 1971 1642 1338 1290 1258 48245 8092 7148 6947 ----
NM_006614chr373614 3596 2332 1378 1096 896 686 11071 --12602
NM_006628chr1584665 4419 4267 3135 1754 492 345 142 31218 853 240 24068 377 --
NM_006629chr1862000 1905 1820 746 713 705 12221 --12602
NM_006654chr1264549 3758 3723 1256 1110 209 34112 3834 924 34014 3770 1398 23913 3750
NM_006738chr1544440 1633 1625 1233 --11619 --
NM_006750chr1688030 7938 7366 7290 4975 2118 1707 386 --25692 543 17262
NM_006785chr1842104 319 279 78 42247 1395 653 96 1335 --
NM_006888chr1483486 2941 2924 2883 2340 1229 843 354 ----13111
NM_006918chr11105844 5800 5709 4581 4304 2251 1038 726 375 244 35895 5016 274 34542 3620 1217 --
NM_006924chr1774342 4121 3393 2889 650 411 280 24245 39 21667 183 1255
NM_007007chr12174823 4706 4211 3903 3827 3606 3547 3258 3105 2924 1793 1759 1640 1095 891 489 413 --14441 --
NM_007038chr21106126 5528 5009 4190 1386 1303 1266 1091 1040 839 --14377 --
NM_007054chr593332 3067 2811 1085 721 236 217 190 111 13943 43957 3927 3909 1139 --
NM_007125chrY51409 1386 1082 474 324 1225 11126 1964
NM_007146chr1772697 2648 2521 2388 703 640 357 --22361 753 32778 2334 1018
NM_007200chr1544440 1633 1625 1233 --11619 --
NM_007231chrX42307 1789 377 74 --32444 1571 773 131
NM_007249chr13109392 9082 9059 8388 8114 7953 7711 2382 1948 1087 29348 6972 23629 3278 --
NM_007345chr1852075 1789 1735 333 316 11591 11979 21955 1598
NM_012082chr82760 661 2651 390 --2298 287
NM_012096chr393478 3295 3089 2888 1098 552 317 295 125 13504 33268 855 841 --
NM_012097chr23806 622 458 22182 33 --3699 470 262
NM_012214chr286348 6170 5656 2541 1099 1039 835 282 13943 46042 5782 1004 166 16203
NM_012287chr384538 4516 4465 4425 3878 3754 3729 3178 33506 3304 1049 23364 3230 --
NM_012330chr1021258 1146 11119 21806 1739 1425
NM_013255chr7118835 8822 7337 7049 6909 5531 3355 2583 1282 1182 582 27105 1673 28352 8010 13054
NM_013943chr162856 2587 2518 2211 1326 652 11128 43303 2360 310 92 --
NM_014048chr16105304 5257 5110 1584 1549 1407 1076 804 786 592 11429 1174 --
NM_014155chr1187315 7217 6930 6766 4909 1824 1193 129 1707 --17293
NM_014243chr462129 1969 1794 1591 422 301 1476 31561 452 259 --
NM_014309chr2285330 5281 4738 4640 4617 3772 2083 219 35045 4387 1844 --15216
NM_014721chr6117276 6969 6915 6903 6201 6130 5160 4849 2721 1189 1166 27007 2274 11334 14842
NM_014739chr683870 3695 3605 3162 1314 1198 270 185 23126 3015 23637 1529 --
NM_014746chr284271 4192 3664 3565 3283 1496 1377 629 14103 24340 854 --
NM_014873chr174687 4672 4184 1718 1663 1372 688 --14598 14432
NM_014877chr17167160 7081 6903 6567 6074 5198 2959 1731 1691 1526 928 651 595 362 294 48 35671 2647 247 ----
NM_014897chr1743050 2848 2633 672 2588 532 21113 414 13172
NM_014904chr1083807 3409 3077 3046 2460 1627 972 124 23939 501 --33998 3982 2879
NM_014906chr1784045 3873 3770 2661 2574 2547 1124 648 ----12677
NM_014912chr1083321 3058 2680 2659 2639 2493 2326 1180 22976 2616 ----
NM_014920chr633473 2882 781 2264 205 --23142 2568
NM_014932chr3--11389 11713 31660 428 163
NM_014936chr6102263 2160 1083 991 798 788 493 310 151 74 22616 440 ----
NM_014946chr262627 2593 1251 1212 802 610 21175 314 1320 --
NM_014991chr483091 2976 2837 2055 1087 829 424 388 ----13203
NM_015000chr1242711 2631 1062 1055 12567 --12960
NM_015026chr12124830 4609 4415 4073 3996 3845 3672 3481 3177 1725 821 499 13805 --22983 1565
NM_015032chr1372201 2109 2027 1067 633 421 415 32319 525 305 11808 1884
NM_015040chr253244 2879 2835 2425 427 12604 --13314
NM_015076chr693982 2907 1454 1430 1267 1091 940 232 146 24245 3891 --11532
NM_015097chr352383 1715 819 528 143 --12138 21567 323
NM_015208chr18113458 2549 2534 1259 1244 1075 985 768 660 535 470 ------
NM_015230chr431461 1442 499 1408 2226 45 1338
NM_015310chr8108049 7846 7760 7672 5902 5686 5174 1026 958 373 28135 5242 --28243 136
NM_015314chr792601 2500 2467 2333 1705 1631 671 453 105 12482 12243 11662
NM_015317chr282861 2181 1796 1122 827 713 534 57 32795 1821 165 22840 1021 1690
NM_015455chr553880 3675 2901 1085 1061 13794 23479 520 1459
NM_015560chr372814 2577 2380 2045 1809 584 217 22897 733 21157 466 1434
NM_015569chr1114824 4538 4205 4063 3960 3508 3441 3277 1470 1333 222 24226 244 23231 1589 11699
NM_015640chr1135194 5160 5030 4946 4875 3611 3327 2077 2038 1209 363 279 205 34902 4503 3859 ----
NM_015678chr13101657 1473 1361 1160 614 516 330 285 166 142 21218 486 11255 --
NM_015886chr845484 5426 3503 1020 21615 135 25744 1306 1233
NM_015906chr1104784 4775 4036 3825 3752 3280 3178 2927 1508 755 11812 24072 313 --
NM_016009chr174130 3888 1947 1629 1502 346 41 1835 23869 1780 1873
NM_016096chr862164 2049 1766 571 487 251 11510 --1276
NM_016206chr3149012 8793 8775 7880 7558 6814 6401 6119 5884 2920 2627 2075 1890 471 ----15511
NM_016260chr297328 7143 6987 5190 2794 2732 2547 1830 888 57408 5765 5122 5095 4752 --11447
NM_016271chr1872026 1954 1589 910 608 351 260 --42242 1981 821 527 11436
NM_016275chr342784 2753 2371 137 1587 --31792 1019 657
NM_016374chr181578 1342 1255 1229 1133 1099 1084 360 21165 1047 1226 1483
NM_016374chr181578 1342 1255 1229 1133 1099 1084 360 21165 1047 1226 1483
NM_016513chr633473 2882 781 2264 205 --23142 2568
NM_016651chr1421027 29 2988 89 --21095 971
NM_016950chr41526 1121 2971 542 21248 1170
NM_016953chr276043 5530 4836 4495 2024 1107 473 36016 5642 374 --14792
NM_017447chr2184367 4132 3132 3026 2791 1204 1044 955 13248 34245 3486 1003 --
NM_017599chr1261977 1429 1296 761 639 436 11862 21668 1620 --
NM_017628chr494975 4085 3580 3226 1703 1524 612 561 80 24038 222 1693 --
NM_017637chr9109440 9327 9194 6628 5764 2480 2134 1568 1366 390 26991 927 1567 18196
NM_017644chr385212 5165 5094 5070 4349 3835 1455 583 11559 13584 24599 1291
NM_017650chr754975 3685 2042 1603 282 45729 4932 4770 2289 11805 14861
NM_017658chr1494633 4622 4359 3743 3193 2932 1770 1506 527 24497 683 24594 3245 --
NM_017736chr16113127 3069 2839 2774 1084 794 754 512 396 102 77 ------
NM_017813chr895517 4644 2276 2113 1503 1344 630 507 191 45636 3833 999 385 33902 2231 1215 --
NM_017831chr18114462 4198 3308 3228 2925 1832 1475 1216 1093 888 485 --14062 --
NM_018036chr1494121 4028 3471 2920 1756 1717 643 589 96 64183 4129 3570 1220 660 336 ----
NM_018155chr393256 2554 2309 2176 2156 2103 1248 346 137 32390 1079 552 ----
NM_018181chr1891745 1731 1277 1270 1251 469 459 369 246 21342 201 ----
NM_018225chr985244 5212 4878 2144 1606 1064 1058 560 --15289 --
NM_018351chr1294725 4680 3888 3179 913 879 504 435 349 --12904 182
NM_018361chr864056 3271 3135 1401 695 186 13623 2563 479 1296
NM_018638chr12115686 5157 4664 4543 4453 4318 3991 2093 1652 458 280 15220 34614 4439 1279 --
NM_018640chr1272566 2485 776 372 353 304 255 22572 943 1341 1292
NM_018976chr1262025 1964 1122 948 819 667 22784 2417 22599 1047 12567
NM_018979chr1242540 2396 2114 806 --1817 1849
NM_019072chr533635 1663 64 2297 143 1939 23879 3063
NM_019593chr2063126 2946 2426 959 910 781 1486 11139 11041
NM_020119chr7114019 4001 3828 3558 2880 1408 1226 810 559 424 242 22706 1074 ----
NM_020245chr675089 4962 4544 4521 4354 4257 1312 44952 4440 3861 3440 13965 11353
NM_020337chr492970 2946 2117 465 443 378 220 211 34 --12077 --
NM_020357chr321185 1177 11155 1433 11191
NM_020390chr384915 4776 4486 3780 3363 3147 1431 130 11091 14326 --
NM_020432chr772301 2268 2255 2212 659 604 308 --11902 11548
NM_020648chr1851866 441 109 84 76 --22805 2500 12837
NM_020673chr2077756 7609 6137 5207 1481 887 430 25826 1691 21545 269 26745 1051
NM_020699chr164009 3604 3540 1412 928 374 13644 25239 4016 13549
NM_020718chr1686471 6350 4456 4215 1090 438 288 254 15174 --14379
NM_020727chr2193983 3352 2762 2549 1459 582 572 199 56 --23287 269 --
NM_020734chr1283362 3195 3179 2765 2738 2343 740 448 32751 2671 1306 22779 391 --
NM_020752chr1052697 2651 2053 764 535 ----22597 563
NM_020766chrX44422 3937 3338 588 14374 13580 23513 453
NM_020771chr621388 550 --31135 625 289 1445
NM_020772chr17117389 7212 6759 6650 5330 3399 3225 2131 1910 1497 1334 57799 6104 2937 2255 1308 11825 1871
NM_020774chr1866158 5330 5168 4291 4119 2159 --45979 5202 1961 181 --
NM_020940chr1062849 2552 2338 2169 2018 395 21974 175 22563 776 --
NM_021072chr581984 1052 945 859 842 756 712 273 --2920 512 --
NM_021148chr752106 2088 1834 346 330 ----2140 53
NM_021183chrX31805 544 345 --32052 1619 850 1871
NM_021629chr385009 4496 4184 3997 1950 1655 992 256 2358 283 1321 13880
NM_021911chr575652 4772 4004 1797 1559 772 53 14519 11284 11388
NM_021961chr11197470 7371 7232 7115 6941 6876 6263 6190 5945 5374 5247 5241 4925 2833 1111 892 336 220 195 --1782 15572
NM_021964chr3136512 6387 5855 5638 4967 4863 4618 4232 2592 1990 998 749 320 15143 31981 887 346 --
NM_022894chr251263 617 445 392 367 1542 --1403
NM_024665chr374438 4312 4195 3745 3631 967 418 12883 24678 3149 14515
NM_024770chr286033 5045 4569 1880 1595 972 878 108 25169 1318 15843 --
NM_024930chr572443 2407 1839 1050 995 640 110 2783 86 --1827
NM_024947chr3159608 9597 9510 9364 9249 8766 8222 7939 7471 6896 3419 2908 2316 1372 98 58595 6985 2991 1846 1742 39124 1671 538 --
NM_024953chr1252565 2356 2327 2110 1756 12584 --22193 181
NM_025054chr893783 3529 3056 2638 1668 1420 652 374 38 13823 2679 462 --
NM_030627chr5103997 3918 3868 3648 3374 3013 2955 1161 1050 173 --23669 2842 --
NM_030647chr766172 2261 1739 1214 835 97 25908 1182 16225 16305
NM_031243chr772386 2230 1700 1508 1496 482 231 1606 --1523
NM_031296chr462330 2024 1760 954 146 139 ------
NM_031371chr181578 1342 1255 1229 1133 1099 1084 360 21165 1047 1226 1483
NM_031371chr181578 1342 1255 1229 1133 1099 1084 360 21165 1047 1226 1483
NM_031483chr2042951 2628 2554 476 23378 2336 12176 13426
NM_032012chr9105092 4981 4714 4646 4266 3340 3224 1186 883 183 --24560 1226 --
NM_032121chrX112788 2555 2446 2368 2118 2112 2095 812 462 283 97 189 ----
NM_032288chr332275 2155 728 ----32098 1908 1474
NM_032373chr10115843 5594 5494 5319 1560 1013 918 598 514 452 224 13783 --1829
NM_032828chr19104940 4432 4369 4169 3724 3582 3450 3153 1366 304 11068 ----
NM_032968chrX104216 4070 3977 2977 2957 2790 1414 1388 871 567 23179 627 34175 3109 342 13259
NM_032969chrX104216 4070 3977 2977 2957 2790 1414 1388 871 567 23179 627 34175 3109 342 13259
NM_032973chrY84208 4062 2972 2952 2785 1414 871 567 23174 627 34167 3104 342 13254
NM_033020chr1104784 4775 4036 3825 3752 3280 3178 2927 1508 755 11812 24072 313 --
NM_033224chr777459 6485 6067 3108 2975 1800 1639 12379 38078 2079 1259 11873
NM_033285chr874151 4095 4007 3055 1073 685 360 13828 14409 23865 2842
NM_033360chr1254645 4437 4292 3786 432 14402 13593 13925
NM_033430chr4104128 3871 3658 3583 3259 3114 1075 881 576 350 33592 2562 190 21678 502 --
NM_033437chr4104128 3871 3658 3583 3259 3114 1075 881 576 350 33592 2562 190 21678 502 --
NM_033505chr2136747 6301 6022 5680 5247 4966 4406 2413 2044 1567 1142 769 668 22295 1731 12555 --
NM_033656chr21125989 5975 5364 5330 5311 3924 3741 3688 1781 970 811 753 --21497 1382 --
NM_052879chr12134068 4062 3034 2631 2571 2547 1602 1580 1440 1364 693 679 489 --1940 --
NM_052885chr1284248 4104 4073 3951 3793 1146 944 280 11293 --14843
NM_080759chr1362519 2292 2233 2204 1946 546 31674 1041 117 12637 1279
NM_080760chr1362519 2292 2233 2204 1946 546 31674 1041 117 12637 1279
NM_130831chr372814 2577 2380 2045 1809 584 217 22897 733 21157 466 1434
NM_130832chr372814 2577 2380 2045 1809 584 217 22897 733 21157 466 1434
NM_130833chr372814 2577 2380 2045 1809 584 217 22897 733 21157 466 1434
NM_130834chr372814 2577 2380 2045 1809 584 217 22897 733 21157 466 1434
NM_130835chr372814 2577 2380 2045 1809 584 217 22897 733 21157 466 1434
NM_130836chr372814 2577 2380 2045 1809 584 217 22897 733 21157 466 1434
NM_130837chr372814 2577 2380 2045 1809 584 217 22897 733 21157 466 1434
NM_133334chr4126211 5925 4687 4505 4351 4045 2244 2213 1157 925 604 474 15103 15401 --
NM_138270chrX42871 2311 1179 1043 22893 2341 32656 2519 584 22321 650
NM_138286chr19124022 3352 3202 3120 2696 1409 1278 1106 753 379 363 50 1715 1846 --
NM_138423chr1552038 580 327 102 80 --2184 94 2861 607
NM_138473chr1275059 4594 3454 2061 1827 1376 987 23360 1030 23476 3387 --
NM_138621chr264091 4066 2800 2791 2640 382 1280 23847 2706 12865
NM_138713chr1697765 6850 6838 2883 1971 1642 1338 1290 1258 48245 8092 7148 6947 ----
NM_138714chr1697765 6850 6838 2883 1971 1642 1338 1290 1258 48245 8092 7148 6947 ----
NM_138771chr72464 289 21038 277 11328 1596
NM_139182chr431461 1442 499 1408 2226 45 1338
NM_144571chr496526 6455 5310 4395 2408 1879 1534 1354 55 36398 2432 2285 22578 254 25093 2318
NM_144578chr14125122 4724 4713 4610 4590 4423 4342 4007 3988 1486 1284 1034 24873 3487 ----
NM_144599chr15104879 4543 4161 4136 2122 1253 1019 997 845 444 15340 1862 14244
NM_144664chr1162615 2351 872 614 260 165 1770 21029 462 12243
NM_144767chr1544440 1633 1625 1233 --11619 --
NM_147171chr7179 2439 169 --2184 126
NM_147185chr7179 2439 169 --2184 126
NM_152409chr563495 2914 2690 1131 498 42 22577 659 22377 197 12563
NM_152624chr597072 5994 5865 5507 2930 2886 2688 1365 281 1843 27423 1667 --
NM_152636chr1162997 2661 2225 1219 819 773 12046 22958 1155 11946
NM_152754chr783845 3740 3318 2837 2752 1388 1382 251 164 ----
NM_152756chr554011 3966 3265 2653 1011 54288 4211 1372 1245 1188 1257 14147
NM_152999chr784832 4615 4482 4213 3826 3209 958 214 35016 3442 1207 2682 547 --
NM_153188chr5155649 5637 5620 5367 4767 4750 4742 4613 3800 3681 1728 1340 985 340 320 14496 21151 1146 --
NM_153207chr1253284 1440 1206 588 547 12838 33337 1048 893 --
NM_153240chr351240 166 140 131 93 11180 --1915
NM_153607chr5113145 3023 2999 2890 2077 1281 1194 643 608 322 58 1448 --1796
NM_170606chr751555 1446 1399 659 622 11617 --11660
NM_170665chr1274468 4227 4208 3975 947 765 614 1295 33551 1006 403 11164
NM_172071chr1167432 7262 7253 6649 6572 6562 5781 5690 5420 5184 5087 2877 2783 2476 2108 380 36539 5949 414 1352 --
NM_173214chr1697765 6850 6838 2883 1971 1642 1338 1290 1258 48245 8092 7148 6947 ----
NM_173468chr4106005 5890 5479 5468 5363 5354 4620 1851 487 341 15296 21969 277 24675 4357
NM_173531chr19102606 2501 2372 1425 615 587 571 560 400 288 1934 ----
NM_173582chr1186273 6166 6078 4264 2261 481 401 78 12307 22035 922 1351
NM_173642chr199025 8067 7820 7197 5850 1909 1822 1427 955 33162 3106 926 16927 --
NM_175624chr12107410 7401 6090 4840 4834 3055 2192 1410 1297 914 --47045 6218 1335 1213 27785 7299
NM_175625chr12107410 7401 6090 4840 4834 3055 2192 1410 1297 914 --47045 6218 1335 1213 27785 7299
NM_175854chr1342741 2647 2622 1907 1285 21878 812 1346
NM_177974chr1552038 580 327 102 80 --2184 94 2861 607
NM_177985chr23806 622 458 22182 33 --3699 470 262
NM_178151chrX147513 7209 7161 7027 6912 6853 6425 2940 2554 1545 593 386 143 52 26632 5506 12635 --
NM_178152chrX147513 7209 7161 7027 6912 6853 6425 2940 2554 1545 593 386 143 52 26632 5506 12635 --
NM_178153chrX147513 7209 7161 7027 6912 6853 6425 2940 2554 1545 593 386 143 52 26632 5506 12635 --
NM_178585chr483091 2976 2837 2055 1087 829 424 388 ----13203
NM_178586chr1422362 623 --12374 22172 1792
NM_181358chr1114213 3042 2806 2710 2673 2611 1624 1111 405 398 189 22752 1077 23949 1420 24155 1360
NM_181481chr1895939 5680 1839 1333 663 557 506 418 330 14730 11344 26678 5895
NM_181482chr1895939 5680 1839 1333 663 557 506 418 330 14730 11344 26678 5895
NM_181483chr1895939 5680 1839 1333 663 557 506 418 330 14730 11344 26678 5895
NM_181521chr1667215 6728 5128 2297 1340 865 25794 5693 47263 5935 4617 1176 --
NM_182485chr483660 3437 3275 3128 2698 2675 891 242 22964 2812 12667 --
NM_182493chr1675351 5124 4942 1875 1095 457 440 12019 --14385
NM_182503chr675416 4835 4010 1958 1332 1249 184 35548 4294 499 11575 1488
NM_182515chr19116348 5200 4234 4218 4141 2316 2228 1180 1164 552 176 11499 12272 --
NM_182646chr483660 3437 3275 3128 2698 2675 891 242 22964 2812 12667 --
NM_182920chr361122 512 254 122 114 103 1445 ----
NM_182948chr172983 2937 2904 2862 2038 1953 1107 12030 11219 12492
NM_182972chr162354 2198 956 722 389 338 11945 2646 153 160
NM_194314chr1115635 5496 4442 3961 3927 2198 1787 1720 1451 968 878 --14017 15343
NM_194434chr1885577 4989 3968 2304 2149 1579 627 112 1204 23532 1536 15699
NM_198128chr1872026 1954 1589 910 608 351 260 --42242 1981 821 527 11436
NM_198268chr1114213 3042 2806 2710 2673 2611 1624 1111 405 398 189 22752 1077 23949 1420 24155 1360
NM_198269chr1114213 3042 2806 2710 2673 2611 1624 1111 405 398 189 22752 1077 23949 1420 24155 1360
NM_198468chr664559 4542 4451 2884 1744 328 13835 14062 188
NM_198581chr2137264 7083 6250 6006 5969 5899 5307 2797 2657 2219 1129 743 250 36916 1142 562 55011 1889 1555 1108 825 1609
NM_199188chr12134068 4062 3034 2631 2571 2547 1602 1580 1440 1364 693 679 489 --1940 --
NM_199190chr12134068 4062 3034 2631 2571 2547 1602 1580 1440 1364 693 679 489 --1940 --
NM_199324chr442605 2516 1108 1056 32659 983 643 13431 11038
NM_199436chr262627 2593 1251 1212 802 610 21175 314 1320 --
NM_203406chr532822 2271 1018 22939 547 1879 21814 679
NM_205860chr153015 2035 1950 261 202 1333 --12044
NM_206594chr173180 3157 2459 2452 2361 1162 629 13543 23282 3133 23567 3492
NM_206595chr173180 3157 2459 2452 2361 1162 629 13543 23282 3133 23567 3492
NM_206854chr695358 4146 2072 1859 1775 812 710 450 370 24330 718 25061 3681 2397 129
NM_206855chr6106323 5111 4094 3851 1777 1675 1415 1335 721 695 45295 1683 358 220 36026 4646 428 21362 1094
NM_206876chr273579 3379 3170 2719 1146 753 183 22428 1138 ----
NM_206909chr8108049 7846 7760 7672 5902 5686 5174 1026 958 373 28135 5242 --28243 136
NM_207406chr496254 5790 2534 1533 1469 1009 391 53 22 25462 2551 25285 5194 1905