TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4666a-5p
miRNA Sequence: AUACAUGUCAGAUUGUAUGCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000081chr131811 1401 1203 11728 31781 1431 1225 --
NM_000084chrX96115 5911 5463 5148 4551 2596 1642 883 54 26992 5315 --1961
NM_000109chrX22481 686 ----2983 310
NM_000112chr575330 4770 4591 4091 3758 1357 258 35515 5382 5166 11372 11430
NM_000138chr153823 232 206 12020 2465 259 1578
NM_000168chr733006 365 95 --1452 23163 3074
NM_000189chr262341 1998 1461 895 881 692 ----1847
NM_000216chrX103633 3470 2647 1504 1266 1244 1117 897 769 269 13944 42890 2493 1301 1289 --
NM_000217chr12115243 5194 4701 4480 4472 4426 4284 1482 1097 1055 867 35031 4707 1353 --23921 482
NM_000259chr1595810 5784 4303 4247 2544 2167 2099 1772 796 15429 --1524
NM_000267chr1743469 3107 2961 221 --11166 1235
NM_000297chr441790 1777 1709 828 --11715 11733
NM_000314chr1072869 2700 2611 1035 890 489 216 ----12210
NM_000393chr262070 1854 1687 1513 532 409 --21999 1383 --
NM_000430chr1711385 52342 634 525 439 107 --33327 2395 1098
NM_000555chrX77728 6674 6646 5880 5683 1682 149 --26315 2323 17262
NM_000627chr2----1853 2728 232
NM_000633chr1854379 4276 3570 3428 2027 --11223 11480
NM_000793chr1495025 3852 3549 3496 996 985 546 476 272 --24376 1207 --
NM_000810chr154606 479 119 88 --1132 1165
NM_000813chr5115068 4455 4365 3955 3778 3508 3479 3429 1625 1597 1391 15583 13422 24066 3924
NM_000814chr1563963 3369 802 226 197 139 13679 21032 174 --
NM_000826chr482628 2531 2262 1776 1033 514 287 77 22387 2230 --1703
NM_000829chr1141509 1425 546 163 ----1512
NM_000831chr164599 2498 2374 2119 1943 1835 32354 1888 1750 22363 2249 22196 2145
NM_000899chr1284089 2979 1398 1187 1176 558 325 311 1897 ----
NM_000926chr11148730 8663 7758 7140 6011 3302 2994 2606 1617 1205 1080 593 379 293 18767 --1358
NM_000945chr221773 1583 --2363 347 21695 324
NM_000950chrX83528 3431 3298 2228 807 465 293 271 12487 --2318 259
NM_000956chr143995 803 438 21040 176 --1418
NM_000959chr163629 3474 2882 1555 114 50 12997 22961 2557 --
NM_001001323chr1262954 2755 2697 2509 1958 1279 ----13076
NM_001001396chr184317 4302 4024 4005 2828 1544 1153 707 --23991 1610 --
NM_001001484chr1062229 2221 2205 2056 903 836 11783 12160 --
NM_001001974chr1052362 2318 2293 2220 2009 ----1820
NM_001002860chr1483982 3944 3235 1714 1420 1335 417 141 14669 --14204
NM_001003407chr1084748 4728 3390 1996 1212 1172 1055 264 ----1242
NM_001003408chr1084748 4728 3390 1996 1212 1172 1055 264 ----1242
NM_001003652chr1838566 7716 7439 22202 1713 11700 17899
NM_001003712chr1243867 1312 1297 297 33660 3413 2612 42496 1623 686 276 42573 1630 1057 399
NM_001003760chr6103628 3305 2699 2452 2437 1279 535 299 138 126 23260 375 13111 13086
NM_001004317chr684495 4220 3771 3732 2856 2775 230 224 1394 11669 --
NM_001005473chr566360 4376 4028 1938 1803 1553 --35104 5053 1967 --
NM_001007023chr1495025 3852 3549 3496 996 985 546 476 272 --24376 1207 --
NM_001008707chr1441785 1757 1380 1352 ----11876
NM_001008925chr493510 3262 3068 2477 2256 1291 1242 992 258 1846 ----
NM_001009554chr443690 3014 2921 1172 34726 3566 3105 --13245
NM_001009554chr443690 3014 2921 1172 34726 3566 3105 --13245
NM_001009909chr1153298 3284 3113 1409 690 1118 --33614 3356 283
NM_001009960chr762722 2688 2518 430 93 81 12767 32802 2710 783 12790
NM_001009993chr274549 3910 3272 1513 1166 842 295 43426 3369 2788 866 13414 --
NM_001010861chr112580 22421 1031 22436 2428 12333
NM_001010891chr5146840 6460 6043 5594 4255 2642 2409 2381 1642 1288 1015 977 417 305 --46648 6211 2138 1844 22360 1867
NM_001011666chr736420 4976 1055 1697 13982 16395
NM_001012418chr664250 4177 4051 3233 3053 676 --14256 11155
NM_001012751chr1091709 1643 1402 784 474 328 228 174 83 1583 11819 --
NM_001012761chr552399 1952 1744 176 106 --32448 317 95 --
NM_001013031chr10123485 3390 3247 2942 2397 1171 1052 780 631 317 180 158 ------
NM_001013438chr34978 906 658 315 ----1385
NM_001013439chr33824 752 161 ----1231
NM_001013620chr12158470 8344 8319 8052 6527 6117 5509 5149 3270 2522 2232 1645 1153 588 297 17645 15132 35877 2248 156
NM_001015048chr1452847 1183 431 56 45 12582 13214 --
NM_001015049chr1452847 1183 431 56 45 12582 13214 --
NM_001018065chr985703 4137 4042 2353 924 904 738 333 2964 775 45942 4958 4854 696 15092
NM_001018066chr985703 4137 4042 2353 924 904 738 333 2964 775 45942 4958 4854 696 15092
NM_001018067chr155113 4796 4376 1690 474 13741 33263 1865 525 --
NM_001018068chr155113 4796 4376 1690 474 13741 33263 1865 525 --
NM_001018069chr155113 4796 4376 1690 474 13741 33263 1865 525 --
NM_001024948chr143444 2369 934 27 --12665 13388
NM_001024956chr1175823 5732 4703 3727 1642 771 713 45530 4298 1094 549 25519 5328 --
NM_001025108chr294172 4087 3417 2578 2539 1543 608 540 151 14136 23725 3620 --
NM_001025366chr631614 1607 1600 ----11658
NM_001025366chr631614 1607 1600 ----11658
NM_001025367chr631614 1607 1600 ----11658
NM_001025367chr631614 1607 1600 ----11658
NM_001025368chr631614 1607 1600 ----11658
NM_001025368chr631614 1607 1600 ----11658
NM_001025369chr631630 1623 1616 ----11674
NM_001025369chr631630 1623 1616 ----11674
NM_001025370chr631614 1607 1600 ----11658
NM_001025370chr631614 1607 1600 ----11658
NM_001025580chrX93927 3734 3060 2778 2761 1199 963 607 272 --24183 2772 --
NM_001030055chr1463597 1894 1789 1607 768 59 1179 24590 1568 --
NM_001031623chr661252 451 227 205 134 118 --1184 1575
NM_001033045chr224328 821 34385 2966 760 34103 1614 178 --
NM_001033756chr631548 1541 1534 ----11592
NM_001033756chr631548 1541 1534 ----11592
NM_001035260chr1071576 1458 1448 1029 616 267 203 21516 397 11481 --
NM_001037174chr252038 1927 1765 1469 1424 ----1745
NM_001037317chr112580 22421 1031 22436 2428 12333
NM_001037954chr1153485 3412 2260 1007 704 13290 11237 13325
NM_001039547chr385629 4952 4914 2990 1623 1415 1222 549 --17398 --
NM_001039569chr253377 2797 2147 881 35 22706 2111 --1478
NM_001039585chr163886 3731 3139 371 307 157 13254 23218 2814 --
NM_001039618chr1155419 4510 1913 1488 528 --11034 21078 189
NM_001039840chrX85852 5387 4212 4005 3792 2223 2069 1636 24422 3831 --11253
NM_001040001chr631970 1859 1385 1203 --11763
NM_001040142chr23808 455 401 22287 315 4824 796 788 780 1328
NM_001040143chr23808 455 401 22287 315 4824 796 788 780 1328
NM_001040284chr1665580 5373 5231 1767 816 454 22224 1830 15529 --
NM_001040402chr472929 2252 1290 1056 405 281 126 1959 --1604
NM_001040429chr1363565 3101 2656 2404 893 811 12576 --12366
NM_001040441chr163462 1543 1154 1120 1097 30 25518 378 13588 11497
NM_001040712chr952847 2833 1278 929 376 13113 22839 2473 11413
NM_001042355chr1665222 1896 1650 1136 1000 527 13864 21844 1240 --
NM_001042412chr1665222 1896 1650 1136 1000 527 13864 21844 1240 --
NM_001042473chr1061732 1569 695 617 494 304 ----11824
NM_001042481chr1432241 1011 932 12610 22349 1054 1335
NM_001042492chr1743469 3107 2961 221 --11166 1235
NM_001042555chr1231456 678 131 24582 447 --24117 508
NM_001042599chr265820 3005 2857 2833 1626 1297 27676 4845 16631 16595
NM_001042601chr383283 3189 2966 2954 1168 1158 876 598 1439 ----
NM_001042603chr1254275 3855 3265 2048 1427 11596 13644 13840
NM_001050chr172593 584 --1359 21341 340
NM_001083620chr482626 2529 2260 1774 1032 513 286 77 22385 2228 --1702
NM_001100108chr1107638 6960 6786 6031 6013 3302 2976 2236 1744 1391 22795 2671 27250 265 --
NM_001106chr359194 7782 7182 6558 3111 59508 8756 6351 3204 1481 --31883 1876 1865
NM_001113490chrX93496 3369 3279 3265 2920 2818 2398 1232 1062 2511 164 ----
NM_001167chrX126451 2362 1700 1303 1284 1161 935 876 702 676 642 22 36609 2221 1383 1614 --
NM_001173chr1463597 1894 1789 1607 768 59 1179 24590 1568 --
NM_001204chr276551 2419 1857 1508 1381 914 265 27162 6962 26238 2654 --
NM_001241chr242395 1842 516 504 12076 --21897 100
NM_001241chr242395 1842 516 504 12076 --21897 100
NM_001257chr1651433 1111 377 361 304 11147 1964 --
NM_001304chr1712577 23453 278 23460 2560 13828
NM_001310chr1232759 2296 251 2364 355 3867 835 569 --
NM_001315chr672081 890 769 744 601 318 160 1753 11800 12069
NM_001412chrX63371 2664 2297 1302 1078 779 13355 --23304 855
NM_001419chr1943503 1635 645 163 34333 4068 3774 --14653
NM_001491chr652583 2547 2287 2007 1054 --11065 11898
NM_001616chr222738 2541 12770 --21212 1027
NM_001682chr1262668 2469 2411 2223 1118 993 ----12790
NM_001684chr184034 4019 3741 3722 2545 1261 870 424 --23708 1327 --
NM_001709chr1132876 167 114 12733 --12305
NM_001931chr112944 66 11120 1246 1918
NM_001942chr1821513 380 1280 --11898
NM_001981chr131986 1906 643 --12009 12386
NM_002006chr474320 2318 2060 1684 1669 409 299 25775 920 25341 2066 1146
NM_002025chrX99066 8314 8305 8006 7936 3080 2459 2395 1553 13229 12713 --
NM_002040chr2163100 2027 2012 1076 460 192 12563 --12313
NM_002069chr751699 1512 1332 1310 281 --2513 289 --
NM_002092chr484994 4932 4904 4130 4080 1860 797 308 14717 15101 --
NM_002130chr52156 107 21541 114 --21385 379
NM_002203chr523978 687 13759 13776 32545 764 433
NM_002214chr775594 4556 4002 3834 3783 693 590 14707 --1409
NM_002222chr331336 1027 137 2536 452 2307 171 --
NM_002223chr1252875 1504 982 732 719 13820 1813 --
NM_002247chr1051983 1670 952 469 147 --32074 868 132 11909
NM_002270chr575286 2097 1673 1493 1442 518 238 1484 11621 13458
NM_002285chr294172 4087 3417 2578 2539 1543 608 540 151 14136 23725 3620 --
NM_002310chr5126572 5999 4369 4088 4070 2537 1444 1381 364 257 153 127 1884 16267 1310
NM_002313chr1084748 4728 3390 1996 1212 1172 1055 264 ----1242
NM_002356chr662791 2416 2270 1748 780 534 11776 22112 2019 --
NM_002387chr574860 4774 4648 4286 4081 242 76 34465 4417 234 --14922
NM_002397chr542039 1719 1473 93 --1681 1336
NM_002430chr2222594 771 ----22548 2391
NM_002577chr363849 3249 3089 937 497 277 --1699 1573
NM_002594chr2042465 2309 1874 1811 --21863 1848 --
NM_002641chrX12017 ----21750 512
NM_002645chr1172775 2602 2547 957 732 355 237 11994 22148 738 --
NM_002655chr885292 5028 5019 4620 3893 2112 2042 1142 13977 13731 --
NM_002687chr142876 105 --11053 2956 220
NM_002814chrX3586 303 131 ----1712
NM_002837chr1264224 2933 1823 1765 484 109 1659 1210 13460
NM_002839chr952847 2833 1278 929 376 13113 22839 2473 11413
NM_002906chr1152265 1549 593 542 23 11790 ----
NM_002956chr12----11224 21379 1190
NM_002977chr253220 2456 1130 584 284 32202 1105 349 1619 13110
NM_003014chr731177 330 87 178 11358 1974
NM_003034chr1278033 5257 2678 2516 2079 1272 1026 37195 5601 769 47619 1131 1119 984 --
NM_003045chr1374734 4121 3948 3898 3815 999 719 1737 --24010 3964
NM_003048chr232546 2084 835 190 1376 12462
NM_003108chr287128 6583 6209 6167 5942 5775 5152 1311 15408 35021 4989 1286 --
NM_003112chr763103 2813 2546 2449 303 294 11089 1401 --
NM_003133chr141068 995 396 29 190 --1269
NM_003199chr1895252 5196 4543 4164 3888 2184 1744 963 265 11938 11958 25513 3787
NM_003262chr375053 3963 3345 1402 916 398 204 23820 822 25242 3441 11790
NM_003274chr2151178 1090 792 778 397 12939 --22322 826
NM_003291chr133729 158 92 --2672 133 1174
NM_003298chr376061 4883 4122 4017 1544 598 102 14810 44134 4077 4056 1723 --
NM_003342chr1762927 2909 2403 1088 440 303 33253 1058 364 11267 --
NM_003376chr631614 1607 1600 ----11658
NM_003376chr631614 1607 1600 ----11658
NM_003392chr343826 2959 2704 616 12794 --12668
NM_003423chr1932457 699 223 41750 1611 1041 754 12481 21648 1031
NM_003463chr683325 3161 3145 3108 673 608 599 75 11110 1821 13043
NM_003468chr274228 4038 3762 3753 3096 3070 412 12654 33937 254 195 --
NM_003477chr114585 570 301 66 ----1725
NM_003489chr2132904 2862 2180 13372 22707 2492 12357
NM_003507chr221926 1552 11894 12037 11746
NM_003566chr1263466 3293 2369 2326 1015 510 13081 1590 --
NM_003590chr273648 3221 3067 3054 2763 2671 116 --23972 1183 11296
NM_003615chr353333 3296 2932 352 163 --11242 23190 45
NM_003617chr184947 4015 3939 3259 1914 1364 1200 530 23089 856 14991 --
NM_003618chr241328 1296 1201 289 1216 11151 1477
NM_003672chr121757 1511 1390 61898 1805 1777 1767 335 314 --
NM_003677chr1251991 1818 1494 874 162 11878 8238 218 196 170 154 142 120 102 11868
NM_003722chr34841 630 499 308 --1650 22632 535
NM_003772chr1111042 --2235 227 1843
NM_003799chr1864502 3393 856 789 782 181 --21554 479 --
NM_003822chr162496 2439 2359 1022 677 655 1746 11135 --
NM_003825chr1531294 1123 241 --1959 11113
NM_003895chr2121986 1373 11749 21461 496 12091
NM_003909chr842875 2819 1860 63 1666 12924 13041
NM_003913chr664318 4094 3672 3093 1702 632 11219 --13918
NM_003916chrX31432 1121 452 11075 --2425 310
NM_003966chr5127570 6334 6098 5667 5426 5215 4812 2503 2460 1864 1630 1551 37806 1522 1093 37227 3087 3060 --
NM_003994chr1284089 2979 1398 1187 1176 558 325 311 1897 ----
NM_004006chrX22481 686 ----2983 310
NM_004007chrX22481 686 ----2983 310
NM_004009chrX22481 686 ----2983 310
NM_004010chrX22481 686 ----2983 310
NM_004011chrX22481 686 ----2983 310
NM_004012chrX22481 686 ----2983 310
NM_004013chrX22481 686 ----2983 310
NM_004014chrX22481 686 ----2983 310
NM_004015chrX22481 686 ----2983 310
NM_004016chrX22395 600 ----2897 224
NM_004017chrX22481 686 ----2983 310
NM_004018chrX22395 600 ----2897 224
NM_004020chrX22481 686 ----2983 310
NM_004021chrX22395 600 ----2897 224
NM_004022chrX22395 600 ----2897 224
NM_004023chrX22395 600 ----2897 224
NM_004035chr1795039 4834 4722 3802 3509 3193 1367 1039 909 25116 654 14026 --
NM_004087chr331993 1701 1575 11781 1146 1705
NM_004136chr1553263 3073 1135 669 219 1800 22282 688 --
NM_004171chr11159063 8908 8895 8178 8142 7907 6961 2846 2765 2755 2742 2545 2435 1554 1089 17102 37113 3748 2931 19578
NM_004232chr1863877 3807 3641 2965 1071 349 ----11496
NM_004274chr1463211 3065 2769 1079 678 433 12073 33153 2232 858 --
NM_004392chr1362437 2200 894 845 755 727 1953 32009 1730 805 --
NM_004432chr942384 1678 1518 143 --12133 --
NM_004434chr1441785 1757 1380 1352 ----11876
NM_004458chrX32062 1854 1805 12070 32222 970 421 --
NM_004464chr4124338 4330 4238 4112 4073 3921 3906 2906 2754 2685 1503 624 13132 33943 2698 1704 --
NM_004571chr2173395 2993 2806 2436 2296 1069 74 --184 1857
NM_004612chr953821 1892 1242 370 182 11398 34403 4113 3505 11389
NM_004726chrX95606 4889 4480 3964 2201 2161 1430 1070 416 1741 13694 --
NM_004744chr4113959 3743 3704 3677 3058 2745 971 789 516 469 45 31195 1117 39 1809 --
NM_004745chr874574 4414 2774 2352 1731 1504 905 15748 17011 22678 888
NM_004748chr1564125 2739 1563 1163 429 315 ----13902
NM_004857chr1464788 3782 3618 3465 2999 443 --14034 --
NM_004873chr1452847 1183 431 56 45 12582 13214 --
NM_004904chr736420 4976 1055 1697 13982 16395
NM_005065chr142438 269 25349 3421 64491 4308 3828 3391 1801 1698 --
NM_005087chr33824 752 161 ----1231
NM_005121chr1733592 3536 3414 --21228 746 22841 563
NM_005126chr362245 1669 1526 744 82 69 1623 32050 821 810 --
NM_005233chr342487 2461 2360 1615 1603 --12236
NM_005235chr265820 3005 2857 2833 1626 1297 27676 4845 16631 16595
NM_005316chr113834 783 280 --2274 268 --
NM_005358chr1351823 1625 1619 76 61 ----21642 1281
NM_005359chr1854330 1489 1080 471 262 --34129 1263 342 16233
NM_005477chr153638 609 589 --5627 579 560 554 548 --
NM_005477chr153638 609 589 --5627 579 560 554 548 --
NM_005497chr1795995 5029 4687 3992 3791 1755 795 300 198 16091 22080 753 14578
NM_005509chr551561 1310 670 590 579 21847 1370 11858 1538
NM_005596chr9115727 4731 4601 4574 4472 4156 4071 3898 1868 1044 796 16128 ----
NM_005613chr182159 1515 700 627 541 433 346 133 12030 2525 371 --
NM_005665chr171698 1593 1279 1104 994 635 306 11286 188 --
NM_005668chr584038 4030 3965 3758 3535 1819 1604 305 11047 24067 4002 --
NM_005725chr142127 2031 701 211 --22282 2259 1787
NM_005746chr721801 754 31980 188 34 32729 1827 618 12755
NM_005748chr1222994 2540 32105 1117 332 32812 413 378 --
NM_005828chr1754640 4483 1837 1429 81 14368 25094 3822 14427
NM_005840chrX127387 7018 5890 5635 5371 4885 4851 2884 2865 2196 2065 688 17104 45386 4868 2944 423 --
NM_005877chr2272341 2097 1975 845 811 622 559 2927 916 12467 --
NM_005898chr1172566 2491 2405 2204 946 203 61 --1841 1617
NM_005901chr1838566 7716 7439 22202 1713 11700 17899
NM_005935chr475128 5042 4677 4666 1574 1558 1362 14103 14583 12029
NM_006007chr994338 4057 1485 1419 1366 1275 865 317 287 11468 13595 13580
NM_006080chr792995 2895 2872 2830 2631 2385 2296 734 476 22610 2506 ----
NM_006154chr1552641 2285 932 411 405 11878 12184 1699
NM_006203chr5125533 5414 5034 4657 4227 3926 3677 2110 1170 950 418 63 --11642 24016 570
NM_006206chr442817 1043 797 442 1360 32647 2639 1152 12928
NM_006251chr573306 1353 1336 1096 353 339 213 --21299 1232 12823
NM_006267chr221439 229 11483 11833 11684
NM_006298chr672823 2394 2158 2144 2137 639 485 --22358 2152 --
NM_006306chrX95558 5148 2085 1695 1595 555 354 341 329 25020 364 21867 698 --
NM_006333chr21557 ----2134 115
NM_006380chr1763825 2826 1529 410 206 197 2856 368 11317 1398
NM_006393chr1052895 1809 1621 778 772 13920 24411 976 --
NM_006540chr851569 1530 1166 1065 334 ----11241
NM_006544chr1465835 4215 3904 3810 634 273 24201 2238 65921 5748 4791 4777 4757 956 --
NM_006614chr393632 3590 3518 3331 2882 1423 1389 1260 977 23698 3361 ----
NM_006628chr15104604 4413 3713 2992 2940 985 683 201 154 55 11056 ----
NM_006654chr1231456 678 131 24582 447 --24117 508
NM_006717chr972691 2513 2388 1250 1223 413 388 ----12325
NM_006720chr1084748 4728 3390 1996 1212 1172 1055 264 ----1242
NM_006729chrX43458 1426 1114 1097 11810 22003 1413 15639
NM_006750chr1657963 6148 5380 2564 1889 --22848 2606 12326
NM_006754chr731188 50 34 --2452 310 1196
NM_006775chr633125 2702 1234 12604 32805 2662 2569 22741 875
NM_006827chr1452819 2454 1188 950 654 1702 22078 689 --
NM_006852chr1752821 2188 2177 1798 302 --22152 1767 11930
NM_006873chr243329 1370 1223 184 13152 --22914 45
NM_006902chr132949 2915 2429 --146 23282 2711
NM_006914chr94610 489 467 430 21083 473 ----
NM_006915chrX22443 467 ----12536
NM_006918chr1175823 5732 4703 3727 1642 771 713 45530 4298 1094 549 25519 5328 --
NM_006922chr242427 2238 944 62 1917 22584 998 --
NM_007034chr1--1877 31013 867 408 3690 402 256
NM_007038chr2175607 5227 5103 4699 4548 4108 1929 21704 1615 --11332
NM_007054chr573960 3917 3527 3063 1503 795 602 11527 ----
NM_007124chr681955 1938 1792 1385 1335 1285 545 502 ------
NM_007175chr853029 2464 938 525 446 ----23501 2639
NM_007276chr73968 370 117 ----2858 426
NM_007292chr1795039 4834 4722 3802 3509 3193 1367 1039 909 25116 654 14026 --
NM_007350chr1264582 4516 4057 3758 1568 758 --21850 1842 13562
NM_007358chr151778 762 613 583 359 --2604 150 11390
NM_012097chr252038 1927 1765 1469 1424 ----1745
NM_012158chr1341843 732 723 300 ----1130
NM_012177chr63599 587 575 ----1552
NM_012214chr256387 4580 4455 4005 62 15356 --1868
NM_012224chr421190 1144 ----11088
NM_012234chr373671 2697 882 659 452 308 201 53203 2767 2361 1372 867 ----
NM_012252chr775111 4906 4260 1885 807 479 79 12096 13595 --
NM_012257chr73782 326 245 ----1369
NM_012287chr384413 4275 3200 1088 881 623 425 379 24508 1814 14335 11600
NM_012382chr544419 1525 512 112 --23841 2951 1264
NM_012399chr2241535 230 205 181 --2271 192 --
NM_012420chr10------32205 1485 616
NM_012434chr611612 153 --21571 198
NM_012479chr752741 2570 2299 438 378 ----1618
NM_013255chr7147940 7270 6839 6569 6425 6366 3114 2765 2367 2353 2098 1448 1278 1201 28840 472 12393 --
NM_013261chr453499 1115 322 305 238 1894 23694 2722 1374
NM_013283chr51707 1788 4934 774 640 604 1904
NM_013381chr1241945 418 304 116 11971 4733 706 685 679 --
NM_013943chr183248 2881 2841 2203 1266 785 669 436 --23079 530 --
NM_013989chr1495025 3852 3549 3496 996 985 546 476 272 --24376 1207 --
NM_014016chr311697 11155 11234 11458
NM_014021chr163362 2806 1140 1078 484 460 23274 2360 2768 194 --
NM_014043chr331544 1294 41 --21605 86 11372
NM_014048chr1685211 4866 4405 4287 1702 1258 789 109 24796 3221 35175 3783 898 11615
NM_014112chr855434 5412 4584 4421 1325 --54841 3720 1091 747 268 --
NM_014141chr775279 4719 4688 4681 2029 1140 750 15252 24900 855 --
NM_014155chr1137000 4610 1091 1963 37351 7284 2988 22628 2129
NM_014253chrX32196 964 300 1778 11887 1100
NM_014319chr1231599 1325 538 21798 93 3691 582 557 --
NM_014331chr4127664 6859 6542 6414 5638 5045 2801 2720 2187 1654 310 185 27492 2675 27746 5230 --
NM_014350chr53394 364 237 --2400 352 1786
NM_014388chr176079 5380 5357 3814 1161 438 159 --33909 1355 1339 12339
NM_014415chr321139 608 ----21693 1320
NM_014423chr574635 4378 4179 3571 2089 856 130 24489 4394 45439 4141 3532 646 --
NM_014504chr732101 633 496 ----2456 440
NM_014584chr1431531 1512 180 1320 --1330
NM_014607chr231783 1661 1458 22095 714 --22135 1583
NM_014660chr71330 ----21117 1102
NM_014670chr231237 546 64 ----21442 493
NM_014682chr861817 1500 1459 906 233 74 ----1285
NM_014701chr1543129 2724 2183 782 32597 1339 1313 43064 2922 1169 1068 1833
NM_014717chr192219 115 2727 86 --1635
NM_014721chr656936 5996 4845 4736 4506 17280 27094 6896 37437 7297 1401
NM_014735chrX31603 1578 86 1399 21584 310 11880
NM_014743chr473041 2825 2746 2092 530 263 41 --13133 --
NM_014755chr274068 4024 3880 2591 1520 715 335 --44203 3127 1392 922 --
NM_014820chr351956 695 391 362 228 --11264 12075
NM_014873chr164693 4683 4094 1918 1067 213 --22993 75 14478
NM_014877chr17147069 6415 5805 5456 5014 2311 2283 1802 1317 876 580 260 220 117 14992 47151 6488 2817 2806 --
NM_014893chrY52275 2002 905 836 223 ----1786
NM_014898chr1922105 143 --12440 1959
NM_014901chr532166 2032 1552 --21965 820 11978
NM_014904chr1053503 3382 3373 2565 492 24008 3972 33770 535 468 12894
NM_014912chr1053459 2723 2451 867 297 23518 668 13094 --
NM_014934chr13103770 3608 2889 1509 1453 1413 739 393 348 245 1205 53442 2803 1369 915 880 13417
NM_014947chr182914 2795 2776 800 622 355 223 196 12697 1368 --
NM_014953chr1344230 1467 1455 1434 14190 --11370
NM_014991chr462804 2692 2674 560 417 115 43144 2528 2066 945 12560 --
NM_015000chr12--22906 937 12766 1769
NM_015026chr1284781 4263 3180 1855 1742 1112 644 297 1742 14172 --
NM_015032chr1342409 1986 1086 233 --12523 12701
NM_015040chr273358 3214 2593 2368 381 256 75 ------
NM_015049chr23862 522 491 12794 21035 68 1949
NM_015076chr6114213 4207 3978 3469 1165 1158 1122 901 775 221 56 --14034 --
NM_015115chr472929 2252 1290 1056 405 281 126 1959 --1604
NM_015132chr741830 1657 1650 757 11945 11959 11966
NM_015149chr152221 1935 1389 782 290 11597 41975 1841 1405 276 --
NM_015192chr2082651 2476 2271 1008 851 222 186 179 22616 1033 21072 1016 1985
NM_015205chr1364755 4494 3543 3383 3366 3246 14927 93827 3756 3680 3436 3402 3279 3229 3187 511 33708 3602 3573
NM_015208chr1852605 1572 1240 249 132 --33093 2960 597 11034
NM_015247chr1665222 1896 1650 1136 1000 527 13864 21844 1240 --
NM_015265chr242412 1901 702 525 12603 2416 410 --
NM_015271chr4104295 4064 4056 3973 1687 1122 1069 853 835 272 1991 1913 1324
NM_015275chr1231657 525 319 21384 579 21919 1358 11685
NM_015285chr18102559 2384 1838 1658 947 936 836 627 517 439 --22373 1687 --
NM_015310chr8167831 6286 6211 5939 5571 5234 2930 2172 2153 1921 914 800 546 441 318 265 18343 38382 8207 6305 18396
NM_015349chr642502 2234 2164 895 12395 22453 872 1881
NM_015355chr174710 434 282 92 --21873 184 11631
NM_015365chrX93927 3734 3060 2778 2761 1199 963 607 272 --24183 2772 --
NM_015394chr1252463 2413 2136 598 420 12346 32376 2256 2153 --
NM_015436chr493329 3081 2887 2296 2075 1110 1061 811 77 1665 ----
NM_015464chr73842 795 403 --11027 2808 694
NM_015554chr1532826 2730 95 12311 22713 448 1600
NM_015555chr661252 451 227 205 134 118 --1184 1575
NM_015564chr543343 852 516 403 1262 --13188
NM_015569chr154553 3289 3102 218 93 --74815 4559 3377 3297 3269 3263 1300 24233 4184
NM_015570chr741810 383 211 176 21750 396 21669 1419 --
NM_015571chr652077 2041 245 178 154 11937 --1975
NM_015633chr122802 447 --1108 11109
NM_015640chr155113 4796 4376 1690 474 13741 33263 1865 525 --
NM_015852chr733455 3438 2905 22830 2555 --12545
NM_015886chr885528 4912 4443 1490 402 346 157 51 --54490 1901 1591 415 362 1238
NM_015888chr122809 1122 13093 11234 12404
NM_015906chr164431 4314 4005 3709 3615 3386 23216 776 --13396
NM_016040chr11695 12526 22796 2061 12688
NM_016073chr153284 132 51 ----11157
NM_016075chr1392945 2563 2500 1986 1030 989 480 347 47 12980 12857 --
NM_016076chr142469 1270 1129 1006 --33031 822 783 --
NM_016081chr4--1282 21850 1729 1671
NM_016087chr751430 1176 1159 557 189 11372 --1657
NM_016132chr1523266 2651 22468 743 12225 23013 377
NM_016133chr271487 1330 1294 1138 1078 1070 675 --1247 11693
NM_016205chr431301 502 290 --1923 1484
NM_016206chr3128673 8304 7953 7721 6593 6562 6348 6302 3618 2859 1763 1702 58001 7917 7305 5873 1534 25784 719 --
NM_016217chr673669 3114 1295 933 671 641 414 --13192 --
NM_016248chr1353855 3083 2938 2674 936 --32780 252 224 --
NM_016260chr2147415 7392 7371 7360 6816 6171 5114 2694 2388 2297 2143 1784 1524 779 35910 5847 4964 26750 913 17120
NM_016315chr281881 1730 1506 479 447 422 92 52 21867 1649 ----
NM_016374chr141355 1290 588 326 11569 1349 1499
NM_016374chr141355 1290 588 326 11569 1349 1499
NM_016530chr1544018 3946 3065 1622 12708 1387 1907
NM_016531chr444143 3369 2664 332 13792 43009 3003 1324 91 1300
NM_016587chr73968 370 117 ----2858 426
NM_016620chr131302 481 411 21361 1093 11079 1262
NM_016631chr211810 ----21012 68
NM_017420chr14133752 3700 3555 3242 3218 3060 2775 2674 2415 1494 963 733 700 13509 --11268
NM_017594chr983216 2334 1142 1128 1085 656 100 85 1358 42886 2632 998 324 13133
NM_017626chr1031802 1716 475 --1481 1502
NM_017628chr474933 4765 4560 4463 4041 3709 142 1641 --15161
NM_017633chr673869 3256 3066 2915 2857 1034 157 --32832 1075 1012 --
NM_017637chr9149224 9021 8632 8348 8161 7878 7409 6624 3605 2100 1696 125 82 50 13548 22729 1480 --
NM_017644chr395118 4824 4615 3613 3410 2049 621 354 338 14759 1379 11594
NM_017650chr775790 5011 4791 4114 3681 1358 410 11328 25891 5556 14584
NM_017658chr1484188 3908 2949 2864 1704 1440 1189 1000 11800 64520 4501 4014 3733 3377 306 --
NM_017742chr1821912 1212 --1216 2599 228
NM_017848chrX33549 3469 1033 14081 14442 11007
NM_017938chrX31940 1843 755 1329 12023 1709
NM_018105chr831135 1029 839 --1465 1482
NM_018120chr811175 1328 31519 1345 288 11211
NM_018126chr44981 558 392 159 31546 1309 306 ----
NM_018133chr361631 1388 757 536 196 139 12098 11789 --
NM_018155chr353386 3172 2344 2219 718 23362 2675 --1111
NM_018181chr1852004 1960 1768 1293 240 ----11460
NM_018184chr361949 1617 1401 488 246 134 31943 1914 535 --1500
NM_018225chr964556 3369 1989 1780 961 36 23418 61 --35222 1187 883
NM_018243chr433902 3688 68 23854 758 23203 1405 13893
NM_018247chr671158 1003 532 489 372 365 32 1296 11179 2841 733
NM_018364chr133772 3758 3694 23789 209 21624 1618 --
NM_018374chr785056 5029 4640 4046 3673 1934 970 549 15136 11317 --
NM_018403chr384099 4062 3887 3843 3830 3124 3105 701 11144 12752 11081
NM_018429chr572810 2561 2210 847 610 469 321 32915 2594 1933 1823 --
NM_018444chr832315 2184 1771 1837 --12123
NM_018555chr1912195 --32235 658 617 11554
NM_018557chr221422 1413 11562 --1594
NM_018569chr441275 1199 1049 577 --1564 11369
NM_018638chr1255062 3894 1420 1091 659 15501 1918 11075
NM_018662chr1--24237 1762 --24178 3573
NM_018958chr153374 366 115 --12523 12749
NM_018999chr1054702 4130 3181 1542 323 11280 11418 1450
NM_019022chr1862591 1036 872 483 267 101 1980 22700 352 --
NM_019050chr432018 441 237 32253 2114 807 1226 --
NM_020122chr2105868 5128 5013 5003 4695 2158 1566 1449 941 824 12224 11999 --
NM_020198chr1741276 1061 574 532 --1641 11347
NM_020199chr541167 1125 1058 429 129 --11052
NM_020297chr1273483 2256 2250 1434 706 433 180 11122 126 21412 253
NM_020338chr1093647 3568 3495 3047 3016 2869 2855 2750 1245 13207 33613 3266 1233 13028
NM_020390chr354594 4160 3106 3078 210 24173 542 33087 1551 182 14063
NM_020473chrX12017 ----21750 512
NM_020673chr2062739 2342 2044 747 647 563 77541 7157 2453 1858 932 320 198 36887 2310 1786 26525 880
NM_020734chr12112972 2715 2494 2427 2329 2283 2254 1117 1093 726 630 --21312 913 --
NM_020739chr1564125 2739 1563 1163 429 315 ----13902
NM_020748chr1732074 672 213 --1842 21680 263
NM_020771chr621470 980 31536 412 330 --11163
NM_020772chr17137911 7777 7192 6487 6454 5382 3132 2990 2682 2031 1931 1450 593 16077 28066 7696 15519
NM_020774chr1886072 4886 4167 3980 2328 1845 1706 551 1223 34827 4504 1211 --
NM_020783chr1872278 1814 1774 1576 785 488 329 ----22222 686
NM_020800chr371490 1322 1206 920 261 227 68 ------
NM_020802chr1141117 1100 363 36 23380 2149 23331 1012 194
NM_020841chr1243867 1312 1297 297 33660 3413 2612 42496 1623 686 276 42573 1630 1057 399
NM_020844chr855432 5401 4775 2678 997 1481 57441 7223 6984 6939 304 1618
NM_020871chrX21753 701 ----21712 579
NM_020872chr341797 1645 1191 83 1491 21170 305 11605
NM_020940chr1052842 2823 1077 1049 693 12480 52584 2576 1980 1097 799 --
NM_020948chr153578 3517 2848 739 701 13304 --1590
NM_020951chr1952034 738 712 253 137 22272 2108 1829 12144
NM_020962chr1532486 254 71 --2242 83 3230 202 195
NM_021007chr23808 455 401 22287 315 4824 796 788 780 1328
NM_021038chr383298 2824 2618 2416 1257 970 380 147 13257 ----
NM_021111chr941299 1094 932 108 3862 530 521 11220 --
NM_021183chrX52318 2276 654 532 134 11656 1742 1942
NM_021252chr1041583 1342 304 211 1272 41839 1532 1445 669 --
NM_021622chr1052362 2318 2293 2220 2009 ----1820
NM_021647chr443690 3014 2921 1172 34726 3566 3105 --13245
NM_021911chr5115068 4455 4365 3955 3778 3508 3479 3429 1625 1597 1391 15583 13422 24066 3924
NM_021912chr1563963 3369 802 226 197 139 13679 21032 174 --
NM_021961chr11117302 7043 6821 5553 4526 2965 1677 1608 1195 178 50 16802 36884 1632 1294 --
NM_021964chr396240 6215 5850 5622 1679 1401 778 572 195 --15120 14597
NM_022048chr1556054 5457 2146 1717 1615 46171 4041 2466 1211 --13981
NM_022130chr531281 357 351 21082 556 21442 153 --
NM_022351chr843633 3117 1435 277 3824 701 169 13780 13705
NM_022459chr1394866 4740 4355 3958 1531 1022 1014 271 217 25738 1630 2842 136 24553 1545
NM_022716chr132793 2759 2273 ----23126 2555
NM_022763chr32492 380 12765 22582 1960 23185 3155
NM_022817chr241964 786 225 202 ----22159 847
NM_022977chrX32062 1854 1805 12070 32222 970 421 --
NM_023016chr252696 2633 2373 2313 367 11047 12074 12227
NM_024511chr483194 3180 2915 1230 676 196 155 32 21378 1157 ----
NM_024524chr342773 2523 1106 50 ----12418
NM_024639chr652423 2313 1075 798 44 --1811 11988
NM_024665chr384476 4191 3441 3021 1537 653 421 72 --1316 11101
NM_024700chr141068 1025 913 751 --21173 881 11081
NM_024744chr222593 399 12518 31841 1705 735 --
NM_024770chr246089 5846 5782 4962 1954 --1161
NM_024947chr3129525 9333 9082 8554 7212 6789 6444 3586 3462 2998 1375 498 19271 48599 8573 6829 1887 27753 1903
NM_024989chr2137255 6068 5952 5920 5880 4985 2662 2084 1858 1788 1655 595 204 27667 1353 46495 2685 1976 1391 --
NM_025054chr863112 3070 2607 1243 696 248 23655 433 13159 21301 47
NM_025073chr144663 4630 3454 1436 --34559 1894 716 --
NM_025191chr133508 3455 2851 ----13552
NM_030621chr1453738 2884 2698 1417 601 --3866 834 172 11653
NM_030625chr1031762 770 757 --11858 11792
NM_030627chr553075 3041 2932 573 92 23154 2974 --12996
NM_030664chr1062229 2221 2205 2056 903 836 11783 12160 --
NM_030674chr1235545 2236 990 35633 4962 1508 15687 14807
NM_030816chr183594 3180 2579 2275 1151 816 614 507 22870 498 ----
NM_031371chr141355 1290 588 326 11569 1349 1499
NM_031371chr141355 1290 588 326 11569 1349 1499
NM_031442chrX43052 2797 2282 241 1793 1627 12729
NM_032186chr131302 481 411 21361 1093 11079 1262
NM_032189chr1354557 4296 3345 3185 3168 14729 73629 3558 3482 3238 3204 3081 313 33510 3404 3375
NM_032229chr131442 1229 1400 1414
NM_032373chr10105728 5105 4630 4273 2230 1473 911 843 651 623 11615 15678 12109
NM_032433chr1971585 1566 1521 1351 1011 343 190 1286 ----
NM_032435chr182390 2380 2160 2011 1959 952 935 608 11762 ----
NM_032445chr1552580 2478 1942 1678 107 1819 42399 1795 416 336 11656
NM_032446chr553471 3107 2995 2522 1197 189 21106 447 --
NM_032505chr342698 2461 1697 742 32655 1911 603 22311 479 --
NM_032842chr751616 1599 1263 1076 173 11220 21380 1154 --
NM_032859chr1353642 2957 726 247 224 1555 23300 1167 33684 496 340
NM_032873chr11104058 3723 3595 1783 1777 1582 1442 1021 973 745 --14216 --
NM_032906chr44866 793 677 263 ----1587
NM_032968chrX64249 3849 3028 2806 356 308 44197 3216 875 106 24057 651 11043
NM_032969chrX64249 3849 3028 2806 356 308 44197 3216 875 106 24057 651 11043
NM_032973chrY74241 3841 3023 2923 2801 356 308 44189 3211 875 106 24049 651 11043
NM_033020chr164431 4314 4005 3709 3615 3386 23216 776 --13396
NM_033143chr4124669 4661 4569 4443 4404 4252 4237 3237 3085 3016 1834 955 13463 24274 3029 --
NM_033224chr766737 5518 2366 2188 1840 353 22841 2715 16557 12735
NM_033360chr1244369 4204 3750 3561 43184 2937 1760 121 ----
NM_033389chr1784038 3523 2964 1528 1330 1184 1070 862 --33131 2977 912 2172 65
NM_033425chr1153485 3412 2260 1007 704 13290 11237 13325
NM_033505chr286267 6174 6158 5999 5881 5162 4413 2501 1782 26076 6053 35610 5476 1358
NM_052832chr832921 2099 917 23007 217 --12473
NM_052834chr18102559 2384 1838 1658 947 936 836 627 517 439 --22373 1687 --
NM_052851chr1332355 355 337 21539 75 1348 1388
NM_052885chr1274692 4334 3910 3765 3437 1754 1467 24214 507 54792 4657 4227 3817 374 24873 3042
NM_052918chr10123684 3589 3446 3141 2596 1370 1251 979 830 516 379 357 1191 ----
NM_053016chr967565 6679 6049 5415 2657 182 --11374 15013
NM_057168chr751430 1176 1159 557 189 11372 --1657
NM_058241chr242295 1742 416 404 11976 --11797
NM_058241chr242295 1742 416 404 11976 --11797
NM_080546chr9163 21940 1677 5210 121 115 99 93 --
NM_080759chr1362437 2200 894 845 755 727 1953 32009 1730 805 --
NM_080760chr1362437 2200 894 845 755 727 1953 32009 1730 805 --
NM_130391chr952847 2833 1278 929 376 13113 22839 2473 11413
NM_130392chr952847 2833 1278 929 376 13113 22839 2473 11413
NM_130393chr952847 2833 1278 929 376 13113 22839 2473 11413
NM_130773chr24963 897 875 290 --2886 275 --
NM_130798chr1531294 1123 241 --1959 11113
NM_130809chr553140 537 368 323 296 ----23134 605
NM_133265chrX93496 3369 3279 3265 2920 2818 2398 1232 1062 2511 164 ----
NM_133468chr771769 988 920 742 736 256 124 --2217 194 --
NM_133477chr473022 2956 2864 2259 1264 168 23 --11212 1291
NM_133493chr6104632 4088 3530 3353 3088 2956 1749 1248 801 154 --14188 23137 53
NM_138286chr1954290 4247 3783 1491 1252 54382 4355 1420 866 594 --1856
NM_138333chr982579 2547 2305 2299 1686 871 271 257 12464 12555 --
NM_138426chr742179 2077 765 205 12306 31696 816 808 --
NM_138444chr1374956 4571 4277 3584 3496 3377 3221 33727 1964 1703 13392 --
NM_138459chr643101 1195 523 204 --22765 190 12685
NM_138468chr256287 6171 5762 1694 385 54927 4172 4091 4054 415 --16083
NM_138492chr51298 21060 291 --1592
NM_138494chr762722 2688 2518 430 93 81 12767 32802 2710 783 12790
NM_138731chr1433723 2766 319 21052 518 13323 21621 1569
NM_138959chr166507 4227 2551 2104 1991 749 26580 5184 35080 2694 433 --
NM_139012chr672081 890 769 744 601 318 160 1753 11800 12069
NM_144571chr466010 4956 2628 2218 225 69 36521 4811 612 15446 --
NM_144578chr1445486 4707 4316 4194 25049 4649 54376 1099 697 177 48 --
NM_144599chr1595452 4870 4383 3410 1714 1658 806 710 463 45470 4427 1085 970 45399 5362 4449 1979 11195
NM_144632chr251748 700 579 534 264 1859 --1771
NM_144664chr1142422 1621 1040 1009 11779 22511 784 1535
NM_144963chr842708 683 535 335 32462 2109 565 11751 --
NM_144973chr1285115 4942 4271 3840 3778 3283 444 208 ----34217 1576 371
NM_145259chr277032 6282 5797 1851 1777 1478 562 36975 6590 806 26835 6704 --
NM_145649chr652583 2547 2287 2007 1054 --11065 11898
NM_145655chr652583 2547 2287 2007 1054 --11065 11898
NM_145698chr1061732 1569 695 617 494 304 ----11824
NM_148170chr1175553 5228 5092 4910 4395 1772 642 25618 5240 45421 5299 5265 4691 12094
NM_148894chr44995 396 188 106 ----1370
NM_152330chr1432241 1011 932 12610 22349 1054 1335
NM_152352chr1862821 2631 2524 2431 2024 1953 --172 1574
NM_152409chr583566 3507 2965 2617 2582 2214 1446 831 --12237 11437
NM_152519chr27653 525 479 437 305 106 97 21499 28 ----
NM_152529chr224328 821 34385 2966 760 34103 1614 178 --
NM_152551chr663021 2844 2483 2292 1143 934 11123 2633 275 1312
NM_152622chr532760 2380 126 22598 2448 --11289
NM_152624chr596302 5132 2893 2632 2570 1299 1277 1060 583 --1851 --
NM_152641chr1242914 2740 2091 1028 12691 11004 12386
NM_152678chr362480 2433 1882 1827 484 461 22664 2596 ----
NM_152680chr432164 1993 1625 --2804 286 22423 2328
NM_152754chr732884 2808 142 23722 292 12464 11433
NM_152774chr782731 2670 2632 1054 898 684 652 625 --1754 --
NM_152793chr7114466 3606 3469 3376 3278 2013 1937 1443 1021 613 428 15177 11351 --
NM_152835chr131855 421 300 12036 1409 1428
NM_152996chr111533 11385 --2805 730
NM_153013chr532548 517 507 ----22034 908
NM_153188chr575286 2097 1673 1493 1442 518 238 1484 11621 13458
NM_153207chr1273462 3174 2931 2582 2532 1290 1028 12775 44032 3866 3744 393 --
NM_153235chr652158 1674 934 496 464 12357 2546 480 --
NM_153262chr152555 2410 638 535 180 11205 22461 2455 --
NM_153456chr13115856 5304 4212 4117 4046 3899 2461 2023 1526 1040 554 15609 46213 6140 5963 1359 15002
NM_153607chr543029 3004 236 81 198 22633 2549 --
NM_153619chr1543275 3044 1263 84 13647 23621 1401 12505
NM_153688chr1631657 1324 1183 --1469 2381 174
NM_170672chr261832 1740 1695 321 270 248 --1664 1649
NM_170731chr1132876 167 114 12733 --12305
NM_170732chr1132876 167 114 12733 --12305
NM_170733chr1132876 167 114 12733 --12305
NM_170734chr1132876 167 114 12733 --12305
NM_170735chr1132876 167 114 12733 --12305
NM_172071chr177268 7198 4684 2747 1269 1233 844 11380 11993 --
NM_172127chr441923 576 177 131 --11866 1168
NM_172128chr441879 532 133 87 --11822 1124
NM_173177chr21557 ----2134 115
NM_173511chr253914 3070 2523 823 782 12773 13270 1121
NM_173576chr1062060 1845 1775 565 541 428 11510 --12282
NM_173642chr148269 1339 376 346 33189 2628 1883 23622 2018 --
NM_173808chr143664 1240 1184 363 1150 23717 3586 11359
NM_173829chr552360 2318 806 454 52 26143 4979 24143 4137 15234
NM_173851chr853409 3020 2997 2981 2730 --42511 2486 2475 537 --
NM_175056chr342114 1921 735 188 ----22186 840
NM_175607chr31257 11344 2595 558 11695
NM_175612chr31257 11344 2595 558 11695
NM_175624chr1287454 6803 2677 2607 1994 1312 819 765 --57767 7441 7426 1685 1350 1967
NM_175625chr1287454 6803 2677 2607 1994 1312 819 765 --57767 7441 7426 1685 1350 1967
NM_175861chr1265162 4661 4340 1804 784 531 35973 5854 4918 --15229
NM_175921chr564235 4228 3035 1602 712 558 ----1327
NM_177438chr1453738 2884 2698 1417 601 --3866 834 172 11653
NM_177966chr32743 480 ----21422 83
NM_177968chr22649 414 1391 2806 498 1383
NM_177985chr252038 1927 1765 1469 1424 ----1745
NM_178006chr1332355 355 337 21539 75 1348 1388
NM_178007chr1332355 355 337 21539 75 1348 1388
NM_178151chrX77728 6674 6646 5880 5683 1682 149 --26315 2323 17262
NM_178152chrX77728 6674 6646 5880 5683 1682 149 --26315 2323 17262
NM_178153chrX77728 6674 6646 5880 5683 1682 149 --26315 2323 17262
NM_178313chr262195 1661 1640 1417 1352 797 --32110 1633 369 --
NM_178498chr1153898 3865 3693 3242 3180 1960 2480 94 13479
NM_178509chr1743461 3262 3087 2890 --1311 13503
NM_178585chr462804 2692 2674 560 417 115 43144 2528 2066 945 12560 --
NM_181354chr84457 290 217 94 ----11214
NM_181358chr143760 3171 2668 1164 14083 43854 3837 2794 1266 13866
NM_181504chr573856 3834 3768 3482 3410 2984 581 12967 63909 3885 3871 3033 711 526 --
NM_181521chr1687218 7053 6005 5696 2891 2381 2372 2095 188 11515 27305 6764
NM_181523chr573856 3834 3768 3482 3410 2984 581 12967 63909 3885 3871 3033 711 526 --
NM_181524chr573856 3834 3768 3482 3410 2984 581 12967 63909 3885 3871 3033 711 526 --
NM_181705chr585707 5647 4371 2164 1992 1388 1050 812 1364 25230 4734 15370
NM_181714chr631581 327 226 11649 11560 11605
NM_181782chr63735 722 174 12231 1741 12291
NM_181783chr1251826 1778 1495 565 182 154 2649 355 --
NM_182485chr462558 2300 1062 740 429 47 --1922 1268
NM_182646chr462558 2300 1062 740 429 47 --1922 1268
NM_182715chr731188 50 34 --2452 310 1196
NM_182757chr673423 2263 1398 1235 1109 935 31 1953 --11352
NM_182765chr1042128 1852 918 427 1549 21756 34 --
NM_182796chr51707 1788 4934 774 640 604 1904
NM_182898chr736420 4976 1055 1697 13982 16395
NM_182899chr736420 4976 1055 1697 13982 16395
NM_182920chr34305 193 184 81 1554 1201 --
NM_183079chr2031532 1498 1395 21453 1274 21287 1221 --
NM_183397chr2025181 3506 --11192 25144 714
NM_198240chr12----11224 21379 1190
NM_198268chr143760 3171 2668 1164 14083 43854 3837 2794 1266 13866
NM_198269chr143760 3171 2668 1164 14083 43854 3837 2794 1266 13866
NM_198270chrX11402 --1510 22603 452
NM_198273chr563095 3026 2592 2419 2407 287 1903 32384 501 37 23167 1976
NM_198400chr1552641 2285 932 411 405 11878 12184 1699
NM_198449chr53486 225 155 1453 --1439
NM_198450chrX12233 179 8532 500 470 440 408 386 360 330 --
NM_198465chrX52135 1186 1067 171 41 --22698 778 12719
NM_198503chr131800 1792 614 ----21882 96
NM_198578chr12--31368 1127 441 --1154
NM_198581chr221872 754 22375 2058 16355 26241 443
NM_198715chr1135986 5836 5537 4599 4193 4020 2474 2453 2429 2390 1363 246 23 55140 3989 2214 1470 770 46309 6276 3902 2370 --
NM_198859chr363497 1907 1135 600 405 183 13951 23755 3491 --
NM_198968chr13103770 3608 2889 1509 1453 1413 739 393 348 245 1205 53442 2803 1369 915 880 13417
NM_199000chr711466 --11447 42131 2019 841 330
NM_199072chr733063 223 178 12956 22425 386 13024
NM_201269chr131302 481 411 21361 1093 11079 1262
NM_203282chr1921611 1257 1738 11622 11825
NM_203394chr1242565 1839 1090 650 --1357 22678 2151
NM_203463chr294770 4193 3723 3267 1834 1708 1352 1332 149 1207 11929 --
NM_205846chr51298 21060 291 --1592
NM_205860chr162496 2439 2359 1022 677 655 1746 11135 --
NM_206853chr673984 1390 1336 1050 630 469 447 12752 ----
NM_206854chr675245 3730 3567 1891 1730 1708 375 14013 11153 1491
NM_206855chr646210 4695 4532 1340 14978 12118 11456
NM_206907chr573306 1353 1336 1096 353 339 213 --21299 1232 12823
NM_206909chr8167831 6286 6211 5939 5571 5234 2930 2172 2153 1921 914 800 546 441 318 265 18343 38382 8207 6305 18396
NM_206943chr2----1853 2728 232
NM_207292chr383298 2824 2618 2416 1257 970 380 147 13257 ----
NM_207293chr383298 2824 2618 2416 1257 970 380 147 13257 ----
NM_207294chr383298 2824 2618 2416 1257 970 380 147 13257 ----
NM_207295chr383298 2824 2618 2416 1257 970 380 147 13257 ----
NM_207296chr383298 2824 2618 2416 1257 970 380 147 13257 ----
NM_207297chr383323 2849 2643 2441 1282 995 405 172 13282 ----
NM_207303chr1011133 --44079 1635 1430 1332 1300
NM_207325chr1962020 1788 1713 647 621 317 182 2730 658 --
NM_207406chr496535 6286 6110 5023 4819 4488 4431 4083 1144 14540 ----
NM_212554chr103618 410 208 --11569 11625
NM_212558chr953561 3544 1433 767 163 2580 153 34137 4131 888 11557
NM_213589chr285564 1835 968 420 402 341 153 127 --2197 185 24286 1180