TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4666b
miRNA Sequence: UUGCAUGUCAGAUUGUAAUUCCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51466 --11216 --
NM_000027chr4----1923 --
NM_000038chr522112 1545 1407 21684 252 --
NM_000052chrX42462 2276 862 39 ------
NM_000074chrX3348 285 150 ------
NM_000076chr11190 ------
NM_000081chr121401 448 --31683 1431 223 --
NM_000084chrX56609 5425 2741 1040 883 36992 6836 334 11030 1316
NM_000087chr42382 32 1444 ----
NM_000089chr71639 ------
NM_000092chr243650 1571 1090 272 14508 11667 --
NM_000093chr942419 636 74 49 --1906 1754
NM_000109chrX22629 981 1276 --1310
NM_000110chr121157 49 1854 ----
NM_000112chr585330 5019 4770 3758 2165 1912 1362 989 15382 ----
NM_000125chr644130 3062 103 60 ------
NM_000127chr81289 ------
NM_000138chr152832 294 --1750 1578
NM_000142chr41448 1576 ----
NM_000163chr522054 930 ------
NM_000168chr732658 451 365 --22717 1283 23163 3074
NM_000170chr92444 219 ------
NM_000189chr221998 692 --1222 1847
NM_000194chrX1112 ------
NM_000208chr1964699 4481 4149 1832 688 637 14746 ----
NM_000210chr2--12247 ----
NM_000216chrX63634 2889 2492 1608 1032 269 1599 52787 1321 1301 1241 70 11280
NM_000217chr1285036 4997 4702 4480 4091 1327 902 311 15310 11533 13921
NM_000232chr442775 1008 54 26 159 --1483
NM_000237chr821728 1397 ----1551
NM_000242chr1062661 2515 2030 1984 1028 839 32291 2043 521 12280 --
NM_000245chr71886 12234 ----
NM_000248chr311932 11075 1986 --
NM_000251chr21264 ------
NM_000252chrX41016 969 934 101 ------
NM_000259chr15105643 4781 4739 4228 3999 2544 2513 2167 2104 796 11398 12460 26186 747
NM_000262chr2241720 1633 1433 65 --11285 --
NM_000264chr972871 1345 1286 1042 988 643 196 22830 395 ----
NM_000266chrX3907 803 151 1808 ----
NM_000267chr1722681 1178 12980 11166 --
NM_000271chr181561 ------
NM_000278chr10--11512 ----
NM_000297chr431639 1418 83 ----11733
NM_000314chr1083154 2937 2700 2611 2068 597 490 216 ------
NM_000315chr11159 ----1125
NM_000330chrX12156 1715 ----
NM_000332chr666890 6705 5269 2331 173 92 --34857 1429 719 1516
NM_000337chr5106437 6407 5760 5246 4976 2619 2589 1955 1167 1046 --15503 25205 2418
NM_000343chr221127 ------
NM_000345chr41782 ------
NM_000362chr2233224 2565 1085 1579 ----
NM_000371chr18198 151 ----
NM_000390chrX42838 2327 383 295 12339 12142 --
NM_000393chr271998 1986 1687 1513 1495 1363 409 --21383 529 --
NM_000399chr10--2900 837 ----
NM_000408chr233142 2684 2428 2553 55 1380 --
NM_000430chr1742812 2776 1061 162 1107 --23327 2395
NM_000435chr192800 676 ------
NM_000436chr541619 1554 163 136 ------
NM_000439chr542527 1574 713 150 --22511 2459 --
NM_000441chr722281 818 1424 12007 --
NM_000448chr11--1313 12627 --
NM_000452chr1331710 342 133 11574 ----
NM_000459chr93791 152 75 --1826 1248
NM_000461chr344587 4104 3128 497 24159 1408 13059 --
NM_000462chr1531229 1210 185 11781 ----
NM_000474chr71121 ------
NM_000482chr111107 ------
NM_000489chrX23224 1306 ------
NM_000492chr721081 591 ------
NM_000495chrX2815 137 ------
NM_000555chrX35880 4845 1485 --16315 17262
NM_000574chr12899 535 ------
NM_000598chr74472 316 293 37 --11098 --
NM_000599chr254638 2843 850 803 756 --1380 --
NM_000609chr1032882 1092 878 1728 23125 2191 --
NM_000612chr1131463 1390 870 22464 790 81440 1370 1314 1235 1178 1066 1022 218 --
NM_000615chr11--22449 549 1113 --
NM_000618chr1266284 6270 2501 1970 1745 33 24735 2264 --12403
NM_000618chr1266284 6270 2501 1970 1745 33 24735 2264 --12403
NM_000633chr1824761 3570 --44522 1820 1223 64 21480 32
NM_000663chr1633048 2543 1105 22881 445 13074 12109
NM_000681chr1021342 1275 ------
NM_000684chr102891 820 ------
NM_000686chrX31044 489 313 21489 23 ----
NM_000719chr1276054 5953 5382 5261 1251 1149 1084 26268 1706 11230 11399
NM_000721chr152133 1016 503 122 26 ------
NM_000767chr1941220 1175 520 364 ------
NM_000793chr14105009 4957 4375 4021 3597 3496 985 885 546 315 14405 ----
NM_000801chr202228 72 ------
NM_000806chr521606 183 --1765 --
NM_000807chr41563 1199 2156 103 --
NM_000810chr151575 ------
NM_000811chr51615 ------
NM_000813chr554080 3778 672 387 276 25583 436 35384 3470 3422 23924 1266
NM_000814chr1523963 3369 23241 1081 11022 --
NM_000817chr22819 346 11220 1254 --
NM_000818chr102459 43 ------
NM_000824chr4--1173 1330 --
NM_000826chr442628 1033 514 110 12230 1375 --
NM_000829chr1141638 1509 581 411 ----1512
NM_000831chr1135713 5679 5216 3991 2439 2362 2304 2226 2202 2189 2071 497 258 22032 1888 56106 5129 4570 4126 2249 --
NM_000833chr1631464 500 276 2437 373 11036 --
NM_000838chr632002 411 362 ----11854
NM_000844chr33962 770 745 ------
NM_000859chr53636 213 174 ------
NM_000866chr311691 21774 242 ----
NM_000868chrX62134 2051 1952 1943 1900 1762 ----12489
NM_000875chr1536258 5824 4857 ----1194
NM_000880chr8169 1278 ----
NM_000891chr1722878 2592 1926 ----
NM_000899chr1274420 1694 1398 1184 1015 558 326 1677 12758 --
NM_000901chr452140 1939 914 239 88 22517 1982 ----
NM_000912chr863516 2933 2350 2231 2171 683 13253 2501 207 --
NM_000922chr112972 174 ------
NM_000926chr1188730 8514 6501 2606 1901 1077 800 293 31019 664 445 --29275 358
NM_000933chr2051356 1106 400 336 263 --11609 --
NM_000938chr4----1127 --
NM_000944chr431473 931 313 ------
NM_000945chr211584 ----11695
NM_000950chrX53290 2228 1317 430 300 12487 --1259
NM_000956chr142995 803 21040 176 ----
NM_000961chr2054014 1050 1042 824 26 --13570 --
NM_000977chr161366 ------
NM_001001323chr1232633 2240 1279 ------
NM_001001331chr321041 299 --12512 --
NM_001001349chr1731355 477 452 ------
NM_001001394chr2--1487 1714 --
NM_001001395chr1222705 2317 --21776 67 --
NM_001001396chr174318 4013 3998 3724 3088 1714 195 ------
NM_001001419chr575117 4419 1187 1120 766 535 273 12024 1832 --
NM_001001420chr575117 4419 1187 1120 766 535 273 12024 1832 --
NM_001001433chr2032793 2731 349 ------
NM_001001481chr852792 2602 524 304 196 --1561 13175
NM_001001484chr1022372 2283 11783 22075 1629 --
NM_001001549chr742542 2411 2066 1758 ------
NM_001001550chr742542 2411 2066 1758 ------
NM_001001555chr742542 2411 2066 1758 ------
NM_001001557chr81500 11906 11936 12193
NM_001001586chr11381 ------
NM_001001664chr243081 778 712 293 --34079 3499 841 23745 577
NM_001001668chr19104157 3870 2978 1573 1476 1436 1187 1087 141 52 ------
NM_001001706chr63817 204 185 1381 ----
NM_001001852chr22----1670 --
NM_001001890chr2123287 1686 12651 ----
NM_001001974chr1042293 1741 1604 1550 ------
NM_001001977chr20160 ------
NM_001001995chrX31354 410 371 ------
NM_001002026chr31820 1984 12451 --
NM_001002800chr31129 ------
NM_001002814chr843471 3436 321 122 2523 431 12565 --
NM_001002838chrX1503 ------
NM_001002843chr154944 933 516 424 ------
NM_001002860chr1484301 3944 3535 3235 3206 1766 1420 161 24669 4442 23878 1812 14204
NM_001002906chrY--1441 ----
NM_001002909chr1712238 12034 ----
NM_001003652chr1848566 7913 5982 988 11713 16537 --
NM_001003674chr1855015 4780 2594 1804 959 21058 166 21527 937 --
NM_001003675chr1855015 4780 2594 1804 959 21058 166 21527 937 --
NM_001003676chr1111021 ------
NM_001003677chr111577 ------
NM_001003688chr42914 47 1865 ----
NM_001003698chr6--1488 21731 777 11327
NM_001003699chr6--1488 21731 777 11327
NM_001003712chr1233771 2495 1628 --1276 12573
NM_001003760chr622420 138 ----13086
NM_001003800chr973068 2792 1470 1457 1381 1253 525 --13549 --
NM_001003945chr951881 1633 1201 163 123 ------
NM_001004106chr51823 ------
NM_001004303chr12664 89 --1867 --
NM_001004303chr12664 89 --1867 --
NM_001004317chr644393 2984 2856 658 156 --13128
NM_001005335chr192289 247 ------
NM_001005366chr121294 1335 ----
NM_001005375chrY11354 ------
NM_001005463chr10179 ----1178
NM_001005473chr576360 5103 4376 4176 2038 1716 568 25021 1687 26051 1967 --
NM_001005739chr2--1723 ----
NM_001005845chr83677 263 196 11367 --1237
NM_001005849chr17----1495 --
NM_001005861chr31878 ------
NM_001006600chr51816 --12283 --
NM_001006605chr121079 987 2914 877 ----
NM_001006605chr121079 987 2914 877 ----
NM_001006610chr162941 163 ------
NM_001006624chr152017 1546 329 213 34 ------
NM_001006634chr161503 ------
NM_001006636chr22314 246 --1263 --
NM_001006657chr253149 3044 1219 795 60 --12979 --
NM_001006681chrX126 ----159
NM_001006682chrX126 ----159
NM_001006683chrX126 ----159
NM_001006946chr221352 520 ------
NM_001007023chr14105009 4957 4375 4021 3597 3496 985 885 546 315 14405 ----
NM_001007027chr111188 ------
NM_001007067chr83407 103 70 ------
NM_001007068chr83407 103 70 ------
NM_001007069chr83407 103 70 ------
NM_001007070chr83407 103 70 ------
NM_001007075chr4------1733
NM_001007097chr954354 3248 1808 1148 249 163 21434 850 1465
NM_001007098chr1177 ------
NM_001007214chr14504 494 488 175 ----11583
NM_001007231chr2--1587 ----
NM_001007245chr71565 --1203 --
NM_001007527chr51588 --1288 --
NM_001008220chr553623 3104 1154 904 380 12968 11213 --
NM_001008225chr72625 556 --1548 --
NM_001008239chr1833261 2771 615 12879 ----
NM_001008392chr363593 3258 2921 2575 1075 623 --23514 213 12471
NM_001008408chr775424 5048 4942 3871 2307 1001 287 --22252 2069 --
NM_001008495chr82388 353 12292 --1671
NM_001008540chr22512 324 ------
NM_001008564chr13----21774 339 --
NM_001008660chr111429 ------
NM_001008707chr1421757 1352 --11513 --
NM_001008738chr522963 625 --168 --
NM_001008777chr171494 ------
NM_001008783chr61310 ------
NM_001008895chr131556 --11235 11492
NM_001008925chr483290 3262 2532 2477 1242 629 516 272 22692 1106 --12504
NM_001009554chr463719 3704 3243 1147 1003 23 --11797 --
NM_001009554chr463719 3704 3243 1147 1003 23 --11797 --
NM_001009899chr355090 4531 1474 303 59 --24385 75 14955
NM_001009909chr1111527 23530 97 --1283
NM_001009960chr731003 431 81 1404 22802 2710 --
NM_001009993chr233817 1486 701 44482 3117 2788 429 13414 1364
NM_001010000chr1842528 738 37 29 ----1515
NM_001010861chr132580 2331 1120 12421 ----
NM_001010862chrX33281 3200 3045 --11290 --
NM_001010867chr166699 6401 5431 4911 2127 1668 ------
NM_001010888chrX64540 1565 1513 975 557 303 11738 14524 --
NM_001010891chr556659 2358 1275 977 305 --26211 1844 11867
NM_001010927chr61496 ------
NM_001010942chr1241078 929 862 329 11258 1298 --
NM_001010971chr1193 163 ----
NM_001010986chrX22061 915 21823 317 22333 923 --
NM_001010989chr162448 127 ------
NM_001010990chr162448 127 ------
NM_001011515chr41167 ------
NM_001011516chr41167 ------
NM_001011537chr352254 2115 2020 535 271 ----12237
NM_001011546chr20------1147
NM_001011553chr7143 --1866 --
NM_001011666chr765835 4558 2591 2105 1055 49 25001 192 14526 16395
NM_001011708chr232080 2000 298 --12526 --
NM_001011713chr1431426 625 105 155 ----
NM_001011724chr131127 ------
NM_001011725chr131127 ------
NM_001012267chr941500 1237 121 111 ----152
NM_001012337chr31123 ------
NM_001012393chr1164784 3959 3435 1372 661 480 --23422 3236 14310
NM_001012398chr163726 131 27 ------
NM_001012410chr3261 45 ------
NM_001012418chr674250 4177 3459 3053 2974 676 493 ------
NM_001012420chr1542306 512 377 256 ------
NM_001012423chr1542306 512 377 256 ------
NM_001012514chr22999 122 ------
NM_001012516chr22999 122 ------
NM_001012716chr18----1270 --
NM_001012732chr451123 891 875 362 180 ------
NM_001012751chr1041818 459 328 114 --21517 1243 --
NM_001012761chr552447 2399 1952 1744 106 --1346 --
NM_001012968chrX42123 980 454 409 --1473 --
NM_001012977chrX41440 1376 1307 555 ------
NM_001012989chrX1466 ------
NM_001013031chr1063391 1171 1052 994 318 180 --1423 11148
NM_001013398chr74472 316 293 37 --11098 --
NM_001013415chr4------11312
NM_001013437chr181122 ------
NM_001013438chr32989 906 ------
NM_001013439chr32835 752 ------
NM_001013620chr1268330 7034 5149 3270 1772 1153 --15132 12248
NM_001013624chr17183 1256 11078 --
NM_001013629chr1022142 1409 ----143
NM_001013699chr12------1208
NM_001014283chr1342166 1440 631 322 ----11971
NM_001014443chr12220 192 ------
NM_001014449chr16--1165 ----
NM_001014451chr16--1165 ----
NM_001014797chr10108118 8001 5988 5033 1443 1211 970 359 304 207 --27984 611 --
NM_001014839chr111083 ------
NM_001014841chr111083 ------
NM_001015048chr1423213 431 22998 2582 190 --
NM_001015049chr1423213 431 22998 2582 190 --
NM_001015053chr17--11519 ----
NM_001015877chrX72762 2416 2177 1166 508 401 190 ------
NM_001015892chr5----266 26 --
NM_001017371chr22437 334 1899 --1926
NM_001017395chr322609 46 ----13300
NM_001017424chr121900 445 ------
NM_001017425chr121900 445 ------
NM_001017440chr752964 1950 1559 1510 50 28253 8103 16281 --
NM_001017926chr811196 --11323 --
NM_001017930chrX31299 1187 956 ------
NM_001017963chr142891 805 --2866 244 --
NM_001017969chr91454 1645 ----
NM_001018008chr151641 ------
NM_001018009chr3185 ------
NM_001018025chrX3817 807 29 ------
NM_001018054chr131175 971 46 ------
NM_001018067chr164376 1742 604 474 257 62 --33263 1865 298 14907
NM_001018068chr164376 1742 604 474 257 62 --33263 1865 298 14907
NM_001018069chr164376 1742 604 474 257 62 --33263 1865 298 14907
NM_001018100chr152833 798 ------
NM_001020658chr11324 --1200 11339
NM_001020658chr11324 --1200 11339
NM_001023567chr1542437 515 472 256 12490 ----
NM_001024218chr14------167
NM_001024455chrX52630 2566 1999 626 239 ------
NM_001024463chr151141 ------
NM_001024647chr12117636 6708 6364 5286 2877 2582 2422 2078 1849 780 769 --27009 992 1872
NM_001024649chr522142 924 ------
NM_001024680chr21271 ----11112
NM_001024847chr332445 2372 2076 1860 1489 11957
NM_001024924chr41555 1376 ----
NM_001024934chr6------1646
NM_001024935chr6------1646
NM_001024936chr6------1646
NM_001024948chr143444 3386 2369 2352 --22665 1339 --
NM_001024956chr1125732 5327 25530 4298 1336 --
NM_001025068chr3------11456
NM_001025069chr3------11456
NM_001025076chr1056018 5630 2418 2223 1381 1269 12379 --
NM_001025077chr1047376 6988 4803 2739 11627 ----
NM_001025079chr322888 2614 --11303 --
NM_001025580chrX22761 1348 --14183 --
NM_001025595chr421493 443 ------
NM_001029860chr82311 29 ----178
NM_001029875chr552864 2745 1079 973 877 12091 ----
NM_001029884chr61192 1243 1959 --
NM_001030007chr1623320 3082 --22694 621 --
NM_001030019chr7131 ------
NM_001030055chr1421607 649 1252 34297 1568 56 --
NM_001030272chr11------1323
NM_001030273chr11------1323
NM_001030287chr12987 480 ------
NM_001031623chr63568 205 118 1213 1184 --
NM_001031679chr1252919 2281 2219 1004 165 13564 ----
NM_001031684chr231276 1062 382 ------
NM_001031695chr2254402 1741 856 706 543 ----24971 3450
NM_001031700chr442185 1641 168 41 ----12460
NM_001031710chr71358 ----11068
NM_001031712chr6174 ----1335
NM_001031716chr221066 40 --1862 --
NM_001031723chr4--1325 ----
NM_001031732chr483570 3546 3024 2859 1483 1101 849 154 32748 829 433 1388 --
NM_001031804chr1644059 3240 990 887 --22703 1000 --
NM_001032280chr61425 ------
NM_001032380chr10--1666 21770 1544 --
NM_001033045chr253791 1367 943 821 692 24385 2966 33603 178 155 --
NM_001033057chr331935 419 138 ------
NM_001033059chr63320 255 161 --142 --
NM_001033081chr111231 2760 321 11295 --
NM_001033082chr111231 2760 321 11295 --
NM_001033117chr33957 432 77 --1382 --
NM_001033503chr5--2497 486 168 --
NM_001033507chr121872 1769 21828 281 ----
NM_001033551chr1733055 1384 1324 14092 11178 --
NM_001033557chr21362 ------
NM_001033561chr171704 ------
NM_001033566chr171130 --198 --
NM_001033568chr171130 --198 --
NM_001033578chr832037 1718 747 1428 ----
NM_001034954chr1043161 2753 2591 994 --12145 12152
NM_001034955chr1043161 2753 2591 994 --12145 12152
NM_001034956chr1043161 2753 2591 994 --12145 12152
NM_001034957chr1043161 2753 2591 994 --12145 12152
NM_001035chr11492 1860 1505 --
NM_001035003chr4--1117 11378 --
NM_001035004chr4--1117 11378 --
NM_001035254chr93692 273 125 12237 1348 --
NM_001035260chr1061577 1480 1448 1306 1030 267 11516 11190 1495
NM_001037131chr2----11134 --
NM_001037132chr721571 869 ----11602
NM_001037133chr721571 869 ----11602
NM_001037164chr71708 --1442 --
NM_001037165chr778487 8263 8153 6178 2085 1697 644 --18302 --
NM_001037172chr31931 ------
NM_001037174chr222039 1469 ----1745
NM_001037317chr132580 2331 1120 12421 ----
NM_001037332chr552496 1899 642 457 164 ------
NM_001037333chr552496 1899 642 457 164 ------
NM_001037535chrX21442 1210 21088 281 ----
NM_001037536chrX21442 1210 21088 281 ----
NM_001037540chrX21442 1210 21088 281 ----
NM_001037582chr451426 1315 1224 711 24 ------
NM_001037631chr221024 849 --11145 --
NM_001037738chr5------123
NM_001038493chr231340 975 159 ------
NM_001038707chr111964 ------
NM_001038707chr111964 ------
NM_001039199chr2055023 4936 4124 1861 1001 24597 574 ----
NM_001039538chr233329 2363 1291 1463 1170 --
NM_001039547chr377264 6391 4952 1222 1120 789 373 --150 --
NM_001039569chr263377 3041 2797 2509 2147 35 22706 2111 ----
NM_001039570chr2244545 4503 4422 3797 11090 --14516
NM_001039571chr2244545 4503 4422 3797 11090 --14516
NM_001039590chrX23959 1579 ----1924
NM_001039591chrX23959 1579 ----1924
NM_001039690chr16----11934 --
NM_001039693chr223794 3758 --53770 3107 2836 2683 463 --
NM_001039762chr1041727 1550 722 665 --11456 --
NM_001039802chr12914 318 --21389 134 --
NM_001039840chrX95878 5387 4348 4178 3792 2069 707 459 314 --1226 1476
NM_001039888chr11144 --2242 216 --
NM_001039916chr12--11232 ----
NM_001039917chr12--11232 ----
NM_001039918chr12--11232 ----
NM_001039919chr12--11232 ----
NM_001039920chr12--11232 ----
NM_001040057chr711446 11049 11436 --
NM_001040100chr361225 1185 825 187 163 121 --11254 --
NM_001040101chr41300 11027 --11581
NM_001040135chr71607 --1694 --
NM_001040142chr232142 563 326 12287 2836 780 --
NM_001040143chr232142 563 326 12287 2836 780 --
NM_001040144chr16----11934 --
NM_001040146chr16----11934 --
NM_001040152chr743718 3611 949 661 --24734 1912 --
NM_001040153chr131375 ------
NM_001040158chr5133 ------
NM_001040159chr421011 340 --2427 225 --
NM_001040214chr631912 1802 487 --42009 1840 1778 233 --
NM_001040272chr942034 907 781 770 ------
NM_001040284chr1655897 4032 1053 318 249 ------
NM_001040402chr461290 1110 609 525 126 88 1632 12708 --
NM_001040429chr1343581 3565 2364 332 13340 ----
NM_001040441chr153587 3462 1783 1154 137 ------
NM_001040446chr532119 1949 1929 1183 ----
NM_001040624chr852427 2000 1719 648 418 --22241 1088 --
NM_001040625chr852427 2000 1719 648 418 --22241 1088 --
NM_001040626chr852427 2000 1719 648 418 --22241 1088 --
NM_001040627chr852427 2000 1719 648 418 --22241 1088 --
NM_001040628chr852427 2000 1719 648 418 --22241 1088 --
NM_001040629chr852427 2000 1719 648 418 --22241 1088 --
NM_001040630chr852427 2000 1719 648 418 --22241 1088 --
NM_001040712chr923026 2458 --12473 --
NM_001042369chr1185 ------
NM_001042404chr111980 ------
NM_001042406chr621092 401 --1793 --
NM_001042413chr944143 4076 594 540 --11652 --
NM_001042425chr61425 ------
NM_001042481chr1432241 1720 613 ----22526 335
NM_001042492chr1722681 1178 12980 11166 --
NM_001042537chrX42141 1910 1668 43 ------
NM_001042550chr92470 219 --21721 1287 --
NM_001042555chr1224004 269 1447 --11167
NM_001042573chr1752183 2155 2018 1805 736 ------
NM_001042599chr277520 7458 6772 5359 3006 2858 2833 24845 1531 26928 2684 --
NM_001042601chr331168 446 348 ------
NM_001042603chr1264872 3838 3643 3595 877 192 14058 ----
NM_001042635chr141108 ------
NM_001042749chrX41416 1344 687 119 ------
NM_001042750chrX41416 1344 687 119 ------
NM_001042751chrX41416 1344 687 119 ------
NM_001044305chr61237 --21111 84 --
NM_001044385chr243835 3485 3300 84 1482 13726 12450
NM_001046chr522380 2370 --12829 --
NM_001048183chr143078 1025 612 234 13636 ----
NM_001049chr1432290 2069 1568 ------
NM_001079874chr142082 1838 1342 383 ------
NM_001083620chr442626 1032 513 110 12228 1374 --
NM_001099678chr385525 5299 4887 2580 2568 1048 763 463 26070 5044 11555 11329
NM_001100108chr1117085 6960 6786 6201 3321 2976 2942 2236 1744 1197 264 --27991 7703 17294
NM_001106chr366885 3858 3329 2139 1372 1324 29508 8756 27430 3210 31883 1876 1865
NM_001109977chr4--1757 ----
NM_001113490chrX52920 2818 2564 701 683 --23181 831 --
NM_001119chr431510 605 234 ----11389
NM_001121chr10--11467 --183
NM_001122679chr51466 --11216 --
NM_001123chr10------1562
NM_001124chr111723 ------
NM_001126chr11860 ------
NM_001128chr1623320 3082 --22694 621 --
NM_001130chr192349 246 ------
NM_001148chr412168 --1218 --
NM_001149chr10--1148 ----
NM_001159chr21180 --1778 --
NM_001173chr1421607 649 1252 34297 1568 56 --
NM_001174chrX32268 1958 34 22201 168 --12003
NM_001177chr1211917 ------
NM_001178chr11------1323
NM_001186chr2112532 22992 2266 --1877
NM_001198chr632262 1473 295 11583 ----
NM_001204chr286551 6237 5622 3064 2965 2375 1230 154 --22138 53 --
NM_001206chr921946 835 1603 ----
NM_001241chr2162 12076 11652 1100
NM_001241chr2162 12076 11652 1100
NM_001257chr162982 304 21376 1147 21353 964 --
NM_001259chr754383 4234 1853 1194 717 21771 1755 ----
NM_001270chr531064 922 838 ------
NM_001271chr1522488 108 ------
NM_001278chr102741 52 --11042 --
NM_001290chr43730 383 326 2773 109 --11010
NM_001292chr154750 223 141 57 --1775 --
NM_001304chr1733702 1355 216 11327 12560 --
NM_001310chr1241136 1114 615 251 2364 355 ----
NM_001315chr632096 2067 890 --21800 762 --
NM_001331chr1132592 555 386 --12641 1397
NM_001343chr511692 11707 ----
NM_001349chr2----2241 143 --
NM_001351chr311805 ------
NM_001356chrX22233 981 12347 1701 156
NM_001358chr41326 ------
NM_001364chr1184753 4101 3410 1913 1735 1650 960 439 31118 1059 810 ----
NM_001378chr23517 434 72 --1169 --
NM_001379chr193225 94 74 --151 --
NM_001387chr53953 443 197 22466 244 1239 --
NM_001391chr181900 ------
NM_001401chr93568 550 114 1556 ----
NM_001402chr621502 1486 ----11875
NM_001408chr121358 1033 ------
NM_001412chrX53408 3261 2433 1302 274 11276 1776 23304 855
NM_001417chr1231502 269 159 --11394 11847
NM_001419chr194789 611 304 163 ----14653
NM_001422chr1121423 115 --1867 --
NM_001423chr1221896 339 11943 ----
NM_001427chr741974 1905 1366 1302 ------
NM_001429chr221301 11020 1693 2866 163
NM_001431chr61196 ----1945
NM_001432chr453315 2938 1551 973 276 13729 ----
NM_001449chrX----1475 21199 403
NM_001478chr122768 675 ------
NM_001482chr151655 ------
NM_001483chr711052 ------
NM_001491chr652583 2547 1896 679 606 --21065 755 --
NM_001497chr92932 837 32694 1951 513 ----
NM_001498chr621197 1160 --21283 184 --
NM_001527chr6--14828 14846 --
NM_001530chr143993 960 900 ------
NM_001533chr192289 247 ------
NM_001541chr111146 ------
NM_001546chr641459 910 576 538 ------
NM_001550chr71565 --1203 --
NM_001556chr821299 954 --11425 --
NM_001564chr4--194 ----
NM_001584chr112931 318 ----11222
NM_001616chr213288 --13189 11318
NM_001621chr752999 2909 2542 1916 117 ------
NM_001621chr752999 2909 2542 1916 117 ------
NM_001634chr63320 255 161 --142 --
NM_001642chr1121270 314 --1368 --
NM_001650chr182497 446 --13193 13873
NM_001659chr1232146 460 124 189 1484 --
NM_001660chr3130 ------
NM_001663chr1431897 738 453 --22765 1086 --
NM_001664chr32784 347 ------
NM_001668chr12573 515 1614 21887 122 --
NM_001674chr12987 480 ------
NM_001677chr14913 850 240 119 ------
NM_001679chr34691 537 318 140 --1256 1595
NM_001682chr1252347 1954 1164 1118 993 ------
NM_001683chr321041 299 --12512 --
NM_001684chr164035 3730 3715 3441 2805 1431 ------
NM_001690chr341899 764 533 351 11983 ----
NM_001695chr863256 2624 1677 820 633 302 --13623 --
NM_001701chr931502 1094 574 ------
NM_001709chr1162630 2502 2344 302 167 115 12733 ----
NM_001723chr6----2639 88 --
NM_001730chr1311003 21548 1046 --21180 562
NM_001730chr1311003 21548 1046 --21180 562
NM_001731chr121861 ------
NM_001743chr21208 --1110 --
NM_001744chr51421 1201 ----
NM_001746chr522142 924 ------
NM_001753chr731842 1809 1736 11769 ----
NM_001754chr2123287 1686 12651 ----
NM_001755chr1631789 1666 251 1285 ----
NM_001759chr1274914 4451 3812 3720 3651 3628 234 24177 1015 14673 --
NM_001777chr322888 2614 --11303 --
NM_001788chr7143 --1866 --
NM_001791chr12914 318 --21389 134 --
NM_001792chr182761 368 ------
NM_001797chr161590 ----1715
NM_001826chr1--1326 ----
NM_001829chr41694 1908 1734 --
NM_001839chr12612 301 1290 ----
NM_001843chr121235 ------
NM_001855chr91836 1864 ----
NM_001858chr655138 5128 1371 545 359 14877 24240 3673 21153 264
NM_001859chr953715 3213 1503 1198 313 ------
NM_001884chr5145 182 ----
NM_001901chr621043 332 ------
NM_001904chr31882 ------
NM_001918chr1109237 8904 7045 6330 3376 3144 2682 2312 635 72 11013 26214 5980 --
NM_001921chr451123 891 875 362 180 ------
NM_001924chr12367 142 ------
NM_001931chr11--11120 1246 --
NM_001938chr131913 522 93 ----1167
NM_001944chr1812031 12284 12006 --
NM_001945chr531154 437 335 ------
NM_001949chr632469 2309 70 1500 ----
NM_001964chr53828 809 316 --11074 --
NM_001968chr41710 1594 ----
NM_001969chr1443396 2780 1271 676 --176 --
NM_001987chr1234079 3748 859 --11729 --
NM_001992chr54819 306 285 155 ----1415
NM_001995chr4----11299 --
NM_001999chr511120 11031 11316 --
NM_002006chr485687 4089 2318 2065 1835 1738 1669 409 15409 14453 11644
NM_002009chr1532499 1008 611 12316 ----
NM_002015chr1343316 2878 2571 937 13106 12764 --
NM_002017chr1111051 ------
NM_002024chrX22107 678 11759 12012 --
NM_002025chrX168952 8314 8285 8165 8072 8006 7639 7114 7097 2712 1939 1664 1566 1553 1512 822 23438 3229 21620 232 --
NM_002031chr62572 136 ------
NM_002039chr42741 282 --1775 1196
NM_002040chr2122241 2012 22100 889 ----
NM_002046chr122172 124 ------
NM_002056chr21759 ------
NM_002063chrX51249 1165 319 297 275 ------
NM_002069chr71662 --1289 1272
NM_002074chr12652 408 1401 1680 --
NM_002078chr32148 32 1640 --1525
NM_002082chr51786 ------
NM_002092chr454897 4130 3907 1559 797 24717 1987 25101 4077 --
NM_002094chr161398 ------
NM_002107chr11459 ----1451
NM_002111chr461092 768 755 451 138 116 1654 ----
NM_002114chr61176 ------
NM_002129chr41405 ------
NM_002130chr54544 281 192 107 11541 --1379
NM_002135chr12143 --3552 421 30 --
NM_002136chr121127 1600 ----
NM_002137chr742348 1519 356 123 --1133 --
NM_002139chrX2494 175 ------
NM_002140chr91409 31050 328 238 ----
NM_002146chr17--11208 ----
NM_002148chr21682 ------
NM_002151chr19--1203 ----
NM_002155chr11267 ------
NM_002157chr2--175 ----
NM_002161chr91125 --167 --
NM_002163chr1631240 999 486 ------
NM_002199chr41976 1729 ----
NM_002202chr51238 ------
NM_002203chr522932 651 ----1764
NM_002211chr1041159 954 411 363 1977 ----
NM_002214chr744556 4177 587 407 13919 ----
NM_002222chr321027 934 2536 376 2864 307 --
NM_002223chr1253503 3384 1144 732 719 12880 13815 --
NM_002227chr121338 493 1869 21291 148 --
NM_002233chr11155 ----188
NM_002235chr1211403 11697 ----
NM_002239chr22746 213 1233 ----
NM_002240chr212583 534 ------
NM_002245chr11452 ------
NM_002247chr1042110 1670 469 256 11510 --11909
NM_002252chr21288 1411 1378 --
NM_002264chr334223 4160 4010 --15040 --
NM_002267chr1332223 325 104 --1196 --
NM_002268chr321537 1369 21491 613 ----
NM_002270chr575604 4801 4231 3822 2098 929 876 24482 3519 21621 1523 13458
NM_002271chr1321697 1608 12128 ----
NM_002294chrX1496 ----138
NM_002296chr111738 --11395 --
NM_002310chr556266 2592 2537 257 127 24742 884 36569 5021 2091 1310
NM_002333chr1911020 ----11282
NM_002336chr1273848 3631 3526 1678 1570 282 111 11880 ----
NM_002345chr122548 464 ------
NM_002351chrX41391 641 630 49 ------
NM_002356chr632111 534 366 ------
NM_002374chr233329 2363 1291 1463 1170 --
NM_002380chr81964 1248 ----
NM_002383chr161870 ------
NM_002387chr574920 4774 4286 4081 2042 242 76 --14333 --
NM_002395chr611097 11468 ----
NM_002397chr531720 1473 1441 1404 21982 85 1336
NM_002398chr231306 495 167 11059 1337 --
NM_002430chr22------12391
NM_002451chr973861 3812 3773 3125 2926 2484 222 11339 195 --
NM_002470chr17------2101 35
NM_002473chr2231209 1121 110 ------
NM_002480chr122591 325 11381 ----
NM_002481chr132006 1666 1456 27836 2971 26348 1971 27171 350
NM_002493chr91261 1316 ----
NM_002500chr21506 31170 1041 342 ----
NM_002515chr1452070 1889 1387 641 319 1114 ----
NM_002520chr51290 ------
NM_002522chr1763435 3094 2753 318 234 156 ------
NM_002524chr11718 --1808 --
NM_002527chr12----152 --
NM_002538chr5--1629 ----
NM_002539chr2--166 ----
NM_002545chr1164784 3959 3435 1372 661 480 --23422 3236 14310
NM_002570chr1531031 852 439 ------
NM_002577chr313249 --1699 1573
NM_002581chr911801 1650 44952 4946 549 346 --
NM_002586chr631178 1029 512 ------
NM_002589chr4131 ------
NM_002590chr131390 ----192
NM_002594chr2022465 1862 ------
NM_002595chr12----11599 --
NM_002596chr121406 528 --1940 --
NM_002613chr1665414 3791 1993 776 364 287 --24960 4170 --
NM_002623chr202576 147 ------
NM_002627chr10184 ------
NM_002629chr102642 79 ------
NM_002641chrX82017 2010 1748 1628 1522 1360 774 698 2241 169 --1512
NM_002645chr1142776 2602 633 371 --42148 738 60 48 --
NM_002655chr855019 4745 3299 1348 753 14212 11926 14650
NM_002666chr1541000 957 935 925 ------
NM_002674chr121155 ------
NM_002687chr1421052 868 ------
NM_002699chr1--11170 ----
NM_002706chr2166 ------
NM_002709chr233596 868 258 --23449 2590 --
NM_002710chr122729 399 1341 ----
NM_002713chr1--1139 ----
NM_002731chr123105 1976 ------
NM_002734chr1731896 1874 409 158 ----
NM_002736chr71408 1383 21981 548 --
NM_002737chr1765991 5019 2346 1968 1917 1873 22063 1240 ----
NM_002738chr162875 188 ------
NM_002740chr332757 1913 21 --12680 --
NM_002745chr2273945 3196 3062 1426 919 363 36 --13007 --
NM_002748chr153864 481 162 ------
NM_002752chr5--1111 ----
NM_002753chr4------1791
NM_002758chr17----1543 --
NM_002763chr11519 ------
NM_002787chr72617 55 ------
NM_002815chr17--1173 ----
NM_002821chr61640 ------
NM_002822chr1211803 --11224 11360
NM_002828chr181271 ----11024
NM_002829chr911001 1190 1830 --
NM_002834chr1223846 488 23831 3603 22790 1059 --
NM_002835chr72505 253 --1738 --
NM_002837chr1254224 3531 3517 3458 484 24552 659 --1791
NM_002838chr121141 454 --1963 --
NM_002839chr923026 2458 --12473 --
NM_002843chr1153084 518 352 78 62 ------
NM_002844chr641293 1107 330 288 --11178 --
NM_002845chr183457 443 95 ------
NM_002849chr124951 891 852 118 ------
NM_002851chr7--1684 ----
NM_002869chr111751 ------
NM_002880chr3194 ------
NM_002886chr354901 3960 1906 1420 234 1641 24768 4133 --
NM_002890chr51868 1132 ----
NM_002892chr1421449 1327 1642 ----
NM_002893chrX------1314
NM_002906chr1152265 1886 1700 1549 542 ------
NM_002924chr11397 ------
NM_002941chr321526 358 11576 11131 --
NM_002945chr171795 ------
NM_002955chr6--1488 21731 777 11327
NM_002956chr1211254 --11224 11379
NM_002958chr31878 ------
NM_002968chr16----21002 434 --
NM_002971chr311165 3981 932 915 ----
NM_002977chr262872 2757 2456 937 666 284 21105 349 1996 --
NM_002997chr221352 520 ------
NM_002998chr81155 ------
NM_003011chr9----1457 --
NM_003013chr4----1566 --
NM_003014chr751466 1357 1309 1178 972 ------
NM_003017chr621364 273 1203 ----
NM_003022chrX21195 968 ----1133
NM_003026chr931257 1209 857 1389 --11069
NM_003031chr162941 163 ------
NM_003034chr12138033 7618 7528 6794 6500 5360 5257 2956 2871 2679 2464 1272 1257 --31131 1119 984 1997
NM_003038chr242660 2612 2176 1024 11979 12192 --
NM_003042chr332005 1520 435 --21503 328 --
NM_003048chr232561 590 347 190 ----
NM_003059chr51258 ------
NM_003060chr531270 1241 322 ------
NM_003069chrX1742 ------
NM_003071chr321955 1350 ------
NM_003076chr12----1285 --
NM_003081chr2011028 11133 ----
NM_003100chr51117 ------
NM_003106chr331081 1014 784 ------
NM_003108chr257224 7047 6905 5942 680 25408 1077 14706 --
NM_003110chr171929 --1307 --
NM_003111chr22437 334 1899 --1926
NM_003112chr733100 620 303 22328 1273 --1792
NM_003114chr82833 31 --1155 --
NM_003115chr11369 ------
NM_003127chr9--1299 ----
NM_003128chr232159 2146 1080 2327 59 1578 --
NM_003137chr642099 1729 1692 138 11605 ----
NM_003156chr1121396 442 ------
NM_003161chr1742981 2710 2464 1301 22510 422 --1495
NM_003182chr71170 --171 --
NM_003182chr71170 --171 --
NM_003183chr22775 749 ------
NM_003185chr20--21246 948 ----
NM_003187chr5----266 26 --
NM_003188chr61863 --1277 133
NM_003199chr1875511 4882 4543 3888 3702 1745 1419 35352 4805 1897 11958 --
NM_003211chr1231304 1188 388 11493 1517 --
NM_003220chr61425 ------
NM_003234chr332363 2284 810 11491 11533 --
NM_003239chr144926 900 812 662 ------
NM_003242chr332445 2372 2076 1860 1489 11957
NM_003246chr1531800 521 148 1606 ----
NM_003247chr631757 271 39 --11364 1608
NM_003253chr2121177 146 ------
NM_003257chr155961 915 419 179 153 --1433 11128
NM_003262chr385241 5053 4554 4010 3440 3345 916 388 23820 822 ----
NM_003274chr21----1736 32322 2263 826
NM_003275chr92384 126 --1611 --
NM_003286chr20--1349 ----
NM_003291chr131671 --3800 288 133 1174
NM_003295chr132177 171 ------
NM_003298chr386170 4443 4055 3971 3809 1722 652 598 14810 14134 15501
NM_003300chr141388 ------
NM_003304chr331565 1476 247 ------
NM_003319chr2--1939 1202 --
NM_003337chr51693 11297 --1397
NM_003338chr1021468 209 --1461 --
NM_003339chr51123 --11106 --
NM_003340chr451026 559 475 346 152 ------
NM_003341chr31521 ------
NM_003342chr1763018 2927 2472 894 303 151 21220 1058 ----
NM_003344chr731316 244 229 1489 ----
NM_003348chr121466 --11056 --
NM_003358chr9----1103 --
NM_003372chrX3906 281 40 ------
NM_003373chr10------11932
NM_003379chr641085 937 907 451 1896 ----
NM_003387chr272852 2571 2440 754 390 138 99 --1598 12484
NM_003390chr1121084 380 ------
NM_003403chr143642 135 69 1833 ----
NM_003404chr2011701 ------
NM_003406chr841533 777 743 484 ------
NM_003410chrX31964 884 223 ----13001
NM_003412chr3--1889 ----
NM_003418chr32330 321 ------
NM_003423chr1922457 1029 12445 --11648
NM_003435chr19151 ------
NM_003453chr131293 1142 ----
NM_003458chr353639 3181 2487 1603 580 11363 --11444
NM_003463chr683108 2722 1054 829 673 608 270 75 --21272 821 13043
NM_003467chr22512 324 ------
NM_003471chr312239 1263 --11931
NM_003478chr1133281 396 211 13049 ----
NM_003483chr1211982 1386 ----
NM_003489chr2162905 2862 2486 1069 506 233 --1155 --
NM_003507chr221552 1367 --12037 --
NM_003528chr121743 1494 11418 ----
NM_003566chr1273293 3227 2978 2370 2326 1015 469 ------
NM_003574chr1864793 4743 4135 1721 1643 1631 ------
NM_003583chr1233690 2849 423 --11530 --
NM_003586chr161600 ----2222 184
NM_003589chr131556 --11235 11492
NM_003590chr2103833 3649 3194 3054 2623 1545 1506 1182 541 116 13927 ----
NM_003592chr7------1374
NM_003597chr232149 1918 502 ----11811
NM_003603chr431874 553 43 11687 1564 --
NM_003609chr16----137 --
NM_003615chr343321 3188 2933 2758 ------
NM_003618chr221328 860 ------
NM_003626chr1141042 383 260 45 ------
NM_003631chr101148 ------
NM_003632chr17------1699
NM_003644chr1785994 5904 4972 4891 2417 1569 1005 324 ------
NM_003646chr111564 ------
NM_003663chr373384 3113 2564 2509 2456 2337 327 ------
NM_003671chr933335 3266 231 13622 ----
NM_003672chr131804 1333 750 --31898 1777 314 --
NM_003677chr1241866 1494 367 153 21878 1654 2170 142 --
NM_003681chr2175309 5276 4262 4169 1603 877 156 ----170
NM_003692chr91951 --1928 --
NM_003716chr33892 327 316 1958 ----
NM_003722chr372630 2597 2053 841 585 533 499 ----12738
NM_003728chr41160 ------
NM_003749chr1342004 929 377 36 ----22437 2049
NM_003758chr151622 --156 --
NM_003758chr151622 --156 --
NM_003759chr423303 1248 32796 1627 757 --11528
NM_003760chr1----1228 --
NM_003762chr121216 410 ------
NM_003763chr2032793 2731 349 ------
NM_003766chr173186 100 63 ------
NM_003768chr1--1279 21310 681 --
NM_003772chr111841 --2235 227 --
NM_003773chr3162 ------
NM_003783chr141022 834 255 54 ----1243
NM_003787chr18--11332 ----
NM_003795chr64635 127 102 78 ------
NM_003800chr612294 21781 1604 ----
NM_003816chr83476 409 291 1981 ----
NM_003822chr163193 2578 2496 2356 2168 1134 23053 1034 ----
NM_003850chr131193 ------
NM_003861chr141432 --1757 12914
NM_003864chr4----162 --
NM_003872chr211936 --12528 --
NM_003877chr12124 1267 ----
NM_003885chr1722350 2263 12194 ----
NM_003887chr242050 766 594 206 --22144 2090 --
NM_003895chr2112201 --2874 496 --
NM_003909chr843039 2923 566 518 1666 ----
NM_003913chr654355 4094 1257 1232 427 ------
NM_003916chrX51432 1303 1152 1121 452 ----1310
NM_003930chr722376 137 2654 442 ----
NM_003931chr6------1646
NM_003934chr911230 --11055 --
NM_003941chr71551 187 11016 12060
NM_003947chr31148 ------
NM_003968chr3----1603 --
NM_003972chr1041125 1075 991 225 --2934 922 --
NM_003980chr621390 1183 ----1360
NM_003987chr10--11512 ----
NM_003988chr10--11589 ----
NM_003989chr10--11448 ----
NM_003990chr10--11448 ----
NM_003994chr1274420 1694 1398 1184 1015 558 326 1677 12758 --
NM_004006chrX22629 981 1276 --1310
NM_004007chrX22629 981 1276 --1310
NM_004009chrX22629 981 1276 --1310
NM_004010chrX22629 981 1276 --1310
NM_004011chrX22629 981 1276 --1310
NM_004012chrX22629 981 1276 --1310
NM_004013chrX22629 981 1276 --1310
NM_004014chrX22629 981 1276 --1310
NM_004015chrX22629 981 1276 --1310
NM_004016chrX22543 895 1190 --1224
NM_004017chrX22629 981 1276 --1310
NM_004018chrX22543 895 1190 --1224
NM_004020chrX22629 981 1276 --1310
NM_004021chrX22543 895 1190 --1224
NM_004022chrX22543 895 1190 --1224
NM_004023chrX22543 895 1190 --1224
NM_004028chr182497 446 --13193 13873
NM_004056chr81757 ------
NM_004063chr841003 943 936 805 --185 --
NM_004075chr12------1630
NM_004080chr741437 1165 249 61 21170 101 ----
NM_004081chrY11354 ------
NM_004087chr311993 11781 1146 --
NM_004090chr1752635 1271 1264 792 288 1435 ----
NM_004093chr1312250 22395 2026 ----
NM_004100chr632522 2364 329 ----1478
NM_004109chr11--1170 ----
NM_004114chrX11170 --1493 --
NM_004171chr11119459 9272 8178 8060 3320 2755 2743 2087 1378 562 438 --17113 --
NM_004183chr111108 --1545 --
NM_004193chr101498 ------
NM_004209chr1621081 929 ------
NM_004225chr841434 1247 1231 320 ----1473
NM_004226chr23254 242 89 ------
NM_004229chrX21742 642 --11756 --
NM_004232chr1843641 2844 2686 329 ----11496
NM_004235chr92659 643 ------
NM_004236chr151435 ------
NM_004238chr22272 93 ------
NM_004239chr141100 ------
NM_004241chr102673 71 ------
NM_004255chr15--1132 ----
NM_004261chr1--2828 272 ----
NM_004267chr32521 385 ------
NM_004272chr551793 1721 1697 694 237 --11256 --
NM_004274chr1462769 2640 2623 1080 609 433 --13153 --
NM_004277chr621613 1455 --11465 --
NM_004279chr731639 874 693 --275 34 --
NM_004291chr51397 ------
NM_004293chr923430 659 1746 13768 --
NM_004296chr1454020 3366 3207 1514 696 12558 ----
NM_004297chr91121 ------
NM_004316chr1221022 203 ----1817
NM_004330chr15----2415 327 --
NM_004331chr822608 2203 11937 12666 --
NM_004338chr1855015 4780 2594 1804 959 21058 166 21527 937 --
NM_004342chr71142 ------
NM_004344chrX1349 ----137
NM_004349chr811177 ------
NM_004352chr161113 ------
NM_004354chr41735 ------
NM_004370chr641905 1615 732 77 ------
NM_004376chr1031532 1066 529 11369 ----
NM_004389chr2177 2343 141 ----
NM_004392chr1352437 2200 943 849 727 22404 953 11903 --
NM_004397chr1143235 918 881 387 --1729 1698
NM_004432chr952384 2188 1864 1834 1678 12240 12133 --
NM_004434chr1421757 1352 --11513 --
NM_004438chr232704 2485 53 --32100 1287 268 13035
NM_004454chr332258 2112 1593 ----1294
NM_004457chr22591 528 ------
NM_004458chrX22062 1855 --1970 --
NM_004459chr1731823 1411 580 11536 ----
NM_004472chr51499 1202 ----
NM_004480chr141213 ----1246
NM_004484chrX122 ------
NM_004491chr1944284 3919 2650 1065 ------
NM_004500chr1442020 1508 319 107 ------
NM_004501chr143767 3734 3030 2503 21434 424 ----
NM_004504chr26905 797 752 630 527 223 --11021 --
NM_004505chr1721647 1275 ------
NM_004506chr6----127 --
NM_004514chr1722041 408 ------
NM_004516chr1911289 ------
NM_004520chr51730 ------
NM_004529chr91334 11348 ----
NM_004550chr11148 ------
NM_004565chr12707 688 ------
NM_004571chr2132296 1075 678 13141 ----
NM_004575chr421641 1227 ------
NM_004580chr1521747 1532 --2495 387 --
NM_004583chr171307 ----1759
NM_004586chrX35167 1634 514 33919 1957 1819 13340 --
NM_004593chr31231 ------
NM_004602chr2011064 ------
NM_004612chr934557 616 370 23626 564 23505 3227 11389
NM_004631chr131175 971 46 ------
NM_004654chrY136 --1180 --
NM_004655chr1721321 415 ------
NM_004660chrY21997 796 1757 --157
NM_004663chr1521537 1081 ------
NM_004667chr151677 --2589 247 --
NM_004673chr121294 318 --175 --
NM_004677chrY--1441 ----
NM_004685chr1342777 2583 617 387 11915 1934 --
NM_004687chr1721316 771 ----12079
NM_004708chr19190 ------
NM_004726chrX74889 4822 4480 2234 1605 1290 552 25194 741 14733 --
NM_004730chr541920 1887 1785 29 ----1853
NM_004734chr1333089 2656 505 ------
NM_004744chr463544 3167 3122 3058 516 469 11195 13956 --
NM_004745chr876568 6539 2620 2353 1504 1123 886 17016 --12678
NM_004748chr1531225 924 429 13541 --13902
NM_004755chr1441130 932 916 54 1886 ----
NM_004763chr221075 996 177 ----
NM_004768chr131024 383 278 ----11051
NM_004774chr1742946 2103 946 387 ----13166
NM_004775chr182822 733 1405 ----
NM_004781chr131433 1285 143 11683 1162 --
NM_004781chr131433 1285 143 11683 1162 --
NM_004785chr161397 ------
NM_004786chr18------1170
NM_004788chr1132596 2545 931 ------
NM_004791chr13175 1172 1514 --
NM_004795chr13143 ----11569
NM_004796chr1422429 2290 ------
NM_004798chr2073025 2919 2475 878 826 572 161 12851 ----
NM_004808chr1022224 148 31193 423 348 1581 1621
NM_004816chr91639 ------
NM_004824chr611136 ------
NM_004834chr243108 2266 945 379 ----1887
NM_004836chr23843 395 63 ------
NM_004841chr11235 ------
NM_004842chr631770 1468 500 1538 ----
NM_004844chr3185 ------
NM_004845chrX53519 3355 2606 983 32 ------
NM_004850chr21580 --21385 1201 1237
NM_004855chr151172 ------
NM_004859chr1762421 2284 2167 1041 618 601 1465 --11101
NM_004866chr554961 3840 3146 1226 219 --1757 --
NM_004873chr1423213 431 22998 2582 190 --
NM_004887chr551116 1093 1082 1057 994 1941 2906 821 --
NM_004893chr5133 ------
NM_004896chr1051492 1395 1363 1221 182 11431 11105 1410
NM_004902chr201239 1116 ----
NM_004904chr765835 4558 2591 2105 1055 49 25001 192 14526 16395
NM_004932chr511639 11424 --1702
NM_004938chr921091 488 11121 11157 --
NM_004947chr351045 627 490 262 171 12061 ----
NM_004948chr1821187 322 --2431 197 --
NM_004952chr12619 350 1798 ----
NM_004956chr764597 4563 3901 1275 942 805 --11042 --
NM_004968chr73736 668 31 ------
NM_004969chr102574 205 1463 ----
NM_004973chr621125 649 ------
NM_004985chr1264248 3440 1083 776 277 115 --24339 4300 --
NM_004993chr141276 1400 ----
NM_004998chr151243 --1797 --
NM_005010chr721571 869 ----11602
NM_005014chr9----175 --
NM_005028chr1021532 1451 ------
NM_005037chr31137 ------
NM_005044chrX74513 4315 3772 3742 1743 1696 548 12821 1573 --
NM_005045chr7136 ------
NM_005056chr1265116 4082 3887 3839 1121 436 14302 ----
NM_005057chr131867 1447 355 ------
NM_005065chr1444442 4367 3714 2049 35349 3461 712 34491 3273 1801 1547
NM_005080chr222838 294 1969 ----
NM_005087chr32835 752 ------
NM_005095chr12729 41 ------
NM_005103chr11--182 195 --
NM_005110chr53817 139 101 2837 769 ----
NM_005113chr141443 --1501 --
NM_005116chr2053893 3709 3322 82 41 --1720 --
NM_005119chr121148 1136 ------
NM_005121chr1753592 1541 1442 1222 1026 12743 1746 --
NM_005124chr611018 ------
NM_005126chr3--1142 22050 810 --
NM_005156chr965378 4422 3692 3635 3617 533 ------
NM_005157chr951797 542 532 502 271 --3765 610 53 --
NM_005168chr241555 231 171 100 ------
NM_005171chr1221303 1187 --134 --
NM_005180chr1031212 157 90 --1452 --
NM_005192chr141110 ------
NM_005197chr1444617 2134 1752 678 26000 1889 --15554
NM_005201chr32168 47 1715 --1285
NM_005204chr102628 168 1929 1186 --
NM_005214chr22987 812 --11108 --
NM_005215chr18------1753
NM_005221chr7--1275 ----
NM_005231chr1121172 255 ----11328
NM_005233chr322461 2060 31662 940 603 ----
NM_005235chr277520 7458 6772 5359 3006 2858 2833 24845 1531 26928 2684 --
NM_005238chr1133058 1088 460 1656 --12303
NM_005249chr141851 ------
NM_005252chr143720 577 526 ------
NM_005254chr1511062 --1566 --
NM_005256chr111252 ------
NM_005259chr221067 1061 ----2513 161
NM_005261chr81261 ----11008
NM_005264chr101232 ----132
NM_005271chr101184 ----274 42
NM_005274chr11107 ------
NM_005277chr431557 1485 696 --11653 --
NM_005284chr62485 198 --1466 --
NM_005295chr7--1258 ----
NM_005296chrX1401 ------
NM_005311chr742542 2411 2066 1758 ------
NM_005312chr922626 1658 ----12680
NM_005328chr81239 ------
NM_005339chr454341 3017 1293 450 275 12951 ----
NM_005348chr142891 805 --2866 244 --
NM_005358chr1341872 1719 1177 61 --11892 --
NM_005359chr1836231 5631 1080 ------
NM_005375chr62889 755 --1408 --
NM_005378chr21735 ------
NM_005389chr63804 766 280 ----136
NM_005392chr9----11772 --
NM_005398chr1011328 149 ----
NM_005400chr22616 513 1629 --21229 1081
NM_005401chr11157 ------
NM_005402chr741346 1313 699 596 1458 ----
NM_005417chr2051897 1590 1297 1228 700 ----11557
NM_005433chr181522 32074 834 509 124 --
NM_005436chr1054112 3929 2821 1287 232 --13085 11198
NM_005465chr131275 667 489 11619 21896 737 --
NM_005474chr17--11519 ----
NM_005491chrX22033 1410 --21447 321 --
NM_005493chr61693 ------
NM_005494chr71237 ------
NM_005496chr31129 ------
NM_005497chr1775797 5614 4531 3992 3791 737 198 1641 34151 2106 2080 --
NM_005499chr191453 ------
NM_005504chr1236611 4403 2588 11165 ----
NM_005509chr521900 1617 11606 11576 --
NM_005521chr101790 ------
NM_005542chr711285 ------
NM_005544chr21924 ------
NM_005561chr132614 149 ------
NM_005565chr5------1441
NM_005573chr5--1550 ----
NM_005578chr363997 3252 1357 736 466 194 15123 11263 --
NM_005587chr151807 ------
NM_005593chr12----192 --
NM_005596chr965560 5504 4771 4731 4574 1486 46425 6128 1848 821 16114 --
NM_005599chr11399 ------
NM_005604chr631860 487 432 ------
NM_005613chr132143 1750 700 --31684 371 365 --
NM_005618chr6164 ------
NM_005625chr83407 103 70 ------
NM_005626chr1286 48 ------
NM_005629chrX11363 ------
NM_005638chrX21759 1191 ------
NM_005639chr1231630 1247 101 ------
NM_005648chr81226 ------
NM_005656chr2121354 69 31574 1561 1323 ----
NM_005668chr544184 4001 3590 3535 --127 --
NM_005669chr51941 --2480 445 1627
NM_005688chr3--1198 ----
NM_005715chr61127 ------
NM_005717chr11918 ------
NM_005724chr153727 632 265 --1106 --
NM_005725chr152387 2074 2031 544 236 --12282 1787
NM_005733chr51211 ------
NM_005734chr111106 ------
NM_005738chr71708 --1442 --
NM_005746chr7--1188 21827 782 12755
NM_005748chr1242540 2507 250 100 2332 46 ----
NM_005749chr171699 --1141 --
NM_005751chr72372 196 ------
NM_005759chr254539 4051 3658 3443 2918 ------
NM_005765chrX1212 --1280 --
NM_005776chr141658 140 ----
NM_005779chr553203 2457 2263 890 790 --1178 --
NM_005780chr131737 ----1787
NM_005786chr1821131 153 --11291 --
NM_005795chr221925 370 ----22213 694
NM_005802chr91635 --1201 --
NM_005808chr363593 3258 2921 2575 1075 623 --23514 213 12471
NM_005819chr122880 353 --11249 --
NM_005822chr611683 12274 1477 --
NM_005826chr1--1634 ----
NM_005828chr1744425 3721 1705 81 --35094 4268 3822 --
NM_005832chr311040 --189 1157
NM_005834chrX----1213 --
NM_005839chr1------1132
NM_005840chrX76480 6438 2853 1031 962 688 422 17104 25806 2944 16688
NM_005842chr133548 231 171 ----166
NM_005843chr2----11404 --
NM_005845chr131361 --11297 --
NM_005851chr111406 ------
NM_005859chr531316 1280 628 --21039 37 --
NM_005862chr321023 713 1166 ----
NM_005868chr722387 631 2791 336 --12210
NM_005875chr31314 ------
NM_005879chr3134 1478 ----
NM_005885chr52351 39 ----11490
NM_005898chr1142491 2148 946 527 --32772 2545 841 2702 617
NM_005900chr42914 47 1865 ----
NM_005901chr1848566 7913 5982 988 11713 16537 --
NM_005902chr1554482 3359 979 435 50 13925 --1758
NM_005903chr575117 4419 1187 1120 766 535 273 12024 1832 --
NM_005905chr13197 ------
NM_005906chr6------2114 49
NM_005909chr584022 3449 3278 3005 1118 863 810 270 1745 ----
NM_005911chr221376 1210 2568 246 ----
NM_005923chr62629 427 ------
NM_005933chr1122313 163 11013 ----
NM_005935chr465042 4944 1558 1302 1217 188 --14583 14118
NM_005941chr812890 13660 21388 618 13483
NM_005955chr123837 1987 23864 981 --14451
NM_005964chr1741223 1013 376 140 ------
NM_005966chr22882 806 ------
NM_005977chr1321012 858 ------
NM_005990chr532781 1897 815 12549 --173
NM_005994chr17------1643
NM_005999chr131611 277 221 ------
NM_006007chr934414 1485 204 --24187 821 13580
NM_006016chr642325 2296 393 277 ------
NM_006022chr133248 167 132 --11007 --
NM_006036chr242321 761 644 193 --22262 1637 --
NM_006038chr2032127 727 114 --21737 1521 --
NM_006060chr754111 3960 3489 2792 1242 --23634 553 13511
NM_006080chr712996 12610 22466 673 --
NM_006095chr4104431 3442 3143 1144 984 929 625 573 433 148 ------
NM_006106chr1133382 3016 1037 --155 --
NM_006113chr142082 1838 1342 383 ------
NM_006133chr1132351 2338 521 --1410 12300
NM_006135chr121367 1272 ------
NM_006136chr721015 438 ------
NM_006141chr1662741 2341 2029 1895 187 88 ------
NM_006143chr12126 ------
NM_006148chr1711065 --12664 --
NM_006153chr33619 418 174 148 ----
NM_006158chr831318 1213 179 11563 ----
NM_006159chr122451 233 ------
NM_006164chr2--1105 ----
NM_006166chr1231788 1652 270 12613 --11842
NM_006178chr173237 166 121 ----1412
NM_006183chr12125 ------
NM_006190chr21191 --1856 --
NM_006194chr1441257 960 848 347 ------
NM_006195chr92888 32 11167 ----
NM_006203chr523926 70 11018 --14562
NM_006206chr442817 1043 797 442 ------
NM_006216chr21563 125 ----
NM_006226chr221301 209 ----11105
NM_006245chr62989 403 ------
NM_006246chr1421140 1047 ------
NM_006251chr543306 2072 1319 41 12719 41329 1232 1070 170 --
NM_006252chr167050 5107 3042 2924 2631 2541 1591 26039 5241 --
NM_006256chr142246 956 780 343 1631 1968 --
NM_006265chr8--1288 ----
NM_006267chr21456 ----21684 312
NM_006277chr24489 231 119 94 1169 1697 --
NM_006282chr2024400 1252 1900 1371 --
NM_006283chr834169 1438 127 11401 54879 4523 1674 1462 526 --
NM_006298chr632151 1343 639 12094 ----
NM_006306chrX25149 1327 --11450 --
NM_006307chrX1290 --154 --
NM_006310chr17180 ------
NM_006315chr454178 3982 3811 3072 729 --34147 2832 1559 --
NM_006320chr411163 ------
NM_006325chr121112 ------
NM_006330chr83437 386 124 --1191 --
NM_006334chr9194 2272 57 ----
NM_006359chrX42141 1910 1668 43 ------
NM_006364chr1411138 ------
NM_006367chr1------1993
NM_006371chr354754 4051 3389 3357 1205 ----14099
NM_006380chr1733825 3184 198 --31526 1317 465 --
NM_006386chr221157 --11615 --
NM_006390chr1231633 1396 328 --1603 --
NM_006393chr1032895 1731 778 24550 4285 1976 --
NM_006401chr91171 ------
NM_006420chr2042707 438 284 49 ------
NM_006434chr1043161 2753 2591 994 --12145 12152
NM_006451chr5--1129 1959 --
NM_006469chr12496 145 ------
NM_006474chr152017 1546 329 213 34 ------
NM_006482chr1233690 2849 423 --11530 --
NM_006489chr1452070 1889 1387 641 319 1114 ----
NM_006504chr1032485 317 165 12364 --12895
NM_006513chr1--1212 ----
NM_006517chrX32264 2180 2166 ------
NM_006534chr2022798 697 --13062 --
NM_006537chr15192 ------
NM_006540chr811569 --11495 --
NM_006548chr31395 --11655 --
NM_006557chr9----11648 --
NM_006558chr81373 --1401 1185
NM_006559chr111167 ------
NM_006561chr1056018 5630 2418 2223 1381 1269 12379 --
NM_006571chr82317 103 ------
NM_006575chr14--11466 --1985
NM_006595chr1111514 --1773 --
NM_006599chr1667081 6123 6077 5815 5334 1418 26439 5786 ----
NM_006601chr122223 103 ------
NM_006603chrX41416 1344 687 119 ------
NM_006614chr363084 3007 1423 1389 369 96 33698 3361 2455 ----
NM_006622chr51102 ------
NM_006624chr1022036 1577 ------
NM_006625chr121177 986 --11158 --
NM_006625chr121177 986 --11158 --
NM_006625chr121177 986 --11158 --
NM_006628chr1554604 4113 1013 680 201 11056 ----
NM_006633chr5--1612 --1322
NM_006650chr553623 3104 1154 904 380 12968 11213 --
NM_006654chr1224004 269 1447 --11167
NM_006660chr151262 ------
NM_006699chr131845 769 197 ------
NM_006706chr52652 544 ----1317
NM_006717chr942851 2645 2402 1288 ----12325
NM_006721chr10------1562
NM_006722chr311932 11075 1986 --
NM_006727chr51428 ----1452
NM_006729chrX95220 5100 4091 3458 2115 1958 1372 750 492 --41736 1413 1317 461 --
NM_006734chr651636 1504 1486 636 91 ------
NM_006746chrX21442 1210 21088 281 ----
NM_006754chr721030 50 --1310 1196
NM_006756chr821278 402 ------
NM_006766chr812461 --1267 --
NM_006769chr1--1554 ----
NM_006772chr611758 ------
NM_006775chr642216 2162 527 463 12117 22662 759 22741 875
NM_006791chr151241 ------
NM_006805chr531685 1311 537 ------
NM_006806chr211410 --1169 --
NM_006813chr61183 ------
NM_006815chr1231375 1298 983 ------
NM_006823chr831398 1167 514 ------
NM_006827chr1452819 1188 951 688 62 1675 22078 1028 --
NM_006832chr142707 70 --1844 --
NM_006838chr1221830 81 1109 1588 --
NM_006852chr1741928 1766 925 302 --32664 2164 582 --
NM_006870chr20------1147
NM_006873chr2--13152 ----
NM_006874chr41834 --1402 --
NM_006886chr20160 ------
NM_006888chr1441206 601 317 172 --21086 490 1969
NM_006899chr20--1330 ----
NM_006902chr172949 2916 2709 2429 2162 1055 45 1907 ----
NM_006908chr721496 996 ------
NM_006914chr91468 11083 3530 524 165 --
NM_006918chr1125732 5327 25530 4298 1336 --
NM_006920chr242002 1363 592 573 ------
NM_006922chr232238 1932 1728 1689 ----
NM_006937chr17----1495 --
NM_006939chr142745 739 ------
NM_006940chr1211204 ------
NM_006948chr2111731 --22391 305 1412
NM_006950chrX2834 195 ----1671
NM_006951chr101262 ------
NM_006981chr922823 452 --12769 32279 997 865
NM_006996chr131825 693 492 --11186 --
NM_006997chr103357 152 108 139 1348 --
NM_007006chr1633359 2924 1084 ------
NM_007008chr22639 142 1846 ----
NM_007011chr1585778 5335 4698 4677 2208 2156 1126 135 ------
NM_007013chr81734 ----1150
NM_007017chr5----1281 --
NM_007023chr21187 --1747 --
NM_007034chr11986 1700 11013 1402
NM_007038chr2155560 4846 4424 1330 22 ------
NM_007039chr1421834 161 12294 11694 --
NM_007050chr2067275 7178 5776 5769 2385 1051 37547 6757 5741 --12449
NM_007054chr523527 602 --23968 3135 12963
NM_007067chr1731540 1302 1270 ------
NM_007078chr1021034 167 --21925 1218 --
NM_007111chr131176 --2839 133 --
NM_007118chr5--1877 ----
NM_007124chr621335 545 21824 230 ----
NM_007125chrY1176 1111 1929 --
NM_007126chr92520 461 ------
NM_007129chr131747 ------
NM_007135chr92171 39 ----1137
NM_007145chr1921004 448 --1169 --
NM_007146chr1742391 2091 1846 925 11840 31071 518 484 22876 591
NM_007159chr321570 1128 1234 11750 --
NM_007166chr111429 ------
NM_007172chr2232762 2755 904 ----1953
NM_007175chr813499 ----12639
NM_007187chr133744 723 25 ----11057
NM_007202chr172786 534 ------
NM_007207chr11654 ------
NM_007214chr6------1875
NM_007217chr31337 ------
NM_007219chr203764 671 64 ------
NM_007222chr811196 --11323 --
NM_007240chr11180 ------
NM_007242chr16--1165 ----
NM_007246chr411049 ------
NM_007249chr1349340 8320 6818 2251 13620 16711 12193
NM_007259chr11499 ------
NM_007269chr11581 177 ----
NM_007282chr311012 ------
NM_007308chr41465 ------
NM_007313chr951797 542 532 502 271 --3765 610 53 --
NM_007315chr23444 339 194 11314 11408 --
NM_007358chr12359 281 1636 1150 --
NM_007373chr1021312 242 ------
NM_007374chr141406 --1483 --
NM_012069chrX3468 430 145 12482 12376 --
NM_012081chr543628 3380 3094 794 ----11097
NM_012082chr81963 ------
NM_012084chrX1550 ----174
NM_012092chr231594 1460 726 ------
NM_012093chr13877 265 181 ----11022
NM_012095chr1012786 ------
NM_012096chr333653 3565 375 13588 --13490
NM_012097chr222039 1469 ----1745
NM_012104chr1122517 2373 --13003 --
NM_012104chr1122517 2373 --13003 --
NM_012109chr191494 ------
NM_012111chr141199 ------
NM_012115chr61237 1615 1511 --
NM_012157chr3--1866 ----
NM_012158chr1331524 1233 354 ------
NM_012160chr61464 2379 346 ----
NM_012164chr987315 6936 6824 2801 1519 1280 894 203 ------
NM_012180chr4--1585 ----
NM_012193chr1175297 4624 4559 1478 946 787 83 11927 ----
NM_012197chr921248 1058 1629 ----
NM_012214chr245317 4580 2306 63 ------
NM_012215chr1021505 1202 11976 ----
NM_012218chr1962889 2361 2336 2047 81 66 --12030 --
NM_012234chr352972 2698 2313 882 308 22361 1372 ----
NM_012238chr1011410 --2708 564 --
NM_012243chr12295 149 ------
NM_012247chr101767 ------
NM_012248chr16----1167 --
NM_012249chr273563 3133 2765 2363 1407 1401 763 ------
NM_012250chr112929 254 ------
NM_012252chr732089 676 479 157 1786 --
NM_012257chr72782 326 ------
NM_012259chr631283 1276 1223 31424 1345 1113 ----
NM_012262chr145196 4669 3994 2107 45153 4610 4338 3811 13195 --
NM_012281chr752464 2458 1796 1547 482 ------
NM_012286chrX1204 ------
NM_012287chr363197 1808 1168 881 679 349 11814 14335 --
NM_012288chr634825 4239 582 15611 25126 2293 --
NM_012290chr21621 ----11422
NM_012294chr743443 2549 642 370 ----1342
NM_012297chr452541 1801 1785 460 281 11747 11711 --
NM_012300chr532493 770 530 12518 12109 --
NM_012301chr742103 1889 1386 557 ------
NM_012309chr1134434 3903 280 34387 3679 827 23658 1025 --
NM_012316chr174630 4355 4117 2162 1121 1048 271 ------
NM_012317chrX1660 ------
NM_012319chr182261 86 ------
NM_012322chr71310 ------
NM_012328chr711129 11088 ----
NM_012329chr1721224 1130 --1527 --
NM_012334chr574082 3772 3716 1620 600 585 245 11341 1823 --
NM_012345chr131514 2279 167 ----
NM_012382chr533840 3442 174 --34335 2951 753 --
NM_012388chr151702 13034 --13042
NM_012395chr743337 2973 2189 270 ------
NM_012399chr2221535 231 --1162 --
NM_012406chr1251196 1137 1113 854 435 ------
NM_012416chr91351 ------
NM_012417chr171105 ------
NM_012420chr1012203 --1156 --
NM_012425chr1042768 2337 489 438 1338 ----
NM_012428chr154960 937 302 129 2847 715 ----
NM_012448chr1732503 428 383 ------
NM_012454chr61496 ------
NM_012471chrX11589 ------
NM_012475chr12220 192 ------
NM_012479chr722609 2238 1254 12446 --
NM_012482chr1----1252 --
NM_013231chr1414253 --14071 --
NM_013242chr162378 160 ------
NM_013257chr832037 1718 747 1428 ----
NM_013261chr473499 2721 1155 956 372 306 238 1894 23694 3066 --
NM_013267chr122459 366 --1372 157
NM_013281chr2021513 945 --11338 --
NM_013283chr51902 1788 1604 --
NM_013293chr72738 527 ------
NM_013308chr3--1377 ----
NM_013341chr232080 2000 298 --12526 --
NM_013372chr1523035 2914 ------
NM_013374chr332439 1079 179 --11173 --
NM_013381chr122673 383 21971 445 1733 --
NM_013390chr971802 1531 1470 1179 1143 556 169 --11204 --
NM_013411chr142191 1865 1084 674 32539 2076 2063 12781 --
NM_013417chr91125 --167 --
NM_013423chrX21230 920 11163 --1965
NM_013427chrX21230 920 11163 --1965
NM_013444chrX--1334 11022 --
NM_013449chr1241898 754 508 354 ------
NM_013943chr163249 3078 2882 2434 2344 669 --1108 --
NM_013989chr14105009 4957 4375 4021 3597 3496 985 885 546 315 14405 ----
NM_013995chrX52403 2273 1868 845 384 12523 21845 1679 162
NM_013996chr71170 --171 --
NM_013996chr71170 --171 --
NM_013997chr71170 --171 --
NM_013997chr71170 --171 --
NM_013998chr71170 --171 --
NM_013998chr71170 --171 --
NM_014000chr10------11932
NM_014011chr232419 2395 2272 ----12448
NM_014016chr331697 1068 135 ----11458
NM_014021chr133407 2807 1078 --11348 --
NM_014028chr622726 1016 --13231 23313 258
NM_014034chr631222 992 499 ------
NM_014038chr71383 ------
NM_014043chr331604 1544 1370 --186 --
NM_014048chr1644287 3782 3654 1491 34796 4316 3221 35175 898 316 --
NM_014089chr13----21774 339 --
NM_014110chr1--1139 ----
NM_014112chr855434 4491 4421 3719 1588 25456 1568 2747 658 --
NM_014117chr1642131 2073 753 473 1598 21804 786 --
NM_014141chr774719 4705 4688 4634 4622 4494 1635 15252 24900 3341 13419
NM_014154chr321027 490 --1646 --
NM_014155chr1157283 6688 4610 2127 1391 ------
NM_014171chr22260 90 1704 ----
NM_014182chr121643 ------
NM_014189chr431510 605 234 ----11389
NM_014190chr421862 586 ----11741
NM_014212chr122922 703 ------
NM_014217chr121900 445 ------
NM_014240chr333120 1358 870 14147 ----
NM_014243chr421408 71 21490 847 11649 --
NM_014253chrX1295 1778 11887 11732
NM_014264chr4----1438 --
NM_014268chr182138 68 ------
NM_014282chr911176 1120 ----
NM_014284chr111083 ------
NM_014309chr2254392 1731 846 696 533 ----24961 3440
NM_014317chr10------1286
NM_014319chr1211837 11798 ----
NM_014321chr161808 ------
NM_014323chr2221012 682 1896 ----
NM_014333chr1132761 2327 1867 ------
NM_014344chr112773 673 ------
NM_014345chr62761 298 ------
NM_014350chr5----1352 1786
NM_014351chr2231485 67 24 --1197 1282
NM_014368chr911957 ------
NM_014376chr552496 1899 642 457 164 ------
NM_014392chr41300 11027 --11581
NM_014393chr82878 101 --42089 1977 1700 157 --
NM_014410chr181316 ------
NM_014415chr321441 608 ----21693 1320
NM_014417chr193911 874 100 ------
NM_014423chr544800 4030 2089 678 44489 4394 3485 1041 25485 646 --
NM_014432chr62236 172 --2471 368 --
NM_014445chr332056 1879 884 1473 ----
NM_014447chr421492 443 ------
NM_014454chr62824 744 1342 ----
NM_014456chr1021583 642 11864 --11906
NM_014458chr111405 2904 445 ----
NM_014473chr51385 --1460 --
NM_014491chr72876 347 ------
NM_014521chr241462 1376 1271 146 11769 ----
NM_014548chr1521115 545 --1399 1183
NM_014554chr1232062 1805 1601 ----12084
NM_014571chr132731 1871 1090 12106 ----
NM_014574chr14195 ------
NM_014577chr22153 --1631 --
NM_014584chr1411531 ------
NM_014585chr221094 49 --21134 869 --
NM_014600chr241628 1616 1084 1030 --2112 98 --
NM_014606chr421247 1056 31555 1303 449 ----
NM_014612chr911078 ------
NM_014614chr221359 1221 ------
NM_014615chr1643174 1119 670 120 ----12612
NM_014616chr363150 3011 1283 1055 835 203 ------
NM_014618chr9------1307
NM_014623chr61201 ------
NM_014630chr1553517 3161 2689 1607 907 ------
NM_014637chr831324 223 209 --21234 366 --
NM_014647chr16--11735 2859 386 --
NM_014659chr151141 ------
NM_014660chr72454 330 ----21117 1102
NM_014670chr221550 456 ----11442
NM_014674chr343860 1523 1264 252 ------
NM_014676chr11324 --1200 11339
NM_014677chr831262 378 89 1298 ----
NM_014682chr842229 1683 1468 74 ------
NM_014683chr1751730 1498 853 568 467 ----1711
NM_014685chr162448 127 ------
NM_014686chr1952341 1990 1004 481 265 ------
NM_014701chr1543129 2319 878 782 --22207 1068 1833
NM_014702chr622472 559 --33469 443 397 --
NM_014705chr722107 1401 --21884 1709 --
NM_014711chr1661608 832 771 616 502 250 ------
NM_014715chr111920 ------
NM_014717chr19--1727 ----
NM_014720chr101476 ------
NM_014721chr6105856 5095 4576 2673 2619 1853 748 725 703 656 15785 16647 17297
NM_014727chr191254 ------
NM_014729chr8--11902 11808 --
NM_014732chr1695841 5688 5606 5302 4703 4679 2010 1598 1199 --21371 991 15526
NM_014735chrX31676 1593 1583 ------
NM_014743chr43806 775 530 --23133 895 --
NM_014746chr254128 4039 3938 1736 619 --24134 4113 --
NM_014747chr175792 4422 4373 623 617 360 112 15517 --24021 3635
NM_014752chr1131847 1833 328 21841 1410 ----
NM_014755chr284068 3699 3222 3126 1517 1391 921 80 14157 24203 792 13276
NM_014764chr1221175 108 2812 174 ----
NM_014765chr142627 2566 880 92 --11713 --
NM_014766chr793733 3618 3450 3411 3102 2785 1288 639 503 11099 1213 --
NM_014776chr1242632 1184 599 493 33155 2821 434 ----
NM_014781chr82994 489 199 ----
NM_014786chr1161250 898 436 383 243 112 ------
NM_014787chr152710 2369 1776 451 101 --22465 2077 --
NM_014790chr51186 --1206 --
NM_014798chr1711572 11841 ----
NM_014810chr123635 3255 ------
NM_014812chr111980 ------
NM_014819chr52490 116 ------
NM_014820chr351782 1436 667 533 228 1283 11264 12075
NM_014822chr41605 1435 ----
NM_014835chr2021464 898 --1643 --
NM_014836chr10--1666 21770 1544 --
NM_014839chr132182 2167 402 22449 484 ----
NM_014841chr611367 ------
NM_014844chr1444142 3440 274 255 14175 1600 --
NM_014850chr33957 432 77 --1382 --
NM_014859chr1711091 11096 11423 --
NM_014872chr942285 2138 2025 1585 --1146 --
NM_014873chr154490 4398 2992 213 74 ------
NM_014876chr2241988 1411 511 54 --11652 12019
NM_014877chr1797069 6843 6047 5806 5456 2773 2287 873 400 --36488 5746 2796 --
NM_014882chr2--1587 ----
NM_014885chr4169 ----1185
NM_014892chr6--1439 ----
NM_014893chrY1906 ----1786
NM_014903chr1231978 1603 1575 12269 ----
NM_014904chr1083769 3437 3373 2637 1165 918 534 492 ----23597 2894
NM_014905chr241494 750 223 68 --31358 459 335 --
NM_014906chr171946 --11158 --
NM_014912chr1052723 2451 2164 1033 392 1893 ----
NM_014913chr181274 21379 249 ----
NM_014914chr2----11134 --
NM_014923chr1341538 557 413 48 ------
NM_014932chr31634 --21955 360 --
NM_014934chr1353770 3177 1413 1348 245 1205 1915 13417
NM_014936chr622528 2385 1423 --12567
NM_014945chr531835 1609 1579 --21692 26 --
NM_014946chr221993 1182 --1739 --
NM_014947chr11196 12697 13124 --
NM_014950chr1431348 619 310 ------
NM_014952chr15--11922 ----
NM_014953chr1334230 1467 206 ------
NM_014962chr2022411 2379 --1849 --
NM_014963chr19122 ----1411
NM_014969chr12132 25 --1353 --
NM_014982chr1424246 294 --34371 1579 1036 --
NM_014988chr422017 419 --22121 1970 --
NM_014989chr672067 2056 1845 1531 1432 1313 216 --21765 297 --
NM_014990chr1411278 --1265 --
NM_014991chr412674 22528 945 12560 --
NM_014992chr141260 ------
NM_014994chr1522370 947 --2962 954 --
NM_014997chr732427 2419 185 1906 2231 225 --
NM_014999chr12----1597 11505
NM_015000chr1222663 1153 1937 1285 1769
NM_015001chr1----1646 --
NM_015004chr3------1110
NM_015008chr322609 46 ----13300
NM_015009chr31704 ------
NM_015017chr111146 --156 165
NM_015018chr6------2236 34
NM_015020chr1633695 3304 2973 ------
NM_015024chr8----1333 --
NM_015025chr21262 2238 213 12191 --
NM_015026chr1254171 1873 1855 673 257 1429 ----
NM_015027chr1621311 188 --1194 --
NM_015032chr1322409 166 1627 ----
NM_015035chr20105154 4282 4152 2688 2347 2242 1186 1112 868 89 12493 11983 --
NM_015039chr183976 2688 1579 1108 445 406 367 289 14363 1719 --
NM_015040chr273358 3214 3058 2593 381 256 75 ------
NM_015042chr1513956 --33699 2863 2857 --
NM_015044chr1642874 2096 991 370 ------
NM_015049chr233110 1010 67 --21035 56 13131
NM_015052chr71404 1231 ----
NM_015055chr1132874 2401 1059 ------
NM_015057chr132680 156 ------
NM_015061chr91820 ------
NM_015062chr101271 ------
NM_015068chr722570 2463 --33586 1077 764 --
NM_015071chr576483 6307 5573 5123 1482 626 519 11002 1187 --
NM_015073chr1911865 ------
NM_015076chr653740 3441 1768 1169 775 --11547 23711 1537
NM_015087chr1331741 1713 281 --22419 2298 12569
NM_015090chr165214 3794 2257 1820 1341 591 35505 5304 1444 --15002
NM_015091chr141821 ------
NM_015092chr1624625 871 --11235 --
NM_015097chr331813 543 276 1180 ----
NM_015100chr1144 --12065 --
NM_015107chrX32281 806 480 ------
NM_015115chr461290 1110 609 525 126 88 1632 12708 --
NM_015125chr191537 ------
NM_015129chrX41771 1245 551 122 --1383 --
NM_015132chr751964 1879 1830 1634 1285 11945 ----
NM_015137chr821963 250 11973 --11784
NM_015138chr1532656 2213 34 --12333 --
NM_015143chr4147 ------
NM_015149chr142145 1825 1404 287 --2276 270 --
NM_015153chr6------1273
NM_015155chr1033095 2444 764 ----13283
NM_015156chr1433595 1146 231 --12726 11540
NM_015170chr812289 ------
NM_015176chr141583 675 623 60 --1305 --
NM_015185chrX42235 2167 661 271 ------
NM_015186chr9145 ------
NM_015192chr2031071 1008 223 32965 2616 1033 1484 1985
NM_015200chr421842 1822 --22589 1671 --
NM_015202chr16--21312 1253 11113 --
NM_015205chr13104190 3826 3600 3440 3307 1013 523 510 407 234 --174861 4587 3807 3775 3756 3750 3670 3584 3533 3515 3478 3402 3380 3327 3273 3264 3235 13708
NM_015206chr1523430 3208 23871 3167 ----
NM_015208chr1843147 3013 776 710 11148 22712 597 --
NM_015215chr122536 860 33121 3066 3009 --180
NM_015216chr541446 1174 506 68 --1605 11392
NM_015230chr4--149 ----
NM_015236chr421003 575 ------
NM_015246chr1692060 1844 1772 1763 1725 1695 1683 1624 98 --11706 --
NM_015250chr941370 318 201 127 --11851 --
NM_015263chr153923 386 173 ------
NM_015265chr211901 22603 1741 ----
NM_015267chr1211744 ------
NM_015270chr1232341 1943 540 1206 ----
NM_015271chr424312 3150 13488 1913 --
NM_015272chr1661820 1749 827 580 563 544 ------
NM_015275chr1251723 1657 1475 413 319 ----11685
NM_015285chr1841747 517 207 150 --11655 --
NM_015291chr162828 2771 1000 448 387 46 12568 1797 --
NM_015293chr61141 ------
NM_015296chr131891 ----1935
NM_015305chr1451356 454 429 276 75 --1445 --
NM_015308chr112286 136 --1878 --
NM_015310chr896792 6314 6304 6286 6208 5939 2970 2930 1921 --36327 6090 5831 18396
NM_015313chr1154397 3748 3677 3279 491 ------
NM_015315chr542564 2477 1050 418 ------
NM_015317chr221874 857 1562 11015 --
NM_015335chr1222361 150 --12169 --
NM_015339chr20130 ----1807
NM_015344chr81489 --12131 1313
NM_015349chr612234 --12453 --
NM_015355chr171172 --1184 --
NM_015358chr212938 132 ------
NM_015360chr51158 ------
NM_015365chrX22761 1348 --14183 --
NM_015378chr1----2299 251 --
NM_015381chr2231324 805 575 ------
NM_015382chr142540 139 ------
NM_015385chr1043161 2753 2591 994 --12145 12152
NM_015387chr2181 --1510 --
NM_015388chr6184 ------
NM_015423chr1141644 1077 249 180 ------
NM_015429chr331081 725 456 1750 ----
NM_015435chr831361 1082 65 --11016 1511
NM_015436chr483109 3081 2351 2296 1061 448 335 91 22511 925 --12323
NM_015442chr31233 ------
NM_015443chr1721262 87 --11418 --
NM_015446chr12431 324 --11159 --
NM_015455chr531115 980 190 13516 11499 --
NM_015460chr3----12097 --
NM_015461chr18155 --1209 1573
NM_015475chr21808 --2685 347 21036 295
NM_015477chr152831 60 1268 1281 --
NM_015483chr72773 186 ------
NM_015488chr221728 1674 --11450 --
NM_015493chr19--11873 ----
NM_015509chr1231454 629 266 ------
NM_015514chr141566 ------
NM_015520chr342633 1117 836 191 ------
NM_015523chr11----1232 --
NM_015535chr243172 1634 660 490 12674 2696 407 --
NM_015542chr1031157 810 798 ------
NM_015548chr63985 655 252 --1402 --
NM_015550chr753608 2720 2428 974 423 13367 --1669
NM_015554chr1522826 2712 ----22741 988
NM_015555chr63568 205 118 1213 1184 --
NM_015564chr551288 1281 922 516 403 ----13188
NM_015565chr2122054 553 --12204 --
NM_015567chr1311079 ----11307
NM_015569chr133376 3099 932 --54815 4559 4192 3297 1300 1660
NM_015570chr7--2608 351 --1435
NM_015576chr362862 2555 2094 1200 934 822 --21169 71 --
NM_015577chr521776 99 1702 ----
NM_015601chr101932 ------
NM_015602chr111240 --1241 --
NM_015609chr122992 168 ------
NM_015626chr1711195 --1313 --
NM_015630chr221112 729 ------
NM_015640chr164376 1742 604 474 257 62 --33263 1865 298 14907
NM_015641chr721237 511 --11014 --
NM_015646chr1241078 929 862 329 11258 1298 --
NM_015652chr102662 549 ------
NM_015678chr1311689 1218 --11737
NM_015687chr6----188 1578
NM_015691chrX42598 1167 531 434 ----12767
NM_015850chr831658 1599 677 1327 ----
NM_015869chr31137 ------
NM_015878chr821950 1785 21730 1710 --1260
NM_015885chr111332 ----1880
NM_015886chr841590 1490 1323 52 14890 44490 3530 415 384 35115 3807 728
NM_015888chr123118 1233 22292 459 1139 --
NM_015898chr1912503 ----12036
NM_015902chr8--1606 ----
NM_015904chr21197 ------
NM_015905chr7--1600 ----
NM_015906chr174006 3927 3755 3615 3394 3386 1088 13216 ----
NM_015912chr852130 1863 1584 881 734 ------
NM_015915chr14--170 1206 --
NM_015939chr202144 109 ------
NM_015941chr81160 ------
NM_015980chr51232 31399 1351 267 ----
NM_015990chr4------1733
NM_015995chr1555550 5170 5092 4844 836 15501 ----
NM_016009chr134290 3506 1535 11275 11150 --
NM_016021chr642473 2182 844 642 --1890 --
NM_016023chr822028 1981 ------
NM_016025chr1631786 1282 121 11456 ----
NM_016027chr81398 1548 ----
NM_016037chr121156 358 ------
NM_016040chr122286 695 --32490 2061 502 12688
NM_016053chr121108 --129 --
NM_016061chr231634 1342 213 1672 11617 --
NM_016063chr61689 ------
NM_016072chr12------1622
NM_016073chr151284 ------
NM_016075chr13112942 2771 2563 2500 1030 990 677 480 433 47 35 ----12364
NM_016076chr132893 2469 1270 197 33031 822 783 --
NM_016078chr173882 265 248 1278 ----
NM_016081chr421938 100 11719 31974 1850 1729 --
NM_016083chr653235 2842 2824 2426 1518 13527 ----
NM_016090chr11--1223 --1876
NM_016097chr1821013 39 ------
NM_016103chr5--2497 486 168 --
NM_016128chr31340 ------
NM_016129chr4--1300 ----
NM_016131chr231792 776 429 11461 ----
NM_016132chr1512582 --12225 12782
NM_016133chr231070 357 306 --11034 --
NM_016138chr161279 --1295 --
NM_016141chr32511 51 ----1326
NM_016142chr111934 --21085 47 --
NM_016162chr124835 701 647 602 ----1566
NM_016192chr22256 95 ------
NM_016195chr10191 1566 1886 --
NM_016205chr41290 --1923 --
NM_016206chr378304 7953 7721 6593 1702 1674 563 27917 1534 25656 1874 --
NM_016224chr611629 --12126 --
NM_016248chr132936 223 --22780 252 --
NM_016252chr2--1936 1837 --
NM_016255chr633138 3095 2936 --1642 --
NM_016257chr143500 2789 2610 1306 ------
NM_016260chr287372 7360 6816 5365 4851 2700 2388 2098 --17412 --
NM_016262chr6----1560 --
NM_016272chr221778 --22009 275 --
NM_016287chr1--12035 ----
NM_016289chr22603 194 ----1524
NM_016306chr3------1102
NM_016308chr111876 ------
NM_016315chr251393 447 422 402 52 11401 ----
NM_016319chr123632 514 295 --1771 --
NM_016320chr1121023 31 ------
NM_016338chr5----1992 1245
NM_016351chr71474 --2556 409 --
NM_016357chr12----1237 --
NM_016373chr161861 1633 ----
NM_016374chr12588 326 ----1499
NM_016374chr12588 326 ----1499
NM_016376chr1734032 2773 1651 ------
NM_016377chr631770 1468 500 1538 ----
NM_016396chr1552117 2013 1141 1092 521 12843 1689 --
NM_016424chr1791813 1743 1726 1500 1442 1435 456 424 102 ------
NM_016436chr2041681 915 399 87 12576 ----
NM_016448chr111783 --2463 194 --
NM_016451chr111231 ------
NM_016470chr20123 ------
NM_016472chr1431245 1145 233 ------
NM_016485chr652197 1680 1507 713 25 ------
NM_016507chr1712007 --12978 --
NM_016516chr2--1723 ----
NM_016530chr1543946 3519 3065 386 23864 2708 1224 13717
NM_016531chr453552 3482 3093 2664 332 23737 890 33806 3308 91 1300
NM_016544chr252521 2499 1475 972 24 ------
NM_016603chr531750 1371 718 --11878 11863
NM_016607chrX2464 202 ----11547
NM_016620chr121302 481 11282 11338 1262
NM_016621chr1123733 3663 21214 616 --1197
NM_016623chr82612 242 ------
NM_016626chr1821453 486 ------
NM_016628chr101922 ----1329
NM_016631chr211316 --1767 2825 636
NM_016644chr55522 356 347 176 149 ------
NM_016651chr14----21115 1000 --
NM_016654chr1511062 --1566 --
NM_016824chr10--11467 --183
NM_016830chr121555 ------
NM_016929chr634007 3964 3849 21015 713 --1358
NM_016930chr4165 ----11027
NM_016950chr421011 340 --2427 225 --
NM_016953chr265904 5750 5289 4775 1271 128 --14744 11920
NM_016954chrX--1435 --2244 35
NM_017409chr121777 1318 ----
NM_017410chr1211257 ------
NM_017412chr821304 98 1418 ----
NM_017415chr534486 3640 1830 22834 2804 ----
NM_017420chr1483556 3266 3060 2927 2674 2665 2379 473 --2486 117 --
NM_017423chr432107 2075 1847 11884 ----
NM_017440chr121461 ----1242
NM_017447chr2164394 2849 2804 2737 1375 245 23323 1640 --155
NM_017452chr2011064 ------
NM_017453chr2011064 ------
NM_017454chr2011064 ------
NM_017455chr154960 937 302 129 2847 715 ----
NM_017488chr2--11015 ----
NM_017519chr611338 ------
NM_017522chr131175 971 46 ------
NM_017526chr14535 237 95 60 --169 --
NM_017544chrX167 ------
NM_017545chr202382 46 ------
NM_017558chr161451 ------
NM_017582chr121637 369 ------
NM_017594chr932820 2334 86 --42886 998 353 324 13133
NM_017595chr1731355 477 452 ------
NM_017610chr1541436 1379 1370 422 ------
NM_017615chr10155 ------
NM_017628chr444766 4561 3710 139 1947 1109 15161
NM_017629chr12609 42 --1400 --
NM_017633chr643869 1011 656 126 ------
NM_017634chr8----11493 21461 390
NM_017637chr966624 3701 1696 1479 817 756 --57194 3484 2729 627 294 13237
NM_017640chr61273 ------
NM_017641chr1231183 851 377 ------
NM_017643chr17------1481
NM_017644chr335118 762 621 ----1100
NM_017645chr923094 86 22767 2078 12440 --
NM_017650chr745142 4760 1358 410 14725 ----
NM_017658chr1483908 3738 3541 2949 1244 1189 1000 537 --44520 1215 992 306 --
NM_017661chr154944 933 516 424 ------
NM_017667chr72176 76 ----1460
NM_017670chr11----158 --
NM_017676chr531741 1176 1156 1203 ----
NM_017693chr1321500 1249 ------
NM_017694chr262061 1933 1832 518 114 83 ------
NM_017709chr12644 273 ----12725
NM_017737chr132153 2095 122 --21374 48 --
NM_017742chr1821424 116 11958 1629 1228
NM_017744chr131792 853 112 ------
NM_017745chrX3236 160 21 ------
NM_017747chr51277 --1307 --
NM_017748chr172861 594 ------
NM_017749chr1121031 80 ------
NM_017752chrX22113 306 --11746 1290
NM_017754chr664782 4684 4343 3641 1057 796 --13625 23410 1403
NM_017768chr14963 919 870 31 ------
NM_017769chr1442929 2732 636 497 ----12903
NM_017770chr642048 2013 1156 82 --1874 --
NM_017780chr8--1898 1964 --
NM_017789chr21310 ------
NM_017799chr1411265 1186 ----
NM_017810chr16145 ------
NM_017813chr875311 5264 3801 1784 1356 866 89 11301 25107 4473 1496
NM_017824chr1042049 691 359 328 11804 ----
NM_017847chr131562 883 220 22293 242 ----
NM_017848chrX13693 14081 1944 --
NM_017869chr161624 ------
NM_017893chr101194 11104 1483 --
NM_017902chr1075106 3706 3508 2045 1734 355 344 ------
NM_017910chr2----1366 --
NM_017913chr91379 ------
NM_017915chr122174 58 11086 ----
NM_017917chr141106 ------
NM_017919chr955589 3693 1110 793 34 11208 --15840
NM_017922chr14--1614 ----
NM_017925chr931729 1587 1466 ------
NM_017933chr221562 1513 1513 ----
NM_017938chrX3755 707 99 ------
NM_017944chr1112496 22444 741 11059 12410
NM_017955chr1431134 901 358 ------
NM_017987chr1071993 1915 1783 1518 1376 718 206 1221 ----
NM_018008chr3--1347 ----
NM_018010chr331505 1224 1102 ----11514
NM_018027chr1042395 2382 2056 1017 13144 12903 --
NM_018030chr181267 1846 ----
NM_018045chr12846 514 1801 11032 --
NM_018054chr161503 ------
NM_018084chr252934 2415 2060 1050 25 22628 2619 ----
NM_018085chr187538 6921 6252 2772 1742 1322 768 225 --2872 653 --
NM_018092chr1621524 1259 11253 ----
NM_018094chrX1395 ------
NM_018098chr341139 893 486 410 1194 ----
NM_018120chr841518 450 287 128 --11345 --
NM_018121chr1042560 746 714 558 ------
NM_018126chr41981 21309 306 ----
NM_018131chr105886 838 732 142 128 ------
NM_018133chr311355 ------
NM_018150chr11107 --2133 117 2370 347
NM_018155chr333172 2971 2615 ----1111
NM_018156chr1----2299 251 --
NM_018157chr1253184 2353 2159 2095 1095 12383 ----
NM_018179chr12--183 ----
NM_018181chr1841419 1293 577 240 ------
NM_018195chr1141872 1662 648 390 ------
NM_018206chr16134 ------
NM_018211chr112038 1541 22241 511 --
NM_018222chr1141834 1584 631 603 --2713 707 11223
NM_018225chr973662 3370 1990 1589 1581 961 37 161 --35222 1187 883
NM_018227chr411186 22410 422 23073 2987 --
NM_018243chr474046 3992 3778 3770 2724 1489 1255 1758 23203 1405 --
NM_018246chr842797 1927 415 250 12508 ----
NM_018247chr633100 1048 532 ----1841
NM_018252chr12516 449 1133 ----
NM_018254chr132213 969 519 --22106 2054 --
NM_018261chr41555 1376 ----
NM_018264chr7--2952 631 ----
NM_018293chr32447 293 --12793 --
NM_018299chr852792 2602 524 304 196 --1561 13175
NM_018307chr171130 --198 --
NM_018312chr1111768 1281 ----
NM_018313chr321872 954 --22630 789 --
NM_018314chr11----2752 708 --
NM_018315chr4------11312
NM_018317chr4--2298 64 --1310
NM_018318chr121105 1900 ----
NM_018322chr62934 22 ----11310
NM_018325chr921356 336 ------
NM_018328chr21385 --146 --
NM_018330chr1041658 1359 1207 236 --11486 --
NM_018351chr1244285 3965 3448 1832 14592 ----
NM_018364chr153772 3695 3480 2855 718 33789 3541 169 ----
NM_018368chr6151 ------
NM_018373chr1434953 1705 337 22302 524 12332 --
NM_018374chr755146 4924 4640 4046 970 15136 14804 --
NM_018383chr241753 1361 815 649 ------
NM_018388chrX11027 ------
NM_018403chr364062 3830 3216 2751 1547 945 11144 ----
NM_018429chr532810 2561 469 1527 1823 --
NM_018439chr1852546 2268 1627 942 307 ------
NM_018440chr847295 5643 923 96 26592 3149 25820 2500 28651 8608
NM_018444chr82857 457 ----12123
NM_018452chr6_random23114 559 --22806 1540 1957
NM_018471chr21462 ------
NM_018476chrX160 ------
NM_018482chr852528 2437 1793 1750 800 4690 624 60 41 ----
NM_018489chr121689 761 ------
NM_018534chr22425 52 ------
NM_018555chr191378 --12235 11554
NM_018557chr231596 1502 21 ------
NM_018638chr1264390 4124 3772 3744 2169 1420 15501 --21460 1075
NM_018639chr1231375 1234 1031 1329 ----
NM_018640chr1222705 2317 --21776 67 --
NM_018650chr11107 1407 1214 --
NM_018652chr151324 ------
NM_018657chr31842 ------
NM_018662chr144147 3771 3121 609 24237 1762 --23573 563
NM_018685chr71136 ------
NM_018691chr52437 310 --1800 --
NM_018695chr51816 --12283 --
NM_018698chrX31955 1482 199 ------
NM_018700chr521320 1282 11563 ----
NM_018704chr13377 353 338 ------
NM_018710chr8----21313 437 1173
NM_018712chr1131565 219 108 ------
NM_018719chr741259 1015 209 153 --156 --
NM_018834chr541030 912 884 873 ------
NM_018841chr133849 3175 468 13677 12421 12578
NM_018845chr14543 529 520 417 ------
NM_018890chr721496 996 ------
NM_018898chr552197 2182 2128 769 64 1847 ----
NM_018899chr552197 2182 2128 769 64 1847 ----
NM_018900chr552197 2182 2128 769 64 1847 ----
NM_018901chr552197 2182 2128 769 64 1847 ----
NM_018902chr552197 2182 2128 769 64 1847 ----
NM_018903chr552197 2182 2128 769 64 1847 ----
NM_018904chr552197 2182 2128 769 64 1847 ----
NM_018905chr552197 2182 2128 769 64 1847 ----
NM_018906chr552197 2182 2128 769 64 1847 ----
NM_018907chr552197 2182 2128 769 64 1847 ----
NM_018908chr552197 2182 2128 769 64 1847 ----
NM_018909chr552197 2182 2128 769 64 1847 ----
NM_018910chr552197 2182 2128 769 64 1847 ----
NM_018911chr552197 2182 2128 769 64 1847 ----
NM_018945chr643607 785 768 541 --11125 --
NM_018948chr121359 1186 --1267 --
NM_018958chr1543730 808 374 115 1421 --12749
NM_018968chr21125 ------
NM_018970chr742949 908 815 502 12883 --11946
NM_018977chrX1186 --2176 62 --
NM_018979chr1222224 381 ----22023 651
NM_018981chr231396 890 262 --11286 --
NM_018993chr2031317 569 71 --1966 --
NM_018999chr1074702 4476 3181 1423 1417 907 642 11228 2225 21 1450
NM_019003chrX126 ----159
NM_019015chr71130 ------
NM_019022chr1862984 939 619 483 351 101 --12700 --
NM_019024chr21305 ------
NM_019027chr462396 2137 749 587 191 78 ----195
NM_019030chr5----1161 --
NM_019035chr441389 803 268 33 ------
NM_019036chr621092 401 --1793 --
NM_019042chr711150 --1175 --
NM_019045chrX----3326 305 262 --
NM_019050chr432018 441 359 22114 807 ----
NM_019058chr102837 275 1810 ----
NM_019063chr262273 2038 1419 837 598 346 --11653 --
NM_019071chr71196 --1260 --
NM_019074chr15------199
NM_019084chr1042595 2114 2090 762 ------
NM_019091chr2--142 ----
NM_019094chr1232730 774 725 1113 ----
NM_019095chr20----1182 --
NM_019556chrX31462 1163 330 --11043 192
NM_019558chr2153 ------
NM_019590chr1021158 982 11106 1321 --
NM_019593chr207994 899 786 756 437 392 35 11053 32913 1091 515 --
NM_019594chr911615 ------
NM_019595chr24489 231 119 94 1169 1697 --
NM_019600chr152228 167 1504 ----
NM_019613chr1721252 896 11214 --11147
NM_019854chr121499 ------
NM_019903chr10--11467 --183
NM_020116chr421379 690 11752 --11624
NM_020122chr255129 2158 1566 1119 392 ----1246
NM_020123chr101225 1600 ----
NM_020130chr821291 472 1933 ----
NM_020133chr674734 4385 2460 1410 1025 952 671 ------
NM_020135chr6------1429
NM_020152chr212865 383 1963 ----
NM_020159chr42389 292 ------
NM_020177chr553355 2202 850 578 534 11117 ----
NM_020178chr171912 1873 --1236
NM_020198chr1711061 --1641 --
NM_020226chr41588 ------
NM_020232chr18----1166 --
NM_020239chr111964 ------
NM_020297chr1243284 2597 821 433 11122 21298 26 1253
NM_020336chr2043363 2780 547 306 --23119 325 --
NM_020337chr451221 1133 854 689 72 12813 23085 3076 12009
NM_020338chr1022855 1232 13207 13266 --
NM_020341chr2021413 494 --2324 312 182
NM_020342chr24982 325 74 44 ------
NM_020346chr1111134 1362 --1638
NM_020360chr17196 ------
NM_020390chr333422 3086 1064 1845 23381 1412 1534
NM_020403chr13141 21457 188 1302 11379
NM_020420chrY11354 ------
NM_020440chr141079 1061 365 171 13342 ----
NM_020443chr125878 924 11007 --12252
NM_020445chr71607 --1694 --
NM_020449chrX1215 --1528 --
NM_020456chr1342271 2174 505 105 ------
NM_020463chr241475 975 587 28 --1985 --
NM_020473chrX82017 2010 1748 1628 1522 1360 774 698 2241 169 --1512
NM_020532chr22639 142 1846 ----
NM_020640chr331930 790 551 11549 ----
NM_020647chr81925 ------
NM_020651chr211711 --1395 --
NM_020673chr20117736 6331 5411 5181 5089 2739 2383 2342 1785 1158 563 1116 16887 --
NM_020686chr1633048 2543 1105 22881 445 13074 12109
NM_020689chr2031614 1373 647 --11280 --
NM_020718chr1686495 6308 5038 5011 4245 1458 729 111 14262 34871 1593 1110 15945
NM_020724chr41252 12071 12063 12513
NM_020728chr743180 2529 2015 376 21198 347 1226 --
NM_020732chr611338 ------
NM_020734chr1242494 2462 1113 813 --1913 --
NM_020739chr1531225 924 429 13541 --13902
NM_020748chr1742074 2002 1888 1678 ----1263
NM_020752chr1052224 2106 1999 1792 1076 42914 2722 2607 611 ----
NM_020760chr2----11741 1616
NM_020766chrX54377 2964 2854 780 734 ------
NM_020768chr543229 2882 2684 522 --13176 1170
NM_020771chr6--1412 21109 1004 11163
NM_020772chr1798280 7187 6538 6487 6455 5382 2031 1450 1316 11129 ----
NM_020774chr1874639 4530 1935 1706 1394 551 419 25016 223 24504 1211 --
NM_020776chr1852560 2344 1122 850 236 ----12223
NM_020779chr253149 3044 1219 795 60 --12979 --
NM_020792chr332650 679 451 --167 1201
NM_020794chr131444 1386 378 ------
NM_020795chr171357 ------
NM_020796chr521213 1149 --22727 352 1997
NM_020800chr311322 --1146 --
NM_020801chr53540 330 194 --12178 --
NM_020802chr1192769 2096 1117 1100 1011 804 266 92 36 23380 2149 13331 --
NM_020805chr18--1527 ----
NM_020806chr14------167
NM_020808chr1166 ------
NM_020810chr1443447 2272 2254 921 --141 --
NM_020819chr61968 ------
NM_020824chr10196 ------
NM_020825chr1663271 2561 1432 1105 670 455 --13652 --
NM_020841chr1233771 2495 1628 --1276 12573
NM_020843chr151131 ------
NM_020844chr876969 6682 2757 2707 2678 813 616 --1304 11018
NM_020850chr1653062 3011 2608 1315 248 --1209 --
NM_020856chr193519 285 95 11480 ----
NM_020858chr1531806 1665 399 12409 1163 --
NM_020860chr4--1797 --1295
NM_020866chr1311004 11067 ----
NM_020872chr3180 --21723 305 11605
NM_020873chr31690 ------
NM_020886chr1131330 956 520 ----11190
NM_020898chr12139 --261 21 --
NM_020918chr1032394 1167 1048 22742 1303 23043 1068 --
NM_020921chr1453647 3053 2340 1200 839 ------
NM_020922chrX1503 ------
NM_020926chrX--1394 --1121
NM_020935chr274634 4294 3957 2965 363 257 28 --23154 685 --
NM_020940chr1021138 1049 --42839 2351 1097 799 --
NM_020947chr1631956 1709 137 ------
NM_020948chr143578 3517 2741 2678 13304 11118 --
NM_020951chr1921777 760 --1771 --
NM_020959chr19------134
NM_020962chr1572486 255 241 228 200 193 82 ------
NM_020975chr1052074 1657 321 203 46 1610 ----
NM_020977chr412168 --1218 --
NM_020983chr1232341 1943 540 1206 ----
NM_020987chr10--1148 ----
NM_021007chr232142 563 326 12287 2836 780 --
NM_021021chr82959 732 ------
NM_021033chr1353257 2640 2199 906 219 1876 ----
NM_021035chr2051326 1300 1155 933 911 ------
NM_021061chr843966 1099 782 376 1516 ----
NM_021069chr431874 553 43 11687 1564 --
NM_021072chr531947 1013 622 1912 ----
NM_021083chrX53193 3081 2887 1462 583 --12522 --
NM_021090chr2253598 1723 1560 837 85 ----1427
NM_021109chrX----124 1396
NM_021109chrX----124 1396
NM_021111chr951318 1245 1174 1091 108 1862 1986 --
NM_021116chr7148492 8481 8355 8299 7974 7792 7662 7110 6835 5682 5649 5494 3471 3458 --13158 18273
NM_021132chr1021366 174 --1891 --
NM_021136chr14----2618 577 --
NM_021148chr722298 1983 ------
NM_021151chr71253 ------
NM_021155chr1921995 1091 22769 2384 --1325
NM_021180chr1184 ----1678
NM_021183chrX2741 654 --11573 1942
NM_021190chr131296 948 303 --2987 840 --
NM_021191chr123670 546 501 12267 11599 --
NM_021202chr2053021 2341 2323 1057 399 12409 11005 --
NM_021205chr132695 1023 1013 2468 202 1813 --
NM_021222chr121117 393 11261 ----
NM_021238chr1222009 1733 --11751 --
NM_021239chr1411060 ------
NM_021240chr92595 518 ------
NM_021252chr1031472 1444 181 1272 11532 --
NM_021622chr1042293 1741 1604 1550 ------
NM_021629chr333952 1478 567 --11423 --
NM_021637chrX3520 236 158 --1242 --
NM_021643chr231576 1267 627 --11841 --
NM_021647chr463719 3704 3243 1147 1003 23 --11797 --
NM_021648chr662401 2295 2156 439 223 76 ------
NM_021722chr71433 --2515 368 --
NM_021723chr71474 --2556 409 --
NM_021728chr14--1647 1966 --
NM_021813chr665869 5335 5060 4810 2146 496 25387 2006 15194 1483
NM_021814chr63414 359 121 ------
NM_021818chr1411387 --1132 --
NM_021905chr692033 1932 1853 1829 1783 1681 1629 1552 1493 --11594 --
NM_021907chr21249 ------
NM_021911chr554080 3778 672 387 276 25583 436 35384 3470 3422 23924 1266
NM_021912chr1523963 3369 23241 1081 11022 --
NM_021914chr1441591 1517 499 258 11580 ----
NM_021931chr203960 297 279 ----11114
NM_021940chr61237 --21111 84 --
NM_021942chr43935 299 54 1801 ----
NM_021956chr611230 --1261 183
NM_021960chr152650 2208 922 886 65 --12630 11030
NM_021964chr345721 719 532 195 12289 1654 16040
NM_021998chrX31115 1006 45 1395 31085 979 256 --
NM_021999chr131239 1101 ----
NM_022037chr21962 --1875 1379
NM_022041chr1632588 1814 426 21852 299 --1406
NM_022048chr1545660 4173 3916 2553 ------
NM_022079chr101932 ------
NM_022080chr2042714 637 553 24 --12613 --
NM_022114chr143412 943 743 243 12948 14042 14789
NM_022118chr132579 27 ----1235
NM_022123chr141519 ------
NM_022130chr51358 21082 556 ----
NM_022138chr671543 1439 1316 1147 410 313 293 --1459 --
NM_022154chr431265 309 261 2860 474 1294 --
NM_022166chr1675834 4905 4149 3875 2542 1888 1596 24714 2134 25884 4369 11187
NM_022167chr171708 ----1833
NM_022170chr711087 --21641 1557 --
NM_022173chr21962 --1875 1379
NM_022307chr73736 668 31 ------
NM_022334chr221075 996 177 ----
NM_022336chr21832 --1947 1735
NM_022351chr823297 2995 23225 824 1294 --
NM_022373chr73874 139 105 ------
NM_022374chr2----152 --
NM_022456chr12117636 6708 6364 5286 2877 2582 2422 2078 1849 780 769 --27009 992 1872
NM_022458chr752118 2041 1232 959 72 21189 705 22002 1260 --
NM_022459chr1334493 1543 383 --31859 842 306 --
NM_022461chr341151 514 389 223 --11419 --
NM_022469chr162495 2297 984 880 867 750 --22062 1171 --
NM_022474chr142706 451 ------
NM_022475chr41212 1260 1184 --
NM_022476chr163726 131 27 ------
NM_022483chr51675 --1497 --
NM_022484chr711386 ----1992
NM_022488chr31128 ------
NM_022550chr5----1163 --
NM_022566chr153601 213 157 ------
NM_022572chr221728 1674 --11450 --
NM_022650chr51868 1132 ----
NM_022658chr12--11215 ----
NM_022716chr162793 2760 2553 2273 2006 899 1751 ----
NM_022726chr631597 1483 312 11326 ----
NM_022728chr7--1528 ----
NM_022735chr131721 1569 271 ------
NM_022748chr752436 2265 1758 964 225 ----1296
NM_022751chr181135 ------
NM_022758chr682787 2075 953 945 891 384 236 179 ------
NM_022763chr322225 1270 --11960 --
NM_022771chr1221006 305 ------
NM_022776chr311239 11036 ----
NM_022781chr921255 515 12217 148 --
NM_022782chr12157 ------
NM_022817chr22845 103 ------
NM_022828chr511607 ------
NM_022831chr12402 229 11607 ----
NM_022832chr411569 --1163 12384
NM_022841chr151887 11729 ----
NM_022845chr1631743 1620 205 1239 ----
NM_022893chr252597 510 424 370 335 --12692 12811
NM_022902chr51348 ------
NM_022965chr41448 1576 ----
NM_022977chrX22062 1855 --1970 --
NM_023000chr1421449 1327 1642 ----
NM_023001chr1421449 1327 1642 ----
NM_023012chr121729 ------
NM_023033chr121595 --1580 --
NM_023037chr131862 --1402 1263
NM_023074chr1921139 963 ------
NM_023076chr1632163 454 68 12971 ----
NM_023105chr831658 1599 677 1327 ----
NM_023106chr831658 1599 677 1327 ----
NM_023110chr831658 1599 677 1327 ----
NM_023111chr831658 1599 677 1327 ----
NM_023923chr143078 1025 612 234 13636 ----
NM_023928chr1221076 679 11061 11087 --
NM_023929chr8198 11014 ----
NM_024045chr10155 ------
NM_024052chr1753066 2459 1940 1204 1180 11979 ----
NM_024089chr131144 ------
NM_024095chr123557 128 28 21416 1301 ----
NM_024294chr682787 2075 953 945 891 384 236 179 ------
NM_024306chr162980 922 ------
NM_024411chr2041395 434 423 397 11482 ----
NM_024420chr1----1431 --
NM_024501chr2--1730 ----
NM_024511chr442916 2781 1230 155 ------
NM_024539chrX2397 308 --11156 --
NM_024548chr331742 635 289 --21197 238 --
NM_024557chr111143 ----11341
NM_024567chr82634 77 ------
NM_024574chr41326 ------
NM_024612chr1721097 782 ----1250
NM_024613chr821370 301 ------
NM_024624chr221354 520 --1308 --
NM_024626chr111615 128 ----
NM_024659chr22314 246 --1263 --
NM_024665chr324476 72 11486 1316 --
NM_024674chr152889 2819 2582 1166 108 12009 ----
NM_024686chr11401 --2144 136 172
NM_024692chr211181 --11821 --
NM_024700chr13913 752 216 --1881 --
NM_024713chr1521270 1112 ------
NM_024721chr83336 217 149 11723 12380 --
NM_024740chr1143912 1128 726 525 22869 209 ----
NM_024744chr2--12518 11705 --
NM_024749chr122261 2079 --11815 2605 476
NM_024759chr83766 174 136 ------
NM_024780chr161969 1144 --1424
NM_024811chr1141379 433 397 265 ------
NM_024824chr1431293 50 31 ------
NM_024828chr921482 1289 1104 1441 --
NM_024837chr1531827 709 402 1701 1423 --
NM_024852chr1--1196 1495 --
NM_024896chr951618 1586 703 235 27 --11634 --
NM_024900chr4----31723 1463 587 --
NM_024900chr4----31723 1463 587 --
NM_024920chr4--1325 --11066
NM_024930chr522833 72 ----12302
NM_024944chr213477 206 180 ------
NM_024946chr1651634 1221 652 587 458 ------
NM_024947chr3159082 8194 6828 6789 6444 3656 3462 3016 2071 1380 1315 1263 513 498 174 --46485 3855 2505 1887 11079
NM_024949chr433417 316 193 ----13435
NM_024953chr1252179 2129 1785 838 231 --2564 240 --
NM_024960chr202482 221 ------
NM_024989chr267255 6006 5952 5234 1975 204 11353 17912 --
NM_024991chr1043161 2753 2591 994 --12145 12152
NM_025054chr833860 3070 893 13655 --11301
NM_025073chr174663 4309 4016 3762 3454 715 194 ------
NM_025074chr433102 2785 1045 --1134 --
NM_025076chr21687 ------
NM_025126chr121588 ------
NM_025133chr211053 --1458 --
NM_025134chr161332 31717 927 160 11028 12243
NM_025135chr18----1486 --
NM_025138chr1361268 982 903 433 343 191 ------
NM_025146chr322267 2045 12497 ----
NM_025154chr711304 ------
NM_025160chr144166 3949 2792 105 ------
NM_025179chr144162 1931 1342 629 ------
NM_025184chrX3913 881 220 --3659 594 573 --
NM_025191chr133229 2786 163 1940 ----
NM_025195chr81185 --11499 --
NM_025208chr1142464 719 703 398 --32421 2221 243 --
NM_025211chr9194 ------
NM_025214chr1852771 2402 964 605 434 12169 ----
NM_025219chr2052365 2068 1766 238 179 --11939 --
NM_025221chr4--1117 11378 --
NM_025222chr372679 2402 2240 1144 1086 596 324 ------
NM_025235chr102674 292 ------
NM_025248chr17102951 2807 2594 2557 2536 2490 2433 2380 2349 2244 22626 2467 ----
NM_030583chr81964 1248 ----
NM_030621chr1494113 3426 2940 2884 2821 1385 1146 1037 747 ------
NM_030625chr1032255 2070 770 --11858 --
NM_030627chr554115 3075 3042 2932 1365 22974 402 --12996
NM_030629chr1631848 1243 557 1505 ----
NM_030637chr14--1281 ----
NM_030647chr725931 483 14940 ----
NM_030648chr475109 5046 4738 1729 1351 121 52 1744 13646 --
NM_030660chr141276 1400 ----
NM_030664chr1022372 2283 11783 22075 1629 --
NM_030751chr1031827 451 238 --2347 272 --
NM_030751chr1031827 451 238 --2347 272 --
NM_030753chr171301 ------
NM_030772chr11452 ------
NM_030786chr13522 402 194 --1301 --
NM_030791chr1421656 524 1238 --2397 304
NM_030806chr1119402 8669 6383 3658 2845 2612 2172 2128 2039 579 274 29153 7546 ----
NM_030816chr163594 3180 2960 2579 1151 1027 33208 2870 441 1331 --
NM_030820chr631028 423 337 ------
NM_030881chr221157 --11615 --
NM_030885chr332163 934 437 ------
NM_030915chr221984 437 ------
NM_030920chr12720 73 11966 1683 --
NM_030926chr22999 122 ------
NM_030939chr63197 121 107 --1752 --
NM_030949chr631551 595 531 ------
NM_030958chr8--1458 ----
NM_030963chr61155 ------
NM_030981chr111329 ------
NM_031157chr121127 1600 ----
NM_031243chr742348 1519 356 123 --1133 --
NM_031262chr91352 3993 271 181 ----
NM_031263chr91409 31050 328 238 ----
NM_031268chr1665414 3791 1993 776 364 287 --24960 4170 --
NM_031282chr121553 128 --21489 134 --
NM_031296chr442697 2591 1111 928 ------
NM_031314chr1442020 1508 319 107 ------
NM_031371chr12588 326 ----1499
NM_031371chr12588 326 ----1499
NM_031372chr4------11536
NM_031411chr552197 2182 2128 769 64 1847 ----
NM_031412chr122844 162 --1958 --
NM_031418chr1162583 970 589 386 269 117 1349 21988 109 --
NM_031430chr17--1265 ----
NM_031442chrX33052 2798 626 ----22821 2729
NM_031461chr82680 318 11427 ----
NM_031462chrX52634 2454 2186 1915 25 --1651 --
NM_031468chr752964 1950 1559 1510 50 28253 8103 16281 --
NM_031469chr674109 3915 3622 3108 1479 688 65 ----13876
NM_031479chr1231129 1060 793 ------
NM_031483chr20----22398 353 --
NM_031492chr111370 ------
NM_031844chr143767 3734 3030 2503 21434 424 ----
NM_031845chr233329 2363 1291 1463 1170 --
NM_031847chr233329 2363 1291 1463 1170 --
NM_031849chr552197 2182 2128 769 64 1847 ----
NM_031857chr552197 2182 2128 769 64 1847 ----
NM_031860chr552197 2182 2128 769 64 1847 ----
NM_031889chr431407 1361 1282 ------
NM_031890chr2242931 2557 2057 813 --12777 --
NM_031892chrX----1968 --
NM_031908chr541067 532 363 282 --2984 978 --
NM_031922chr62572 547 ------
NM_031953chr41380 1403 ----
NM_031992chr711087 --21641 1557 --
NM_032012chr954451 4252 3810 3206 1229 ------
NM_032021chr1111128 ----11138
NM_032023chr1011163 11012 ----
NM_032041chr852427 2000 1719 648 418 --22241 1088 --
NM_032042chr532758 2084 582 ------
NM_032050chr2221012 682 1896 ----
NM_032052chr2231397 1067 281 11281 ----
NM_032102chr1152486 2431 2168 788 398 --1871 --
NM_032121chrX32755 916 409 12498 ----
NM_032128chr42884 358 --1981 --
NM_032144chr21603 ------
NM_032149chr4------1125
NM_032181chr21127 --1703 --
NM_032186chr121302 481 11282 11338 1262
NM_032189chr13103992 3628 3402 3242 3109 815 325 312 209 36 --154663 4389 3609 3577 3558 3552 3472 3386 3335 3317 3280 3204 3182 3129 3075 13510
NM_032199chr1023824 155 12973 --11461
NM_032208chr242660 2377 1027 548 --13355 --
NM_032228chr1153198 2775 2445 1179 343 --12385 --
NM_032239chr421471 161 --1532 --
NM_032242chr322745 76 --32477 1222 1212 --
NM_032256chr126987 956 919 285 185 139 ------
NM_032268chr1632465 2057 2035 1872 12113 --
NM_032288chr352254 2115 2020 535 271 ----12237
NM_032289chr52578 271 --11897 --
NM_032291chr1------11984
NM_032312chr22598 106 ------
NM_032373chr1044630 4274 924 843 1116 ----
NM_032379chr111792 1130 ----
NM_032387chr172333 21 ------
NM_032408chr721282 252 --1477 --
NM_032410chr81231 ------
NM_032424chr111360 11525 ----
NM_032430chr19191 ------
NM_032431chr11158 ------
NM_032437chr1----1120 --
NM_032439chr1031372 637 101 --1358 --
NM_032445chr1522133 1943 1819 22399 336 --
NM_032446chr523471 948 --33544 1106 447 13551
NM_032451chr162888 78 ------
NM_032456chr41459 1551 --2624 540
NM_032457chr453795 3465 3110 2498 934 --31531 745 36 --
NM_032458chrX83092 2746 2507 838 731 520 79 62 ------
NM_032501chr2021104 489 1453 2504 465 --
NM_032505chr322310 305 21911 603 ----
NM_032523chr2157 ------
NM_032532chr61454 --1599 --
NM_032547chr41359 --11057 1197
NM_032560chr141336 ------
NM_032561chr221252 ------
NM_032564chr113997 751 641 ------
NM_032576chrY146 ------
NM_032578chr1031306 352 288 --21113 462 --
NM_032590chr121466 ------
NM_032622chr41333 ------
NM_032626chr161273 ------
NM_032632chr1421558 1457 11825 ----
NM_032682chr333286 3223 2796 --13233 11445
NM_032689chr19--1342 1173 --
NM_032717chr411059 ------
NM_032731chr171973 --11420 --
NM_032777chr841527 1482 1423 339 1553 ----
NM_032784chr63874 781 96 ------
NM_032790chr121360 ------
NM_032804chr1062371 1736 1609 1592 599 38 ----11905
NM_032806chr31357 ------
NM_032813chr1331037 418 100 11017 --1140
NM_032828chr1953502 1340 660 602 462 1233 ----
NM_032839chr31409 --1500 --
NM_032842chr731616 1599 524 --21399 1380 --
NM_032846chr1421427 602 --11558 --
NM_032859chr1333642 1375 727 22753 477 11167 23987 496
NM_032873chr1183237 1783 1442 973 825 745 492 296 11384 ----
NM_032900chr1063887 3193 3144 1497 1347 32 13215 ----
NM_032906chr45866 793 677 585 334 ------
NM_032918chr12--1169 --1238
NM_032943chr111792 1130 ----
NM_032949chr131390 ----192
NM_032967chrX------1334
NM_032968chrX23797 3053 --13061 11043
NM_032969chrX23797 3053 --13061 11043
NM_032971chrY------1361
NM_032972chrY------1361
NM_032973chrY34138 3789 3048 --13056 11043
NM_032978chr181900 ------
NM_032979chr181900 ------
NM_032981chr181900 ------
NM_032983chr753007 2924 674 588 553 --1660 --
NM_033020chr174006 3927 3755 3615 3394 3386 1088 13216 ----
NM_033056chr10----1568 --
NM_033071chr61141 ------
NM_033083chr3142 --13360 --
NM_033105chr81164 ------
NM_033117chr91112 ------
NM_033135chr1142464 719 703 398 --32421 2221 243 --
NM_033138chr71142 ------
NM_033139chr71142 ------
NM_033140chr71142 ------
NM_033147chr21249 ------
NM_033148chr21249 ------
NM_033157chr71142 ------
NM_033158chr3162 ------
NM_033181chr653235 2842 2824 2426 1518 13527 ----
NM_033215chrX1401 ------
NM_033224chr7138101 7454 7447 6556 5776 5226 5062 2645 2366 1840 1708 1368 353 12715 ----
NM_033225chr822956 2668 11041 23088 196 --
NM_033251chr161366 ------
NM_033254chr31123 ------
NM_033272chr2----1267 1116
NM_033281chr5--1760 ----
NM_033285chr864256 4163 3658 708 634 162 13023 23734 49 --
NM_033290chrX53482 3102 3090 1318 973 --13061 --
NM_033300chr131175 971 46 ------
NM_033331chr933335 3266 231 13622 ----
NM_033360chr1264369 3561 1204 897 398 236 --24460 4421 --
NM_033380chrX2815 137 ------
NM_033381chrX2815 137 ------
NM_033389chr1774813 4039 3745 3699 1392 862 129 13574 34405 3131 75 --
NM_033393chr442757 869 543 250 --12922 --
NM_033401chr161130 ------
NM_033429chr1542725 2412 1195 672 12642 ----
NM_033430chr483761 3469 3302 2748 1257 602 291 56 --11349 --
NM_033437chr483761 3469 3302 2748 1257 602 291 56 --11349 --
NM_033495chrX1809 --1698 --
NM_033505chr274235 4224 4126 2403 1069 1053 293 --36103 5975 2498 35610 5476 4262
NM_033515chr62366 261 --1864 --
NM_033551chr542564 2477 1050 418 ------
NM_033632chr4------11312
NM_033642chrX11170 --1493 --
NM_033644chr532493 770 530 12518 12109 --
NM_033645chr532493 770 530 12518 12109 --
NM_033656chr2134956 340 209 --25942 446 14290
NM_052832chr852932 2921 2833 2099 58 33007 2507 1838 ----
NM_052834chr1841747 517 207 150 --11655 --
NM_052840chr1521564 1208 11193 1633 --
NM_052854chr112629 267 ------
NM_052855chr171616 ------
NM_052857chr171176 ------
NM_052879chr1244032 4025 3586 1397 ------
NM_052880chr2221408 28 ------
NM_052886chr822073 1478 1751 ----
NM_052898chr841238 727 718 617 ------
NM_052904chr61447 11423 ----
NM_052907chr1243489 2935 636 205 24013 3900 ----
NM_052911chr182888 253 --1262 --
NM_052918chr1063590 1370 1251 1193 517 379 --1622 11347
NM_052923chr6144 ------
NM_052925chr19--1904 ----
NM_052927chr52494 224 ------
NM_052936chrX3802 741 100 ----1781
NM_052954chr2121750 24 ------
NM_052958chr83731 708 492 ------
NM_052964chr4------1198
NM_052966chr173898 3754 3109 2644 1553 941 837 176 ----
NM_053016chr946679 3142 2795 2104 27390 7283 1179 --
NM_053023chr1142845 2609 2061 817 ------
NM_053043chr775424 5048 4942 3871 2307 1001 287 --22252 2069 --
NM_053056chr1132526 2086 1110 --1576 13123
NM_053064chr1442933 2844 678 135 12205 ----
NM_054016chr152037 1473 638 154 32 11759 11772 --
NM_054016chr152037 1473 638 154 32 11759 11772 --
NM_054016chr152037 1473 638 154 32 11759 11772 --
NM_054033chr21379 ------
NM_057159chr93568 550 114 1556 ----
NM_057169chr1242632 1184 599 493 33155 2821 434 ----
NM_057170chr1242632 1184 599 493 33155 2821 434 ----
NM_057175chr412676 1497 21651 959 --
NM_058172chr41702 ------
NM_078487chr942872 2163 1180 211 13093 1888 13204
NM_079837chr161624 ------
NM_080390chrX1146 ------
NM_080546chr922187 478 21677 712 21735 210 --
NM_080597chr181267 1846 ----
NM_080599chr1031157 810 798 ------
NM_080607chr20--1166 ----
NM_080645chr641905 1615 732 77 ------
NM_080678chr21247 ------
NM_080748chr20150 ------
NM_080759chr1352437 2200 943 849 727 22404 953 11903 --
NM_080760chr1352437 2200 943 849 727 22404 953 11903 --
NM_080821chr2011462 12044 1442 --
NM_080867chr14----14922 1404
NM_080872chr853600 1224 1023 344 165 --11175 --
NM_080874chr4181 --21602 766 --
NM_080921chr121141 454 --1963 --
NM_100264chr101922 ----1329
NM_100486chr101922 ----1329
NM_130386chr182679 203 ------
NM_130387chr33958 212 162 ------
NM_130391chr923026 2458 --12473 --
NM_130392chr923026 2458 --12473 --
NM_130393chr923026 2458 --12473 --
NM_130395chr6------1429
NM_130435chr1032485 317 165 12364 --12895
NM_130469chr142801 683 ------
NM_130773chr21274 ------
NM_130809chr552925 2261 2117 368 323 12884 --1605
NM_130811chr2011028 11133 ----
NM_130838chr1531229 1210 185 11781 ----
NM_130839chr1531229 1210 185 11781 ----
NM_130846chr124951 891 852 118 ------
NM_130847chr1185322 4585 4307 4132 3814 3689 3580 839 ------
NM_133170chr2067275 7178 5776 5769 2385 1051 37547 6757 5741 --12449
NM_133264chr172163 102 12612 ----
NM_133265chrX52920 2818 2564 701 683 --23181 831 --
NM_133334chr456370 5564 4574 4393 1110 42412 1115 952 845 ----
NM_133367chr642647 1279 1188 613 --13499 --
NM_133369chr52678 347 ----1779
NM_133370chr483570 3546 3024 2859 1483 1101 849 154 32748 829 433 1388 --
NM_133372chr522963 625 --168 --
NM_133378chr2--1939 1202 --
NM_133432chr2--1939 1202 --
NM_133437chr2--1939 1202 --
NM_133446chr10----1309 --
NM_133468chr741769 920 300 256 --1217 --
NM_133476chr12--11232 ----
NM_133477chr452797 2292 2259 1000 473 1329 23252 1212 13029
NM_133499chrX2904 265 ----1741
NM_133631chr321526 358 11576 11131 --
NM_133650chr61141 ------
NM_134265chr1711195 --1313 --
NM_134424chr1211000 ------
NM_138270chrX23224 1306 ------
NM_138286chr1954197 3268 1506 1491 854 34355 3925 3649 --1256
NM_138290chr72103 55 ------
NM_138300chr131261 203 33 ------
NM_138316chr1031204 862 273 --11012 --
NM_138319chr1531031 852 439 ------
NM_138333chr932579 2547 2305 ------
NM_138340chr182622 490 ----1133
NM_138357chr1021791 446 ------
NM_138360chr14136 ------
NM_138423chr151158 11988 ----
NM_138426chr762179 2154 815 807 629 238 12306 ----
NM_138444chr1374808 3433 3391 3377 3209 1457 1141 13727 11105 13812
NM_138459chr642633 1195 523 189 --22765 182 --
NM_138468chr2106287 6171 6081 5833 5806 4943 3961 2337 1509 828 24376 415 ----
NM_138473chr121617 ------
NM_138494chr731003 431 81 1404 22802 2710 --
NM_138554chr952392 2036 703 559 89 11970 22208 137 12685
NM_138558chr1--1139 ----
NM_138565chr1121172 255 ----11328
NM_138609chr5133 ------
NM_138610chr5133 ------
NM_138612chr162211 35 ------
NM_138633chr631770 1468 500 1538 ----
NM_138638chr1441591 1517 499 258 11580 ----
NM_138711chr31137 ------
NM_138712chr31137 ------
NM_138713chr1667081 6123 6077 5815 5334 1418 26439 5786 ----
NM_138714chr1667081 6123 6077 5815 5334 1418 26439 5786 ----
NM_138727chr131792 853 112 ------
NM_138728chr131792 853 112 ------
NM_138731chr1431584 790 319 12595 34113 3549 435 --
NM_138771chr721482 1348 --11359 --
NM_138782chr511729 1535 --12421
NM_138811chr721122 964 ----1848
NM_138966chr181475 --1414 --
NM_138970chr1422429 2290 ------
NM_138971chr1122517 2373 --13003 --
NM_138971chr1122517 2373 --13003 --
NM_138972chr1122517 2373 --13003 --
NM_138972chr1122517 2373 --13003 --
NM_138973chr1122517 2373 --13003 --
NM_138973chr1122517 2373 --13003 --
NM_138981chr4------1791
NM_138994chr161130 ------
NM_139012chr632096 2067 890 --21800 762 --
NM_139035chrX1742 ------
NM_139048chr311118 ------
NM_139057chr1532008 634 394 ------
NM_139068chr5--1242 ----
NM_139069chr5--1242 ----
NM_139070chr5--1111 ----
NM_139071chr12----1285 --
NM_139132chr1121023 31 ------
NM_139182chr4--149 ----
NM_139244chr64761 750 334 132 ------
NM_139266chr2123 ------
NM_139280chr1721500 1096 ------
NM_139283chr1252419 1772 1614 1010 452 --11607 --
NM_139321chr2033667 2585 1560 14033 ----
NM_139323chr2011701 ------
NM_144498chr2021464 898 --1643 --
NM_144571chr486961 4774 4630 2775 1436 1132 425 225 46766 6521 2035 612 22182 1988 --
NM_144578chr1454660 4382 4375 3995 1056 --3697 54 48 --
NM_144595chr131375 ------
NM_144599chr1565398 4774 1714 1193 806 464 35470 4427 1085 35362 4449 1470 14333
NM_144618chr11364 --1351 --
NM_144632chr261775 644 580 534 277 264 ------
NM_144633chr3--1547 ----
NM_144636chr31541 ------
NM_144642chr331124 1029 361 --2422 325 --
NM_144643chr4--1314 ----
NM_144658chrX1228 ------
NM_144664chr1111040 11779 22511 2477 1303
NM_144665chr11130 ------
NM_144690chr193505 459 368 --1495 --
NM_144720chr4140 --1153 --
NM_144723chr5--1635 1877 --
NM_144728chr11654 ------
NM_144729chr11654 ------
NM_144778chr1322243 110 ----12227
NM_144949chr232419 2395 2272 ----12448
NM_144963chr812708 12109 11751 --
NM_144973chr1265115 3873 3283 1574 228 110 ----1371
NM_145011chr1041948 1364 805 435 1235 --1784
NM_145025chr62235 64 1806 ----
NM_145049chr51176 ------
NM_145055chr1833261 2771 615 12879 ----
NM_145117chr1111128 12685 12539 --
NM_145176chr623482 377 22354 2173 ----
NM_145203chr131318 --1719 --
NM_145245chr1911229 ------
NM_145251chr142238 113 11533 1221 --
NM_145259chr2127036 6510 6282 6044 5246 4446 2698 2377 2320 1478 1313 417 --16818 1405
NM_145266chr51245 ------
NM_145284chrX32260 1884 1696 --12564 --
NM_145285chr101705 ------
NM_145305chrX31285 1003 140 ------
NM_145307chr1043739 3578 1594 1577 13872 11610 --
NM_145315chr61102 ------
NM_145320chr753608 2720 2428 974 423 13367 --1669
NM_145321chr753608 2720 2428 974 423 13367 --1669
NM_145322chr753608 2720 2428 974 423 13367 --1669
NM_145331chr61863 --1277 133
NM_145332chr611011 ----1181
NM_145333chr611011 ----1181
NM_145341chr1021583 642 11864 --11906
NM_145350chr1731645 1071 333 ----11037
NM_145649chr652583 2547 1896 679 606 --21065 755 --
NM_145655chr652583 2547 1896 679 606 --21065 755 --
NM_145686chr243108 2266 945 379 ----1887
NM_145687chr243108 2266 945 379 ----1887
NM_145690chr841533 777 743 484 ------
NM_145693chr242515 2356 2082 1954 11818 1317 --
NM_145725chr141388 ------
NM_145726chr141388 ------
NM_145739chr2157 ------
NM_145793chr101232 ----132
NM_145799chrX43102 2576 1021 118 --11011 --
NM_145808chr743089 1159 1113 733 22909 2826 22499 2390 --
NM_145859chr31337 ------
NM_145860chr31337 ------
NM_145913chr1221058 718 --2301 295 --
NM_147156chr101213 11196 21323 976 --
NM_147171chr72372 196 ------
NM_147175chrX21572 864 11495 ----
NM_147181chr4--1117 11378 --
NM_147182chr4--1117 11378 --
NM_147183chr4--1117 11378 --
NM_147185chr72372 196 ------
NM_147189chr842015 536 411 133 12114 ----
NM_148174chr821950 1785 21730 1710 --1260
NM_148894chr42995 59 --1103 1370
NM_148898chr72876 347 ------
NM_148899chr72876 347 ------
NM_148977chr1031204 862 273 --11012 --
NM_148978chr1031204 862 273 --11012 --
NM_152261chr1232482 1790 572 ------
NM_152263chr175758 4983 4635 2437 2109 1490 833 26066 2089 14458 15707
NM_152277chr522017 1398 21660 212 ----
NM_152282chr31931 ------
NM_152330chr1432241 1720 613 ----22526 335
NM_152347chr173468 147 56 1424 ----
NM_152350chr173655 173 148 ------
NM_152352chr1852631 2480 2024 1953 71 ------
NM_152380chr131625 1078 596 --2440 389 1429
NM_152384chr212067 ------
NM_152388chr243835 3485 3300 84 1482 13726 12450
NM_152409chr573507 3189 2763 2582 1425 832 159 --12237 11437
NM_152410chr6------1324
NM_152414chr821173 600 ------
NM_152424chrX52862 1573 1442 1152 444 --1426 --
NM_152440chr1231078 854 813 1890 ----
NM_152450chr1541915 1454 492 111 ------
NM_152451chr152833 798 ------
NM_152470chr1843990 2838 483 388 23502 1090 ----
NM_152478chr19--1528 ----
NM_152519chr241528 653 526 107 1226 ----
NM_152520chr22923 291 ------
NM_152525chr2136 ------
NM_152529chr253791 1367 943 821 692 24385 2966 33603 178 155 --
NM_152553chr6133 --146 --
NM_152556chr742280 1658 1578 194 ------
NM_152581chrX2357 149 --31323 459 123 --
NM_152594chr1532252 1552 316 1663 --12243
NM_152610chr1--1107 ----
NM_152622chr522401 2380 12448 11254 1556
NM_152624chr596388 6302 5875 4731 2893 2718 2238 1012 957 --1683 12429
NM_152625chr51227 ----1327
NM_152629chr944143 4076 594 540 --11652 --
NM_152636chr1122445 2170 12925 12872 --
NM_152641chr1242914 2661 2354 760 --21120 1004 --
NM_152665chr1----21261 517 --
NM_152673chr354008 3958 654 357 254 34364 3670 3425 14398 --
NM_152678chr342433 2153 484 37 ------
NM_152682chr431580 1379 1102 ------
NM_152688chr61957 ------
NM_152695chrX12214 12039 ----
NM_152699chr363560 1284 1269 276 259 171 13726 11098 --
NM_152713chr11124 --189 --
NM_152716chr1121505 660 --21352 487 --
NM_152721chr182675 654 ------
NM_152723chr111728 --1451 --
NM_152724chr1042768 2337 489 438 1338 ----
NM_152739chr7----1823 --
NM_152745chr74460 436 274 237 1824 ----
NM_152748chr71380 --1391 --
NM_152754chr743080 2653 821 380 23722 292 11526 11433
NM_152756chr523760 2790 1261 1347 11236
NM_152758chr832696 1971 268 12861 1637 12053
NM_152774chr752731 2440 2096 898 652 12027 22653 754 --
NM_152782chr7131 ------
NM_152787chrX23911 2424 23125 382 1581 --
NM_152789chr711446 11049 11436 --
NM_152793chr753469 2013 1350 1021 673 15177 ----
NM_152829chr721237 511 --11014 --
NM_152835chr141959 760 365 34 12036 ----
NM_152857chr61943 --1285 --
NM_152858chr61943 --1285 --
NM_152888chr82973 245 ------
NM_152896chr91671 1573 ----
NM_152902chr131997 1597 400 21665 763 ----
NM_152924chr1585778 5335 4698 4677 2208 2156 1126 135 ------
NM_152989chr1211204 ------
NM_152996chr121470 728 11985 --1805
NM_153029chr1643833 3344 3323 823 ------
NM_153042chr641861 1498 1162 58 ------
NM_153050chr2253598 1723 1560 837 85 ----1427
NM_153051chr2253598 1723 1560 837 85 ----1427
NM_153181chr181475 --1414 --
NM_153184chr361766 1577 1351 503 482 331 ------
NM_153188chr575604 4801 4231 3822 2098 929 876 24482 3519 21621 1523 13458
NM_153207chr1263462 3174 2814 931 392 304 --22937 1459 --
NM_153208chr161111 1913 ----
NM_153211chr18----1171 --
NM_153235chr622158 1722 --1532 --
NM_153255chr62948 236 ----1116
NM_153261chr1621253 1238 ------
NM_153262chr1--11205 12428 --
NM_153331chr32538 195 ------
NM_153369chr631397 333 236 ------
NM_153374chr15--1346 ----
NM_153456chr1375962 5856 4305 2539 1526 1041 862 15376 16140 15002
NM_153464chr192882 134 ------
NM_153607chr533030 3004 774 ------
NM_153616chr1531806 1665 399 12409 1163 --
NM_153617chr1531806 1665 399 12409 1163 --
NM_153618chr1531806 1665 399 12409 1163 --
NM_153619chr1583044 2903 2503 2471 1173 1020 138 84 13647 11401 --
NM_153634chr1231549 1129 386 ------
NM_153640chr202482 221 ------
NM_153645chr2232762 2755 904 ----1953
NM_153686chr41168 ------
NM_153690chr3------1816
NM_153828chr22639 142 1846 ----
NM_153836chr231756 739 297 ------
NM_170606chr711251 11233 ----
NM_170665chr1264264 4216 3885 906 397 264 21055 235 1209 --
NM_170672chr241695 1644 322 270 --41737 1438 1269 664 --
NM_170675chr15--1209 ----
NM_170676chr15--1209 ----
NM_170679chr511022 ----11209
NM_170692chr11235 ------
NM_170706chr183976 2688 1579 1108 445 406 367 289 14363 1719 --
NM_170709chr832037 1718 747 1428 ----
NM_170719chr1361268 982 903 433 343 191 ------
NM_170731chr1162630 2502 2344 302 167 115 12733 ----
NM_170732chr1162630 2502 2344 302 167 115 12733 ----
NM_170733chr1162630 2502 2344 302 167 115 12733 ----
NM_170734chr1162630 2502 2344 302 167 115 12733 ----
NM_170735chr1162630 2502 2344 302 167 115 12733 ----
NM_170750chrX1277 ----1858
NM_170751chr611136 ------
NM_170752chr611136 ------
NM_171998chrX32532 276 26 1687 ----
NM_172069chr222321 879 --1479 --
NM_172071chr137198 2747 844 ------
NM_172103chr632522 2364 329 ----1478
NM_172105chr632522 2364 329 ----1478
NM_172127chr41128 --11866 1168
NM_172128chr4184 --11822 1124
NM_172159chr312239 1263 --11931
NM_172160chr312239 1263 --11931
NM_172218chr82833 31 --1155 --
NM_172230chr11158 ------
NM_172337chr14--1647 1966 --
NM_172373chr13----159 --
NM_173054chr7136 ------
NM_173082chr641502 1380 1199 1087 --11315 --
NM_173157chr12143 --3552 421 30 --
NM_173163chr16124 ------
NM_173198chr922823 452 --12769 32279 997 865
NM_173200chr922823 452 --12769 32279 997 865
NM_173214chr1667081 6123 6077 5815 5334 1418 26439 5786 ----
NM_173355chr22907 108 --1276 --
NM_173359chr331913 1897 1823 --1407 --
NM_173463chr444476 4228 2854 1812 23420 665 ----
NM_173468chr42744 576 15884 15485 --
NM_173470chrX22497 801 --12704 --
NM_173477chr1721661 1476 --1270 --
NM_173491chr5--11398 2230 118 --
NM_173496chr1011222 --1203 1886
NM_173511chr233269 1545 119 12773 ----
NM_173515chr6--1110 ----
NM_173517chr7----1462 --
NM_173519chr83788 444 84 11972 169 --
NM_173552chr31897 ------
NM_173576chr1042060 538 329 223 11510 ----
NM_173582chr1176111 6094 5995 5246 2241 1547 1111 ------
NM_173595chr1244891 4695 3526 968 ----1678
NM_173602chr1233065 1355 211 --31250 560 257 --
NM_173607chr1421818 429 12126 ----
NM_173642chr167678 7452 6117 5949 1940 793 42628 2530 1883 1389 11294 --
NM_173670chr511001 ------
NM_173694chrX32127 1577 981 21889 383 22399 989 --
NM_173797chr52377 326 ------
NM_173808chr113063 ------
NM_173812chr1231568 1338 1103 --11256 --
NM_173829chr545551 5385 5232 1556 12140 14143 --
NM_173833chr871637 1608 1600 1524 1303 293 179 ------
NM_173834chrX1428 ------
NM_173872chr41626 1840 1666 --
NM_174856chr20--1330 ----
NM_174858chr13877 265 181 ----11022
NM_174909chr51561 ------
NM_174916chr1552282 2235 1607 1512 180 1464 ----
NM_175038chr121235 ------
NM_175056chr341921 1731 838 735 21354 806 --12186
NM_175061chr72544 119 ----1192
NM_175607chr321350 1177 31344 523 379 3595 558 268 11593
NM_175610chr155961 915 419 179 153 --1433 11128
NM_175612chr321350 1177 31344 523 379 3595 558 268 11593
NM_175623chr12117636 6708 6364 5286 2877 2582 2422 2078 1849 780 769 --27009 992 1872
NM_175624chr12127731 6803 6459 5381 2972 2677 2517 2173 1944 875 864 40 --27104 1087 1967
NM_175625chr12127731 6803 6459 5381 2972 2677 2517 2173 1944 875 864 40 --27104 1087 1967
NM_175634chr811177 ------
NM_175635chr811177 ------
NM_175636chr811177 ------
NM_175736chr1267788 7637 7193 6183 5244 2616 --46922 6731 5426 812 --
NM_175748chr1421588 1389 12040 11847 --
NM_175767chr561676 1631 1333 429 360 242 ------
NM_175854chr1321825 698 32560 778 529 1289 --
NM_175856chr51723 ------
NM_175863chr611338 ------
NM_175876chr11440 --22711 32 --
NM_175910chr1922381 2345 ------
NM_176801chr421862 586 ----11741
NM_176814chr721400 229 ------
NM_176824chr421025 477 --1348 --
NM_177398chr121872 1769 21828 281 ----
NM_177399chr121872 1769 21828 281 ----
NM_177401chr1921792 457 ------
NM_177422chr1--1196 1495 --
NM_177438chr1494113 3426 2940 2884 2821 1385 1146 1037 747 ------
NM_177538chr288045 6842 5658 2840 2295 1991 1220 951 ------
NM_177553chr111252 ------
NM_177947chrX2464 202 ----11547
NM_177948chrX2464 202 ----11547
NM_177967chr133409 356 200 ------
NM_177968chr22805 646 1391 --1383
NM_177969chr2166 ------
NM_177974chr151158 11988 ----
NM_177985chr222039 1469 ----1745
NM_177990chr2021413 494 --2324 312 182
NM_178010chr1211204 ------
NM_178011chr1023189 2921 --21202 536 --
NM_178120chr211162 ------
NM_178123chr23707 182 142 ------
NM_178135chr4130 --11268 --
NM_178140chr531897 1098 945 1657 ----
NM_178151chrX35880 4845 1485 --16315 17262
NM_178152chrX35880 4845 1485 --16315 17262
NM_178153chrX35880 4845 1485 --16315 17262
NM_178154chr141213 ----1246
NM_178155chr141213 ----1246
NM_178156chr141213 ----1246
NM_178157chr141213 ----1246
NM_178161chr10------2217 57
NM_178270chrX3802 741 100 ----1781
NM_178313chr242195 2182 1942 1493 --12110 --
NM_178424chr5----1251 --
NM_178426chr12673 615 1714 21987 222 --
NM_178427chr12573 515 1614 21887 122 --
NM_178439chr21200 ------
NM_178450chr52236 70 ------
NM_178496chr321455 979 ------
NM_178502chr12------1645
NM_178539chr1221754 541 --22024 48 --
NM_178568chr17136 ------
NM_178585chr412674 22528 945 12560 --
NM_178812chr851579 1214 1203 394 26 21054 67 21007 84 --
NM_178815chr1022619 295 12299 ----
NM_180976chr62989 403 ------
NM_180977chr62989 403 ------
NM_181054chr1431139 1106 1046 --1819 --
NM_181077chr1551562 1438 515 472 256 ------
NM_181351chr11--22449 549 1113 --
NM_181354chr871496 1212 664 457 290 217 94 11187 ----
NM_181358chr143937 2793 2668 1165 13633 13837 1909
NM_181361chr311040 --189 1157
NM_181442chr20130 ----1807
NM_181443chr2022411 2379 --1849 --
NM_181457chr241242 978 531 316 11335 ----
NM_181458chr231375 1111 449 11468 ----
NM_181459chr241141 877 430 215 11234 ----
NM_181460chr241188 924 477 262 11281 ----
NM_181481chr1855015 4780 2594 1804 959 21058 166 21527 937 --
NM_181482chr1855015 4780 2594 1804 959 21058 166 21527 937 --
NM_181483chr1855015 4780 2594 1804 959 21058 166 21527 937 --
NM_181504chr543410 2835 581 308 1811 33895 1333 170 --
NM_181521chr1655837 2381 2372 1514 880 14563 1903 12476
NM_181523chr543410 2835 581 308 1811 33895 1333 170 --
NM_181524chr543410 2835 581 308 1811 33895 1333 170 --
NM_181552chr7----1914 --
NM_181571chr102432 33 1298 ----
NM_181598chr14--170 1206 --
NM_181645chr111195 --1291 --
NM_181655chr17--178 ----
NM_181659chr2022798 697 --13062 --
NM_181659chr2022798 697 --13062 --
NM_181670chr121929 ------
NM_181672chrX11615 ------
NM_181673chrX11615 ------
NM_181702chr81261 ----11008
NM_181705chr585707 4371 3966 2230 2164 1992 1388 812 ----25370 3595
NM_181726chr42175 164 149 1155 --
NM_181782chr642332 2114 348 174 11917 ----
NM_181783chr1241826 1778 565 354 --1649 --
NM_181784chr2--1619 ----
NM_181789chr1543254 1109 618 380 ------
NM_181838chr51123 --11106 --
NM_181839chr831398 1167 514 ------
NM_181886chr451026 559 475 346 152 ------
NM_181887chr451026 559 475 346 152 ------
NM_181888chr451026 559 475 346 152 ------
NM_181889chr451026 559 475 346 152 ------
NM_181890chr451026 559 475 346 152 ------
NM_181891chr451026 559 475 346 152 ------
NM_181892chr441073 522 393 199 ------
NM_181893chr451026 559 475 346 152 ------
NM_182398chr14--1262 ----
NM_182485chr473178 2300 1046 1001 921 882 342 --3766 129 78 23463 934
NM_182503chr634972 4825 1300 15276 21433 1402 --
NM_182508chr1351775 1045 641 367 41 1897 1566 12729
NM_182515chr19106503 6022 5374 4696 4684 4356 2566 2302 1656 589 35799 5644 1265 ----
NM_182641chr1731823 1411 580 11536 ----
NM_182646chr473178 2300 1046 1001 921 882 342 --3766 129 78 23463 934
NM_182666chr31521 ------
NM_182691chr741351 1163 580 242 ------
NM_182692chr741351 1163 580 242 ------
NM_182697chr731316 244 229 1489 ----
NM_182715chr721030 50 --1310 1196
NM_182717chr101438 1218 ----
NM_182718chr102432 33 1298 ----
NM_182719chr102432 33 1298 ----
NM_182720chr101438 1218 ----
NM_182721chr101438 1218 ----
NM_182722chr101438 1218 ----
NM_182723chr101438 1218 ----
NM_182724chr102432 33 1298 ----
NM_182725chr102432 33 1298 ----
NM_182757chr633423 1235 991 ----11352
NM_182763chr152639 2197 911 875 54 --12619 11019
NM_182765chr1042128 918 745 428 1549 11756 11668
NM_182767chr1242086 1440 714 232 --11629 --
NM_182769chr102432 33 1298 ----
NM_182770chr102432 33 1298 ----
NM_182771chr102432 33 1298 ----
NM_182772chr102432 33 1298 ----
NM_182789chr5--1129 1959 --
NM_182796chr51902 1788 1604 --
NM_182797chr2051376 1126 420 356 283 --11629 --
NM_182830chr142706 670 11649 12016 --
NM_182848chr1341336 1167 617 455 --1114 --
NM_182850chr102432 33 1298 ----
NM_182853chr101438 1218 ----
NM_182898chr765835 4558 2591 2105 1055 49 25001 192 14526 16395
NM_182899chr765835 4558 2591 2105 1055 49 25001 192 14526 16395
NM_182907chr632262 1473 295 11583 ----
NM_182948chr123105 1976 ------
NM_182961chr61141 ------
NM_182964chr1111128 12685 12539 --
NM_182972chr152059 1898 741 502 341 --11873 --
NM_182983chr19--1203 ----
NM_183004chr1443396 2780 1271 676 --176 --
NM_183011chr101438 1218 ----
NM_183012chr101438 1218 ----
NM_183013chr101438 1218 ----
NM_183043chr1321012 858 ------
NM_183044chr1321012 858 ------
NM_183049chr4----124 1391
NM_183060chr102432 33 1298 ----
NM_183061chr3126 ------
NM_183079chr20--11453 11495 --
NM_183234chr1521747 1532 --2495 387 --
NM_183235chr1521747 1532 --2495 387 --
NM_183236chr1521747 1532 --2495 387 --
NM_183238chr1233693 3385 1005 23278 1183 ----
NM_183323chr5--1129 1959 --
NM_183353chrX------1915
NM_183360chr21249 ------
NM_183361chr21249 ------
NM_183380chr63985 655 252 --1402 --
NM_183381chr311012 ------
NM_183383chr311012 ------
NM_183384chr311012 ------
NM_183387chr14----1174 1873
NM_183393chr33892 327 316 1958 ----
NM_183394chr33892 327 316 1958 ----
NM_183397chr2033634 1191 271 13616 --15144
NM_183419chr831361 1082 65 --11016 1511
NM_183422chr133248 167 132 --11007 --
NM_184234chr201239 1116 ----
NM_194071chr775077 4167 3840 3526 3334 2181 949 --14149 --
NM_194247chr244277 1626 1155 611 11680 ----
NM_194271chr121588 ------
NM_194285chr1163129 2654 2635 1059 854 273 ------
NM_194291chr862509 2453 475 332 123 58 12484 1341 --
NM_194301chr1411106 --193 --
NM_194314chr164953 4757 4190 904 393 41 --22047 1252 11074
NM_194328chr921255 515 12217 148 --
NM_194329chr921255 515 12217 148 --
NM_194330chr921255 515 12217 148 --
NM_194332chr921255 515 12217 148 --
NM_194434chr1864793 4743 4135 1721 1643 1631 ------
NM_194442chr111738 --11395 --
NM_194449chr181964 ------
NM_194463chrX2397 308 --11156 --
NM_197968chr131293 1142 ----
NM_198066chr1442946 2272 1237 175 --1391 --
NM_198074chr12948 234 ------
NM_198081chr642712 2069 1091 923 11927 ----
NM_198097chr7------162
NM_198158chr311932 11075 1986 --
NM_198159chr311932 11075 1986 --
NM_198173chr1184 ----1678
NM_198174chr1184 ----1678
NM_198177chr311932 11075 1986 --
NM_198178chr311932 11075 1986 --
NM_198181chr1552802 2067 965 400 342 ------
NM_198195chr3----1603 --
NM_198225chr10--1666 21770 1544 --
NM_198240chr1211254 --11224 11379
NM_198243chr152849 205 185 ----
NM_198261chr121729 ------
NM_198262chr121729 ------
NM_198268chr143937 2793 2668 1165 13633 13837 1909
NM_198269chr143937 2793 2668 1165 13633 13837 1909
NM_198270chrX43094 1107 830 509 --11253 --
NM_198273chr562814 2420 2383 868 500 36 23031 2431 1797 13167
NM_198291chr2051897 1590 1297 1228 700 ----11557
NM_198336chr721197 701 ------
NM_198381chr1121423 115 --1867 --
NM_198390chr1631848 1243 557 1505 ----
NM_198391chr2021513 945 --11338 --
NM_198396chr171326 ------
NM_198399chr3------11456
NM_198401chr81109 ----11650
NM_198402chr31302 ------
NM_198404chr134776 334 86 34 ------
NM_198446chr11158 ------
NM_198450chrX32051 800 141 179 21907 360 --
NM_198503chr132254 1785 1761 ------
NM_198581chr255609 4985 2205 1872 291 12375 ----
NM_198679chr922626 1658 ----12680
NM_198714chr11528 ------
NM_198718chr1----1293 --
NM_198793chr322884 2610 --11299 --
NM_198794chr14--11466 --1985
NM_198829chr721496 996 ------
NM_198834chr171147 --1290 12122
NM_198836chr171147 --1290 12122
NM_198837chr171147 --1290 12122
NM_198838chr171147 --1290 12122
NM_198839chr171147 --1290 12122
NM_198844chr172879 861 --2924 122 --
NM_198859chr361931 1907 1135 600 508 405 13951 --14188
NM_198896chr111751 ------
NM_198900chr1267788 7637 7193 6183 5244 2616 --46922 6731 5426 812 --
NM_198902chr153727 632 265 --1106 --
NM_198904chr562123 1588 832 733 582 531 11751 ----
NM_198935chr2042257 663 409 90 12795 1472 --
NM_198947chr113856 196 30 --11038 --
NM_198965chr12--1413 ----
NM_198966chr12--1413 ----
NM_198968chr1353770 3177 1413 1348 245 1205 1915 13417
NM_198969chr192349 246 ------
NM_198970chr192349 246 ------
NM_198990chr752858 2834 2618 231 184 --22428 149 --
NM_198992chr122361 46 11239 1868 11228
NM_199000chr722017 1466 11939 21447 897 22131 330
NM_199039chr4------1733
NM_199040chr1232730 774 725 1113 ----
NM_199053chr43957 321 76 1823 ----
NM_199167chr181316 ------
NM_199168chr1021149 617 --11469 --
NM_199185chr51290 ------
NM_199188chr1244032 4025 3586 1397 ------
NM_199189chr541030 912 884 873 ------
NM_199190chr1244032 4025 3586 1397 ------
NM_199321chr172879 861 --2924 122 --
NM_199324chr421404 807 21374 471 ----
NM_199344chr12561 97 ------
NM_199355chr16--2715 700 --1269
NM_199421chr14----14922 1404
NM_199436chr221993 1182 --1739 --
NM_199454chr143412 943 743 243 12948 14042 14789
NM_199482chr2181 --1510 --
NM_201266chr211936 --12528 --
NM_201267chr22425 52 ------
NM_201269chr121302 481 11282 11338 1262
NM_201279chr211936 --12528 --
NM_201280chr61646 --11020 --
NM_201432chr1785994 5904 4972 4891 2417 1569 1005 324 ------
NM_201433chr1785994 5904 4972 4891 2417 1569 1005 324 ------
NM_201434chr171307 ----1759
NM_201437chr821278 402 ------
NM_201516chr71611 ------
NM_201521chr61385 ------
NM_201522chr61385 ------
NM_201523chr61385 ------
NM_201532chr111564 ------
NM_201533chr111564 ------
NM_201591chr431557 1485 696 --11653 --
NM_201592chr431557 1485 696 --11653 --
NM_201613chr121894 ------
NM_201624chr111146 --156 165
NM_201999chr41834 --1402 --
NM_203301chr1421548 423 11416 11067 2406 39
NM_203305chr93692 273 125 12237 1348 --
NM_203327chr2053893 3709 3322 82 41 --1720 --
NM_203341chr1--2901 345 ----
NM_203364chr111379 1998 ----
NM_203372chr22591 528 ------
NM_203394chr122845 650 --21836 357 12678
NM_203406chr551857 563 532 359 239 --32889 2373 940 --
NM_203446chr2133011 256 208 1820 --11991
NM_203459chr112210 11620 1983 --
NM_203463chr264770 4611 4465 3267 1526 198 ------
NM_203487chr13141 21457 188 1302 11379
NM_203504chr452541 1801 1785 460 281 11747 11711 --
NM_203505chr452541 1801 1785 460 281 11747 11711 --
NM_205860chr163193 2578 2496 2356 2168 1134 23053 1034 ----
NM_206827chr131125 ------
NM_206839chr151241 ------
NM_206852chr14----2618 577 --
NM_206853chr662575 1636 1390 1336 1240 785 12752 --13958
NM_206854chr683836 3708 2046 1152 552 375 327 148 14013 21079 897 25219 491
NM_206855chr6114801 4673 4198 3862 2117 1517 1340 1292 1113 677 481 14978 22044 1862 26184 1456
NM_206857chr14----2618 577 --
NM_206860chr103357 152 108 139 1348 --
NM_206861chr103357 152 108 139 1348 --
NM_206862chr103357 152 108 139 1348 --
NM_206866chr2112532 22992 2266 --1877
NM_206876chr233596 868 258 --23449 2590 --
NM_206907chr543306 2072 1319 41 12719 41329 1232 1070 170 --
NM_206909chr896792 6314 6304 6286 6208 5939 2970 2930 1921 --36327 6090 5831 18396
NM_206927chr111792 1130 ----
NM_206928chr111792 1130 ----
NM_206929chr111792 1130 ----
NM_206930chr111792 1130 ----
NM_206998chr11------127
NM_207012chr1012786 ------
NM_207043chr131714 1641 418 ------
NM_207044chr131714 1641 418 ------
NM_207047chr131714 1641 418 ------
NM_207123chr42741 282 --1775 1196
NM_207171chr1144 --12065 --
NM_207304chr1312130 ----12114
NM_207306chr131646 218 169 ------
NM_207325chr1952020 1626 657 621 317 11496 ----
NM_207343chr113398 187 109 ------
NM_207371chr1021582 392 ----11478
NM_207406chr456110 6012 5965 4431 4408 24540 940 14075 --
NM_207422chrX2271 265 --11452 1468
NM_207435chr121368 --1131 --
NM_207520chr22639 142 1846 ----
NM_207521chr22639 142 1846 ----
NM_207577chr1152865 2843 1920 405 273 --12780 --
NM_207647chr922020 1640 --12282 --
NM_207660chr1431293 50 31 ------
NM_207661chr1431293 50 31 ------
NM_207662chr1431293 50 31 ------
NM_212460chr71708 --1442 --
NM_212471chr1731896 1874 409 158 ----
NM_212472chr1731896 1874 409 158 ----
NM_212502chr121406 528 --1940 --
NM_212503chr121406 528 --1940 --
NM_212554chr102411 208 --21569 1231 21656 1625
NM_212558chr954071 3724 3598 3541 767 1153 1888 23481 2605
NM_213589chr265564 5243 3947 1956 1415 417 --1150 --
NM_213619chr81160 ------
NM_213620chr81160 ------
NM_213654chr321027 490 --1646 --