TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4667-3p
miRNA Sequence: UCCCUCCUUCUGUCCCCACAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001005473chr556012 2466 1888 1015 999 71065 1061 1045 1041 976 964 952 ----
NM_001031695chr22105404 4509 4353 4168 3675 3658 3537 2171 1983 345 --11399 11502
NM_001130chr194594 269 29 21 --1562 134
NM_001409chr162412 2162 1579 876 856 132 1949 22035 863 1189
NM_003051chr111728 --11732 21344 185
NM_003099chr15196013 5547 5504 5495 5385 5324 4959 4780 4742 4640 4484 4385 4289 4089 1317 1104 1020 987 688 --16294 --
NM_003108chr2142502 2467 2324 2303 2220 1942 1929 1718 1689 417 403 136 58 34 56884 2682 2363 2297 658 --16998
NM_004774chr1763011 2902 2604 2063 275 264 2567 300 2817 268 --
NM_004976chr11114914 4748 4039 3356 3147 1641 1274 1212 935 778 192 24222 3364 3946 459 277 34399 3360 940
NM_004992chrX127822 7602 6572 6564 6046 5737 3215 1870 1421 913 901 476 27265 3224 37540 2585 664 1668
NM_004992chrX127822 7602 6572 6564 6046 5737 3215 1870 1421 913 901 476 27265 3224 37540 2585 664 1668
NM_005477chr1542371 2135 1751 930 31675 235 225 --1242
NM_005477chr1542371 2135 1751 930 31675 235 225 --1242
NM_006034chr11102270 2234 2227 2178 2059 1723 940 137 130 123 --189 --
NM_012199chr174175 4030 1395 856 441 107 87 --13222 2446 92
NM_012316chr1175142 5110 4967 4819 4787 4654 4525 2220 2093 1293 961 793 674 481 474 306 23 1162 11028 --
NM_014240chr373881 2967 2550 1401 1207 160 137 11007 1103 1113
NM_014309chr22105394 4499 4343 4158 3665 3648 3527 2161 1973 335 --11389 11492
NM_015315chr543039 3008 2375 2321 1252 --43013 261 248 32
NM_015375chr1144647 4292 3931 3580 3098 1942 1910 1583 1560 899 867 733 632 291 ----14490
NM_015520chr32478 455 3292 226 218 --22783 331
NM_017590chr22102404 2329 2311 1715 1073 904 734 557 98 41 12495 41989 921 382 91 22334 262
NM_017741chr492653 2275 2243 2107 1004 997 989 347 212 ------
NM_020205chr1143183 2971 2853 2158 896 887 622 580 450 380 365 344 89 28 12991 13165 12163
NM_020443chr166265 4647 2334 420 326 110 ----2145 123
NM_020699chr1155160 5118 5103 4561 4462 4359 3950 3705 3690 3679 2063 1091 811 724 607 11597 22067 593 --
NM_020956chr19154719 4690 4569 4268 4094 3978 3692 3548 3538 3530 3370 3345 3152 3056 113 14099 34389 4173 4161 --
NM_021189chr12689 363 2199 185 1191 --
NM_030918chr184912 4717 4205 4160 3942 1747 1544 411 14946 13955 24775 4521
NM_033551chr543039 3008 2375 2321 1252 --43013 261 248 32
NM_052906chr22164651 4090 3767 3631 3424 3309 1924 1905 1896 1685 1467 1049 1038 789 354 306 44131 3243 3109 318 53714 3229 2037 1158 517 14640
NM_080669chr17144716 4454 4441 4033 3825 3771 3434 3240 1882 1685 1620 1386 1266 1035 23245 486 11916 21452 482
NM_148955chr15196013 5547 5504 5495 5385 5324 4959 4780 4742 4640 4484 4385 4289 4089 1317 1104 1020 987 688 --16294 --
NM_152470chr18113001 2914 2685 2560 1295 1204 958 766 680 673 178 12547 43176 684 271 167 11419
NM_152826chr15196013 5547 5504 5495 5385 5324 4959 4780 4742 4640 4484 4385 4289 4089 1317 1104 1020 987 688 --16294 --
NM_173595chr12174846 4837 4577 4518 4455 4397 4083 4060 3992 3893 3575 1726 1325 1239 794 118 109 2982 978 21730 1113 44287 3763 1614 537
NM_181521chr1666860 5531 1481 1471 856 181 32884 2413 1118 25273 2068 25284 346
NM_182565chr17398 90 75 1154 166 180
NM_198969chr194594 269 29 21 --1562 134
NM_198970chr194594 269 29 21 --1562 134
NM_199462chr1144647 4292 3931 3580 3098 1942 1910 1583 1560 899 867 733 632 291 ----14490
NM_203458chr133321 2602 504 1769 23460 260 1636
NM_207380chr1563150 3077 2692 2388 611 537 32920 2726 1074 23206 3139 23155 1070