TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4668-3p
miRNA Sequence: GAAAAUCCUUUUUGUUUUUCCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr832417 990 381 1694 2389 375 --
NM_000092chr263604 3486 2814 543 459 189 ----1410
NM_000332chr697072 6500 6367 5758 2466 2229 1827 1087 725 --24369 1998 --
NM_000337chr586107 5855 4602 4312 2604 2336 2239 1558 26453 1700 45826 2124 1677 627 16270
NM_000448chr1193163 2864 2736 2702 2312 2088 1251 377 28 12937 1705 --
NM_000555chrX126541 6040 6011 5706 5282 5112 3121 2770 1353 1019 532 156 12134 12038 --
NM_000618chr1296030 5386 4859 4388 4072 2170 1605 1593 1360 11625 35467 5142 4866 15486
NM_000618chr1296030 5386 4859 4388 4072 2170 1605 1593 1360 11625 35467 5142 4866 15486
NM_000875chr1586182 5837 5284 5112 4874 2590 1304 1007 16398 36531 6490 2599 --
NM_000899chr1223556 548 12781 --22908 1587
NM_001001419chr574883 4786 4657 4380 3979 3263 1009 45162 3961 2087 1284 ----
NM_001001420chr574883 4786 4657 4380 3979 3263 1009 45162 3961 2087 1284 ----
NM_001001890chr21103948 3264 3248 3116 2994 1677 1628 1204 1185 542 23530 371 23400 1029 --
NM_001002860chr1484629 4513 4011 3090 1832 1325 173 117 1329 13406 --
NM_001003652chr18178459 8239 7546 7381 6247 5907 3204 3116 2914 2838 2795 2631 1657 1378 657 525 502 1230 27446 5697 --
NM_001004317chr654213 3413 3353 1019 551 --1275 24447 103
NM_001005473chr564607 4189 2534 2419 1163 601 11152 11122 --
NM_001007097chr984974 4778 4598 3550 1540 1200 520 486 --44730 3498 1082 122 --
NM_001008408chr766183 5725 5116 5066 4522 4231 24896 4882 --14511
NM_001009554chr494765 4332 4179 4037 3884 3119 1771 1467 1402 21571 1121 1418 --
NM_001009554chr494765 4332 4179 4037 3884 3119 1771 1467 1402 21571 1121 1418 --
NM_001010888chrX64582 3506 3485 3425 3367 821 11108 24411 3055 11655
NM_001011666chr766550 6516 6113 4187 2126 2029 11022 34259 2615 2518 11892
NM_001014380chr1384961 4783 3983 1875 1486 998 416 106 21659 1015 11958 --
NM_001015881chrX21245 1232 --21239 1173 --
NM_001025077chr1065692 5579 5147 1347 1233 725 11853 24729 2882 1584
NM_001025580chrX53681 3550 3292 545 220 --23090 250 1439
NM_001030055chr14114524 4364 4155 3727 3458 3390 2982 2879 1415 396 30 14502 ----
NM_001031732chr483405 2941 2759 2495 2242 1330 1055 126 --12282 12703
NM_001032999chr20115235 5180 4521 4112 3780 1668 1553 1373 721 667 655 11214 11349 --
NM_001039547chr396888 5942 5311 3123 2779 2748 1312 1273 710 15019 16636 27776 2806
NM_001039709chr20115235 5180 4521 4112 3780 1668 1553 1373 721 667 655 11214 11349 --
NM_001040284chr1685824 5281 4528 4361 4354 2284 598 547 14069 ----
NM_001042355chr16114667 4316 4215 3852 2097 1805 1533 742 672 622 222 55034 1694 1461 1344 442 --14535
NM_001042404chr13605 456 255 21644 248 21458 1319 --
NM_001042412chr16114667 4316 4215 3852 2097 1805 1533 742 672 622 222 55034 1694 1461 1344 442 --14535
NM_001042599chr2117491 7277 6415 6394 5645 5207 2661 2431 2371 1775 646 --11134 --
NM_001042601chr382939 2234 2204 1321 882 817 244 116 1804 --1852
NM_001042604chr334344 3031 1294 44901 4678 3198 1509 24383 3074 34877 4815 460
NM_001071775chr1341325 478 446 49 31442 1361 1337 --1686
NM_001106chr399369 6032 2673 2375 2317 1979 1076 794 663 22655 1969 49650 8161 3639 2092 --
NM_001167chrX96658 6533 6469 6390 5670 2045 1649 1138 174 25912 1039 24994 329 26512 813
NM_001173chr14114524 4364 4155 3727 3458 3390 2982 2879 1415 396 30 14502 ----
NM_001204chr256794 6216 3102 1967 833 37725 5589 5230 16712 16245
NM_001304chr17163533 3473 3381 3357 3278 3207 3174 3110 3073 2810 2709 1522 902 631 525 439 ------
NM_001412chrX72768 1460 1127 829 522 425 146 --159 1617
NM_001684chr1114028 3246 3052 2964 2947 2864 2648 1540 1316 200 176 --1349 --
NM_001754chr21103948 3264 3248 3116 2994 1677 1628 1204 1185 542 23530 371 23400 1029 --
NM_001759chr12105294 5282 5141 4644 4189 3383 1939 1931 1679 683 --24882 3315 --
NM_001969chr1473246 1077 1027 899 877 643 296 23947 825 13811 --
NM_002006chr465518 1550 1330 1308 898 744 25770 790 11363 13643
NM_002025chrX79192 9047 3366 3039 2989 2196 1111 --47674 7292 2979 970 18342
NM_002264chr394653 4623 3890 3494 3400 3237 1495 824 561 --23419 1069 --
NM_002270chr585160 4832 4137 3900 3629 3510 2108 1810 35538 3545 1256 13725 11048
NM_002310chr575813 5390 4423 963 705 392 356 21639 482 --16372
NM_002336chr1285075 4483 3232 1976 1809 1276 1211 787 44013 3984 1711 839 11228 --
NM_002709chr282750 2420 2402 1181 1169 905 840 715 31353 634 354 --13443
NM_002737chr1776491 6301 5784 5589 4869 1110 1057 --35928 4268 345 11214
NM_002886chr364511 3746 2006 1923 394 251 34694 3331 965 24952 4044 --
NM_003108chr2106592 6322 6297 6228 5569 5377 5238 5049 1374 576 1807 15550 --
NM_003161chr1762856 2797 1450 1102 718 545 23195 2758 22923 268 1154
NM_003199chr18105610 5464 4403 4097 3752 3678 1351 1333 1316 1226 1760 45544 3474 1051 777 --
NM_003203chr282481 2296 2030 985 959 734 653 113 1312 21854 1749 --
NM_003211chr1231601 428 269 11723 21610 188 11332
NM_003298chr375947 5893 4234 2413 1998 1913 225 34845 1235 294 ----
NM_003342chr1762713 1067 1013 928 644 389 33316 3008 380 12409 --
NM_003478chr1143212 3034 1017 637 ----23325 585
NM_003566chr1252535 2123 968 615 46 ----1656
NM_003574chr1875103 4884 4767 4614 4434 3663 1203 31142 968 293 --11395
NM_003583chr1243079 1492 972 541 23493 2531 23653 3248 13814
NM_003617chr174770 4021 3915 3598 3525 1414 491 --11623 13373
NM_003966chr586920 6405 6226 6140 5089 5080 2883 752 22998 1637 33109 1958 1327 --
NM_003994chr1223556 548 12781 --22908 1587
NM_004089chrX21245 1232 --21239 1173 --
NM_004171chr11109682 7335 6546 6078 3598 3472 2290 2132 1784 1491 --58663 6687 5826 2829 2314 --
NM_004437chr1103386 2445 1289 1250 1216 1205 1191 917 903 589 --32463 1026 268 --
NM_004458chrX62607 2507 2124 2042 1811 49 31837 1017 957 ----
NM_004866chr534060 3288 938 11392 54092 3209 3069 1810 1004 24035 454
NM_004904chr766550 6516 6113 4187 2126 2029 11022 34259 2615 2518 11892
NM_004985chr1273677 2743 1557 1253 544 425 207 23324 809 13734 --
NM_005093chr20115235 5180 4521 4112 3780 1668 1553 1373 721 667 655 11214 11349 --
NM_005156chr985055 4138 2003 1413 1272 1200 1167 929 25086 4698 2986 150 14034
NM_005235chr2117491 7277 6415 6394 5645 5207 2661 2431 2371 1775 646 --11134 --
NM_005359chr1875341 4255 2023 1502 1345 1336 849 1379 12271 14945
NM_005399chr163773 3220 2941 1078 971 330 14047 34421 3926 279 14333
NM_005504chr1276446 6064 5913 4648 4491 1448 484 2734 278 1264 16370
NM_005901chr18178459 8239 7546 7381 6247 5907 3204 3116 2914 2838 2795 2631 1657 1378 657 525 502 1230 27446 5697 --
NM_005903chr574883 4786 4657 4380 3979 3263 1009 45162 3961 2087 1284 ----
NM_006095chr453516 1563 949 853 797 13319 1204 11200
NM_006106chr113879 778 674 22747 597 22212 722 13192
NM_006212chr165127 4205 3580 1909 886 832 24970 4623 --34913 2082 1503
NM_006241chr372406 2172 2003 1837 1831 1619 391 12222 1685 12067
NM_006252chr197426 6755 6674 5251 4737 2995 2282 1255 258 15720 27073 647 --
NM_006380chr1744242 3743 2689 1253 23706 379 11242 24107 3370
NM_006482chr1243079 1492 972 541 23493 2531 23653 3248 13814
NM_006544chr1485502 4652 3844 2268 2106 2084 1596 486 2717 168 1560 14226
NM_006546chr1766502 6296 5825 5329 4712 1715 36117 2535 342 --1895
NM_006599chr1698115 5621 3045 2157 1672 1653 691 677 460 2645 130 15949 --
NM_006614chr363394 2696 2418 2409 1462 1176 33119 2326 314 21086 357 --
NM_006621chr141992 681 583 102 ----21412 236
NM_006820chr143944 2776 1005 91 --22853 1712 1409
NM_006827chr1453342 2840 1196 397 219 23114 524 23379 209 --
NM_006885chr1663437 1493 1486 1480 1416 596 1183 22886 673 --
NM_007007chr1283822 3564 3478 3198 3048 1704 1212 634 23865 810 13328 --
NM_007173chr1162262 1905 1899 781 539 321 --41849 1786 1556 438 --
NM_007249chr13119127 8908 7632 7530 5930 3112 2576 2467 2003 1777 1675 23189 3010 22156 1637 18923
NM_012096chr3103762 3735 3611 3516 3350 3109 2387 2302 1202 777 1531 ----
NM_012164chr997006 6951 6910 5929 2918 2062 2017 1441 459 36552 2891 303 45952 2811 1461 52 --
NM_012214chr266179 5817 4896 1911 633 495 31094 716 197 26277 5409 --
NM_012262chr195256 4912 4869 3287 3248 1021 732 541 405 24634 566 23608 861 --
NM_012287chr374421 4002 3863 3570 3035 1424 336 22947 1638 --11707
NM_012330chr10----11378 31490 651 570
NM_013255chr787045 6512 6481 2994 2896 2707 327 45 36322 3263 1501 28717 6861 15658
NM_013943chr162833 2216 990 907 612 586 22720 2471 21290 701 --
NM_014155chr11107541 7030 6366 6059 5796 2802 2564 1694 831 68 1435 17037 --
NM_014331chr487145 6693 6625 5410 5107 4820 2485 350 56783 6528 2989 2955 383 42116 1885 368 58 --
NM_014333chr1142149 1087 266 140 --21769 381 12445
NM_014423chr595654 5411 5338 5280 5141 2113 998 808 30 24987 3796 15096 1842
NM_014774chr173213 2970 2507 2501 798 620 501 22514 1042 22912 770 --
NM_014812chr13605 456 255 21644 248 21458 1319 --
NM_014830chr12103915 3645 3379 2791 2685 1462 1271 452 395 261 1338 --1759
NM_014864chr194378 4284 4153 3364 3322 3149 1540 1374 1367 34412 1487 1154 1386 --
NM_014877chr1786626 6267 6095 5302 3030 2902 1465 407 35650 5059 4826 47590 7262 7029 949 --
NM_015026chr1264549 2966 1037 1013 948 777 14368 --1914
NM_015155chr1093237 2559 2308 971 931 250 188 179 134 --22099 1247 --
NM_015247chr16114667 4316 4215 3852 2097 1805 1533 742 672 622 222 55034 1694 1461 1344 442 --14535
NM_015310chr8108372 8336 7208 6100 2953 1934 1505 897 284 196 --149 --
NM_015313chr1194517 4258 3208 3014 1897 1643 1466 823 39 14372 24241 3491 --
NM_015359chr882802 2382 2102 1977 1044 811 670 333 ----32824 2692 1171
NM_015365chrX53681 3550 3292 545 220 --23090 250 1439
NM_015458chr864899 3502 860 762 754 138 --1468 23258 3218
NM_015879chr1855989 5712 5621 2427 2286 --12257 1283
NM_016075chr1322324 1140 32739 1941 1006 1646 22424 271
NM_016132chr1562712 1320 471 422 345 288 1433 2503 186 --
NM_016206chr3178680 8524 8093 7888 7577 7358 7004 6422 5866 3482 2066 1581 1376 1295 1035 300 141 23125 3111 22231 73 --
NM_016248chr1383674 3553 2804 2441 1458 1081 476 455 13660 42710 1417 1008 281 --
NM_016260chr266283 5752 5540 5409 4957 874 25380 1533 15453 15952
NM_016322chr952014 1083 964 313 100 12866 12142 21991 1182
NM_016530chr1532821 2570 727 33684 1110 1005 --24090 866
NM_017420chr1453774 2366 1318 834 663 13600 12906 1820
NM_017637chr969383 8367 2668 2128 778 486 38330 7705 3557 --29242 1535
NM_017643chr17122862 2761 2747 2492 2457 2111 2067 1119 993 421 264 130 --22599 429 22722 39
NM_017650chr7105944 5401 4966 4290 2378 1623 1244 1117 1107 900 14957 11338 --
NM_017658chr1484387 3367 3328 1876 1546 1531 941 377 44394 3573 1434 579 14023 14542
NM_017848chrX63338 2854 1119 700 449 361 34110 1595 61 2527 114 --
NM_018227chr492772 2454 2287 2242 2136 837 414 98 40 12782 1608 --
NM_018313chr362532 1638 774 358 324 214 1592 2365 343 --
NM_018362chr1193924 3512 3361 3132 2640 1492 1123 284 261 34042 3799 1007 ----
NM_018374chr784905 4810 4471 4182 3998 3910 1596 1589 24828 1186 14266 --
NM_018566chr185063 3868 3411 1933 1927 1173 1051 1040 25092 602 160 --
NM_019001chr334344 3031 1294 44901 4678 3198 1509 24383 3074 34877 4815 460
NM_020122chr295560 5256 1950 1267 1182 1170 994 380 75 22062 1893 21721 1069 --
NM_020475chr832354 927 318 1631 2326 312 --
NM_020476chr832354 927 318 1631 2326 312 --
NM_020477chr832354 927 318 1631 2326 312 --
NM_020478chr832417 990 381 1694 2389 375 --
NM_020480chr832354 927 318 1631 2326 312 --
NM_020640chr351888 1783 1606 319 242 --1921 12039
NM_020648chr1892764 2453 2361 2124 2031 719 336 313 289 32378 553 190 ----
NM_020673chr20107616 7062 6313 6157 5343 5227 5024 2747 1392 627 21634 315 27056 1810 --
NM_020718chr1665370 4351 2378 2214 1915 1222 34587 4113 1902 22316 339 --
NM_020727chr2183951 3738 3447 3162 2910 618 326 319 33847 3471 928 11277 --
NM_020772chr1777840 7549 2593 2375 1979 1711 267 45511 2223 1730 510 33072 1610 1204 --
NM_020774chr1885570 4897 3909 3815 2246 1853 1610 850 36265 3791 380 12147 15952
NM_020782chr1284330 4267 3981 3484 1714 1524 406 214 34313 1809 349 ----
NM_020918chr1043614 3578 3276 1288 13232 11116 11452
NM_020921chr1473356 3026 2829 2552 845 314 308 23606 1076 ----
NM_021148chr74814 808 793 749 21675 1006 1821 --
NM_021255chr1463417 3074 1466 534 253 51 23577 71 32919 941 288 --
NM_021647chr494765 4332 4179 4037 3884 3119 1771 1467 1402 21571 1121 1418 --
NM_021961chr1197228 6811 6532 6457 5786 3008 2461 2283 1686 --12515 --
NM_021964chr3146296 5604 4833 4681 4547 4299 4120 2522 2184 1467 978 794 771 549 ----24699 4171
NM_022048chr1585746 4685 4636 4603 3943 2309 2240 354 --14577 1825
NM_022753chr141852 636 196 95 --32149 788 659 22198 103
NM_022977chrX62607 2507 2124 2042 1811 49 31837 1017 957 ----
NM_024345chr965866 5824 983 888 634 362 12173 1827 35675 4958 653
NM_024524chr352879 2451 1023 879 325 2619 57 13057 22035 648
NM_024744chr242482 1848 981 745 22566 535 21059 873 --
NM_024947chr369350 8470 8242 6518 3826 3368 --32752 2427 1244 16415
NM_025191chr131132 591 406 23297 3018 --23409 2650
NM_030647chr7126243 5834 5085 2013 1969 1596 1389 1269 840 560 450 347 25727 4676 12130 --
NM_030816chr153619 3405 2517 2295 2246 --12653 11380
NM_031435chr1253166 2952 2199 1355 831 23360 567 33457 2393 421 --
NM_032116chr1384961 4783 3983 1875 1486 998 416 106 21659 1015 11958 --
NM_032228chr1142962 2228 833 673 11189 22616 2352 1477
NM_032373chr10105060 5049 4720 3863 3808 3645 1796 991 478 106 1944 23662 958 --
NM_032632chr1451405 629 413 299 109 1666 2429 116 --
NM_032968chrX54044 3869 1687 1592 480 --22874 1088 --
NM_032969chrX54044 3869 1687 1592 480 --22874 1088 --
NM_032973chrY74036 3861 1681 1591 1458 493 480 --22869 1088 --
NM_033224chr7117115 6986 6785 6035 5589 3164 2022 1834 1520 1177 662 14874 32873 1504 1469 11037
NM_033360chr1273798 2864 1678 1374 665 546 328 23445 930 13855 --
NM_033389chr1784797 4488 4292 3498 3278 3090 1825 136 --14506 1924
NM_033656chr2185764 5747 5245 5050 4783 4116 2198 819 34442 4044 1953 22330 611 --
NM_052879chr1263882 2898 1299 796 615 182 33828 3334 278 33516 2995 135 11492
NM_052907chr1241244 650 603 353 11556 24210 2949 32960 767 173
NM_053043chr766183 5725 5116 5066 4522 4231 24896 4882 --14511
NM_078470chr1092177 2055 1085 985 795 559 523 498 290 12225 11942 --
NM_130446chr384208 4052 2957 2864 2857 1733 1300 1213 14323 --13167
NM_130847chr1165808 5036 4848 1312 1303 768 15411 1573 1202
NM_133370chr483405 2941 2759 2495 2242 1330 1055 126 --12282 12703
NM_133496chr184216 3211 3092 2884 1699 1593 866 257 --1593 11343
NM_138571chr62497 23 ----2224 101
NM_138713chr1698115 5621 3045 2157 1672 1653 691 677 460 2645 130 15949 --
NM_138714chr1698115 5621 3045 2157 1672 1653 691 677 460 2645 130 15949 --
NM_144567chr152459 2061 937 520 279 32662 1092 245 11717 12031
NM_144578chr1495130 4926 4615 2126 2099 1509 1471 234 223 34752 4036 614 ----
NM_145207chr485105 4747 2095 1509 1327 1218 998 151 45086 4945 4528 4324 1675 --
NM_145259chr266339 5110 4525 2206 2086 1576 36665 5481 5019 12403 26715 1977
NM_145753chr351541 1481 1399 1162 299 11423 --1173
NM_145808chr753065 2783 813 648 489 --2888 626 12758
NM_148894chr41278 11245 11174 2927 507
NM_152407chr5103160 2879 2311 2304 2297 2290 1316 472 456 114 --1300 --
NM_152622chr573450 2586 2487 2309 2209 2148 1380 43425 2229 1021 505 32497 818 563 --
NM_152624chr587157 5181 2766 2489 2363 1167 665 551 47474 5387 1496 877 32881 1942 1124 21306 273
NM_152756chr5134274 4259 4244 3450 3317 3003 1715 1169 1110 705 382 292 56 ------
NM_152787chrX1797 1830 --22793 1509
NM_152835chr132617 119 112 12073 2509 131 --
NM_153188chr585160 4832 4137 3900 3629 3510 2108 1810 35538 3545 1256 13725 11048
NM_153332chr883212 2348 2337 711 590 469 442 160 32019 950 291 12086 --
NM_172071chr1107218 7104 6842 5018 4766 2131 1699 1325 1192 373 35221 4639 2959 25474 1827 26462 669
NM_173214chr1698115 5621 3045 2157 1672 1653 691 677 460 2645 130 15949 --
NM_173829chr585859 4816 3906 1814 1748 1739 877 759 33913 3878 1802 25800 517 --
NM_175624chr12107322 6131 4753 2942 2632 1708 1442 1232 832 569 2711 583 16954 12738
NM_175625chr12107322 6131 4753 2942 2632 1708 1442 1232 832 569 2711 583 16954 12738
NM_178151chrX126541 6040 6011 5706 5282 5112 3121 2770 1353 1019 532 156 12134 12038 --
NM_178152chrX126541 6040 6011 5706 5282 5112 3121 2770 1353 1019 532 156 12134 12038 --
NM_178153chrX126541 6040 6011 5706 5282 5112 3121 2770 1353 1019 532 156 12134 12038 --
NM_181521chr16146983 5976 5641 5442 5381 5049 2820 2646 2278 1382 1282 996 753 139 25927 2759 24685 2700 --
NM_181784chr262493 2379 1712 810 405 382 12338 1393 --
NM_182493chr1665324 3644 2122 1575 879 473 34472 4049 1066 21896 908 14020
NM_182515chr1976490 5537 5220 4445 1905 1583 1525 15468 --14488
NM_182762chr765484 4854 4493 2439 956 638 16190 23901 1836 1252
NM_182898chr766550 6516 6113 4187 2126 2029 11022 34259 2615 2518 11892
NM_182899chr766550 6516 6113 4187 2126 2029 11022 34259 2615 2518 11892
NM_183004chr1473246 1077 1027 899 877 643 296 23947 825 13811 --
NM_194291chr882672 2592 2586 976 825 699 433 310 1554 1393 --
NM_194314chr195368 4843 3977 3847 2125 1896 665 218 26 13576 14658 --
NM_194434chr1875103 4884 4767 4614 4434 3663 1203 31142 968 293 --11395
NM_198057chrX21245 1232 --21239 1173 --
NM_199188chr1263882 2898 1299 796 615 182 33828 3334 278 33516 2995 135 11492
NM_199190chr1263882 2898 1299 796 615 182 33828 3334 278 33516 2995 135 11492
NM_203342chr1103386 2445 1289 1250 1216 1205 1191 917 903 589 --32463 1026 268 --
NM_203343chr1103386 2445 1289 1250 1216 1205 1191 917 903 589 --32463 1026 268 --
NM_206853chr633197 1470 1005 13794 21400 987 13942
NM_206855chr665423 4080 1659 1152 708 40 56020 4640 4452 865 52 13992 16168
NM_206876chr282750 2420 2402 1181 1169 905 840 715 31353 634 354 --13443
NM_206909chr8108372 8336 7208 6100 2953 1934 1505 897 284 196 --149 --
NM_207406chr466332 5909 5419 4357 4332 232 16504 34666 1407 1355 --