TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4670-3p
miRNA Sequence: UGAAGUUACAUCAUGGUCGCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr551291 1253 1247 1199 1185 1848 ----
NM_000027chr43938 792 729 --1811 --
NM_000033chrX1640 ------
NM_000038chr551929 1624 739 618 279 41514 1444 553 80 11868 --
NM_000044chrX1104 ------
NM_000046chr572784 2396 1929 969 662 625 273 23117 2373 --1142
NM_000051chr1183387 3224 3078 2721 2256 2240 1290 669 23468 619 22269 1143 1740
NM_000052chrX103112 3094 2634 2545 1353 1169 454 203 186 31 23187 2952 --22556 2434
NM_000061chrX--154 ----
NM_000067chr84655 555 547 275 1491 ----
NM_000081chr141744 1576 1245 478 31891 1657 1599 11304 161
NM_000084chrX146530 6271 5112 4970 2554 2535 850 824 744 667 658 590 292 172 24997 1328 24270 597 16424
NM_000088chr1731346 1264 44 1117 1262 --
NM_000089chr7146 ------
NM_000090chr22731 138 2265 230 1900 --
NM_000091chr292757 2737 2706 2658 2585 2515 2499 1160 115 22594 427 22372 815 1810
NM_000092chr2104240 3942 3613 3570 1530 1212 1012 863 58 40 23512 336 34605 4512 2874 13952
NM_000093chr952262 2157 1904 938 889 12170 --1126
NM_000104chr252826 2032 1890 560 196 22047 2024 --1479
NM_000108chr7101819 1557 1298 1222 567 412 311 118 96 35 ------
NM_000109chrX132391 2279 2056 1863 1828 1789 1064 928 749 736 589 499 332 32617 2583 1994 ----
NM_000110chr12454 31 --1292 1135
NM_000111chr72338 125 154 ----
NM_000112chr5165318 5199 4712 4654 4510 3822 3548 3501 1932 1848 1837 1433 1192 900 818 389 23618 47 --13949
NM_000115chr1392372 1884 1000 909 463 408 325 274 236 22205 2123 22156 1927 22431 1816
NM_000124chr10122 1146 ----
NM_000125chr693834 3798 3617 3242 3032 2592 1501 649 449 22948 863 ----
NM_000126chr153213 115 30 ------
NM_000127chr81301 ------
NM_000129chr651476 1176 504 239 92 1373 --11387
NM_000138chr1562104 1989 1895 729 545 369 22626 2385 --1519
NM_000141chr1041446 940 551 316 --1544 --
NM_000161chr1451937 1808 1490 1215 327 2476 111 32000 1650 1362 11381
NM_000163chr5122126 1989 1927 1921 1910 1670 1452 816 555 433 406 279 2827 563 ----
NM_000165chr661719 1603 1448 1372 1140 82 11644 ----
NM_000167chrX61773 1756 1583 1550 1341 643 ------
NM_000168chr72549 64 22500 2446 ----
NM_000176chr5143663 3527 3218 3135 2449 1512 1393 1321 904 629 577 530 340 48 11111 33823 3385 1026 12827
NM_000188chr102734 693 ------
NM_000189chr262048 2042 1575 887 790 25 ------
NM_000208chr1994368 4143 3893 3342 3325 1862 1720 1022 392 3484 463 373 ----
NM_000210chr241764 1580 454 415 1210 1421 --
NM_000214chr205643 583 469 114 95 ------
NM_000216chrX133590 3499 3459 3308 3073 2957 2557 1178 860 817 142 124 54 ----13363
NM_000217chr1265097 4839 4198 3637 3421 1980 34821 4462 1594 21079 356 --
NM_000218chr111896 ------
NM_000222chr411883 --1224 22035 1775
NM_000227chr183386 361 130 --1268 --
NM_000232chr4113224 3181 2976 2452 2286 2271 966 923 344 189 40 1505 32663 647 425 --
NM_000233chr24662 325 258 72 ------
NM_000237chr851669 1614 1580 1432 554 1413 171 --
NM_000240chrX111792 1773 1680 1628 1513 734 724 653 625 369 303 22068 905 --1178
NM_000242chr1072252 2061 2053 1924 1916 303 87 1557 2707 475 1982
NM_000245chr731396 664 155 ------
NM_000248chr392696 2410 1987 1068 973 514 265 91 65 --22984 353 --
NM_000252chrX61492 612 538 470 274 52 21482 980 ----
NM_000259chr15185942 5841 5792 5499 5473 5259 4920 4840 4121 4095 2152 1850 1487 1455 1388 1022 950 902 22434 1801 24416 364 --
NM_000264chr9113303 2974 2729 2619 2309 2292 2273 2212 2140 523 375 2340 324 23259 499 --
NM_000267chr17163308 3279 2812 2596 2389 2371 2365 2160 1349 1318 1084 963 794 787 553 279 1606 33208 1051 198 11356
NM_000268chr2243760 3449 2934 125 ------
NM_000276chrX22244 2016 1107 ----
NM_000280chr111237 ----1729
NM_000288chr61339 ------
NM_000297chr45665 642 506 455 143 21743 160 2774 492 11488
NM_000314chr1052166 1050 911 811 535 33069 2508 2123 --12194
NM_000317chr112332 298 --1375 --
NM_000321chr1361383 1347 1327 549 414 393 21660 1240 175 11375
NM_000330chrX71894 1824 1492 351 277 158 136 1478 11666 --
NM_000332chr6146940 6879 6091 6004 5513 4785 2686 2301 2103 1640 1553 1513 637 106 22314 541 26100 5947 1908
NM_000337chr5126618 6491 6418 6058 5706 5123 4969 1494 1083 886 687 511 35461 4632 659 1531 --
NM_000340chr341522 1283 1080 598 21052 1036 ----
NM_000345chr41999 ------
NM_000346chr1751834 1792 1702 570 184 --1693 --
NM_000351chrX52935 1661 1515 1100 839 13737 21543 1037 1496
NM_000362chr2293521 3321 3070 2432 2398 1043 841 235 48 ------
NM_000368chr984690 4493 4237 3502 1116 618 275 27 ------
NM_000378chr114942 883 429 123 1100 ----
NM_000390chrX93342 3299 2776 1054 998 944 758 196 31 22785 2582 33161 3096 804 --
NM_000393chr272105 1504 1445 674 509 376 65 1857 12017 --
NM_000401chr1111011 21125 338 ----
NM_000405chr531785 1716 500 --1488 --
NM_000408chr283407 3375 2881 2336 2287 991 663 205 1139 43435 3278 2741 2163 22660 1057
NM_000416chr63392 124 24 ----2404 64
NM_000421chr172342 307 1333 ----
NM_000430chr1763093 2469 1441 1352 749 375 --1818 --
NM_000439chr552555 1903 410 357 184 11658 ----
NM_000441chr722155 49 12183 ----
NM_000448chr114905 856 620 470 22474 2285 ----
NM_000451chrX31919 1430 507 --21865 706 --
NM_000452chr1381974 1955 1948 1683 1649 801 375 349 1119 31305 559 529 11830
NM_000460chr3----1375 --
NM_000461chr374578 4303 4289 3669 1336 1180 537 21735 981 11293 11798
NM_000462chr1521655 1579 1673 11324 --
NM_000480chr1181433 1410 1264 1251 1076 520 488 255 2436 43 2206 29 11101
NM_000484chr211923 ------
NM_000492chr741232 1211 1097 370 1440 ----
NM_000493chr681067 968 878 774 721 424 204 103 --1456 --
NM_000503chr851867 1291 679 345 103 ------
NM_000509chr41163 ------
NM_000510chr1161458 1423 1387 1279 1198 948 --1480 --
NM_000518chr11125 ------
NM_000522chr7--2279 190 ----
NM_000531chrX2367 228 ------
NM_000533chrX31952 1704 1438 --31517 329 254 --
NM_000551chr371668 1448 777 669 408 335 201 11898 --21662 156
NM_000555chrX126887 6872 6627 6513 6436 6269 6060 5518 5230 3037 1184 323 67701 7408 7179 2141 1842 768 46103 4904 3083 2642 22848 1215
NM_000575chr221011 979 ------
NM_000578chr221509 588 ------
NM_000584chr431239 878 246 4800 335 146 55 11051 21149 341
NM_000585chr43556 232 200 --1467 --
NM_000599chr284577 4048 1667 1624 1084 605 406 172 14335 21676 1049 11792
NM_000600chr72338 142 ------
NM_000602chr711176 11043 ----
NM_000609chr1043135 3088 2846 2793 ------
NM_000610chr1162925 2762 2554 2514 2253 618 1962 ----
NM_000611chr11187032 6925 6460 5624 5260 5153 4843 2307 1907 1651 1641 1212 1193 1089 892 528 233 124 1434 --16952
NM_000615chr1182998 2917 2588 2575 748 711 662 627 2862 53 1520 11900
NM_000617chr1222324 1887 --2810 583 1504
NM_000618chr12105457 4631 4564 4464 4445 2227 2024 2005 697 77 21919 1078 56495 6344 4992 4164 801 --
NM_000618chr12105457 4631 4564 4464 4445 2227 2024 2005 697 77 21919 1078 56495 6344 4992 4164 801 --
NM_000633chr1835224 3577 1397 24264 636 21750 903 14605
NM_000663chr1632856 2484 929 22580 2268 ----
NM_000685chr32880 30 ------
NM_000685chr32880 30 ------
NM_000686chrX61559 1292 1088 617 155 94 ----11484
NM_000693chr1531681 1469 1181 11170 --11212
NM_000697chr17--2303 69 ----
NM_000719chr1296738 6274 5778 5293 4929 4613 983 688 455 26618 6478 --14575
NM_000721chr132730 2639 2460 12010 ----
NM_000724chr1051837 1558 1396 797 371 --11381 11820
NM_000726chr251158 1133 584 280 76 --1313 --
NM_000767chr1951195 532 385 120 87 ------
NM_000780chr851258 1067 933 784 228 ------
NM_000783chr102454 73 --186 --
NM_000788chr451472 1238 1104 302 160 ----31310 1157 68
NM_000793chr14145144 4627 4479 4249 4201 3975 3889 3647 3337 3255 3246 1420 1092 536 12011 33780 1641 656 13731
NM_000801chr201412 2933 816 1780 --
NM_000806chr541449 752 631 522 11890 11219 --
NM_000807chr42128 88 1257 1275 1675
NM_000808chrX3791 766 415 ------
NM_000809chr4239181 9138 8572 8404 8025 7518 7462 7418 7249 7055 6902 6780 6331 5618 3065 2901 2839 2774 2718 2386 617 373 111 78687 8312 5888 5733 2539 973 452 26995 1426 13288
NM_000810chr152569 214 ----1170
NM_000813chr5175229 5206 5144 4939 4436 4186 4133 4000 3550 1736 1719 1336 1109 1096 895 656 299 --23994 3943 --
NM_000814chr1574139 3586 3362 3006 2637 1451 146 31168 792 30 12719 --
NM_000816chr53557 516 193 ------
NM_000817chr211069 ------
NM_000824chr43382 150 82 --1930 --
NM_000826chr492517 2042 1846 955 878 748 475 401 94 22610 769 12496 --
NM_000828chrX42114 1973 1604 766 21652 857 1725 11987
NM_000831chr186209 6113 5909 4489 1978 1451 1147 803 55736 4457 1920 1673 518 11107 --
NM_000838chr662717 1764 1724 1052 942 849 --21810 289 --
NM_000840chr72396 167 ------
NM_000845chr72487 377 ------
NM_000856chr4--1112 ----
NM_000859chr551586 1571 1332 1296 441 1466 ----
NM_000861chr362641 1991 894 715 569 201 11960 ----
NM_000865chr6------1223
NM_000866chr341880 672 209 133 --1371 --
NM_000868chrX102626 2616 2377 1609 1034 980 707 213 128 67 ------
NM_000875chr15146830 6543 5814 5722 5683 5464 2457 1433 1390 1362 1144 605 586 149 36896 5035 2520 11222 --
NM_000876chr681253 1023 1007 520 394 111 92 68 21448 1420 ----
NM_000877chr2143106 3000 2733 2701 2692 2406 2317 2181 2163 1926 1241 913 771 79 ------
NM_000879chr54275 248 106 94 ----1113
NM_000880chr82841 752 2659 36 ----
NM_000882chr35365 336 309 59 43 ------
NM_000891chr1743527 2405 450 378 --32571 930 808 12558
NM_000899chr12104149 4046 2832 2681 1569 1540 1443 946 376 145 11070 21721 1592 12954
NM_000901chr482467 2229 2056 2035 982 885 683 24 12044 12317 1972
NM_000902chr373077 2260 2164 2134 747 684 106 1929 1241 11164
NM_000908chr53515 138 107 ----2549 126
NM_000910chr431478 441 354 11444 1736 1744
NM_000912chr8113415 3278 3092 2470 2191 1393 1367 1293 1281 836 117 --1652 --
NM_000917chr102301 278 --174 --
NM_000919chr52624 431 ------
NM_000922chr111386 --11045 --
NM_000926chr11168780 8463 8324 8183 8148 8091 7692 6900 3224 2970 2876 1885 1660 1367 1149 1040 17908 89490 7940 5995 3361 2522 2300 490 312 57556 2329 2313 1921 1677
NM_000933chr2041441 1434 467 44 21122 386 2542 146 11626
NM_000935chr341271 1115 899 148 2858 121 21065 1032 --
NM_000941chr71332 ------
NM_000944chr451836 622 387 336 112 12018 1397 --
NM_000945chr271653 1629 1620 1366 381 351 274 12069 11699 1623
NM_000949chr54929 811 757 648 1704 ----
NM_000950chrX93506 3500 2845 1374 1031 605 495 91 55 12714 2791 344 13462
NM_000953chr1451753 1719 1503 1491 1136 --21608 415 --
NM_000956chr141317 1411 ----
NM_000959chr173650 3261 3039 3018 3000 1328 744 53370 3157 3027 2843 1222 23598 3167 12711
NM_000961chr2073532 3514 3331 3212 2949 950 592 1889 ----
NM_000962chr983032 2959 2931 2771 2739 2296 1038 384 21105 136 13135 12076
NM_000963chr1102465 2097 1757 1526 976 963 758 551 543 50 1269 --1506
NM_000964chr171527 ------
NM_000965chr33246 192 173 1898 ----
NM_000983chr141275 488 229 158 31343 1230 189 1164 --
NM_000989chr8--123 ----
NM_000998chr2152 ------
NM_001001132chr2141080 999 359 294 --31044 388 111 --
NM_001001323chr1273061 2967 2820 2683 1096 786 700 2394 56 22670 678 --
NM_001001330chr1051295 1194 1072 970 911 153 --11145
NM_001001344chrX52594 2574 2567 2547 1940 1759 ----
NM_001001389chr1162925 2762 2554 2514 2253 618 1962 ----
NM_001001390chr1162925 2762 2554 2514 2253 618 1962 ----
NM_001001391chr1162925 2762 2554 2514 2253 618 1962 ----
NM_001001392chr1162971 2808 2600 2560 2299 664 11008 ----
NM_001001395chr1252592 2555 2242 2232 933 1679 1459 32759 990 737
NM_001001396chr174427 4238 3732 1553 1533 1503 476 23555 56 12976 --
NM_001001419chr5115202 3794 3212 2028 1959 1867 1774 906 350 61 49 ----23821 640
NM_001001420chr5115202 3794 3212 2028 1959 1867 1774 906 350 61 49 ----23821 640
NM_001001433chr2073232 3174 3131 3075 2267 553 393 21184 663 22444 1265 --
NM_001001436chr162698 29 ------
NM_001001481chr862978 2446 1295 1037 835 706 180 63415 3215 3044 2301 893 325 --
NM_001001483chr111353 ------
NM_001001484chr1082479 2471 2297 2048 1950 1904 564 216 11734 1461 --
NM_001001485chr3------1354
NM_001001486chr3------1296
NM_001001487chr3------1296
NM_001001520chr19----1145 --
NM_001001521chr22267 256 ------
NM_001001556chr1521442 248 21342 505 ----
NM_001001557chr821803 1517 --31954 1584 180 --
NM_001001664chr2164026 3917 3490 3124 3017 2786 1598 1460 1347 740 729 548 254 228 157 36 13807 2934 859 --
NM_001001665chr253123 3000 2946 945 448 22428 430 --22184 1189
NM_001001668chr1953745 3724 3655 1259 189 13254 ----
NM_001001701chr492306 1943 1900 1825 763 501 239 153 67 1106 ----
NM_001001702chr531823 1641 1198 11607 11762 --
NM_001001706chr651033 1001 949 775 212 31146 1016 831 1955 --
NM_001001787chr11158 1370 ----
NM_001001870chr172857 794 --1819 --
NM_001001890chr2153840 3060 805 493 383 23537 2917 43567 1107 650 389 11233
NM_001001928chr22148271 8183 8119 7967 7781 7770 7201 7164 5433 5412 3188 2753 1854 1095 58041 6991 6289 6033 509 --18323
NM_001001933chr13636 507 89 1428 ----
NM_001001974chr1061997 1985 1764 1668 1620 555 21545 676 41646 383 354 181 --
NM_001001995chrX61649 1543 1316 1206 544 497 --1575 11938
NM_001002233chr872164 2153 2086 2068 1765 642 537 ----140
NM_001002243chr24962 942 932 311 1919 ----
NM_001002257chr282920 2848 2760 2701 2442 787 236 144 43380 3302 3025 680 1193 12449
NM_001002269chr93487 453 101 ------
NM_001002814chr853875 3638 1146 642 537 ----140
NM_001002838chrX31386 751 542 ------
NM_001002843chr1541166 1049 966 344 1993 ----
NM_001002860chr1484678 3748 3726 3375 3218 1172 1149 207 24184 349 ----
NM_001002909chr1732262 2080 777 --12140 12213
NM_001002919chr22440 369 ------
NM_001003407chr10125120 4483 4434 3662 3412 3292 3249 1259 1197 1112 650 207 --34140 3166 1225 23402 399
NM_001003408chr10125120 4483 4434 3662 3412 3292 3249 1259 1197 1112 650 207 --34140 3166 1225 23402 399
NM_001003652chr18187417 7197 7140 6652 6183 6020 5923 5755 5523 5365 5315 3075 2937 2277 1781 1730 1333 544 35811 2249 888 38262 5535 597 15762
NM_001003674chr18166792 6745 6655 6180 5971 4302 2814 2735 2008 1554 1232 1002 991 875 464 191 16589 11627 --
NM_001003675chr18166792 6745 6655 6180 5971 4302 2814 2735 2008 1554 1232 1002 991 875 464 191 16589 11627 --
NM_001003679chr192098 2084 810 769 488 419 229 123 44 1601 2640 582 --
NM_001003681chr2252007 1726 857 297 189 --11564 --
NM_001003683chr2143 ------
NM_001003688chr421082 994 ------
NM_001003698chr621664 1489 21787 483 2523 282 1655
NM_001003699chr621664 1489 21787 483 2523 282 1655
NM_001003712chr1283463 3416 3354 1102 911 878 232 141 13742 34052 3097 1134 --
NM_001003760chr6123570 3536 3480 3382 3225 3138 2947 2627 2319 1344 1003 751 22789 834 ----
NM_001003790chr83787 676 285 ------
NM_001003791chr83787 676 285 ------
NM_001003792chr351122 1017 907 776 242 152 ----
NM_001003793chr351122 1017 907 776 242 152 ----
NM_001003800chr933617 1159 569 --11507 23448 3167
NM_001004065chr973743 3378 3209 2593 1540 1422 715 --33132 2906 2557 --
NM_001004125chr951020 945 925 797 344 ----1847
NM_001004317chr6113798 3792 3690 3680 3429 1473 1046 906 849 728 617 11755 11259 1653
NM_001004328chr1252209 1941 435 143 123 2535 196 ----
NM_001004329chr1251350 460 183 106 73 --2506 421 --
NM_001004330chr1231487 288 202 31387 1380 1176 --2749 57
NM_001004342chr196039 5958 5948 5750 4233 2223 1536 1246 598 24323 2015 1510 --
NM_001004356chr421515 1477 ------
NM_001004358chr421515 1477 ------
NM_001004360chr261869 1854 1813 1671 1545 1308 11567 21385 518 1331
NM_001004419chr1274579 3804 3257 1530 1370 817 305 24627 3780 14523 --
NM_001004439chr1511229 ------
NM_001004722chr221141 801 ------
NM_001005242chr1221619 155 ------
NM_001005366chr124949 704 636 109 1643 ----
NM_001005375chrY61877 1569 610 405 208 197 11517 ----
NM_001005386chr2102357 2237 2077 2056 1893 1865 1581 1545 524 511 2654 376 22390 1620 --
NM_001005404chr1794417 3518 3475 3159 1815 1115 556 492 472 ----11500
NM_001005463chr1092646 2431 1707 768 729 613 606 347 224 150 31683 848 637 1586
NM_001005473chr5116219 5800 4789 4657 4571 4275 2508 2145 1188 747 529 25269 699 35175 2625 256 14770
NM_001005474chr331162 1156 277 --1181 --
NM_001005476chr2--2742 542 ----
NM_001005502chr1244978 4566 2087 973 31050 917 398 24803 3222 --
NM_001005527chr331310 930 396 1113 1956 --
NM_001005609chrX63052 1420 1038 914 262 172 --13137 --
NM_001005746chr251158 1133 584 280 76 --1313 --
NM_001005747chr251158 1133 584 280 76 --1313 --
NM_001005845chr851801 1753 1305 1258 24 41879 1602 1281 517 11709 --
NM_001005861chr32704 152 ------
NM_001006117chrY------1196
NM_001006118chrY------1196
NM_001006120chrY------1196
NM_001006600chr592177 2032 1976 1797 1633 920 913 768 387 12360 --12232
NM_001006623chr242257 1576 512 46 --22103 2067 --
NM_001006636chr23813 342 53 ------
NM_001006657chr272813 2598 1996 1013 820 686 161 12380 32987 2389 719 13172
NM_001006681chrX147 ------
NM_001006682chrX147 ------
NM_001006683chrX147 ------
NM_001006684chrX2504 193 1559 1121 --
NM_001006945chr13585 181 170 1136 --1574
NM_001007023chr14145144 4627 4479 4249 4201 3975 3889 3647 3337 3255 3246 1420 1092 536 12011 33780 1641 656 13731
NM_001007024chr1764411 4352 3947 3110 2700 2666 --24318 3708 --
NM_001007025chr1764411 4352 3947 3110 2700 2666 --24318 3708 --
NM_001007026chr121454 ------
NM_001007033chr12145 --193 --
NM_001007067chr88991 920 871 784 317 238 220 59 ------
NM_001007068chr88991 920 871 784 317 238 220 59 ------
NM_001007069chr88991 920 871 784 317 238 220 59 ------
NM_001007070chr88991 920 871 784 317 238 220 59 ------
NM_001007097chr994649 4529 4290 4073 3862 1522 645 525 367 21375 824 13181 --
NM_001007099chr11756 --1899 --
NM_001007100chr11756 --1899 --
NM_001007102chr641463 594 485 327 21088 417 1528 --
NM_001007157chr7193 ------
NM_001007226chr1751057 1044 979 434 163 --133 --
NM_001007227chr1751057 1044 979 434 163 --133 --
NM_001007228chr1751057 1044 979 434 163 --133 --
NM_001007229chr1751057 1044 979 434 163 --133 --
NM_001007230chr1751057 1044 979 434 163 --133 --
NM_001007237chr132426 439 400 ------
NM_001007245chr75453 436 233 134 95 --2105 33 --
NM_001007246chr21101885 1546 1529 1484 1427 782 549 535 471 271 --21226 368 1299
NM_001007256chr1--1109 ----
NM_001007257chr121545 1230 1959 ----
NM_001007466chr653443 2021 812 615 25 13630 14757 14540
NM_001007471chr92843 828 --1153 --
NM_001007526chrY------1196
NM_001007527chr5183 ------
NM_001007559chr1821783 1311 11528 ----
NM_001007565chr32152 74 --1274 --
NM_001007794chr13684 639 93 1174 2630 118 --
NM_001008225chr73740 209 193 1725 ----
NM_001008226chr1551773 1590 1421 1199 275 21257 444 ----
NM_001008237chr2165 ----1151
NM_001008239chr1883294 3197 3108 3013 2801 2428 274 207 41305 1138 258 91 23255 591 185
NM_001008391chr112644 266 ------
NM_001008392chr353387 3088 3063 435 300 1199 13349 --
NM_001008401chr1941496 1374 1260 1179 1408 ----
NM_001008408chr7106406 5351 5019 4541 4488 4176 2009 1883 333 50 12166 56288 5824 4830 4560 4403 14013
NM_001008495chr842097 2073 1963 539 --1503 11974
NM_001008539chr885264 4394 1940 1262 967 721 447 125 44831 3461 3343 638 24626 3431 1464
NM_001008541chr1062331 2310 2093 1540 1487 634 ----11570
NM_001008541chr1062331 2310 2093 1540 1487 634 ----11570
NM_001008564chr1372185 2067 1670 1383 833 213 141 21652 890 ----
NM_001008707chr1441751 1286 372 141 --1293 1620
NM_001008708chr23562 487 106 ----2204 25
NM_001008723chr101483 ------
NM_001008738chr592688 2621 2517 1966 837 397 277 237 100 --22397 405 --
NM_001008801chr1952054 2008 1792 1689 1625 3568 503 148 12182 --
NM_001008895chr1341481 1418 1192 577 1164 1253 --
NM_001008925chr4103392 3377 3270 3045 2462 2326 1414 1336 572 553 22843 166 --33160 2744 2713
NM_001009185chr5------1518
NM_001009552chr82603 443 --1398 --
NM_001009554chr4113737 3489 3108 2942 1579 1392 1054 732 680 444 172 12884 13256 --
NM_001009554chr4113737 3489 3108 2942 1579 1392 1054 732 680 444 172 12884 13256 --
NM_001009555chr461803 1662 1477 1311 1263 170 31529 1223 439 --11545
NM_001009571chr751484 1244 497 468 295 11318 ----
NM_001009881chr12497 173 1441 ----
NM_001009882chr12497 173 1441 ----
NM_001009894chr1261458 617 331 298 270 181 31635 1365 609 ----
NM_001009899chr3186541 6295 6181 5836 5699 5189 4813 4397 4247 4193 2589 2434 2302 2140 1493 860 455 352 12542 25732 4637 --
NM_001009909chr1173870 3678 3316 3207 2545 643 101 11513 23513 1520 1123
NM_001009958chr71614 --1567 191
NM_001009959chr262632 2422 1688 1677 1043 894 1231 --11770
NM_001009993chr294581 4473 4426 3266 1804 1224 1138 953 462 23465 1118 ----
NM_001009994chr6186 ------
NM_001010000chr18133410 2902 2544 2206 2199 2145 1195 1151 637 560 417 296 199 --12267 --
NM_001010845chr161982 1149 ----
NM_001010846chr1124575 4549 4490 4350 3654 1795 1653 1619 1202 1195 1143 303 21067 853 --14646
NM_001010853chr672908 2612 2589 2567 2020 985 673 12036 42965 2140 1126 949 --
NM_001010854chr141496 1691 1637 --
NM_001010861chr1152604 2542 2524 2086 2055 1923 1860 1707 930 896 741 708 435 123 114 --21714 818 21871 1727
NM_001010862chrX82725 2471 2405 2383 2133 522 438 133 ------
NM_001010867chr1116509 5437 5372 5303 4864 4069 2145 1580 761 335 210 ----25523 4993
NM_001010888chrX134390 3701 3475 3406 3282 3197 2924 1628 1502 1098 930 577 86 43992 2990 1849 1467 ----
NM_001010891chr5186525 6513 6336 5246 5060 4506 4444 4226 2663 2499 1767 1328 1125 383 366 352 175 125 --16743 26791 522
NM_001010895chr931973 1862 96 21954 677 1696 --
NM_001010922chr174105 3645 3037 2906 649 440 312 1834 13593 1845
NM_001010927chr61164 ------
NM_001010934chr731202 1086 810 1216 ----
NM_001010971chr16851 757 652 313 72 51 1112 --1736
NM_001010980chr141417 501 463 94 183 12404 --
NM_001010984chr132391 2259 1919 12593 1213 --
NM_001010986chrX122536 2306 2179 2152 2143 2046 879 867 841 587 419 273 --12287 --
NM_001011513chr494030 3347 3171 1090 961 816 303 252 69 --13778 --
NM_001011515chr461044 779 743 374 135 112 167 ----
NM_001011516chr461044 779 743 374 135 112 167 ----
NM_001011537chr362214 2030 2007 1797 493 21 21941 85 1255 --
NM_001011553chr72752 675 ------
NM_001011645chrX1104 ------
NM_001011666chr7166427 5809 5768 4688 4663 4533 4464 4047 2532 2525 2241 2151 2062 1923 1662 1494 35737 5722 4433 1659 --
NM_001011708chr272627 2593 1902 1050 634 69 34 11946 11789 --
NM_001011713chr1421335 333 21080 202 199 --
NM_001011720chr851033 1025 580 289 106 11342 1165 --
NM_001011885chr1541412 697 488 206 2677 403 11792 1473
NM_001012267chr921935 1453 ------
NM_001012393chr1174992 4871 4182 3929 1635 1076 401 34234 3629 1746 14539 11479
NM_001012398chr1631058 978 769 --1923 --
NM_001012420chr1552461 2283 1123 881 132 42646 783 632 234 --11873
NM_001012423chr1552461 2283 1123 881 132 32646 632 234 --11873
NM_001012425chr1197 ------
NM_001012614chr42539 505 ------
NM_001012732chr421256 1110 --189 --
NM_001012751chr1061944 1877 1613 1535 664 621 21728 1716 --1252
NM_001012754chr1351668 747 503 434 334 21835 345 1703 11757
NM_001012755chrX114627 4209 4160 3842 3787 3711 1348 1005 651 443 65 33640 1952 399 34873 4643 920 --
NM_001012756chr1953115 2635 2501 2153 706 12129 12831 --
NM_001012968chrX82522 2466 2374 2242 2028 1119 1081 209 ----1502
NM_001012989chrX3651 580 51 ----1488
NM_001013031chr1083216 3205 3059 1300 1287 1001 494 143 ------
NM_001013399chr65343 311 290 264 98 --21158 1125 1439
NM_001013406chr761618 1374 1176 1154 643 510 21693 1632 21644 1402 1656
NM_001013415chr441593 1496 1102 439 ------
NM_001013620chr12237966 7340 7181 7028 6983 6953 6655 6612 6045 2989 2724 2647 2591 2536 2431 2288 2107 1871 1842 1729 526 343 90 25274 2305 88204 6791 5906 5218 2662 2239 2008 751 15298
NM_001013703chr15183 ------
NM_001013746chr7102210 2074 1881 1765 1468 844 825 370 266 97 1798 --11922
NM_001013843chr154320 211 88 34 157 1184 --
NM_001014446chr4--163 ----
NM_001014764chr171131 ------
NM_001014797chr10148207 7871 7428 6863 6359 3038 2765 2444 2098 1789 1205 1178 1025 193 35320 1505 175 ----
NM_001014972chr2284 77 ------
NM_001015045chr462576 2233 1970 984 654 198 --12212 11793
NM_001015048chr1463051 2988 2957 2947 2906 1980 12216 1186 --
NM_001015049chr1463051 2988 2957 2947 2906 1980 12216 1186 --
NM_001015508chr82738 697 --1170 --
NM_001015877chrX63127 3120 1953 684 495 426 32736 952 787 199 11195
NM_001015881chrX31276 1258 1061 31267 390 103 ----
NM_001017368chr1762830 2560 2143 860 434 283 1622 ----
NM_001017369chr471076 1064 1032 835 804 259 158 --1413 1722
NM_001017395chr342966 2477 1303 689 ----21386 436
NM_001017396chr261978 1684 869 798 745 33 ------
NM_001017415chr13635 170 84 --2712 215 --
NM_001017416chr13635 170 84 --2712 215 --
NM_001017420chr83945 529 269 --1436 --
NM_001017424chr171767 1549 1422 1280 1239 336 45 --21575 358 --
NM_001017425chr171767 1549 1422 1280 1239 336 45 --21575 358 --
NM_001017440chr7148237 8094 7671 7121 7046 5840 5287 5141 5026 2764 1864 1734 1345 1253 65165 5010 2737 2059 303 175 22985 1338 1462
NM_001017523chr1241376 1336 489 35 1345 21798 1303 --
NM_001017923chr1461605 1448 1436 669 400 187 ------
NM_001017926chr881779 1618 1533 1368 1348 1245 1181 426 1563 21727 1460 --
NM_001017930chrX2203 70 2484 337 11100 --
NM_001017962chr102301 278 --174 --
NM_001017977chr12341 306 ------
NM_001017995chr594567 3460 3037 2968 1873 436 423 95 75 24863 505 24810 128 11031
NM_001017999chr142067 1691 904 800 ------
NM_001017999chr142067 1691 904 800 ------
NM_001018000chr142067 1691 904 800 ------
NM_001018000chr142067 1691 904 800 ------
NM_001018001chr142067 1691 904 800 ------
NM_001018038chr91568 --1122 --
NM_001018054chr131328 1030 540 --11021 --
NM_001018056chr93503 425 238 ------
NM_001018065chr965896 5506 4382 4304 788 441 22186 1291 1138 25847 4911
NM_001018066chr965896 5506 4382 4304 788 441 22186 1291 1138 25847 4911
NM_001018067chr1185299 5238 5143 4672 4309 4128 3514 3450 1936 1759 1721 1551 1185 1088 534 482 243 162 13307 24942 2105 13586
NM_001018068chr1185299 5238 5143 4672 4309 4128 3514 3450 1936 1759 1721 1551 1185 1088 534 482 243 162 13307 24942 2105 13586
NM_001018069chr1185299 5238 5143 4672 4309 4128 3514 3450 1936 1759 1721 1551 1185 1088 534 482 243 162 13307 24942 2105 13586
NM_001018072chr1241376 1336 489 35 1345 21798 1303 --
NM_001018074chr5143663 3527 3218 3135 2449 1512 1393 1321 904 629 577 530 340 48 11111 33823 3385 1026 12827
NM_001018075chr5143663 3527 3218 3135 2449 1512 1393 1321 904 629 577 530 340 48 11111 33823 3385 1026 12827
NM_001018076chr5143663 3527 3218 3135 2449 1512 1393 1321 904 629 577 530 340 48 11111 33823 3385 1026 12827
NM_001018077chr5143663 3527 3218 3135 2449 1512 1393 1321 904 629 577 530 340 48 11111 33823 3385 1026 12827
NM_001018080chr1161458 1423 1387 1279 1198 948 --1480 --
NM_001018089chr1573461 3099 2502 947 430 305 55 13804 23809 584 --
NM_001018090chr1572854 2616 2504 1050 600 162 102 21131 985 22091 310 --
NM_001018091chr1582964 2726 2614 1824 1160 710 272 212 11095 22201 420 --
NM_001018100chr153741 704 623 1593 ----
NM_001018102chr1572854 2616 2504 1050 600 162 102 21131 985 22091 310 --
NM_001018111chr773763 3211 2922 2613 1603 338 144 --13390 --
NM_001020658chr151697 1558 1205 333 182 1603 --11123
NM_001020658chr151697 1558 1205 333 182 1603 --11123
NM_001020825chr521138 1002 --11298 1302
NM_001023567chr1531610 884 132 11647 --11894
NM_001024024chr144991 862 269 151 --41054 704 416 36 --
NM_001024070chr144987 858 265 147 --41050 700 412 32 --
NM_001024071chr144959 830 237 119 --31022 672 384 1403
NM_001024094chr5143663 3527 3218 3135 2449 1512 1393 1321 904 629 577 530 340 48 11111 33823 3385 1026 12827
NM_001024372chr852304 1699 899 669 139 11833 --11630
NM_001024463chr151150 ------
NM_001024593chr105801 712 681 328 79 ------
NM_001024647chr12147196 6888 6674 6056 5962 5601 2403 2066 1982 1735 1526 1110 349 229 23043 1604 46870 6498 4753 369 26775 1412
NM_001024649chr562608 2566 2425 2299 338 310 1105 1265 1155
NM_001024660chr33577 550 438 11652 ----
NM_001024807chr191229 ------
NM_001024808chr1262797 2742 2453 1752 978 69 22872 555 ----
NM_001024809chr171527 ------
NM_001024855chr361790 1499 759 596 491 180 2473 391 1765 --
NM_001024912chr1981856 1757 1530 404 381 244 110 46 176 ----
NM_001024934chr65649 632 610 456 222 --1135 --
NM_001024935chr65649 632 610 456 222 --1135 --
NM_001024936chr65649 632 610 456 222 --1135 --
NM_001024948chr1133423 3412 2748 2573 2532 1134 905 889 705 696 686 486 358 --42849 2679 2388 533 --
NM_001024956chr11145767 5725 5580 5460 5400 5279 5143 4153 2346 2128 2079 891 493 483 25675 1521 --24557 4132
NM_001025072chr382355 2343 2126 958 809 630 317 309 32474 1995 1157 32804 2772 976 22956 935
NM_001025073chr382355 2343 2126 958 809 630 317 309 32474 1995 1157 32804 2772 976 22956 935
NM_001025076chr10106253 6233 5864 2235 2135 1472 1431 1238 1145 37 43783 1120 926 893 14263 --
NM_001025077chr10157611 7591 7222 4972 4823 2830 2789 2596 2503 1123 923 492 290 107 37 45141 2478 2284 2251 35621 1377 1090 --
NM_001025079chr3114054 3498 3449 3211 2590 1459 1449 1440 1354 287 185 --23938 3402 12883
NM_001025100chr1873951 3869 2933 2841 1227 821 589 11611 23204 3106 33331 1382 419
NM_001025105chr541465 1449 1280 1115 --11016 1141
NM_001025108chr254107 3211 2883 2676 964 --1385 --
NM_001025201chr25733 694 663 134 60 ------
NM_001025233chr1252656 2486 1964 782 689 1893 1420 --
NM_001025252chr882668 2601 2530 971 638 628 112 87 --33117 2880 756 --
NM_001025253chr882668 2601 2530 971 638 628 112 87 --33117 2880 756 --
NM_001025266chr3124882 4724 4525 4133 4107 4095 3878 3071 1973 1745 1582 216 --44844 4634 3407 154 1267
NM_001025356chr1282633 2368 1905 1209 938 465 457 40 12750 22977 2935 --
NM_001025366chr641717 1462 1440 1274 ----11325
NM_001025366chr641717 1462 1440 1274 ----11325
NM_001025367chr641717 1462 1440 1274 ----11325
NM_001025367chr641717 1462 1440 1274 ----11325
NM_001025368chr641717 1462 1440 1274 ----11325
NM_001025368chr641717 1462 1440 1274 ----11325
NM_001025369chr641733 1478 1456 1290 ----11341
NM_001025369chr641733 1478 1456 1290 ----11341
NM_001025370chr641717 1462 1440 1274 ----11325
NM_001025370chr641717 1462 1440 1274 ----11325
NM_001025389chr1181433 1410 1264 1251 1076 520 488 255 2436 43 2206 29 11101
NM_001025390chr1181433 1410 1264 1251 1076 520 488 255 2436 43 2206 29 11101
NM_001025580chrX113835 3626 2625 1538 1410 1254 1247 1158 1073 242 133 32934 949 637 23520 2753 --
NM_001025595chr461430 1172 588 536 217 133 --1354 --
NM_001025616chr461288 1226 1188 672 331 68 1345 21901 1623 --
NM_001025780chr951442 1078 622 603 211 11262 11313 --
NM_001029835chr71394 ------
NM_001029858chr683104 2408 2315 2238 2104 1357 336 195 ----12762
NM_001029863chr693094 2792 2481 2373 2335 1200 872 835 348 --3696 632 341 12878
NM_001029875chr552780 2172 1196 725 597 1577 22158 694 12066
NM_001029998chr431002 387 228 ------
NM_001030007chr16103705 3564 3337 3294 2919 2832 2510 1410 928 748 33147 2688 2594 23458 1226 --
NM_001030055chr14164229 3696 3244 3190 3141 3090 3047 1761 1755 1682 979 827 430 416 290 205 31812 1306 970 44706 3967 2970 904 21522 487
NM_001030272chr112313 98 ----2168 114
NM_001030273chr112313 98 ----2168 114
NM_001031679chr1263573 3474 3463 3356 232 202 12968 ----
NM_001031695chr2285319 5233 3322 1690 1478 1283 311 198 --13397 --
NM_001031700chr472481 2442 1908 1620 925 862 130 1274 22127 2068 12417
NM_001031709chr10--1356 ----
NM_001031710chr761119 859 851 803 681 259 1273 ----
NM_001031732chr4103590 3384 3149 2846 2816 2751 2450 1241 986 592 ----13392
NM_001031738chr21526 ------
NM_001031748chr124517 461 214 188 274 35 ----
NM_001031804chr16134162 4026 3562 3332 3132 2991 1669 1478 1103 813 521 308 300 23915 1198 14405 13628
NM_001031812chr531742 1571 186 --1379 1763
NM_001032221chr931679 272 55 ------
NM_001032280chr631703 632 387 11217 ----
NM_001032282chr831281 1012 350 --2881 33 --
NM_001032283chr123961 242 184 1164 ----
NM_001032284chr123961 242 184 1164 ----
NM_001032288chr2031426 250 170 ------
NM_001032394chr692815 2660 2645 2076 988 840 786 745 82 1337 12679 12136
NM_001032395chr692682 2527 2512 1943 1052 855 707 653 612 1204 12546 12003
NM_001032999chr20105295 5097 4885 4511 4185 1527 1154 867 634 276 11921 11265 --
NM_001033002chr172109 91 ------
NM_001033025chr141546 1213 616 391 21018 978 153 --
NM_001033044chr151411 1251 1162 445 421 --1187 --
NM_001033045chr2124291 4221 4210 3875 3797 3487 2989 2914 2728 1695 1681 203 22837 1081 33830 1774 1661 1990
NM_001033047chr461849 1833 1772 911 513 467 --1427 --
NM_001033049chr2162299 2172 1899 773 738 378 --1865 --
NM_001033056chr151411 1251 1162 445 421 --1187 --
NM_001033059chr631814 1641 502 21674 284 22000 1520 --
NM_001033087chr2053054 2527 719 279 207 --32364 258 134 --
NM_001033112chr54763 594 359 39 2800 340 1609 --
NM_001033117chr374279 3959 2993 1693 1075 1050 314 --34921 4065 1316 --
NM_001033503chr54432 198 145 74 --1473 --
NM_001033507chr151822 630 577 551 311 1567 --1487
NM_001033518chr752477 1934 1028 220 80 32535 1066 489 ----
NM_001033519chr752477 1934 1028 220 80 32535 1066 489 ----
NM_001033520chr752477 1934 1028 220 80 32535 1066 489 ----
NM_001033557chr271207 1186 1148 1117 508 227 213 2172 160 11324 --
NM_001033561chr171896 ------
NM_001033566chr171887 1775 ----
NM_001033568chr171887 1775 ----
NM_001033576chr1732772 2492 252 11071 ----
NM_001033578chr842124 1712 936 59 21904 356 --1565
NM_001033602chr1342176 651 457 270 2400 285 32228 2082 504 --
NM_001033659chr1741437 1374 1170 643 11672 --21403 1330
NM_001033723chr842277 1854 300 264 21846 682 22463 493 --
NM_001033756chr641651 1396 1374 1208 1715 --11259
NM_001033756chr641651 1396 1374 1208 1715 --11259
NM_001033910chr142114 1686 145 29 --12040 --
NM_001033925chr1072101 1944 1731 1692 1493 1333 660 ------
NM_001034155chr9--195 ----
NM_001034837chr51779 ------
NM_001034838chr51779 ------
NM_001034841chr16115425 5237 5193 3976 3904 3867 3814 2050 1857 1034 661 25017 4339 24860 540 11919
NM_001034845chr44945 907 252 159 --11400 --
NM_001034850chr531063 424 375 31162 228 49 1542 --
NM_001034954chr1043116 2778 2013 2004 13269 12739 12982
NM_001034955chr1043116 2778 2013 2004 13269 12739 12982
NM_001034956chr1043116 2778 2013 2004 13269 12739 12982
NM_001034957chr1043116 2778 2013 2004 13269 12739 12982
NM_001035chr131301 1076 62 1918 ----
NM_001035260chr1051119 1075 418 309 28 21428 1103 1337 11054
NM_001037131chr221172 369 ------
NM_001037132chr762269 2153 1843 1734 1500 1484 2795 456 ----
NM_001037133chr762269 2153 1843 1734 1500 1484 2795 456 ----
NM_001037163chr74944 356 180 33 ----1777
NM_001037164chr762067 1642 1519 736 574 561 1312 ----
NM_001037165chr768846 8379 7578 7145 5838 3489 1608 35977 5657 2593 1753
NM_001037172chr351360 1212 443 405 246 ------
NM_001037174chr242106 1914 1576 111 11523 ----
NM_001037317chr1152604 2542 2524 2086 2055 1923 1860 1707 930 896 741 708 435 123 114 --21714 818 21871 1727
NM_001037334chr1841751 838 768 567 --31864 1737 658 --
NM_001037339chr161484 1314 672 501 468 190 --1709 1356
NM_001037340chr161484 1314 672 501 468 190 --1709 1356
NM_001037341chr161484 1314 672 501 468 190 --1709 1356
NM_001037341chr161484 1314 672 501 468 190 --1709 1356
NM_001037535chrX41196 1104 588 36 --11245 11421
NM_001037536chrX41196 1104 588 36 --11245 11421
NM_001037540chrX41196 1104 588 36 --11245 11421
NM_001037582chr471441 1350 1281 667 512 368 188 --11476 --
NM_001037872chr23665 108 100 ----1742
NM_001037954chr11103505 3302 3112 2493 2450 872 855 771 624 123 1528 --2922 737
NM_001038493chr241543 1514 999 341 ------
NM_001038707chr162301 1958 1803 929 644 633 ------
NM_001038707chr162301 1958 1803 929 644 633 ------
NM_001039091chrX3314 256 46 --140 2379 330
NM_001039111chr31117 190 ----
NM_001039199chr20135014 4531 4251 4185 4026 3864 3387 3326 3293 3287 3114 1245 416 1627 ----
NM_001039348chr23904 890 799 --1855 --
NM_001039349chr23904 890 799 --1855 --
NM_001039459chr721101 155 ------
NM_001039535chr1881643 1530 1209 652 451 291 78 63 21753 1321 21444 88 --
NM_001039547chr3127784 6911 5216 5133 1769 1289 921 903 770 679 618 124 55096 1616 1488 217 118 34981 2382 516 27960 1924
NM_001039570chr2254520 4473 4455 3114 373 --24152 3666 13589
NM_001039571chr2254520 4473 4455 3114 373 --24152 3666 13589
NM_001039577chr144305 3627 735 224 --44424 1701 1089 1055 --
NM_001039580chr4114749 4738 3843 3756 3509 3474 3457 3365 1220 1152 862 44772 3938 3677 1720 23486 1396 --
NM_001039585chr183907 3518 3296 3275 3257 1585 1001 260 53627 3414 3284 3100 1479 23855 3424 12968
NM_001039590chrX123491 3358 3307 3295 3139 2514 1472 1335 1320 1026 333 286 54046 3943 2843 2506 1251 13219 --
NM_001039591chrX123491 3358 3307 3295 3139 2514 1472 1335 1320 1026 333 286 54046 3943 2843 2506 1251 13219 --
NM_001039618chr11125409 5130 5101 5011 3695 2381 2000 1925 1891 1145 699 419 14808 ----
NM_001039693chr293382 1545 1412 1044 982 928 817 566 229 24065 786 13325 --
NM_001039709chr20105295 5097 4885 4511 4185 1527 1154 867 634 276 11921 11265 --
NM_001039762chr1032385 2136 1714 1433 ----
NM_001039802chr11197 ------
NM_001039840chrX136009 5872 5795 5473 5369 5043 3935 2236 2057 1574 985 423 327 24923 748 45944 5531 4725 866 15314
NM_001039844chr1052708 2450 809 88 38 ------
NM_001039937chr13114024 3549 3028 1370 1081 822 767 378 347 285 224 21403 960 34179 3735 3041 11433
NM_001040001chr661963 679 591 431 206 119 1404 ----
NM_001040057chr72971 443 157 ----
NM_001040092chr82284 73 ------
NM_001040100chr351285 1196 956 292 224 ------
NM_001040151chr1173659 2828 1626 1451 833 694 331 11680 22949 1302 --
NM_001040152chr784889 4664 4346 4034 3289 3104 1601 1204 21727 153 13682 25064 3199
NM_001040153chr134945 706 641 332 ------
NM_001040158chr51464 ------
NM_001040159chr441461 1428 346 290 1159 --11356
NM_001040181chr3187 21055 411 11123 11116
NM_001040182chr3187 21055 411 11123 11116
NM_001040183chr3187 21055 411 11123 11116
NM_001040199chr3187 21055 411 11123 11116
NM_001040200chr3187 21055 411 11123 11116
NM_001040202chr452349 1824 650 607 199 --1317 --
NM_001040214chr652380 2367 1935 1742 47 ------
NM_001040284chr16135667 5541 5262 4704 4655 3827 3709 1346 1031 918 865 707 112 --11696 14156
NM_001040402chr473166 2456 2056 962 677 485 343 --33025 764 511 --
NM_001040409chr231051 938 85 ----1764
NM_001040424chr2122192 117 11047 --1742
NM_001040429chr1383461 3200 3026 2470 1440 882 436 393 23345 3182 13506 13390
NM_001040432chr32448 336 171 1128 --
NM_001040441chr1164913 4357 4016 3850 3713 1933 1827 1619 1592 612 503 328 217 172 131 107 54814 2089 2041 388 373 150 1428
NM_001040446chr552629 2615 2551 2190 373 ------
NM_001040450chr1542311 1894 708 612 ------
NM_001040453chr1542311 1894 708 612 ------
NM_001040665chr784119 4031 3770 3504 3062 218 161 133 14235 44997 4102 3323 62 13928
NM_001040708chr851046 917 412 296 122 ------
NM_001040712chr983431 2999 2853 2523 2406 1053 767 560 12916 22736 99 --
NM_001042355chr16135335 5135 5071 4985 4289 3941 3833 3291 1374 1255 1202 876 435 24946 1025 ----
NM_001042361chr1061514 1308 1121 1077 41 23 --2569 254 11476
NM_001042364chr1061514 1308 1121 1077 41 23 --2569 254 11476
NM_001042365chr1061514 1308 1121 1077 41 23 --2569 254 11476
NM_001042383chr363433 2145 1262 364 287 193 13226 ----
NM_001042387chr1061514 1308 1121 1077 41 23 --2569 254 11476
NM_001042393chr1061514 1308 1121 1077 41 23 --2569 254 11476
NM_001042396chr1061514 1308 1121 1077 41 23 --2569 254 11476
NM_001042397chr1061514 1308 1121 1077 41 23 --2569 254 11476
NM_001042403chr121206 2844 77 ----
NM_001042404chr152020 1362 1227 402 130 11507 1578 --
NM_001042406chr671237 1159 1079 875 815 279 228 142 2301 272 --
NM_001042412chr16135335 5135 5071 4985 4289 3941 3833 3291 1374 1255 1202 876 435 24946 1025 ----
NM_001042413chr953325 3187 2920 998 166 12667 11032 --
NM_001042424chr442175 1995 949 267 23069 2520 32504 2335 803 --
NM_001042425chr631703 632 387 11217 ----
NM_001042437chr28988 916 804 783 310 295 243 124 --1118 --
NM_001042440chr581279 1270 808 759 664 401 226 63 --11631 --
NM_001042441chr581279 1270 808 759 664 401 226 63 --11631 --
NM_001042442chr581279 1270 808 759 664 401 226 63 --11631 --
NM_001042443chr581279 1270 808 759 664 401 226 63 --11631 --
NM_001042444chr581279 1270 808 759 664 401 226 63 --11631 --
NM_001042445chr581279 1270 808 759 664 401 226 63 --11631 --
NM_001042446chr581279 1270 808 759 664 401 226 63 --11631 --
NM_001042453chrX31571 1377 1087 31779 1652 393 1203 --
NM_001042459chr32336 282 ------
NM_001042473chr1031524 1380 398 2691 443 12164 11701
NM_001042490chr55296 209 119 109 65 181 ----
NM_001042492chr17163308 3279 2812 2596 2389 2371 2365 2160 1349 1318 1084 963 794 787 553 279 1606 33208 1051 198 11356
NM_001042506chrX11440 1351 ----
NM_001042510chr851942 1357 867 848 532 11441 31592 674 355 --
NM_001042511chr851942 1357 867 848 532 11441 31592 674 355 --
NM_001042517chr134844 809 794 94 ----1869
NM_001042533chr392637 2627 2611 2034 1050 1034 803 343 330 1364 --13045
NM_001042537chrX52110 1817 894 448 361 --1656 12462
NM_001042543chr451619 1249 1174 1073 539 11455 ----
NM_001042550chr941599 1524 73 50 --11739 --
NM_001042555chr12144607 4421 4402 4128 3860 3844 3829 3780 3719 1626 1490 1406 490 344 14185 34219 3946 3125 1190
NM_001042599chr2227860 7223 7037 6940 6271 5908 5843 4925 4806 3049 2826 2761 2468 2078 1386 1175 1099 740 590 582 160 47 35341 5179 2033 47539 6701 4747 710 45620 2945 2307 2229
NM_001042601chr353291 2996 751 591 31 ----13139
NM_001042603chr1285036 4571 3570 3563 2014 1933 1718 1621 45318 4419 3833 895 --14531
NM_001042604chr3134669 4303 4241 3831 3808 3750 3585 3506 3397 1039 853 526 443 31893 888 632 2737 28 --
NM_001042635chr14------155
NM_001042646chr361746 1450 1436 1336 553 169 ------
NM_001042669chr461288 1226 1188 672 331 68 1345 21901 1623 --
NM_001042681chr152638 2238 547 448 266 32472 1948 1056 12606 11896
NM_001042682chr152638 2238 547 448 266 32472 1948 1056 12606 11896
NM_001042682chr152638 2238 547 448 266 32472 1948 1056 12606 11896
NM_001042683chr671678 1565 1480 730 526 211 46 ----1513
NM_001042749chrX52004 1333 623 569 519 --11878 --
NM_001042750chrX52004 1333 623 569 519 --11878 --
NM_001042751chrX52004 1333 623 569 519 --11878 --
NM_001044385chr293848 3080 3058 3034 2660 2503 499 326 185 11347 12960 13140
NM_001044722chr531742 1571 186 --1379 1763
NM_001044723chr531742 1571 186 --1379 1763
NM_001046chr5132869 2652 2586 2226 2127 2064 1149 847 839 398 175 127 104 2954 356 1289 --
NM_001049chr1462452 2217 2002 1940 1638 323 ------
NM_001071775chr1391816 1741 1521 726 669 386 293 287 145 1411 ----
NM_001078chr15695 668 552 256 102 --1751 1481
NM_001079874chr151776 1367 779 673 429 138 ----
NM_001083620chr492515 2040 1844 954 877 747 474 400 94 22608 768 12494 --
NM_001083621chr154731 3966 3306 155 110 44635 3421 1709 1041 13391 --
NM_001099678chr3146273 5999 5275 4477 2420 2360 2183 2089 1962 1913 1412 991 619 205 25437 2530 22442 329 --
NM_001100108chr1178230 7976 7817 7534 7490 7260 6627 6485 5982 5319 5241 3327 3118 2854 2739 1630 1376 27214 5829 16799 12676
NM_001106chr3189602 9268 9150 9000 8933 8708 8298 6434 6219 6101 2515 2409 1886 1313 905 864 828 129 35905 1858 1428 58208 7316 6876 2507 1985 38686 8127 3199
NM_001113490chrX122897 2759 2506 2445 2247 1104 1033 1010 837 767 696 564 53343 2974 2846 2831 2219 13189 --
NM_001115chr8177 ------
NM_001116chr1642921 2751 2063 330 --1136 23074 2787
NM_001117chr1842377 2255 1819 1011 11725 ----
NM_001121chr1091611 1200 627 616 562 506 462 387 157 --21721 580 --
NM_001122679chr551291 1253 1247 1199 1185 1848 ----
NM_001123chr103808 570 129 ------
NM_001126chr12913 816 --1168 1765
NM_001128chr16103705 3564 3337 3294 2919 2832 2510 1410 928 748 33147 2688 2594 23458 1226 --
NM_001144chr1651390 1369 1317 920 318 ----11065
NM_001148chr461919 1795 747 348 223 57 1488 11488 --
NM_001149chr1031314 304 184 ------
NM_001151chr41227 ------
NM_001153chr21819 1759 1870 157
NM_001160chr12122777 2719 2247 2206 2190 1954 1723 1036 736 162 81 30 32707 2591 1781 ----
NM_001167chrX166649 6521 5769 5701 5641 5524 4769 4658 2651 2282 2017 1970 1859 414 166 69 14837 34907 1794 298 --
NM_001173chr14164229 3696 3244 3190 3141 3090 3047 1761 1755 1682 979 827 430 416 290 205 31812 1306 970 44706 3967 2970 904 21522 487
NM_001178chr112313 98 ----2168 114
NM_001186chr21153207 3146 3116 2928 2808 2792 2769 2157 2134 1182 753 436 399 132 33 --22424 2229 --
NM_001191chr201229 ------
NM_001198chr6102216 2000 1874 956 883 690 655 440 368 42 --22047 488 1539
NM_001200chr203711 398 353 --11002 --
NM_001201chr493763 3728 2970 699 662 397 351 200 59 --13426 11241
NM_001204chr2237464 7196 6784 6590 6452 5856 5546 5391 5145 2873 2575 2177 2042 1795 1711 1579 1434 1344 1296 1163 1107 753 168 --47060 5867 5753 2436 37478 6774 1097
NM_001206chr942641 2612 2180 747 --32021 1029 558 --
NM_001219chr771929 1879 667 391 100 50 36 ----11801
NM_001221chr4--139 ----
NM_001227chr1041149 1129 233 141 --2292 217 1107
NM_001233chr732388 2021 356 21693 739 42219 2202 838 205 --
NM_001235chr112690 573 ------
NM_001237chr481025 782 438 269 203 158 81 69 --1288 --
NM_001237chr481025 782 438 269 203 158 81 69 --1288 --
NM_001239chr51113 ----2147 70
NM_001241chr2102436 2284 2044 1946 1752 1744 1733 1613 140 106 12237 21901 878 21874 665
NM_001241chr2102436 2284 2044 1946 1752 1744 1733 1613 140 106 12237 21901 878 21874 665
NM_001253chr63279 265 244 ------
NM_001256chr17112907 2879 2629 2388 1938 1806 1133 971 663 503 248 32283 1885 716 ----
NM_001271chr1583147 2291 2004 1309 1273 1066 678 646 1290 ----
NM_001278chr1021145 356 11073 1363 --
NM_001283chr71520 ------
NM_001289chrX2656 200 ----1395
NM_001290chr45972 405 315 192 100 1957 ----
NM_001304chr1773781 3187 3032 832 661 251 168 1150 22794 1196 1698
NM_001310chr1272841 2636 2154 1075 674 338 133 --23026 180 --
NM_001328chr42539 505 ------
NM_001329chr1051480 1466 1274 402 223 11045 ----
NM_001330chr164978 315 303 256 ------
NM_001331chr1132429 2392 167 --11951 --
NM_001332chr551526 1383 1097 608 185 1602 ----
NM_001343chr571537 1525 1097 615 537 508 240 --1592 --
NM_001349chr21592 1616 --1233
NM_001351chr351393 727 680 512 109 1710 11366 11491
NM_001356chrX72397 2268 1629 839 332 275 59 1213 22026 1556 2323 86
NM_001358chr42452 122 ----1429
NM_001364chr1184020 3952 3215 1414 915 744 705 638 1572 24410 1134 --
NM_001380chr103857 793 319 --1968 --
NM_001389chr211560 1420 ----
NM_001391chr182279 101 1998 --1890
NM_001396chr21102680 2640 2476 2111 1862 549 370 343 251 147 --11034 --
NM_001399chrX63052 1420 1038 914 262 172 --13137 --
NM_001400chr141355 1345 1320 1163 --1863 --
NM_001401chr951539 1457 1213 1124 185 2638 367 ----
NM_001407chr351731 1479 1201 1169 518 --1561 --
NM_001412chrX103778 3504 3286 2887 2542 2535 1342 1306 1174 717 23212 87 21434 1187 1912
NM_001418chr111697 ------
NM_001418chr111697 ------
NM_001419chr19104599 4202 4088 3713 3411 2971 1517 1132 861 59 14502 34337 4234 831 --
NM_001420chr1952770 2464 2267 2120 1922 --22105 2077 --
NM_001427chr751854 1747 560 232 53 --1441 --
NM_001429chr2231051 709 684 ------
NM_001430chr241675 1568 567 276 31891 524 53 1270 21987 383
NM_001431chr63803 427 35 ------
NM_001432chr4123870 3852 3742 3515 3449 3400 3343 3309 3030 2990 2539 2380 1264 1235 33569 1030 748
NM_001438chr1113679 3089 3083 2537 2321 2241 1189 1104 541 407 125 --1885 --
NM_001439chr141546 1213 616 391 21018 978 153 --
NM_001443chr2158 ------
NM_001448chrX61775 1708 1579 493 149 78 ------
NM_001451chr1621232 1118 --11033 --
NM_001453chr631482 522 511 1593 --11782
NM_001455chr653419 1969 1603 433 407 --34874 4532 1264 11091
NM_001463chr23806 327 34 ------
NM_001482chr155969 927 365 321 282 --1179 --
NM_001483chr751045 703 406 120 63 --11103 --
NM_001490chr983364 3311 2557 1322 1231 960 655 510 --43531 3245 732 671 --
NM_001497chr952081 1880 855 766 438 1460 12131 --
NM_001527chr6114888 4726 4595 4568 4218 3895 3280 1620 548 194 78 123 11590 --
NM_001530chr1451015 931 342 151 84 ------
NM_001542chr132426 439 400 ------
NM_001543chr584629 4596 4439 3760 3726 3480 3299 598 23770 3345 ----
NM_001546chr641339 477 292 177 --11452 --
NM_001550chr75453 436 233 134 95 --2105 33 --
NM_001554chr13601 584 547 ------
NM_001564chr41100 ------
NM_001587chrX22244 2016 1107 ----
NM_001604chr111237 ----1729
NM_001608chr25781 378 332 211 72 ----2924 709
NM_001609chr10153789 3681 3514 3464 3434 3393 3199 3029 3015 2979 1083 1010 849 184 98 12740 23318 3068 13704
NM_001612chr11--1246 ----
NM_001614chr171579 ------
NM_001614chr171579 ------
NM_001616chr282613 2376 2309 1408 1307 424 396 236 23114 1245 --11151
NM_001620chr111761 ------
NM_001621chr772821 2421 1138 1128 1035 768 150 22364 291 ----
NM_001621chr772821 2421 1138 1128 1035 768 150 22364 291 ----
NM_001634chr631814 1641 502 21674 284 22000 1520 --
NM_001642chr111164 11284 11355 --
NM_001649chrX61847 1817 713 548 176 108 11963 2557 146 --
NM_001650chr1863999 3813 3607 1490 1407 156 22838 1435 1939 1595
NM_001655chr1131924 517 229 --11737 12066
NM_001656chr561925 1677 1666 1313 188 95 --2611 47 --
NM_001660chr31228 ------
NM_001663chr14102443 2226 2063 2038 1023 964 944 880 781 566 --1286 1576
NM_001664chr351028 1008 265 98 37 --2310 273 --
NM_001668chr111931 ----12064
NM_001679chr34730 699 617 577 ------
NM_001682chr1272775 2681 2534 2397 810 500 414 1108 22384 392 --
NM_001684chr174144 3955 3449 1270 1250 1220 193 13272 22693 1616 --
NM_001690chr382496 2093 1806 1607 785 499 431 71 --1399 --
NM_001695chr894009 3793 2842 1212 961 884 718 663 556 43505 3264 2635 480 --11158
NM_001699chr1921850 577 11595 11415 --
NM_001701chr941619 1278 239 114 1445 1458 --
NM_001704chr61607 137 1151 --
NM_001709chr1122349 100 22340 2165 1465 --
NM_001713chr54995 904 162 30 ------
NM_001714chr122509 218 --1465 --
NM_001718chr621123 167 11042 ----
NM_001721chrX192 ------
NM_001730chr1341431 1355 1277 1069 ------
NM_001730chr1341431 1355 1277 1069 ------
NM_001731chr124803 708 681 199 --1744 --
NM_001742chr741723 1318 1277 440 1452 ----
NM_001743chr23515 70 28 1131 ----
NM_001744chr5----1433 1152
NM_001745chr531163 958 900 --2460 273 --
NM_001746chr562608 2566 2425 2299 338 310 1105 1265 1155
NM_001750chr581279 1270 808 759 664 401 226 63 --11631 --
NM_001753chr731556 301 49 21348 66 ----
NM_001754chr2153840 3060 805 493 383 23537 2917 43567 1107 650 389 11233
NM_001755chr1662313 2295 358 265 239 41 1476 21813 872 --
NM_001759chr1254327 1658 1466 1374 904 ----1399
NM_001761chr1641399 722 687 125 1300 ----
NM_001762chr73704 336 92 184 ----
NM_001769chr122388 112 1373 ----
NM_001777chr3114054 3498 3449 3211 2590 1459 1449 1440 1354 287 185 --23938 3402 12883
NM_001786chr101143 ----1131
NM_001788chr72752 675 ------
NM_001789chr381591 1481 1238 1215 570 435 123 35 31343 1306 446 ----
NM_001791chr11197 ------
NM_001792chr1851178 1094 971 901 892 2753 44 187 --
NM_001794chr201253 ------
NM_001798chr1221121 280 ------
NM_001802chr166951 870 814 643 384 27 1251 ----
NM_001806chr19142984 2947 2884 2449 2347 2328 2265 2125 2042 1918 1107 637 522 493 22066 602 22357 296 --
NM_001812chr41238 ------
NM_001822chr25733 694 663 134 60 ------
NM_001830chrX83818 3770 3738 3193 3066 363 329 195 ------
NM_001839chr13783 508 74 ------
NM_001843chr122196 82 ------
NM_001845chr1341320 967 538 374 --11246 1974
NM_001854chr171465 1403 1251 1217 1119 463 271 --1529 --
NM_001858chr6184856 4819 4313 4010 3802 3569 3553 3540 3530 3306 3150 1978 1930 1866 1556 506 452 315 33215 887 569 13518 --
NM_001859chr973511 3243 2991 2731 1136 332 317 12816 22966 2922 1424
NM_001874chr1244978 4566 2087 973 31050 917 398 24803 3222 --
NM_001875chr261097 903 842 692 277 75 1106 ----
NM_001880chr22298 238 ----147
NM_001881chr104464 434 389 135 ------
NM_001882chr52518 165 ------
NM_001892chr541465 1449 1280 1115 --11016 1141
NM_001894chr2241251 1181 1148 1076 --1510 --
NM_001903chr54888 854 784 269 2679 358 1914 --
NM_001904chr331091 739 733 172 --1225
NM_001914chr181372 ------
NM_001916chr81179 ------
NM_001918chr1158896 8831 8409 7616 7066 6908 6598 6572 6239 2911 1494 1454 1003 35 26 57804 6499 5783 2129 670 59287 8271 7910 1092 230 17782
NM_001920chr124682 319 144 122 ------
NM_001921chr421256 1110 --189 --
NM_001935chr23999 848 171 1145 1920 --
NM_001938chr171882 1723 1571 1232 1174 327 85 1554 --1301
NM_001939chrX13361 --13801 11355
NM_001940chr121454 ------
NM_001941chr18133950 3108 2746 2608 2483 1500 1391 1077 852 804 776 701 504 43703 3542 1228 76 13717 --
NM_001944chr1842263 2014 284 98 12236 1114 --
NM_001949chr683233 3084 3000 2764 2724 2404 2392 816 1131 ----
NM_001957chr452226 1894 1854 340 208 1392 12259 --
NM_001961chr191319 ------
NM_001963chr43775 543 229 ------
NM_001968chr42666 646 ------
NM_001969chr1493237 3106 2610 2476 1446 959 477 330 22 12931 11308 --
NM_001977chr4111608 1572 1504 1401 1343 1294 1275 1113 336 71 26 21393 1133 --11351
NM_001981chr1101875 1860 1777 1767 1650 959 904 515 502 309 32259 1539 929 11565 --
NM_001987chr1254299 4150 3726 1541 973 ------
NM_001992chr532097 2040 1591 184 11498 --
NM_001993chr171105 1028 1002 912 830 230 56 ----1694
NM_001994chr12178 65 ------
NM_001995chr471482 1409 1188 964 283 121 78 ----11372
NM_001999chr52164 79 ----1233
NM_002006chr4125589 5581 5268 4957 4798 4617 3669 2228 1440 1288 812 315 45673 4936 3534 1527 75424 5321 5185 5098 1842 1111 726 13509
NM_002009chr1572260 1748 1017 639 585 299 282 1938 ----
NM_002014chr121266 ------
NM_002015chr1382951 2940 2497 1096 928 894 628 462 21132 253 22165 734 --
NM_002017chr1171389 1327 1308 1235 1093 976 445 --1163 --
NM_002024chrX62058 1940 802 384 295 68 11906 12082 --
NM_002025chrX188986 8751 8635 8346 8321 7387 7024 6580 6160 3420 2321 2154 2067 1368 1243 1074 666 464 28971 7305 47205 2972 1281 1176 --
NM_002033chr11133911 3489 3297 3187 3131 1596 1351 1199 805 731 376 336 299 --1571 13918
NM_002035chr18103990 3641 2758 1525 1414 1089 1065 1017 1009 40 23022 2906 --12621
NM_002040chr2163132 3120 2930 2584 2178 445 --12266 --
NM_002044chr1521442 248 21342 505 ----
NM_002061chr141675 1565 1201 594 --132 --
NM_002062chr621661 234 --11152 --
NM_002063chrX41079 967 869 517 21291 458 ----
NM_002065chr151411 1251 1162 445 421 --1187 --
NM_002069chr751711 1365 1192 699 299 21858 750 ----
NM_002074chr121680 595 2447 123 ----
NM_002076chr1243221 2773 2679 2517 --33159 2221 157 --
NM_002077chr952005 1993 1933 1598 1458 1558 --1300
NM_002092chr474857 4315 3835 1492 1454 706 420 14876 1379 11107
NM_002107chr12354 53 ------
NM_002111chr463845 3136 2659 2442 2367 592 ------
NM_002114chr62536 127 ----1477
NM_002126chr1754171 3987 1290 915 506 1805 11030 --
NM_002128chr1332536 2432 2326 1695 12440 11973
NM_002129chr41416 ----198
NM_002130chr541590 1454 446 92 31294 257 26 21709 1596 11469
NM_002133chr22135 1214 1575 --
NM_002137chr741871 933 674 264 3923 857 76 ----
NM_002139chrX3192 182 142 --1255 --
NM_002140chr911012 --1958 --
NM_002146chr1731449 1377 509 ------
NM_002158chr2103476 2905 2605 1358 1282 996 679 500 489 219 21093 72 23851 2896 --
NM_002161chr92412 169 ------
NM_002165chr201408 ------
NM_002166chr21578 ------
NM_002182chr392736 2600 2432 2295 1828 666 628 481 263 12134 ----
NM_002193chr241845 1605 1570 720 1164 ----
NM_002194chr2------1159
NM_002199chr43941 873 163 ------
NM_002202chr54894 854 768 749 ------
NM_002203chr5143654 3451 3246 3150 2555 1355 1210 1111 998 894 820 559 329 285 11635 1912 11153
NM_002210chr2143575 3519 3511 3423 3394 3229 3129 2943 2915 2172 969 673 204 69 52253 1086 346 236 52 23111 1221 23213 766
NM_002211chr104383 134 70 48 ------
NM_002214chr7165487 5282 5236 4617 4390 3961 3872 3751 2228 2044 1764 1740 1327 254 181 67 35061 4161 3582 15583 24696 841
NM_002223chr1294011 3893 2978 2640 2570 1463 706 544 392 ----12734
NM_002232chr141278 1237 543 509 1266 ----
NM_002235chr1251581 1447 1412 1217 248 1563 197 31570 377 88
NM_002240chr211115 ----1660
NM_002242chr242008 1562 1306 534 1424 21920 783 --
NM_002247chr1032355 2232 1570 --178 --
NM_002252chr21459 ----1329
NM_002264chr3104016 3789 3586 3321 3281 2030 1760 1438 861 745 --33476 1061 90 --
NM_002266chr171203 --2257 190 --
NM_002267chr1362422 1993 1783 831 709 546 21884 671 ----
NM_002268chr361862 1567 1459 1266 1237 336 1255 ----
NM_002270chr5195632 5542 5459 5321 5307 4950 4807 4704 4621 4415 4332 1758 1593 1406 1266 906 799 767 467 22199 2080 1828 13716
NM_002271chr1342306 1650 580 293 21726 903 ----
NM_002285chr254107 3211 2883 2676 964 --1385 --
NM_002293chr142056 1764 732 703 --12388 --
NM_002296chr191694 1433 1281 1199 619 586 475 187 80 ----1646
NM_002310chr5136046 5491 5224 5159 4020 2293 1663 1532 896 732 642 538 489 35061 2209 119 45791 5217 4037 1848 16424
NM_002312chr1341063 844 331 146 --3819 681 153 --
NM_002313chr10125120 4483 4434 3662 3412 3292 3249 1259 1197 1112 650 207 --34140 3166 1225 23402 399
NM_002317chr53372 358 290 1392 --173
NM_002334chr1152106 2090 1602 1574 1355 ------
NM_002335chr112193 161 ------
NM_002336chr12134879 4389 4320 4215 4157 4089 4048 3935 3465 3426 3281 3067 1731 --11497 --
NM_002349chr281486 1401 1137 1102 518 381 329 24 ------
NM_002350chr831180 965 820 ------
NM_002351chrX51616 1570 621 374 39 11293 ----
NM_002356chr662719 1116 861 671 344 35 --11135 --
NM_002358chr46551 542 536 178 99 34 ------
NM_002360chr712601 12275 ----
NM_002373chr151425 ------
NM_002381chr24906 669 311 102 2355 221 1850 --
NM_002392chr124465 429 218 176 --1229 --
NM_002395chr631114 429 56 --1477 --
NM_002397chr542167 1854 1808 1376 --2792 255 --
NM_002401chr1732136 2072 1531 ------
NM_002402chr721184 340 21170 1037 1367 --
NM_002430chr2272191 2109 1932 1684 275 183 92 --12097 --
NM_002431chr141324 ------
NM_002440chr1--194 ----
NM_002449chr521112 921 --1480 1798
NM_002451chr993823 3749 2935 2727 2454 1237 835 487 70 1186 ----
NM_002467chr82376 174 1328 --1295
NM_002478chr111620 ------
NM_002480chr1231357 387 163 ------
NM_002481chr1137403 7187 6956 6865 6331 5923 4905 2978 2834 2476 572 356 302 16022 28008 5133 37741 5883 2952
NM_002486chr941009 557 437 51 --32267 2170 375 11630
NM_002487chr15--1540 1111 --
NM_002489chr7------1344
NM_002506chr11103 ------
NM_002508chr152022 1625 506 176 139 1754 ----
NM_002514chr83293 263 229 ------
NM_002515chr1421636 1592 11487 ----
NM_002518chr21494 ------
NM_002519chr1131153 253 159 31353 608 122 1342 11549
NM_002523chr721218 1047 ------
NM_002524chr171063 993 964 950 896 750 443 --170 1885
NM_002526chr651729 1675 1228 1139 469 11491 ----
NM_002545chr1174992 4871 4182 3929 1635 1076 401 34234 3629 1746 14539 11479
NM_002546chr83625 497 117 ------
NM_002568chr83402 318 131 ------
NM_002569chr1511488 ------
NM_002576chr1131224 899 222 ------
NM_002577chr3144074 4046 4033 3976 3281 1425 1061 928 871 775 668 421 305 178 13476 ----
NM_002578chrX2170 131 ------
NM_002581chr9105695 5486 5459 4838 4660 4597 4126 4116 1149 138 15430 --11899
NM_002586chr641636 1296 1187 1136 --1480 --
NM_002590chr134469 228 210 183 ------
NM_002594chr2032160 2072 882 22455 131 ----
NM_002595chr1241941 1462 1265 487 --31843 1271 547 11393
NM_002600chr161484 1314 672 501 468 190 --1709 1356
NM_002610chr2103100 3056 2517 2370 2307 2167 2134 562 468 250 32962 1223 270 ----
NM_002613chr1665304 5247 4723 3618 1928 1122 14324 1913 --
NM_002623chr20295 62 ------
NM_002628chr3190 ------
NM_002635chr122391 69 ------
NM_002641chrX41818 1660 189 104 ------
NM_002645chr1152540 2313 2087 2027 97 22919 1029 --33122 898 628
NM_002652chr7288 63 ------
NM_002655chr8175249 5218 4595 4574 4486 4454 3664 3426 3318 3235 1849 1785 1729 994 285 153 99 24369 3278 1453 1541
NM_002656chr641111 948 857 759 ----1338
NM_002657chr2063935 3355 3181 2723 2567 823 1229 23578 775 --
NM_002667chr64861 406 385 275 1902 --1221
NM_002670chr351024 618 531 380 190 ------
NM_002687chr1441185 1173 860 174 --31111 996 844 --
NM_002690chr8147 ------
NM_002697chr12264 214 ------
NM_002698chr1942524 2203 1114 794 ----1944
NM_002703chr441944 1296 1224 632 --1658 --
NM_002706chr22490 469 --1607 --
NM_002709chr2113583 3548 3469 2602 2379 2334 736 729 553 436 120 1662 32995 1249 876 --
NM_002713chr131034 395 86 --11077 --
NM_002715chr54988 927 495 353 --1337 1848
NM_002716chr11103334 3301 3089 2785 2429 1412 914 444 148 49 ------
NM_002718chr3102683 2381 2266 625 536 501 458 211 169 133 --1745 1557
NM_002720chr161221 ------
NM_002721chr9--2489 409 ----
NM_002725chr144354 3924 3409 1771 23071 177 12684 --
NM_002730chr1931355 1102 940 --11263 1117
NM_002731chr193098 2294 2021 1945 1227 1153 929 501 440 22533 289 32628 1261 556 --
NM_002734chr1762310 2095 1589 1546 864 112 12005 11688 --
NM_002736chr761830 1646 593 561 491 227 ----11566
NM_002737chr1756460 5713 1926 1334 1013 25451 1488 --16163
NM_002745chr2274306 4187 4047 3864 2991 1526 177 1832 23145 1320 --
NM_002747chr1821705 1636 ------
NM_002748chr151836 ------
NM_002765chrX3314 256 46 --140 2379 330
NM_002767chr172521 150 1209 ----
NM_002788chr14134 ------
NM_002790chr1123 138 ----
NM_002792chr202113 27 ------
NM_002811chr16128 ------
NM_002822chr1241537 552 508 223 21138 599 11123 --
NM_002824chr121479 ------
NM_002828chr182670 26 1879 --1948
NM_002830chr22257 122 1132 ----
NM_002834chr1283711 3613 3568 3395 3324 3236 1475 388 22907 837 23548 2923 --
NM_002837chr12114519 4385 3989 3640 3208 1108 662 492 277 151 115 11652 11434 23050 3004
NM_002839chr983431 2999 2853 2523 2406 1053 767 560 12916 22736 99 --
NM_002841chr3353 36 27 ------
NM_002843chr1183321 3261 2998 1363 837 620 316 130 12695 ----
NM_002844chr6--1931 --11313
NM_002851chr72687 187 1284 3694 670 117 --
NM_002869chr1151878 1606 1424 516 450 11463 12044 2246 163
NM_002874chr982475 2409 2305 2259 626 356 76 50 --21878 281 --
NM_002886chr3135029 4889 4801 4535 3812 3452 3263 1645 1407 1195 1090 976 534 45182 4933 4325 3541 11227 23378 1416
NM_002890chr54910 893 797 308 ------
NM_002892chr1421115 228 ----11567
NM_002895chr201709 --1606 --
NM_002902chr153511 141 44 1557 ----
NM_002906chr1192377 2339 2243 2040 2020 1825 1758 1502 1474 --11491 --
NM_002938chr442030 1563 1514 494 11784 11658 --
NM_002941chr341639 1603 1499 369 1157 1272 --
NM_002942chr321423 1157 --3418 403 286 --
NM_002945chr172672 129 1278 ----
NM_002955chr621664 1489 21787 483 2523 282 1655
NM_002956chr1211237 184 --1332
NM_002957chr963750 3596 3513 2557 2464 481 ------
NM_002958chr32704 152 ------
NM_002959chr194411 4359 3476 3059 1146 1133 721 663 88 21691 75 24398 239 11553
NM_002968chr1631084 1042 344 2797 162 1231 --
NM_002973chr122529 509 186 ----
NM_002977chr2133076 2997 2958 2952 2621 2583 2374 2244 2165 1335 1040 505 293 13365 ----
NM_002979chr11756 --1899 --
NM_002993chr42804 693 ------
NM_002994chr481994 1710 1624 720 664 616 516 136 ------
NM_002995chr11822 1641 ----
NM_002998chr8102146 2013 1794 1739 1412 613 503 384 269 42 1537 2810 542 --
NM_003014chr73374 35 28 11104 --1609
NM_003016chr1742037 1342 1327 1290 21268 470 11937 --
NM_003017chr631267 1232 263 189 --11404
NM_003022chrX41083 1059 407 73 --1502 --
NM_003032chr342682 2527 2425 2396 1143 ----
NM_003034chr12198099 7973 6883 6521 6048 5808 5610 5494 5354 5276 5079 5033 1920 1803 1732 1670 1516 1018 863 37910 2072 148 37008 5404 4925 --
NM_003040chr71106 ------
NM_003042chr331756 832 468 1873 11956 --
NM_003043chr324070 763 14043 --13885
NM_003046chr885264 4394 1940 1262 967 721 447 125 44831 3461 3343 638 24626 3431 1464
NM_003051chr161909 1695 1509 603 389 250 --1322 --
NM_003054chr102318 236 1219 ----
NM_003068chr81726 ------
NM_003070chr94874 616 301 127 --1832 --
NM_003071chr3101947 1895 1881 820 805 684 586 461 226 149 22087 183 --21994 838
NM_003074chr321601 78 1309 ----
NM_003089chr19----1154 --
NM_003095chr122323 72 1271 ----
NM_003099chr15116526 5129 4313 2482 2471 2205 1916 1693 1660 1491 906 36448 5436 1778 1173 11758
NM_003106chr37833 815 805 757 352 248 226 ------
NM_003107chr672454 2080 2074 1651 924 382 330 --32619 1859 1645 --
NM_003108chr2147199 6406 6200 6069 6038 5286 5211 4869 1176 847 834 764 617 608 15803 36550 4959 4469 15959
NM_003112chr7102983 2780 2552 2527 2337 2245 1224 1199 472 394 32660 2062 849 --1761
NM_003114chr82608 251 1875 ----
NM_003128chr231057 867 131 12355 --22169 670
NM_003131chr631400 710 302 --1772 --
NM_003133chr12301 134 ------
NM_003136chr14144 1398 ----
NM_003137chr61532 --1699 11983
NM_003139chr112950 885 1970 ----
NM_003144chr652224 1853 655 646 586 1444 ----
NM_003149chr321535 1239 11272 ----
NM_003150chr172956 939 1902 22393 104 --
NM_003155chr892593 2467 2458 2225 1070 839 549 337 256 21828 397 12116 1812
NM_003157chr32318 201 1717 ----
NM_003161chr17103133 2955 2902 2844 2751 2305 1432 1290 625 437 1581 13218 22369 1386
NM_003162chr24771 350 309 235 --1833 11077
NM_003165chr931778 371 154 ------
NM_003178chr34553 445 288 221 ----1563
NM_003189chr162795 2484 2246 2144 137 119 --12639 11048
NM_003194chr61442 ------
NM_003199chr18115600 5180 4193 1708 1638 1610 1581 1370 396 368 340 13548 22212 742 --
NM_003201chr104978 713 666 144 1198 ----
NM_003205chr1561944 1674 1599 1572 1554 896 ------
NM_003220chr631703 632 387 11217 ----
NM_003221chr6134001 3572 3456 2643 1159 1025 885 432 425 355 158 73 67 --23368 3343 --
NM_003222chr202889 165 --41109 963 487 203 --
NM_003234chr321829 1658 1395 1507 11756
NM_003253chr2171451 1416 1341 1279 349 159 129 ------
NM_003257chr1571433 1411 1382 1254 1086 541 263 21006 373 1995 1287
NM_003262chr3125160 5033 4791 4573 4035 3275 1842 1793 1164 965 739 223 44299 4192 1957 893 24366 1066 23953 351
NM_003269chr611255 2934 50 ----
NM_003272chr14718 270 225 218 146 ----
NM_003274chr2152877 2450 2358 1831 760 12370 ----
NM_003292chr1102186 1871 1839 1726 722 692 646 574 421 355 1429 --12028
NM_003298chr3166164 5816 5475 5377 5220 5194 4817 4605 4144 3826 2022 2003 1894 1386 1204 703 --24757 3868 11477
NM_003304chr351044 1033 469 66 30 --11388 11060
NM_003309chr661642 1325 1292 767 362 112 ------
NM_003320chr1184477 4463 3533 3254 3058 2766 1014 827 43516 1235 537 473 ----
NM_003326chr182672 2627 2285 793 775 735 681 543 ------
NM_003337chr541672 1531 1283 47 2589 515 --1420
NM_003338chr1071917 1434 1286 1247 664 417 160 --1719 1671
NM_003340chr461407 1311 1189 1057 306 116 149 ----
NM_003342chr17103285 3183 2533 1229 1112 1061 847 823 530 99 12364 3921 657 482 126
NM_003344chr711599 ------
NM_003347chr2241509 1495 1478 1471 1932 1134 --
NM_003348chr1261371 1356 1246 641 390 51 11134 --1486
NM_003349chr2031426 250 170 ------
NM_003350chr82879 821 --1918 --
NM_003358chr91128 ------
NM_003359chr421020 265 --21002 842 --
NM_003363chr33678 490 226 --1543 --
NM_003367chr191480 ------
NM_003368chr13635 170 84 --2712 215 --
NM_003369chr1132717 913 406 21062 924 ----
NM_003376chr641717 1462 1440 1274 ----11325
NM_003376chr641717 1462 1440 1274 ----11325
NM_003379chr62919 362 1306 1419 --
NM_003381chr64850 801 685 37 2258 118 ----
NM_003383chr93503 425 238 ------
NM_003385chr26930 922 877 818 637 397 --1317 --
NM_003387chr282836 2794 2646 1999 1117 1068 281 176 --21808 939 --
NM_003390chr1141103 1069 783 697 --1958 --
NM_003392chr383817 2797 1189 562 534 431 301 256 24073 2650 14054 14135
NM_003403chr143576 326 279 1173 1750 --
NM_003404chr2031339 299 259 --1349 --
NM_003406chr841407 1313 626 129 --1786 --
NM_003409chr184551 403 311 274 --21128 918 31474 942 433
NM_003410chrX62479 2422 2333 668 343 140 21173 835 --1355
NM_003411chrY91729 1614 1587 1507 1407 631 505 456 236 21227 553 1590 --
NM_003412chr3113077 2902 2795 2292 2270 2223 1958 1237 1031 380 185 --12413 --
NM_003413chrX41329 1271 638 450 --1589 --
NM_003418chr32841 680 1564 ----
NM_003420chr33511 328 172 1540 ----
NM_003423chr1962295 1964 1604 133 104 87 --21905 1658 21718 996
NM_003427chr63735 671 488 ------
NM_003432chr51577 ------
NM_003435chr192614 132 147 1676 --
NM_003442chr111885 --1333 --
NM_003453chr131299 --1257 --
NM_003454chr1641490 1360 465 335 1604 11523 --
NM_003462chr151774 1750 1395 416 386 11086 122 --
NM_003463chr6142984 2238 2194 2063 1310 1203 1073 912 894 839 711 287 101 52 ------
NM_003466chr222301 147 11632 11824 --
NM_003468chr2124196 3826 3337 2990 2841 2723 1043 931 647 494 267 247 22792 876 22938 275 13734
NM_003471chr341483 934 632 556 ----1839
NM_003474chr1052325 823 202 127 82 ------
NM_003478chr11103345 3315 2850 2782 2584 2476 2289 2269 623 258 12971 ----
NM_003483chr1252771 2086 964 889 273 --22702 585 12804
NM_003486chr1612656 ------
NM_003488chr175997 927 874 786 636 ------
NM_003489chr2173337 2726 2551 1112 1105 164 110 --23363 1293 --
NM_003498chr1622637 2005 12799 --11087
NM_003503chr131074 371 105 --2467 265 --
NM_003505chr741277 772 740 160 31689 1340 784 --11864
NM_003506chr861312 1297 1118 507 493 431 --2900 822 --
NM_003507chr2--11488 2543 100 --
NM_003508chr71287 ------
NM_003557chr111446 21652 573 1393 --
NM_003563chr1751057 1044 979 434 163 --133 --
NM_003566chr12123343 2789 2165 1381 1227 1170 1030 799 729 349 276 232 22743 1011 11234 22143 315
NM_003574chr1875653 5372 4840 4620 2141 1975 619 13521 34250 4061 3993 14483
NM_003579chr11155 ------
NM_003580chr82137 63 ----1156
NM_003583chr1273762 3421 3157 3023 1195 214 134 21417 1373 --13925
NM_003589chr1341481 1418 1192 577 1164 1253 --
NM_003590chr2143936 3881 3841 3514 3489 2983 2962 2873 1522 1254 1000 743 645 492 34042 4004 182 ----
NM_003591chr10193 ------
NM_003592chr7----1490 --
NM_003597chr272189 1936 1566 1551 612 417 362 --22294 156 --
NM_003601chr4151 ----131
NM_003603chr462033 1583 1452 1400 1383 606 31930 1832 1762 ----
NM_003607chr174237 4025 3859 2852 1065 634 290 --11043 --
NM_003615chr383583 3273 3048 3040 2971 1422 1022 361 1567 33473 701 588 13800
NM_003618chr251050 1021 960 480 118 1256 1509 --
NM_003620chr174411 353 119 78 ------
NM_003622chr1282404 2357 2089 964 661 540 421 115 1753 ----
NM_003626chr1141301 1246 406 308 ----1532
NM_003628chr2--2742 542 ----
NM_003630chr62714 247 ------
NM_003633chr542155 958 633 625 ------
NM_003648chr232519 880 575 ------
NM_003659chr211100 ------
NM_003660chr191277 ------
NM_003663chr3163428 3069 2943 2929 2587 2193 1367 1350 1182 918 871 771 763 737 416 180 43444 2556 933 627 33190 1090 725 --
NM_003664chr51492 ------
NM_003668chr12165 ----192
NM_003671chr9103512 3493 3305 3055 2991 2607 2350 675 466 167 ----1705
NM_003672chr151867 1735 1689 84 47 1347 ----
NM_003675chr104484 380 153 59 1459 ----
NM_003677chr123809 598 416 11550 --21873 756
NM_003680chr12567 499 ------
NM_003686chr1----1272 --
NM_003690chr25624 545 214 186 74 1452 ----
NM_003692chr91988 ------
NM_003701chr1331061 1007 831 ------
NM_003713chr131554 466 101 2667 650 ----
NM_003722chr382161 2039 1681 1670 448 403 295 209 22650 949 ----
NM_003728chr42484 245 ------
NM_003741chr31298 ------
NM_003749chr1332296 2156 2067 42194 2119 1749 1614 1333 --
NM_003750chr104860 822 657 366 ----1884
NM_003758chr1551641 1355 580 391 66 ------
NM_003758chr1551641 1355 580 391 66 ------
NM_003759chr494240 3899 3797 3458 3192 882 761 629 362 23711 508 54170 4066 3918 2862 222 14328
NM_003760chr11327 2721 190 ----
NM_003762chr14491 254 100 64 --191 11208
NM_003763chr2073232 3174 3131 3075 2267 553 393 21184 663 22444 1265 --
NM_003766chr17143 ------
NM_003769chr121110 ------
NM_003772chr1161260 1253 959 812 291 67 ------
NM_003774chr1283333 3248 3125 3048 2584 2292 2078 497 32962 2929 685 11149 --
NM_003783chr141248 1095 434 394 --2845 138 1830
NM_003787chr1871696 1548 1279 1262 1050 489 427 --1546 --
NM_003794chr361050 973 890 236 196 133 --1309 --
NM_003795chr62387 168 --170 --
NM_003796chr192600 574 2621 394 ----
NM_003799chr1893527 2984 2831 2808 1592 1472 1211 291 174 34025 1054 512 14249 --
NM_003800chr652272 2043 2034 789 340 11786 1956 1330
NM_003816chr821415 1367 31493 1216 131 11323 --
NM_003822chr183208 3143 2954 1963 880 783 661 600 --11971 --
NM_003828chrX------1565
NM_003831chr18131742 1716 1615 1587 1458 1282 1121 692 572 303 275 265 77 11704 --11400
NM_003840chr852131 616 172 150 28 1822 11666 1562
NM_003861chr1432567 2542 2285 1724 12113 --
NM_003872chr282599 2470 2162 2057 1890 1191 543 388 1727 22895 638 --
NM_003873chr1052515 2292 2241 2184 1661 32119 962 137 --12452
NM_003884chr381876 1720 1479 1308 1245 744 627 155 ------
NM_003885chr1742641 2546 2497 998 11679 1713 --
NM_003887chr261627 800 560 443 229 179 --11604 --
NM_003895chr2151719 652 635 332 289 22139 1808 1541 --
NM_003896chr28988 916 804 783 310 295 243 124 --1118 --
NM_003901chr1072429 2404 649 376 286 186 79 1295 --12727
NM_003902chr14777 735 666 96 ------
NM_003909chr862774 2475 2317 1918 1189 437 ------
NM_003913chr694331 4299 4163 3921 3458 3124 1146 690 610 42722 1670 196 55 --1773
NM_003916chrX31325 946 477 2489 167 124 --
NM_003921chr171751 1545 1431 1225 704 58 21 --1215 --
NM_003927chr187933 881 735 715 686 676 365 --11049 1390
NM_003929chr151312 1255 1160 559 421 --1378 --
NM_003931chr65649 632 610 456 222 --1135 --
NM_003934chr91987 --2821 475 --
NM_003938chr191115 ------
NM_003940chr3149 ------
NM_003941chr7102563 2094 2076 2006 1977 1943 1896 1640 1553 317 12401 ----
NM_003947chr351193 1174 480 237 99 11298 11006 1555
NM_003948chr482233 2208 1810 1724 1076 753 413 170 11763 22365 641 --
NM_003953chr152898 2375 1951 773 660 12779 ----
NM_003955chr1751609 1563 367 294 223 ------
NM_003957chr111755 1723 ----
NM_003958chr693862 3558 3533 1243 1064 910 904 898 300 1602 22703 1487 13515
NM_003966chr5207257 7242 7063 7037 7008 6878 6808 6766 6581 6326 3091 3040 2601 2198 1659 1421 975 744 495 339 36963 1836 1674 46834 6045 4778 2843 26290 2385
NM_003971chr171567 --1521 2212 136
NM_003972chr1061323 1095 892 444 86 67 ------
NM_003980chr661442 1358 1342 180 168 44 11284 ----
NM_003983chr1651539 1291 951 683 424 ----13383
NM_003986chr111305 --3241 124 101 --
NM_003994chr12104149 4046 2832 2681 1569 1540 1443 946 376 145 11070 21721 1592 12954
NM_004006chrX132391 2279 2056 1863 1828 1789 1064 928 749 736 589 499 332 32617 2583 1994 ----
NM_004007chrX132391 2279 2056 1863 1828 1789 1064 928 749 736 589 499 332 32617 2583 1994 ----
NM_004009chrX132391 2279 2056 1863 1828 1789 1064 928 749 736 589 499 332 32617 2583 1994 ----
NM_004010chrX132391 2279 2056 1863 1828 1789 1064 928 749 736 589 499 332 32617 2583 1994 ----
NM_004011chrX132391 2279 2056 1863 1828 1789 1064 928 749 736 589 499 332 32617 2583 1994 ----
NM_004012chrX132391 2279 2056 1863 1828 1789 1064 928 749 736 589 499 332 32617 2583 1994 ----
NM_004013chrX132391 2279 2056 1863 1828 1789 1064 928 749 736 589 499 332 32617 2583 1994 ----
NM_004014chrX132391 2279 2056 1863 1828 1789 1064 928 749 736 589 499 332 32617 2583 1994 ----
NM_004015chrX132391 2279 2056 1863 1828 1789 1064 928 749 736 589 499 332 32617 2583 1994 ----
NM_004016chrX132305 2193 1970 1777 1742 1703 978 842 663 650 503 413 246 32531 2497 1908 ----
NM_004017chrX132391 2279 2056 1863 1828 1789 1064 928 749 736 589 499 332 32617 2583 1994 ----
NM_004018chrX132305 2193 1970 1777 1742 1703 978 842 663 650 503 413 246 32531 2497 1908 ----
NM_004020chrX132391 2279 2056 1863 1828 1789 1064 928 749 736 589 499 332 32617 2583 1994 ----
NM_004021chrX132305 2193 1970 1777 1742 1703 978 842 663 650 503 413 246 32531 2497 1908 ----
NM_004022chrX132305 2193 1970 1777 1742 1703 978 842 663 650 503 413 246 32531 2497 1908 ----
NM_004023chrX132305 2193 1970 1777 1742 1703 978 842 663 650 503 413 246 32531 2497 1908 ----
NM_004028chr1863999 3813 3607 1490 1407 156 22838 1435 1939 1595
NM_004052chr104742 290 137 21 ------
NM_004056chr83987 770 84 ----11071
NM_004060chr521262 28 21235 386 21205 1178 1296
NM_004063chr83299 252 94 1679 ----
NM_004064chr1261334 1270 1110 912 386 291 ----2884 106
NM_004067chr731537 278 112 2605 309 ----
NM_004075chr122518 184 1164 2426 151 --
NM_004081chrY61877 1569 610 405 208 197 11517 ----
NM_004085chrX2662 309 ------
NM_004086chr141647 ------
NM_004087chr361784 787 549 525 473 133 21931 351 --1307
NM_004089chrX31276 1258 1061 31267 390 103 ----
NM_004094chr1453024 2833 1869 1121 408 22068 95 --1590
NM_004096chr1072107 1965 1823 1797 1426 339 293 1170 ----
NM_004097chr21313 ------
NM_004098chr1021230 972 11038 ----
NM_004099chr951968 773 604 401 157 11705 1272 --
NM_004100chr672082 1974 533 517 507 481 403 1171 1694 --
NM_004105chr23904 890 799 --1855 --
NM_004109chr1172181 1827 1789 1671 1614 1529 112 197 1727 32222 2134 557
NM_004113chr341823 795 628 408 --11586 --
NM_004124chr14133102 2803 2460 2293 1255 1056 1002 897 811 624 474 272 184 1938 22580 264 --
NM_004133chr892712 2562 2536 2334 1694 1076 626 312 183 1993 21899 1852 --
NM_004134chr52134 61 185 2582 126 --
NM_004136chr1542386 2196 1181 1048 22478 852 1812 --
NM_004145chr19------1317
NM_004156chr82603 443 --1398 --
NM_004157chr31778 ------
NM_004161chr261504 1450 1084 550 527 155 11613 --1191
NM_004162chr331077 376 161 --2263 91 --
NM_004170chr951720 1366 1199 700 501 1518 ----
NM_004171chr11209528 9437 9193 9148 8628 8449 8130 7496 7067 6974 6901 6753 5896 3277 2704 2513 2106 1822 289 213 48760 2587 1301 688 39648 7769 1702 18100
NM_004172chr541559 1404 628 365 ------
NM_004180chr21605 ------
NM_004205chr111555 --1569 --
NM_004215chr84591 507 460 398 ------
NM_004229chrX81807 1621 1604 1475 1404 871 710 628 2416 105 11824 12198
NM_004232chr1893913 1499 1357 1309 1292 1139 958 917 70 13659 23837 847 23427 3345
NM_004235chr91685 ------
NM_004241chr103646 605 80 189 ----
NM_004242chr6290 50 ------
NM_004251chrX1240 ------
NM_004267chr31397 ------
NM_004268chr114384 267 152 40 --190 --
NM_004272chr551915 1781 1606 1232 390 --21453 469 --
NM_004274chr1462700 2467 2279 2064 2056 1088 33234 1988 429 2846 140 --
NM_004277chr621682 1472 1626 11621 --
NM_004293chr973639 3614 3373 3254 2681 1099 508 73345 3325 2885 2594 1463 1017 207 ----
NM_004302chr1212936 --12341 --
NM_004311chr1053118 2778 1944 730 64 ------
NM_004316chr1211178 ------
NM_004327chr226962 949 907 801 488 316 ----1870
NM_004329chr1041367 585 181 92 21213 278 1969 11200
NM_004330chr1541089 922 184 121 1796 ----
NM_004331chr8102716 2672 1941 1827 1722 1685 630 294 220 63 --12001 --
NM_004337chr882315 2191 1946 1461 728 651 442 230 11782 11519 21833 130
NM_004338chr18166792 6745 6655 6180 5971 4302 2814 2735 2008 1554 1232 1002 991 875 464 191 16589 11627 --
NM_004343chr192553 93 ------
NM_004362chr42719 172 176 ----
NM_004369chr26733 699 693 506 482 460 ------
NM_004370chr642048 800 464 176 12156 ----
NM_004374chr8121 ------
NM_004379chr241315 1278 278 239 2536 141 11498 --
NM_004380chr1632517 1891 102 --21916 467 --
NM_004384chr531742 1571 186 --1379 1763
NM_004385chr5----2240 53 --
NM_004392chr1362644 2245 1748 314 103 42 1531 ----
NM_004397chr1194312 3675 3539 3350 3342 1606 1541 759 397 34135 3666 1301 21640 992 --
NM_004407chr43867 733 77 --1251 --
NM_004412chr10196044 5917 5760 5717 5608 5287 5183 5085 4907 4559 4364 3945 3673 2214 2048 882 874 725 393 55537 5232 4995 4210 1806 44261 2346 890 441 --
NM_004415chr65714 684 566 313 50 ----136
NM_004419chr1041015 929 425 405 1157 ----
NM_004423chr362345 2178 836 822 464 246 1987 ----
NM_004430chr832375 1975 1063 --12289 --
NM_004432chr982324 1728 1565 721 691 594 421 179 168 11621 11478
NM_004434chr1441751 1286 372 141 --1293 1620
NM_004438chr263230 3183 3136 3078 1003 332 33216 2575 2057 --12691
NM_004440chr631925 1841 473 21314 541 --11877
NM_004441chr321299 1270 ------
NM_004447chr1231089 893 106 ------
NM_004449chr2121468 1193 1323 ----
NM_004457chr231700 1590 1056 1461 1342 11170
NM_004458chrX82527 2249 2098 1068 990 695 361 172 ------
NM_004459chr1781967 1637 1473 1458 793 381 255 118 --11382 --
NM_004464chr4163668 3593 3445 3380 3286 3080 3056 2758 2731 1626 1330 1245 1203 1147 315 268 34169 1483 96 43530 3325 2845 407 11285
NM_004474chr13954 883 683 11068 ----
NM_004480chr141316 ------
NM_004481chr172639 2545 2333 975 697 139 87 ------
NM_004482chr25896 668 594 266 108 1821 ----
NM_004483chr163458 336 94 --1163 --
NM_004496chr1421253 1174 ------
NM_004497chr191662 ------
NM_004499chr55413 368 130 93 83 ------
NM_004500chr1461671 1453 724 259 240 227 11299 ----
NM_004501chr193862 3624 3065 1474 1274 1028 942 716 275 --23128 81 24001 1608
NM_004503chr121860 1680 ----
NM_004504chr2143042 2851 2732 2639 2468 2242 2042 2003 871 824 733 723 95 32 --1853 1337
NM_004505chr1741857 1759 204 146 --11680 --
NM_004514chr1753100 2708 2671 846 244 32701 2139 104 13001 --
NM_004516chr1961158 1148 1058 389 47 34 ------
NM_004520chr53741 609 505 ------
NM_004523chr1041399 1182 1153 1135 --11506 --
NM_004526chr31638 ------
NM_004529chr931197 999 560 ------
NM_004535chr2041420 1321 1192 1113 --194 --
NM_004537chr1281574 1203 1169 1085 978 964 427 190 21305 152 ----
NM_004540chr215878 204 118 108 102 2789 218 190 --
NM_004566chr1062515 2449 2119 1743 91 47 --22457 2184 --
NM_004571chr2193082 2644 2634 2162 1364 992 657 153 25 1923 12761 11061
NM_004575chr431596 1553 1289 1445 ----
NM_004576chr52174 94 --1101 --
NM_004580chr1561398 1350 698 625 525 161 ------
NM_004582chr11121 ------
NM_004583chr172721 142 ------
NM_004586chrX134880 4798 4327 3977 3687 1452 1320 1221 1104 1055 526 399 202 24894 1358 34512 2047 1945 23928 1250
NM_004598chr572782 2281 2218 2187 1142 787 757 1979 13100 --
NM_004600chr151297 1273 1171 471 247 ----1211
NM_004602chr2061450 1370 1033 965 500 81 ----11503
NM_004606chrX2375 303 ----1348
NM_004609chr203584 509 224 ------
NM_004612chr9144136 3649 3609 3573 3515 1845 1672 1543 1392 1200 1020 759 147 59 23704 1888 --22974 298
NM_004619chr142114 1686 145 29 --12040 --
NM_004621chr1141263 1253 156 119 ----11207
NM_004630chr1111128 ------
NM_004631chr131328 1030 540 --11021 --
NM_004635chr32314 126 1142 1754 --
NM_004645chr172742 66 2670 555 --1212
NM_004654chrY5987 403 289 151 60 --1505 --
NM_004660chrY82174 1950 749 734 612 313 273 60 1446 11502 2321 85
NM_004663chr1541550 562 511 148 --11051 --
NM_004666chr63396 387 37 11544 --11485
NM_004673chr171389 1306 1242 1153 1139 1043 37 31577 1129 393 --11063
NM_004681chrY2618 504 1788 ----
NM_004685chr1362571 2381 1015 749 725 405 --22138 996 1337
NM_004687chr1731819 1650 1390 ------
NM_004709chrX81813 1711 1187 615 290 247 217 137 ------
NM_004717chr761574 1025 991 300 280 145 ------
NM_004719chr12122586 2482 2374 2195 1772 1077 764 704 688 334 296 176 21969 53 --12779
NM_004721chr3----1351 --
NM_004725chr1031038 975 104 11022 ----
NM_004726chrX105731 5649 4627 4432 4168 3482 1994 1530 695 312 13755 11357 --
NM_004727chr1511744 11757 --1515
NM_004734chr1353242 2778 2710 309 136 11009 1631 --
NM_004736chr151949 1630 545 200 194 21583 906 31878 825 556 --
NM_004738chr2042387 2046 1849 716 12245 22108 1824 --
NM_004744chr4103975 3937 3659 3626 3207 2667 1495 1468 1165 961 ----1383
NM_004745chr8136958 6680 6610 6590 5448 4347 2728 1527 1340 942 835 586 192 24466 4311 46761 5636 5180 1739 12806
NM_004748chr15134094 4054 3905 3789 3751 3568 2615 1233 1081 895 537 193 175 34077 3685 943 44131 4106 3477 1357 23414 602
NM_004760chr74801 657 617 554 124 1130 --
NM_004768chr13867 750 356 11093 ----
NM_004772chr511248 1210 ----
NM_004774chr1763175 2503 2433 880 716 459 21221 1148 ----
NM_004775chr1842196 1520 648 295 --11870 --
NM_004779chr521320 1017 11145 ----
NM_004781chr181484 1444 1274 1257 670 456 131 56 ------
NM_004781chr181484 1444 1274 1257 670 456 131 56 ------
NM_004788chr11122767 2292 2071 2007 1937 1815 1672 635 616 552 330 255 12474 11029 1516
NM_004792chr21181 ------
NM_004796chr1452310 2042 1922 1837 327 21569 367 --2851 579
NM_004797chr3113685 3571 3500 3437 3187 3136 2564 1408 920 738 552 32764 892 199 --1159
NM_004804chr262404 2230 2024 1770 1116 106 ------
NM_004805chr221410 77 ----1346
NM_004808chr1073287 3225 2828 2804 1330 1289 253 22678 185 ----
NM_004815chr1114416 4303 3721 3654 1703 1586 907 791 767 553 279 11841 14374 --
NM_004820chr81449 --2119 77 --
NM_004824chr64940 292 202 110 --1542 1180
NM_004827chr471696 1343 1280 1269 1263 759 254 --11940 --
NM_004834chr2103367 3261 3245 3193 2780 2229 1074 1036 865 821 --22889 596 --
NM_004835chr32880 30 ------
NM_004835chr32880 30 ------
NM_004836chr23984 946 168 --2954 722 --
NM_004840chrX42411 1879 499 454 ------
NM_004842chr651611 1581 661 273 73 ------
NM_004845chrX73922 3907 3128 1126 842 768 205 12687 2630 308 1715
NM_004849chr661597 1045 521 470 459 412 1381 1564 --
NM_004850chr221279 519 ----1343
NM_004857chr1484783 4505 3897 3659 3562 1644 1380 1222 34202 4022 550 23370 1456 44052 3905 3885 3865
NM_004859chr1721235 124 23000 2463 ----
NM_004866chr5144764 4476 3919 3619 3221 1871 1157 1129 1015 868 830 706 590 150 23871 1239 24053 1712 --
NM_004871chr1764411 4352 3947 3110 2700 2666 --24318 3708 --
NM_004872chr12399 181 ----1157
NM_004873chr1463051 2988 2957 2947 2906 1980 12216 1186 --
NM_004893chr51464 ------
NM_004896chr1041034 990 333 224 21343 1018 1252 1969
NM_004898chr422651 1947 11149 21107 346 11021
NM_004904chr7166427 5809 5768 4688 4663 4533 4464 4047 2532 2525 2241 2151 2062 1923 1662 1494 35737 5722 4433 1659 --
NM_004906chr6139 ------
NM_004912chr761618 1374 1176 1154 643 510 21693 1632 21644 1402 1656
NM_004924chr192786 757 ------
NM_004926chr1451818 1566 1413 1215 1170 --41620 1580 388 210 11369
NM_004930chr11615 ------
NM_004932chr561702 1688 1338 1286 528 176 1654 11307 11647
NM_004938chr91318 --2994 337 --
NM_004956chr7114246 3493 3483 3232 3142 2927 2784 1672 1242 1016 598 44206 3508 2920 1301 11338 1393
NM_004958chr14915 309 164 97 ----1290
NM_004965chr211718 --1510 1683
NM_004966chr1011019 2950 713 ----
NM_004972chr931126 462 148 ------
NM_004973chr651651 1620 260 166 139 11693 ----
NM_004985chr12144218 4043 3929 3618 3285 3056 1642 1521 1282 967 705 127 98 49 --44439 3862 3720 3554 2884 402
NM_004987chr21365 --1303 --
NM_004992chrX77123 6351 2343 1201 886 240 90 23291 2553 ----
NM_004992chrX77123 6351 2343 1201 886 240 90 23291 2553 ----
NM_004999chr6134525 4431 4334 4236 3903 3461 3219 3022 2896 1121 1049 502 329 23151 842 --11519
NM_005006chr251026 920 307 167 105 ------
NM_005010chr762269 2153 1843 1734 1500 1484 2795 456 ----
NM_005023chr541175 503 483 208 ----1576
NM_005032chrX3932 390 137 ------
NM_005036chr22148271 8183 8119 7967 7781 7770 7201 7164 5433 5412 3188 2753 1854 1095 58041 6991 6289 6033 509 --18323
NM_005056chr1275280 4815 3814 3807 2177 1962 1865 45562 4663 4077 1139 --14775
NM_005058chrY------1196
NM_005063chr1093805 3381 3164 3110 2670 1253 1195 524 319 31268 646 508 13817 --
NM_005065chr14105403 4984 4537 4145 3448 1964 1923 1641 770 233 --35271 4880 2026 --
NM_005066chr12826 276 ------
NM_005068chr691439 1248 1230 478 465 439 255 213 107 --21482 529 --
NM_005069chr2131358 1255 92 --11729 --
NM_005073chr132914 629 1105 --1786
NM_005076chr164108 3936 2599 1575 1546 1254 11558 1228 --
NM_005077chr9------181
NM_005079chr882668 2601 2530 971 638 628 112 87 --33117 2880 756 --
NM_005093chr20105295 5097 4885 4511 4185 1527 1154 867 634 276 11921 11265 --
NM_005095chr192096 1695 1388 1370 500 372 358 132 102 1325 1243 --
NM_005104chr64776 728 664 568 ------
NM_005109chr342521 1698 721 469 1693 --1658
NM_005112chr41805 ------
NM_005113chr142168 79 --2418 126 --
NM_005114chr43456 96 28 1575 ----
NM_005116chr2054335 3923 3440 3409 1335 --13154 --
NM_005117chr116917 837 664 360 212 107 ------
NM_005119chr13498 488 380 ----1352
NM_005121chr17153618 3175 3034 3026 2888 2869 2791 2495 1519 1361 1335 1179 1006 871 143 23834 361 23355 2592 --
NM_005126chr362291 2017 1916 1705 638 444 22118 876 ----
NM_005151chr1841751 838 768 567 --31864 1737 658 --
NM_005153chr161168 --1184 1631
NM_005154chr151225 2652 629 --1527
NM_005156chr9105275 4784 3449 1986 1728 1610 1459 747 417 392 1777 21043 645 142
NM_005166chr191229 ------
NM_005168chr241670 1144 382 220 1560 1493 --
NM_005180chr1031257 1171 635 21671 582 ----
NM_005181chr81649 1351 --1723
NM_005188chr11138268 7098 5649 5417 5273 3009 2697 2160 2031 1079 1043 490 343 27382 537 27025 2576 21158 96
NM_005190chr65343 311 290 264 98 --21158 1125 1439
NM_005194chr203581 145 102 ------
NM_005197chr14105889 5873 5426 5247 4643 1772 1418 1307 1237 157 12259 24545 2335 15109
NM_005201chr3--11107 --1229
NM_005202chr172261 2164 2040 1941 1613 757 138 11953 11549 --
NM_005204chr102744 693 ------
NM_005207chr2283743 3702 3631 3162 2731 1271 950 737 13648 --1802
NM_005227chr1--1490 ----
NM_005230chr121107 1491 ----
NM_005233chr342319 1997 1031 619 11895 1585 --
NM_005235chr2227860 7223 7037 6940 6271 5908 5843 4925 4806 3049 2826 2761 2468 2078 1386 1175 1099 740 590 582 160 47 35341 5179 2033 47539 6701 4747 710 45620 2945 2307 2229
NM_005238chr11103398 3313 3213 2888 1363 1277 1160 1069 1030 405 23589 534 --12756
NM_005239chr211531 ------
NM_005241chr32476 448 1890 21064 224 --
NM_005249chr141825 ------
NM_005252chr141647 ------
NM_005254chr1521115 1034 2540 166 21075 326 --
NM_005257chr1821078 379 ----1527
NM_005259chr231506 1397 517 11241 126 --
NM_005261chr84847 650 365 324 ------
NM_005271chr1021195 991 11036 146 1393
NM_005273chr71320 ------
NM_005277chr471582 1498 573 379 238 168 122 --11747 --
NM_005279chr23752 713 247 --1806 --
NM_005295chr7------1310
NM_005296chrX3296 287 46 2675 234 ----
NM_005308chr103501 344 172 ------
NM_005313chr152491 277 --1872 --
NM_005318chr2231270 116 58 11280 ----
NM_005324chr1782019 1969 612 451 343 269 66 59 11437 11849 --
NM_005329chr1682331 2286 2064 1956 1542 1478 782 424 ------
NM_005339chr493988 3939 3929 3534 3333 1480 1117 661 217 23378 1158 44140 4065 1516 464 23320 1507
NM_005342chrX52589 2119 2070 1860 882 --32346 2177 955 1556
NM_005358chr1321367 312 21171 466 1121 --
NM_005359chr18216193 5934 5750 5698 5617 5477 4976 4541 4095 1890 1830 1813 1709 1646 1517 1465 1200 1137 1053 821 484 24191 611 26416 2245 35895 1969 501
NM_005375chr651130 969 779 79 49 ------
NM_005378chr22898 707 --1824 --
NM_005385chr362708 2686 2496 763 278 53 42128 1013 234 106 1543 --
NM_005388chr961724 1594 1125 1079 449 187 ----11355
NM_005392chr931746 1459 1442 11340 ----
NM_005397chr773763 3211 2922 2613 1603 338 144 --13390 --
NM_005399chr184356 3857 3824 3641 3302 3143 3029 645 24436 1045 1753 --
NM_005400chr262985 2794 2274 2114 2095 606 1319 ----
NM_005402chr771864 1727 1542 1437 604 553 50 --1330 11333
NM_005406chr1861520 1499 1319 1124 1046 461 1529 ----
NM_005428chr191173 ------
NM_005429chr41263 ----1145
NM_005433chr1872471 2414 2256 1780 879 706 673 12069 --11803
NM_005436chr10154143 3978 3696 3481 3285 3236 3175 3114 2766 1387 1376 1305 1209 552 98 43745 3685 317 24 12504 12660
NM_005437chr1051415 1150 387 128 107 21222 1190 ----
NM_005450chr171232 ------
NM_005455chr151716 1684 1566 462 387 ------
NM_005458chr982415 1989 1971 1830 1785 1527 617 404 11646 22229 959 --
NM_005461chr2041437 1428 362 120 11896 2677 283 1707
NM_005465chr141866 1689 616 278 2683 267 1407 --
NM_005471chr541250 324 270 192 1824 ----
NM_005475chr1253247 2775 2765 2638 701 --1589 --
NM_005479chr1011491 ----1470
NM_005487chr2252007 1726 857 297 189 --11564 --
NM_005493chr63762 617 169 1239 1644 --
NM_005494chr7------1415
NM_005497chr17136070 5952 5933 4859 4027 2235 1841 1460 1350 1091 1075 761 340 22066 228 22431 69 --
NM_005502chr942888 2551 2483 2410 --22137 1077 13228
NM_005504chr12145987 5865 5684 5635 5085 4794 4595 2120 2087 1818 1763 391 212 198 34265 1045 403 34864 4631 1680 --
NM_005506chr492881 2760 2753 2738 2514 1044 683 387 264 ----2490 360
NM_005509chr541908 1321 1172 320 --21705 709 --
NM_005513chr371477 1419 1286 557 415 166 150 11404 ----
NM_005521chr104840 785 328 278 ------
NM_005524chr3----1134 --
NM_005530chr152969 191 1592 1364 --
NM_005544chr21775 1269 ----
NM_005546chr541900 1773 1629 548 21720 1709 ----
NM_005561chr131184 ------
NM_005570chr186804 783 443 218 178 100 1209 ----
NM_005573chr54715 704 497 267 --1141 --
NM_005578chr3124746 4668 4331 3651 3412 1917 1906 1675 1383 1295 599 227 24499 702 1283 --
NM_005584chr133807 227 64 1611 ----
NM_005591chr1172693 2520 2353 964 901 343 124 --42512 601 353 333 --
NM_005595chr1--3808 698 38 2284 175 --
NM_005596chr9166334 6036 5930 5874 5851 5344 5312 4811 4504 3978 2571 1456 1358 975 656 417 25696 2172 36174 4045 2200 14513
NM_005599chr121035 524 --21217 962 1413
NM_005604chr682448 2408 2171 2107 1929 725 595 408 1927 190 --
NM_005605chr82293 230 196 ----
NM_005607chr83954 805 115 ------
NM_005611chr1621304 1281 ----11208
NM_005613chr151944 1592 1479 1449 167 1784 --21912 1898
NM_005623chr172488 126 1464 ----
NM_005625chr88991 920 871 784 317 238 220 59 ------
NM_005637chr1821783 1311 11528 ----
NM_005638chrX3670 620 356 1194 11610 --
NM_005639chr1221270 144 --11804 --
NM_005642chr51144 ----122
NM_005650chr2211194 11379 ----
NM_005655chr831281 1012 350 --2881 33 --
NM_005657chr151130 ------
NM_005662chr81106 192 ----
NM_005665chr1144690 4638 4444 4331 4203 4192 3532 3399 1936 1359 1140 905 660 76 13181 24713 969 --
NM_005668chr5113685 3579 3240 2808 1696 1443 1312 1249 822 514 194 24171 611 11372 11504
NM_005685chr7153 ------
NM_005694chr32104 55 ------
NM_005700chr111370 ------
NM_005704chr111027 ------
NM_005708chr131371 1450 ----
NM_005711chr51187 --1809 --
NM_005715chr672846 2561 895 627 339 320 176 ----12375
NM_005717chr141210 811 297 271 11309 ----
NM_005721chr271069 943 908 866 795 744 103 ------
NM_005722chr2102357 2237 2077 2056 1893 1865 1581 1545 524 511 2654 376 22390 1620 --
NM_005724chr15------1244
NM_005725chr192426 2367 2267 1813 984 749 739 345 110 11937 ----
NM_005734chr113230 181 132 ----1778
NM_005738chr762067 1642 1519 736 574 561 1312 ----
NM_005739chr1592323 2296 2192 1842 1591 601 580 388 222 183 ----
NM_005746chr7112622 2222 2115 2032 1891 1060 940 823 432 361 287 22099 2090 ----
NM_005748chr1283114 2835 2381 1296 976 862 708 113 22971 1205 13005 --
NM_005749chr171632 ------
NM_005754chr52266 125 ------
NM_005756chrX31488 1452 294 ----1358
NM_005759chr284750 4112 3951 3854 3346 1831 1821 1474 11297 13798 11330
NM_005777chr32104 90 ------
NM_005780chr132842 706 --1806 --
NM_005786chr1821026 960 --1999 --
NM_005788chr11--1517 --1659
NM_005795chr2152932 2740 2712 2573 2558 2502 2496 2462 2216 1916 986 488 442 291 98 21961 84 12600 --
NM_005797chr1151763 1680 572 311 73 21152 1112 --1222
NM_005801chr173628 131 56 ------
NM_005802chr92813 150 1720 ----
NM_005808chr353387 3088 3063 435 300 1199 13349 --
NM_005813chr2102666 2419 1962 1921 1786 706 401 296 223 64 42165 1941 1800 1746 32301 2017 917 --
NM_005819chr1103422 3055 2983 2393 1405 1221 1033 734 449 124 22944 1206 23191 1271 --
NM_005826chr12622 267 ----1529
NM_005828chr1785008 4971 4747 4722 1374 1015 868 505 1899 21639 477 --
NM_005832chr341418 595 300 24 11459 --1577
NM_005835chr62193 23 ------
NM_005836chr83337 83 45 ------
NM_005839chr12969 822 156 ----
NM_005840chrX87637 7489 7448 6760 6256 4721 760 735 35984 4824 1659 42338 1710 1093 997 11933
NM_005841chr441024 293 38 32 ------
NM_005843chr251924 1853 1364 557 83 11603 1535 11700
NM_005853chr162406 34 ------
NM_005857chr14994 416 239 83 11468 1562 11417
NM_005859chr551163 1047 468 360 192 1542 11526 --
NM_005862chr351047 989 930 821 70 ----1383
NM_005868chr762437 2376 2298 1786 681 531 22318 773 1244 1665
NM_005871chr1051042 915 845 333 233 --31081 880 181 --
NM_005872chr14365 187 69 58 1417 ----
NM_005875chr32122 27 ------
NM_005880chr161163 1429 1128 --
NM_005885chr561380 1255 1079 294 119 56 31280 1134 543 ----
NM_005886chr161266 ------
NM_005888chr122391 69 ------
NM_005895chr1264035 3500 3024 1489 936 188 ----14109
NM_005898chr1182883 2579 2350 2245 2142 1275 800 343 --12743 12039
NM_005900chr421082 994 ------
NM_005901chr18187417 7197 7140 6652 6183 6020 5923 5755 5523 5365 5315 3075 2937 2277 1781 1730 1333 544 35811 2249 888 38262 5535 597 15762
NM_005902chr1564623 4062 3882 3589 2933 2879 1971 34515 4468 4029 --
NM_005903chr5115202 3794 3212 2028 1959 1867 1774 906 350 61 49 ----23821 640
NM_005906chr641609 1466 1354 319 ----21044 569
NM_005907chr641601 344 325 89 1450 ----
NM_005909chr5113903 3444 3041 2948 1405 1390 1183 954 604 159 36 23544 2602 33656 3320 291 23841 1331
NM_005910chr1754054 3875 2783 2545 1650 2202 171 --13328
NM_005918chr7276 33 ------
NM_005923chr64652 560 192 167 ----1459
NM_005930chr142862 30 ----1356
NM_005935chr4115329 4699 4257 4146 3749 3740 3358 879 606 438 264 21400 375 44819 1522 691 507 13224
NM_005941chr8114155 3937 3759 3433 2678 1579 1340 1159 502 186 49 1284 ----
NM_005943chr631599 1240 1115 ----11311
NM_005955chr1115315 5248 5153 4338 3741 3622 2008 1813 1678 1570 1099 --35503 2152 1847 --
NM_005962chr1062331 2310 2093 1540 1487 634 ----11570
NM_005962chr1062331 2310 2093 1540 1487 634 ----11570
NM_005966chr281982 1737 1726 1707 1630 1589 821 323 12108 ----
NM_005977chr135783 706 679 662 263 --2806 415 1352
NM_005985chr201818 ------
NM_005986chr1351944 1923 1886 521 232 22850 593 ----
NM_005994chr172657 608 ------
NM_005996chr1231319 1311 285 31565 977 474 ----
NM_005999chr191572 1213 1185 525 441 414 366 343 314 ----186
NM_006007chr9104008 4001 3549 3224 3210 1583 989 857 753 29 31500 925 446 --1461
NM_006010chr32247 77 1207 ----
NM_006016chr6102308 2104 1964 1956 747 686 458 367 361 116 --1290 12076
NM_006033chr1842009 1958 1674 41 12336 12147 --
NM_006036chr262268 1797 534 216 112 90 1882 1389 11626
NM_006038chr2042133 1954 1369 657 21779 1769 1703 --
NM_006047chr2093333 2987 2886 2846 2735 916 679 491 117 33052 3040 2857 ----
NM_006054chr114561 411 283 128 11649 ----
NM_006055chr2103203 2871 2590 2350 1278 1070 987 886 453 124 23012 897 22613 213 1208
NM_006063chr2161 ----1474
NM_006064chrX2419 153 ----1403
NM_006070chr32152 74 --1274 --
NM_006079chr64847 832 256 42 ------
NM_006080chr772748 2710 2645 2347 953 650 84 12258 1168 --
NM_006089chrX71560 1406 1235 1178 416 155 59 --11609 11767
NM_006090chr13684 639 93 1174 2630 118 --
NM_006094chr832236 1829 54 ------
NM_006095chr4144028 3956 3932 3917 3853 3426 3126 3078 2913 1520 1250 959 632 486 14530 13014 11218
NM_006100chr32529 170 --1147 --
NM_006106chr11152969 2811 2393 2317 2311 2261 1342 1257 1012 831 686 629 418 228 66 22521 2385 12921 --
NM_006113chr151776 1367 779 673 429 138 ----
NM_006135chr131025 538 193 --1949 --
NM_006136chr721287 356 11073 11336 --
NM_006141chr1672669 2561 2152 1944 1918 1034 626 31047 142 122 11086 --
NM_006148chr1762981 2932 2626 723 210 135 --22640 2518 --
NM_006152chr12156 --172 --
NM_006153chr35666 635 553 427 39 ------
NM_006154chr1562838 1075 1037 572 300 61 --22120 982 12669
NM_006158chr851669 1478 1280 168 135 1341 --21751 1435
NM_006160chr171554 ------
NM_006166chr1272654 2601 2519 2379 2364 1040 163 22459 2373 1127 12446
NM_006191chr121957 1911 ----
NM_006194chr1461300 1169 1076 516 377 205 2319 27 1178 --
NM_006195chr971437 1318 1054 898 424 401 271 1882 ----
NM_006196chr2194 2295 122 164 --
NM_006197chr872239 2093 1985 1528 894 837 784 22162 1641 1804 21710 371
NM_006203chr5125613 5355 4752 4107 3917 2118 1929 1435 1291 734 686 486 44133 1013 845 651 1817 23476 496
NM_006206chr4122966 2860 2530 2321 2096 2083 1850 823 482 414 283 183 1343 11036 --
NM_006209chr82284 73 ------
NM_006212chr185439 4828 4210 4105 3615 3534 985 844 14802 21762 99 11119
NM_006218chr31267 1235 ----
NM_006226chr2101307 1286 1275 1153 1039 936 477 458 431 161 --31386 1368 437 --
NM_006241chr382399 2233 646 612 593 338 271 89 1733 12358 --
NM_006242chr2042054 1589 625 123 1726 ----
NM_006246chr145491 480 382 217 207 2178 92 ----
NM_006251chr5162959 2915 2868 2712 2412 2402 2230 2136 2130 919 867 850 744 658 611 309 31144 1025 858 21163 480 33342 2927 434
NM_006252chr1267334 6528 6387 6030 5862 5680 5605 5535 5362 5330 5308 4812 2914 2742 2728 2486 2398 2178 1786 1668 1654 1365 1356 1339 1048 736 77374 5968 5767 5405 5235 4789 393 22718 2457 --
NM_006256chr1102759 2749 2393 2096 1857 1838 1017 922 645 333 1605 42420 2361 1807 91 12455
NM_006258chr101302 21482 1096 11163 --
NM_006264chr42479 456 ------
NM_006265chr851247 1191 1176 1043 389 31229 1001 166 21538 1143 --
NM_006267chr271692 1655 682 630 399 347 320 127 31514 599 560 --
NM_006275chr2052452 2283 2132 764 229 --2247 216 --
NM_006279chr11363 1686 ----
NM_006281chr82806 459 21194 882 ----
NM_006281chr82806 459 21194 882 ----
NM_006282chr2094565 4518 3744 3378 3200 2932 1883 1585 326 33769 1866 1528 24636 4525 --
NM_006283chr894665 4390 4323 4208 3674 3661 1914 1133 406 11525 44889 4464 3565 3102 --
NM_006290chr62760 283 11755 21953 1729 --
NM_006298chr663056 2745 1133 489 188 155 1105 3830 460 298 12905
NM_006306chrX64643 4268 3962 3797 2190 1055 15129 24725 3946 11188
NM_006313chr1231063 302 144 1180 ----
NM_006315chr4134355 4074 3869 3828 3497 3359 2770 2763 2744 1486 1264 514 103 14541 3573 480 127 --
NM_006320chr411014 ------
NM_006321chr311522 --1316 --
NM_006328chr111619 ------
NM_006330chr861440 1359 1218 1097 397 85 --1247 --
NM_006333chr22434 223 1531 --1603
NM_006345chr441090 893 869 381 ------
NM_006350chr5291 41 ----159
NM_006352chr1122021 1978 1840 1830 1704 543 530 522 481 298 161 121 2651 185 ----
NM_006353chr621448 332 21172 1111 1375 --
NM_006359chrX52110 1817 894 448 361 --1656 12462
NM_006363chr202617 144 --2420 247 --
NM_006364chr1441241 456 378 253 153 ----
NM_006366chr631077 231 105 1411 1861 --
NM_006371chr394763 4006 3792 3557 3382 849 814 376 23 11600 14635 22093 440
NM_006372chr65464 454 446 192 83 --1383 --
NM_006375chrX71784 1742 1711 1635 1624 1439 387 --1217 --
NM_006379chr772139 2123 1768 1704 932 878 225 21666 1516 11716 --
NM_006380chr1794010 3085 3040 2919 1630 1436 1220 650 387 33649 3218 889 14209 --
NM_006386chr2272266 1647 1627 824 456 294 122 --1281 11668
NM_006393chr10114534 4434 3655 1702 1377 1029 790 570 551 448 348 33796 3640 1421 24448 745 54127 3722 1541 699 414
NM_006403chr651736 1137 1127 517 145 1606 ----
NM_006404chr201535 ------
NM_006416chr64744 683 565 254 2799 755 1530 --
NM_006420chr2083325 3181 2782 2649 2183 874 801 407 ------
NM_006421chr821189 345 ------
NM_006431chr121157 ------
NM_006434chr1043116 2778 2013 2004 13269 12739 12982
NM_006439chr42445 95 ------
NM_006449chr222038 481 41894 504 357 347 21951 1731 --
NM_006451chr531029 405 182 2169 134 --1675
NM_006452chr451494 521 87 50 44 1727 11827 --
NM_006457chr494030 3347 3171 1090 961 816 303 252 69 --13778 --
NM_006459chr1031660 1581 1242 --11323 --
NM_006475chr132532 457 --1270 185
NM_006482chr1273762 3421 3157 3023 1195 214 134 21417 1373 --13925
NM_006489chr1421636 1592 11487 ----
NM_006494chr192885 336 1147 1152 --
NM_006496chr161736 1618 776 593 316 162 21817 305 11705 1392
NM_006504chr1092840 2765 2155 1848 888 485 251 66 30 1989 1101 22983 279
NM_006516chr141491 434 237 80 11552 ----
NM_006520chrX81655 1102 641 545 506 497 453 34 ----1590
NM_006521chrX--1873 11426 --
NM_006526chr201684 --1190 --
NM_006529chr471694 1610 1240 1165 1064 678 530 11446 ----
NM_006534chr20113381 3274 2539 2337 2177 1310 1269 1132 897 689 306 ------
NM_006536chr12966 385 ------
NM_006537chr153165 140 104 1479 --185
NM_006538chr2134205 4188 3883 3516 3491 3188 2849 2772 1675 1544 457 354 191 33907 3703 708 22897 377 11199
NM_006540chr831419 1290 1255 2976 298 ----
NM_006544chr14155389 5225 5203 5074 4986 4882 3958 3786 1976 1846 1803 1517 1423 1117 498 45877 5786 1395 253 --12414
NM_006546chr1796454 6432 6273 5177 1335 1327 745 485 330 26671 6160 35777 2016 1842 15979
NM_006547chr742003 1605 1363 143 12104 --1751
NM_006548chr31530 ------
NM_006557chr941599 1121 710 601 ------
NM_006558chr82517 65 ------
NM_006561chr10106253 6233 5864 2235 2135 1472 1431 1238 1145 37 43783 1120 926 893 14263 --
NM_006565chr163965 65 30 2950 137 1814 --
NM_006572chr1762964 2505 1299 1220 881 838 12300 43465 3169 2717 121 22468 448
NM_006575chr141394 --1514 --
NM_006580chr33456 345 125 ------
NM_006583chr42457 339 1429 ----
NM_006593chr24681 552 508 217 ------
NM_006595chr1182073 2061 1851 1793 671 575 341 280 1309 ----
NM_006599chr16238199 8010 7999 7881 7769 7727 6937 6923 6900 6566 5992 5779 5630 5511 3265 2779 2489 1888 1855 1286 1268 1135 291 48164 7894 5354 2703 27810 2892 27951 5057
NM_006603chrX52004 1333 623 569 519 --11878 --
NM_006609chr242928 692 408 231 1470 12282 --
NM_006614chr363672 3077 2916 2531 407 75 13580 12558 12856
NM_006620chr693753 3661 3552 1736 1453 827 562 400 221 34715 3326 800 13154 11386
NM_006621chr151591 1559 1434 783 666 --2478 70 1117
NM_006622chr54498 450 436 181 ------
NM_006624chr1041710 1584 635 466 --1616 --
NM_006625chr11199 --21203 1020 --
NM_006625chr11199 --21203 1020 --
NM_006625chr11199 --21203 1020 --
NM_006626chr992031 1977 1945 1800 1788 1079 834 694 147 21748 366 31825 1697 468 11809
NM_006628chr15114320 4174 1821 1787 1584 1087 1070 1059 846 583 340 11463 44694 1301 1286 254 1769
NM_006629chr1852484 2216 1850 1073 638 ----22058 809
NM_006633chr52255 168 ------
NM_006636chr231051 938 85 ----1764
NM_006642chr11299 ------
NM_006644chr132565 480 1559 1197 1437
NM_006646chr1372914 2839 2525 2488 2228 1949 1940 --11866 1585
NM_006654chr12144607 4421 4402 4128 3860 3844 3829 3780 3719 1626 1490 1406 490 344 14185 34219 3946 3125 1190
NM_006670chr61560 1569 1576 --
NM_006675chr1253114 2930 2199 620 155 --2588 507 --
NM_006682chr742121 1062 1055 279 --1267 12144
NM_006691chr1171245 1083 1019 999 834 781 228 ------
NM_006699chr1102398 2138 1888 1703 1062 1034 650 633 319 162 21781 955 12482 1918
NM_006703chr63420 411 370 --1525 --
NM_006704chr131347 ------
NM_006706chr53805 787 282 --1616 --
NM_006717chr983354 3269 3263 2312 2143 2107 602 524 32606 2136 797 12466 --
NM_006718chr641111 948 857 759 ----1338
NM_006720chr10125120 4483 4434 3662 3412 3292 3249 1259 1197 1112 650 207 --34140 3166 1225 23402 399
NM_006721chr103808 570 129 ------
NM_006722chr392696 2410 1987 1068 973 514 265 91 65 --22984 353 --
NM_006726chr451067 504 412 160 87 11096 ----
NM_006727chr51132 1481 ----
NM_006729chrX155624 5292 4410 4371 4333 4110 3821 2084 1836 1804 1404 1291 1162 957 414 31687 1060 723 11340 --
NM_006731chr9185669 5343 4818 4621 4155 3952 3907 3707 2191 1657 1579 1227 1027 1014 970 711 645 27 34107 3927 688 --14730
NM_006738chr1564668 4224 4025 3866 2879 1504 14621 13149 --
NM_006744chr10281 34 ------
NM_006745chr471076 1064 1032 835 804 259 158 --1413 1722
NM_006746chrX41196 1104 588 36 --11245 11421
NM_006750chr16148054 7947 7065 7005 6887 6112 4945 3172 3097 2486 2112 1460 1357 442 76921 6008 5441 5255 2411 2318 1813 26048 5728 --
NM_006751chr26907 794 735 681 202 185 ------
NM_006754chr72255 128 ------
NM_006756chr891312 1074 1015 990 519 508 441 196 58 --2614 305 --
NM_006759chr22267 256 ------
NM_006766chr852543 2299 2252 1753 726 1685 11704 --
NM_006769chr11684 ------
NM_006773chr261557 1529 1334 647 264 123 --21367 32 --
NM_006777chrX82933 2883 2784 2523 2434 1967 145 94 ----22603 2459
NM_006788chr1841676 1612 267 254 --11543 --
NM_006790chr51308 ------
NM_006791chr151663 ------
NM_006807chr1721313 1115 11331 ----
NM_006810chr3167 ------
NM_006813chr62625 35 --1729 --
NM_006823chr841189 991 901 864 ------
NM_006825chr123166 95 41 ------
NM_006826chr21447 2831 156 2398 390 1226
NM_006827chr14112810 2795 2649 2479 2296 2228 839 645 442 198 188 --2500 465 1418
NM_006828chr62512 104 ----1504
NM_006832chr1431097 396 118 ----2877 51
NM_006838chr1251304 1205 720 268 72 --11172 --
NM_006851chr12102910 2394 1158 884 749 684 494 458 251 150 ----11077
NM_006852chr1742828 2402 880 587 --22464 498 1565
NM_006857chr27881 834 805 321 299 154 77 1655 ----
NM_006868chr1883053 2954 2904 2628 1064 945 688 476 --22716 1272 --
NM_006873chr233061 2746 439 13292 21127 94 --
NM_006885chr16184166 4133 4055 3320 2856 2834 2807 2730 1300 1260 943 818 790 685 661 611 431 95 51534 1384 1199 705 65 ----
NM_006892chr2031388 1281 425 1262 ----
NM_006892chr2031388 1281 425 1262 ----
NM_006895chr292233 1823 885 587 567 481 471 265 153 21621 1449 11986 --
NM_006898chr21818 ------
NM_006902chr1103224 2593 2169 2139 2113 2077 2048 1179 1019 575 ------
NM_006908chr761502 951 370 178 142 125 --1405 --
NM_006912chr172573 2521 2320 2290 2258 2197 610 1486 22459 1802 1367
NM_006913chr61365 ------
NM_006914chr941427 1377 371 257 ------
NM_006915chrX152539 2526 2464 2428 2385 2253 2174 2165 1875 1594 1015 847 346 339 111 --1797 --
NM_006918chr11145767 5725 5580 5460 5400 5279 5143 4153 2346 2128 2079 891 493 483 25675 1521 --24557 4132
NM_006920chr221866 1627 2762 631 11794 --
NM_006922chr282287 2247 2209 1709 1027 980 749 596 32296 1998 77 22474 343 --
NM_006924chr17104260 4134 3753 3380 3344 3247 2869 2838 1039 746 13147 11125 --
NM_006930chr551778 1466 1362 544 246 1428 21690 1472 1466
NM_006931chr1282049 2016 1520 793 609 503 462 276 12039 1822 1519
NM_006939chr1431208 812 60 --1912 --
NM_006940chr1251817 1632 1378 540 298 1321 2634 85 --
NM_006947chr451662 1250 1158 552 197 11611 1122 --
NM_006948chr2142364 2312 1870 422 22224 1589 12264 --
NM_006951chr101289 --2627 188 --
NM_006963chr10----11170 --
NM_006981chr942262 2145 1062 499 12178 1510 12336
NM_006988chr2141206 836 780 22 ------
NM_006996chr161851 1582 1259 584 229 218 --11316 1114
NM_006997chr101177 ------
NM_006999chr512091 1457 21392 529 --
NM_007005chr9128 --21594 1184 11331
NM_007006chr16123438 3377 3184 3149 2868 2816 2587 1185 828 771 444 280 1981 1268 --
NM_007007chr1294842 4489 3882 1531 1361 1334 719 712 245 44643 3783 3116 256 --54654 4552 4300 4051 3414
NM_007008chr21769 1743 ----
NM_007010chr1761448 1225 636 620 328 38 --11467 --
NM_007011chr1596880 6056 5357 4756 1885 1838 1344 1218 697 22492 974 32107 1854 1248 15837
NM_007013chr81641 1848 ----
NM_007017chr53753 266 85 ------
NM_007023chr231005 873 210 ------
NM_007034chr151042 846 820 693 244 --2881 324 --
NM_007038chr21116065 5390 5265 4899 4856 4651 2073 1847 1239 1101 502 1607 34327 1232 373 1769
NM_007039chr1492305 2297 2221 2207 2009 1720 1593 437 374 --1481 --
NM_007043chr1232128 1304 688 11319 ----
NM_007049chr63983 925 799 ------
NM_007052chrX4423 184 153 56 1168 ----
NM_007054chr5113809 3699 3203 2869 2805 1131 1008 578 155 142 83 1351 23084 647 33823 2982 95
NM_007064chr33577 550 438 11652 ----
NM_007067chr1731411 1255 530 11481 21216 995 --
NM_007068chr223996 982 960 174 ----
NM_007073chr694255 3551 1624 1126 988 731 568 400 286 23293 467 ----
NM_007078chr1052904 2858 2841 856 136 2901 558 12922 --
NM_007084chr1331490 1328 585 --21041 339 --
NM_007106chr1372833 2571 1814 1088 970 888 666 --12781 --
NM_007107chr3102371 2189 2029 1568 855 844 728 520 396 277 ------
NM_007114chr3112902 2368 2319 1048 987 967 850 531 416 356 69 53228 2277 1022 441 194 12928 --
NM_007118chr5----1277 --
NM_007124chr632029 1799 489 1589 21432 1300 1655
NM_007125chrY51433 1298 1275 518 51 1583 ----
NM_007137chrX115333 5220 5200 5145 4968 4867 4526 1951 812 792 650 --12008 --
NM_007145chr1921255 923 21164 1123 --1111
NM_007146chr1782665 1917 1773 1135 1094 711 606 183 12355 158 32368 621 546
NM_007150chrX52039 723 498 465 219 1750 1210 --
NM_007156chrX----2220 37 --
NM_007157chrX52125 2068 911 681 485 1450 21902 220 --
NM_007159chr3101706 1493 1379 684 674 650 611 237 214 191 ----21771 1635
NM_007170chr13912 880 131 ------
NM_007172chr2273181 2337 1206 988 773 121 113 12730 --11001
NM_007173chr1151973 1806 951 506 315 1724 ----
NM_007174chr1252399 837 752 691 273 12079 ----
NM_007175chr893101 2885 2796 2368 2332 2299 1371 1015 269 --22577 217 --
NM_007187chr1321014 252 1848 1885 --
NM_007191chr122611 464 ----1124
NM_007197chr122294 255 ------
NM_007200chr1564668 4224 4025 3866 2879 1504 14621 13149 --
NM_007203chr973743 3378 3209 2593 1540 1422 715 --33132 2906 2557 --
NM_007207chr11234 --1173 --
NM_007212chr182241 1602 914 906 643 634 407 32 --12040 --
NM_007218chr82610 274 --2877 349 --
NM_007222chr881779 1618 1533 1368 1348 1245 1181 426 1563 21727 1460 --
NM_007235chr122155 50 1543 1421 --
NM_007245chr163970 850 213 ----1814
NM_007246chr43966 819 738 --11067 --
NM_007249chr13169287 8775 8446 8384 7196 6768 6693 6161 3614 3308 3171 2759 2077 1715 893 291 28125 8024 38969 7546 1849 47895 3658 3356 1041
NM_007269chr13569 176 80 ------
NM_007270chr731464 622 404 ------
NM_007271chr681871 1693 1499 1397 1304 381 277 81 --11863 --
NM_007281chr41182 ------
NM_007282chr36852 663 377 285 98 58 2734 652 ----
NM_007285chr161451 ------
NM_007287chr373077 2260 2164 2134 747 684 106 1929 1241 11164
NM_007288chr373077 2260 2164 2134 747 684 106 1929 1241 11164
NM_007289chr373077 2260 2164 2134 747 684 106 1929 1241 11164
NM_007325chrX42114 1973 1604 766 21652 857 1725 11987
NM_007331chr4--180 1794 12495
NM_007345chr18102200 1866 1818 1784 1653 1632 1521 889 857 411 188 ----
NM_007347chr1552573 2391 777 344 312 12120 --1617
NM_007353chr762875 2779 2748 2513 2324 470 ----12521
NM_007358chr121669 216 21551 556 ----
NM_007372chr176852 838 750 324 220 40 ------
NM_007373chr104673 665 442 364 ------
NM_007375chr162566 2391 1981 890 776 388 12612 ----
NM_009585chr32880 30 ------
NM_009585chr32880 30 ------
NM_012062chr123817 808 265 ----1955
NM_012069chrX3821 705 339 1953 21987 223 --
NM_012081chr563121 2483 1223 582 237 93 13747 33769 3012 1494 --
NM_012082chr82328 201 1257 1940 2376 147
NM_012083chr101238 11212 ----
NM_012089chr131596 1124 440 2986 340 1201 --
NM_012092chr241878 1693 1659 99 ----11510
NM_012095chr1022716 196 23322 1288 11310 --
NM_012096chr383082 2809 1429 1266 1083 504 301 161 2975 717 --12682
NM_012097chr242106 1914 1576 111 11523 ----
NM_012102chr152638 2238 547 448 266 32472 1948 1056 12606 11896
NM_012104chr1133449 2538 856 23600 283 23693 3397 1872
NM_012104chr1133449 2538 856 23600 283 23693 3397 1872
NM_012108chr4139 1159 ----
NM_012111chr142215 179 ------
NM_012115chr62565 430 154 --1156
NM_012120chr6122997 2842 2740 2670 2384 1069 1038 958 827 815 678 68 31130 1006 60 22338 2160 22949 670
NM_012129chr771907 1544 849 650 545 468 32 1353 12081 11926
NM_012137chr112010 --12739 --
NM_012141chr13114024 3549 3028 1370 1081 822 767 378 347 285 224 21403 960 34179 3735 3041 11433
NM_012158chr1381821 1682 1499 1395 1280 1155 673 661 ----131
NM_012160chr62362 51 ------
NM_012161chr441176 314 149 109 1136 ----
NM_012164chr9157128 7052 7033 5753 5606 4596 2371 2190 1569 1160 804 514 489 444 29 47542 5618 2826 1973 56607 6457 6189 1188 1142 22597 227
NM_012176chr51243 ------
NM_012180chr45622 550 533 204 184 2118 23 1164 1511
NM_012183chr14609 421 236 134 ------
NM_012193chr11125431 5395 5389 5284 4951 4726 4606 1083 1020 992 868 552 35320 1103 696 25148 389 13552
NM_012197chr931234 1222 83 11559 ----
NM_012199chr174441 4135 3596 1867 1755 1274 725 22843 1855 23634 936 --
NM_012207chr104999 865 332 194 193 2418 72 --
NM_012214chr2155280 5232 5061 4901 4383 3900 2289 2262 2000 1860 1025 845 451 244 201 35199 2029 1731 ----
NM_012215chr1021211 662 --21482 1362 1518
NM_012223chr231194 1116 1050 11325 ----
NM_012224chr451091 910 758 746 285 3965 803 72 2785 323 --
NM_012228chr105977 300 143 75 54 21119 730 ----
NM_012234chr3103342 3307 3294 3067 2953 2668 1403 936 375 167 --22725 132 --
NM_012238chr10101782 1714 1661 1253 1235 1188 1144 480 312 155 2651 51 3542 263 200 1164
NM_012242chr101246 ----1743
NM_012243chr13878 849 75 ------
NM_012245chr141423 ------
NM_012247chr1031056 810 214 ------
NM_012249chr273165 2995 2883 2291 1362 924 844 12336 --13388
NM_012250chr1131039 523 347 --1355 11382
NM_012252chr7175302 5178 5129 4640 4471 4432 4283 3481 3371 3347 2156 2128 2008 1970 955 595 406 33869 1493 496 34694 2042 1516 --
NM_012255chr202479 445 1454 ----
NM_012257chr71865 1238 1756 --
NM_012259chr62901 225 1236 ----
NM_012262chr1144842 4801 4209 4180 4127 3557 3424 3295 3272 2021 1676 1283 1156 570 54715 3209 1601 1114 307 --23990 1085
NM_012281chr772216 2185 1905 845 748 227 137 --51636 1518 872 716 570 --
NM_012286chrX1656 ------
NM_012287chr3184534 4088 3966 3940 3378 3107 3093 3058 3024 2989 2796 2788 1793 1534 1225 1096 504 97 32861 1656 852 44246 4128 1400 440 --
NM_012290chr231276 1212 219 ------
NM_012297chr441676 934 197 66 32248 698 173 12139 --
NM_012300chr5102440 2298 2175 1934 1835 749 613 604 512 359 11960 21018 210 --
NM_012301chr781876 1808 1681 1587 1374 628 290 77 1354 12175 --
NM_012302chr151119 1021 859 301 182 ------
NM_012307chr184959 396 260 97 2784 120 ----
NM_012308chr1172149 2123 1988 1921 1891 1872 1038 ------
NM_012309chr11134565 4496 4475 4016 3359 3178 1945 1926 1803 1436 1225 695 576 13072 ----
NM_012319chr182865 26 1714 1641 --
NM_012327chr1861467 1298 1185 1072 326 169 1493 11270 --
NM_012328chr761435 1391 1274 1251 422 234 21358 326 11208 --
NM_012329chr173671 285 109 1486 11614 --
NM_012330chr1041690 1477 1395 560 ------
NM_012334chr584518 3733 3556 3475 3286 554 304 122 1197 11012 11882
NM_012338chr74878 788 486 252 --1430 --
NM_012343chr531111 461 453 --1742 --
NM_012347chr662998 2950 2439 2239 2224 694 22965 2742 22529 2260 22448 1084
NM_012382chr5114354 4078 3859 1707 1646 1383 1275 1044 612 353 321 13780 34060 2882 931 14295
NM_012388chr1582925 2444 2340 2241 626 522 375 217 22631 504 1324 --
NM_012395chr773363 2613 2124 1162 812 587 530 22081 1353 22994 782 --
NM_012397chr1871803 1726 1683 1618 1456 1234 337 --1710 --
NM_012399chr2251774 1281 746 566 305 1780 ----
NM_012414chr14316 292 278 145 ------
NM_012416chr93987 958 381 --21168 891 --
NM_012417chr171536 ----1145
NM_012419chr61533 ------
NM_012420chr10102111 1893 1555 1490 1476 1469 765 460 421 307 11661 21773 253 2621 560
NM_012426chr161331 ------
NM_012428chr152793 785 ------
NM_012434chr641640 1403 1145 209 1432 1468 --
NM_012454chr61164 ------
NM_012460chr142305 23 ------
NM_012463chr1291738 1547 1495 1341 1334 716 658 573 200 1345 ----
NM_012464chr482888 2731 2359 1863 1824 1113 1089 435 22831 565 12001 --
NM_012465chr10133380 3280 3189 3123 2940 2866 2743 1307 1279 1199 1178 851 788 22205 2091 21079 1041 12729
NM_012471chrX51837 1603 1573 749 604 --21544 49 --
NM_012479chr772501 2358 2280 2265 1935 1747 277 22029 747 ----
NM_012482chr14715 643 125 42 ------
NM_012484chr52538 102 ----1499
NM_013229chr12122777 2719 2247 2206 2190 1954 1723 1036 736 162 81 30 32707 2591 1781 ----
NM_013230chrY51316 1296 463 427 33 --11770 --
NM_013231chr14103689 3431 3259 1625 1389 1294 1103 1078 1007 136 24368 3375 ----
NM_013233chr21170 ----11394
NM_013248chr202285 227 ------
NM_013254chr122717 188 ----1546
NM_013255chr7208742 8439 8122 7830 7542 7121 6965 6505 6372 5917 5716 5691 5569 2424 2046 1987 1875 1364 741 573 48099 5586 3287 2597 --12112
NM_013257chr842124 1712 936 59 21904 356 --1565
NM_013261chr453398 3327 2868 2339 97 63449 3093 2933 1379 929 464 ----
NM_013262chr62568 517 2908 422 11046 --
NM_013264chr11172 ------
NM_013269chr1274506 3731 3184 1457 1297 744 232 24554 3707 14450 --
NM_013281chr2081416 1023 579 477 318 247 154 139 2941 176 11196 --
NM_013282chr1951127 1118 255 209 90 ------
NM_013283chr53871 840 194 ------
NM_013293chr72294 114 --1771 --
NM_013301chr191382 ------
NM_013309chr1572631 2429 2422 1892 429 289 193 12441 ----
NM_013316chr71665 ------
NM_013322chr741393 1185 274 182 167 11505 --
NM_013336chr341936 574 355 114 --1279 --
NM_013341chr272627 2593 1902 1050 634 69 34 11946 11789 --
NM_013352chr63357 200 65 ------
NM_013354chr82351 218 2514 291 ----
NM_013357chr84844 831 743 619 ----1613
NM_013371chr11252 ------
NM_013372chr15103355 3316 2818 2413 2277 2192 2175 2138 1107 324 --22699 832 12293
NM_013374chr372748 2693 2351 1011 961 528 459 12640 3800 413 130 12678
NM_013377chr121150 ------
NM_013381chr1232302 1818 850 --11894 --
NM_013386chr1131629 1614 1601 1303 1257 1133 654 560 429 384 149 59 38 11623 11290 --
NM_013390chr971663 1458 1159 604 426 58 49 1165 --11381
NM_013396chr2121190 395 11528 1102 --
NM_013400chr71904 --11001 --
NM_013417chr92412 169 ------
NM_013423chrX51242 1057 835 516 404 ------
NM_013427chrX51242 1057 835 516 404 ------
NM_013433chr1972036 1865 1827 1819 1630 565 239 ------
NM_013436chr23624 226 112 --1637 --
NM_013437chr82967 408 ----167
NM_013438chr991814 1773 1723 461 410 383 332 236 32 159 ----
NM_013444chrX4997 985 777 467 --11051 11125
NM_013448chr141556 --2741 646 --
NM_013449chr1282928 2489 1943 1887 1830 1824 1183 262 ----12034
NM_013450chr251011 943 422 221 104 ------
NM_013937chr64913 838 372 32 1999 2163 83 --
NM_013943chr1103026 3014 2734 2694 2628 917 340 280 262 239 33158 2991 817 23210 2848 --
NM_013951chr222301 147 11632 11824 --
NM_013952chr222378 224 11709 11901 --
NM_013953chr222378 224 11709 11901 --
NM_013956chr81124 138 ----
NM_013957chr81124 138 ----
NM_013960chr81800 1714 ----
NM_013964chr81124 138 ----
NM_013989chr14145144 4627 4479 4249 4201 3975 3889 3647 3337 3255 3246 1420 1092 536 12011 33780 1641 656 13731
NM_013992chr222378 224 11709 11901 --
NM_013995chrX62088 2068 1629 990 483 174 ----12329
NM_014005chr5112861 2204 2024 1199 1000 983 922 729 698 392 128 1404 136 --
NM_014011chr272635 2342 1601 991 930 701 680 42045 1934 1002 629 11989 --
NM_014016chr331471 609 210 ----1544
NM_014021chr16992 981 782 337 127 97 ------
NM_014023chr1071964 1916 938 780 737 509 336 22539 2481 1521 --
NM_014034chr651383 1244 1037 434 189 1513 ----
NM_014039chr1151392 1281 1098 376 57 ------
NM_014043chr321582 1310 1581 2534 249 --
NM_014048chr1684756 4546 4100 4070 3967 3453 537 189 1264 1930 12128
NM_014056chr3152239 2034 1987 1974 1808 856 816 752 664 597 484 474 405 225 96 --11737 --
NM_014057chr961529 1065 579 493 416 348 ------
NM_014071chr205409 104 87 72 43 ------
NM_014089chr1372185 2067 1670 1383 833 213 141 21652 890 ----
NM_014106chr15102875 2645 2094 1193 967 734 488 454 300 191 12659 --21091 906
NM_014109chr851249 812 348 205 139 --1930 --
NM_014110chr131034 395 86 --11077 --
NM_014112chr8135237 5185 4678 4481 3548 1848 1436 1347 1338 1176 1036 953 61 24619 4061 11028 14656
NM_014117chr1682580 2436 2335 2237 2153 1780 829 549 12165 ----
NM_014141chr765004 4593 4254 3987 1871 1667 25228 4746 1948 13770
NM_014154chr341482 1277 1063 596 1253 11567 --
NM_014155chr11187408 7328 7007 6993 6291 5820 5771 5299 2690 2488 2213 2110 1919 1800 1327 525 401 344 37076 2796 975 25993 4997 25310 1414
NM_014160chr371366 1167 1035 536 103 72 47 1914 ----
NM_014170chr3--181 --1115
NM_014181chr282924 2385 1055 1040 972 666 597 447 22359 1141 32579 1910 1091 --
NM_014212chr122823 625 1996 ----
NM_014216chr141123 ------
NM_014217chr171767 1549 1422 1280 1239 336 45 --21575 358 --
NM_014220chr35814 252 180 84 51 ------
NM_014240chr353427 1125 951 899 829 34062 1186 500 23625 3604 --
NM_014241chr103270 124 83 ------
NM_014243chr461860 1776 1531 778 611 316 ------
NM_014245chr371014 869 699 441 355 309 207 ------
NM_014250chr2252007 1726 857 297 189 --11564 --
NM_014253chrX52153 1583 907 810 787 ------
NM_014263chr1021516 1325 ----11496
NM_014264chr45644 577 215 78 52 --141 --
NM_014267chr114752 614 237 97 ------
NM_014268chr1841473 1397 530 363 1241 --21370 950
NM_014282chr9--1235 ----
NM_014283chr161544 1364 1293 1216 331 273 --2440 411 --
NM_014294chr841003 468 329 194 1443 --1932
NM_014309chr2285309 5223 3312 1680 1468 1273 301 188 --13387 --
NM_014313chr171449 1266 1127 260 233 219 197 11564 ----
NM_014319chr122515 259 --1362 --
NM_014325chr1282080 2073 1877 1483 498 436 268 258 11777 ----
NM_014329chr161293 ------
NM_014331chr4277712 7081 7057 6950 6393 6375 6361 6167 6157 5852 5838 5678 5654 5427 5360 4976 2920 2652 2501 2421 2399 2206 1972 1860 1185 835 95 27129 4785 35992 1217 158 36825 5729 1998
NM_014332chrX1395 ------
NM_014333chr1141761 1029 374 226 1766 --12306
NM_014335chr1551201 1053 939 258 50 11161 11186 --
NM_014344chr111694 1127 ----
NM_014345chr62424 252 ----21046 964
NM_014363chr1341175 818 506 338 176 --1929
NM_014372chr172086 1923 1746 1733 1626 1369 666 --1368 124
NM_014374chr71904 --11001 --
NM_014382chr361730 1636 1616 1395 184 95 1235 ----
NM_014395chr422001 502 --2781 436 --
NM_014397chr931119 552 466 ----11226
NM_014399chr75926 865 753 296 57 ------
NM_014409chr131096 927 883 ------
NM_014411chr71517 ------
NM_014415chr351497 1467 1185 670 538 ----11538
NM_014417chr191922 ------
NM_014421chr4102096 2088 1997 1633 1625 1480 1358 498 431 307 11748 ----
NM_014423chr5224959 4642 4557 4501 4397 3937 3800 3592 3489 2135 2121 2033 1987 1871 1837 1607 1244 1131 1070 778 741 315 55307 5262 4796 4015 1221 13735 --
NM_014447chr461429 1171 588 536 217 133 --1354 --
NM_014452chr641208 377 356 61 1815 1411 --
NM_014456chr10--1697 --1703
NM_014458chr131306 212 171 --11412 11158
NM_014494chr1682251 1973 1839 1638 1614 661 622 564 11801 12218 22125 1903
NM_014495chr13665 547 29 ----1460
NM_014497chr2284 77 ------
NM_014503chr122422 32 ------
NM_014504chr771917 1901 1789 1579 761 502 396 --21549 646 --
NM_014517chr331624 1440 718 --11330 --
NM_014521chr22303 216 1686 11663 11257
NM_014547chr152302 217 2278 32 ----
NM_014547chr152302 217 2278 32 ----
NM_014548chr1541445 1335 405 127 ------
NM_014552chr221303 234 1267 11465 --
NM_014554chr1232291 1749 200 1917 --1631
NM_014572chr1331797 1473 1216 --1316 --
NM_014574chr1451370 1290 1159 536 430 ------
NM_014575chr32167 157 ------
NM_014577chr227806 778 768 730 300 268 78 ------
NM_014585chr221261 405 --1176 --
NM_014586chr2164771 4059 3073 1416 735 549 14414 34879 4146 3449 11765
NM_014587chr1621316 616 --11548 --
NM_014588chr205717 518 262 243 230 ------
NM_014592chr51779 ------
NM_014602chr3194 ------
NM_014606chr421575 1312 21161 325 2392 330 --
NM_014607chr2112098 2087 1934 1788 1699 1673 1408 717 511 385 269 --1442 --
NM_014612chr931218 370 358 1508 ----
NM_014613chr523033 2673 13124 1521 --
NM_014615chr1643345 3312 2318 645 33140 1348 696 13626 --
NM_014616chr3103516 3476 3322 3261 3161 2439 1134 805 370 189 32625 2156 721 21321 97 --
NM_014629chr841321 1260 1252 869 2482 322 149 11349
NM_014630chr1553431 3209 3198 1296 980 ------
NM_014636chr994046 3981 3215 2726 1608 1432 1310 1290 1097 13784 --23711 27
NM_014637chr83910 525 342 ------
NM_014646chr1853074 2960 2934 2923 993 --1680 --
NM_014659chr151150 ------
NM_014660chr721120 839 ------
NM_014662chr221436 ------
NM_014666chr52347 298 11300 ----
NM_014667chr331890 1864 411 1518 ----
NM_014669chr161145 ------
NM_014670chr241607 1450 372 286 --21532 553 --
NM_014671chr731459 1334 210 --11327 --
NM_014673chr82107 65 ------
NM_014674chr3114016 3043 2906 2800 2781 1462 1063 931 551 211 122 23442 2619 ----
NM_014676chr151697 1558 1205 333 182 1603 --11123
NM_014677chr851318 1288 1233 1163 1048 ----11183
NM_014678chr22193 ------
NM_014679chr1131275 1179 987 11407 --1911
NM_014682chr8112242 2054 2033 1990 1948 1668 1510 392 310 181 132 11496 --12045
NM_014683chr1791997 1422 1383 1325 827 726 635 602 497 11827 1101 --
NM_014686chr1931784 956 468 ------
NM_014689chr23174 84 38 ----1133
NM_014701chr15133414 3381 3220 2704 2351 1342 1298 1049 594 505 385 157 134 32164 1291 282 23387 2144 --
NM_014702chr632437 1283 380 12157 63238 3188 2810 2354 606 117 --
NM_014705chr791927 1901 1762 1718 1622 1470 1339 435 94 1209 ----
NM_014707chr752202 1794 1717 671 407 ------
NM_014711chr1662122 1904 1868 1410 1339 486 --21954 1532 21314 445
NM_014717chr193853 746 257 1578 ----
NM_014720chr1071606 1592 1503 1494 610 425 236 21245 642 31624 1431 372 --
NM_014721chr6177489 7376 7358 7224 7065 6057 6043 5794 5761 5534 4975 4856 4705 2066 1923 681 111 37250 6554 858 11372 --
NM_014725chrX11092 ------
NM_014729chr852166 1965 1653 852 627 12106 ----
NM_014730chr12103414 3398 2020 1827 1654 1472 1454 1101 807 703 34620 3491 446 25036 3376 11588
NM_014730chr12103414 3398 2020 1827 1654 1472 1454 1101 807 703 34620 3491 446 25036 3376 11588
NM_014731chr2011278 ------
NM_014732chr1625029 3787 14067 25895 2178 12209
NM_014733chr5102053 1994 1844 1831 1531 753 501 222 210 38 ------
NM_014735chrX62058 1725 1663 1357 670 557 11989 ----
NM_014739chr6124061 3691 3617 3404 3180 3142 1360 1306 1173 450 245 236 34202 3385 1247 13222 --
NM_014746chr254412 3277 2988 1353 1260 23764 119 21508 657 14316
NM_014751chr85672 432 353 196 56 --2759 282 1686
NM_014752chr1181907 1656 1387 519 511 426 317 236 ------
NM_014755chr2103980 3732 3533 1615 1587 1434 1280 1181 1120 459 2856 665 1902 --
NM_014757chr522157 2019 21702 412 12266 --
NM_014761chr163913 67 36 --11019 --
NM_014764chr1241252 1038 346 139 --1272 11145
NM_014765chr182550 2266 2001 991 891 693 537 203 --1777 --
NM_014767chr1033454 2245 67 33717 3121 3105 ----
NM_014774chr193289 3270 3222 2427 2411 2002 1010 525 130 --12710 --
NM_014776chr1251099 1010 446 305 118 154 ----
NM_014787chr162835 1905 819 629 433 217 --1141 --
NM_014795chr281224 1005 955 894 501 431 350 23 1332 11392 --
NM_014797chr662867 2499 2430 1217 882 98 1869 2958 522 --
NM_014800chr721101 155 ------
NM_014802chr1271145 920 787 709 356 300 273 ----1732
NM_014803chr1082871 2649 2459 2441 2297 2147 1971 240 1705 11918 --
NM_014807chr111839 ------
NM_014810chr173385 3096 3054 2892 1100 1007 295 1496 23718 3126 --
NM_014812chr152020 1362 1227 402 130 11507 1578 --
NM_014813chr1146 --1415 --
NM_014819chr542238 2228 856 536 163 --11615
NM_014822chr43420 232 65 1146 1118 --
NM_014824chr1121847 759 ------
NM_014826chr174237 4025 3859 2852 1065 634 290 --11043 --
NM_014827chr131603 650 634 11306 ----
NM_014829chr562314 1844 1789 1571 679 302 12045 21976 560 --
NM_014830chr1253835 2774 2613 913 95 12954 13454 --
NM_014832chr13101969 1759 1594 1448 1296 836 810 747 346 292 21907 309 11674 1505
NM_014835chr2041996 1619 96 52 1209 32237 2179 302 --
NM_014838chr224621 427 299 220 32887 2319 1851 12739 --
NM_014839chr192240 2101 1781 1654 900 888 814 600 331 --1131 --
NM_014841chr651165 1080 929 872 492 41323 531 292 59 2379 125 --
NM_014844chr1434164 4031 2666 24025 1463 --11656
NM_014848chr1562229 2007 971 842 333 121 --2860 731 2716 235
NM_014850chr374279 3959 2993 1693 1075 1050 314 --34921 4065 1316 --
NM_014864chr184359 3895 3384 1341 968 850 739 27 33801 2739 1642 ----
NM_014867chr8113785 3474 3384 3344 3326 3005 2968 1287 1025 550 503 13577 23185 3124 --
NM_014868chr123288 185 84 ------
NM_014870chr154731 3966 3306 155 110 44635 3421 1709 1041 13391 --
NM_014872chr92354 50 ----11598
NM_014873chr154735 4504 4311 1366 715 23927 1892 23263 677 13057
NM_014877chr17197811 7627 7550 7450 6899 6866 6705 6563 6068 2881 2767 2535 2197 2046 1387 742 561 205 157 25229 75 139 27315 3013
NM_014883chr462576 2233 1970 984 654 198 --12212 11793
NM_014890chr32336 282 ------
NM_014893chrY92345 2339 2119 1842 942 698 597 194 112 ------
NM_014897chr1773106 3068 645 594 335 249 118 --21127 731 1293
NM_014899chr583144 3082 2968 2551 2174 996 650 122 --33158 2951 2263 11099
NM_014900chr23327 183 173 3849 233 51 ----
NM_014901chr531981 1858 853 ------
NM_014903chr1252400 2159 2000 1787 632 --1885 1192
NM_014904chr1094055 4002 3934 3793 3358 3310 3050 896 589 33558 1147 809 --32513 818 406
NM_014905chr261883 1666 1372 809 266 234 21489 420 --21822 504
NM_014906chr17113841 3630 3516 3442 3429 3200 2918 2681 2543 654 402 22845 1605 13983 11164
NM_014912chr10113466 3343 2698 2611 2425 2265 1388 837 687 573 263 33049 828 484 --22304 1351
NM_014914chr221172 369 ------
NM_014917chr1----1194 --
NM_014918chr1541310 1156 253 42 --1222 --
NM_014920chr693814 3546 3467 3414 3057 2415 756 313 301 32358 1128 480 ----
NM_014923chr1372039 1899 1753 1515 935 571 281 22104 773 ----
NM_014924chr1463195 3157 2027 1097 522 516 22547 2211 --22406 2093
NM_014926chr311148 ----11084
NM_014932chr381888 1681 1572 707 628 393 251 135 2193 180 11934 --
NM_014936chr651778 1772 1755 947 458 --21854 962 1954
NM_014939chr186603 529 483 215 129 82 --1541 --
NM_014943chr831223 446 342 --21072 786 --
NM_014945chr551860 1455 481 359 270 ------
NM_014946chr2123140 2892 2833 2585 2439 2233 1916 962 939 527 309 189 32408 2147 1037 2815 415 --
NM_014947chr122395 161 ----12845
NM_014949chr11707 --1884 11052
NM_014950chr1471773 1555 1238 675 563 441 121 1305 ----
NM_014951chr1082431 1908 1688 1625 966 549 486 326 1584 31832 987 261 --
NM_014953chr1383445 3317 1115 966 519 484 363 319 44087 1482 660 261 14105 1122
NM_014959chr19102878 2566 2349 2322 2210 2204 1345 1331 438 347 ----13067
NM_014961chr472143 1686 1570 610 593 241 121 11520 ----
NM_014962chr20142779 2693 2450 2249 1114 1108 935 885 824 769 477 338 320 102 42511 2492 2077 695 32669 649 136 --
NM_014969chr141035 907 886 425 ------
NM_014970chr12314 63 ----1321
NM_014974chr104466 262 202 148 --21809 706 --
NM_014978chr1091550 1372 1291 578 556 476 269 145 37 ------
NM_014982chr14164355 4027 3887 3772 3737 3572 3282 1803 1795 1485 1333 1224 1176 1118 563 456 44627 1855 1318 541 24607 359 33864 1250 791
NM_014988chr432571 1760 515 --32738 2549 110 --
NM_014989chr641410 1291 802 672 1265 ----
NM_014990chr1441291 331 324 314 1543 1832 1473
NM_014991chr4103283 3012 2969 2329 2303 2290 1238 1081 1019 959 1485 22316 399 12925
NM_014992chr141559 --1725 --
NM_014997chr741115 982 504 40 --1858 12009
NM_014999chr1251627 1259 1036 663 398 11244 11183 --
NM_015000chr1292682 2610 2586 2430 2366 927 834 798 526 1610 11013 1222
NM_015008chr342966 2477 1303 689 ----21386 436
NM_015009chr32764 324 1285 ----
NM_015017chr14927 844 387 229 1960 ----
NM_015020chr1663568 2762 2694 1249 899 854 13691 22907 1033 --
NM_015024chr811363 11483 ----
NM_015025chr2102668 2608 2493 2464 2220 989 874 697 585 66 1131 ----
NM_015026chr12114349 4269 3304 3085 3051 2974 1645 1577 1362 1284 632 11477 --2835 683
NM_015032chr1372773 2650 2238 2022 848 749 309 12149 21962 21 --
NM_015035chr20146202 5708 5261 4940 4918 4854 4077 2304 1992 1958 1864 1386 385 128 16339 46491 5219 1064 779 --
NM_015040chr2133386 3268 3053 2814 2779 2763 2187 1021 993 553 467 443 318 12892 12230 1671
NM_015042chr1542872 1455 1413 605 23711 35 --13424
NM_015046chr972637 2631 2464 1902 1775 1106 499 22220 412 ----
NM_015049chr283327 3256 2968 2225 1186 991 954 82 ------
NM_015051chr993027 2064 847 773 701 656 556 308 135 1801 1924 --
NM_015052chr731063 1025 1007 11333 1443 --
NM_015055chr1152901 2882 2212 1104 1014 12694 1901 11845
NM_015057chr131589 1579 ----
NM_015059chr1573962 3084 3008 2483 1552 1542 864 11117 ----
NM_015063chr1921410 280 --21261 1131 --
NM_015064chr1263254 3106 2928 1424 172 163 2472 232 ----
NM_015068chr773741 3516 3198 2886 1242 453 56 1579 22534 1474 13916
NM_015071chr5116546 6446 6174 6041 5201 5157 4839 4239 4127 2389 2249 36285 5442 1613 --1916
NM_015073chr1911948 ------
NM_015074chr1114791 4279 4193 4037 3768 3609 3592 3535 1426 756 479 33437 3058 797 --11860
NM_015076chr6104555 4348 4109 3382 3311 2901 1175 885 682 175 23501 3119 34472 1004 237 --
NM_015080chr1121011 368 ------
NM_015082chr572632 2564 2074 1904 1888 1878 520 ------
NM_015087chr1362724 1988 1806 1077 581 417 11794 1129 --
NM_015090chr166125 6067 4918 4046 1795 352 35557 954 851 1368 --
NM_015092chr16114582 4542 4420 4358 2997 2968 2950 1330 1213 1183 773 1553 ----
NM_015093chr641794 1229 736 371 21730 486 11610 --
NM_015097chr372218 1987 1930 559 502 257 250 --1184 11702
NM_015100chr161922 1906 537 258 145 115 ------
NM_015101chr182442 2143 2134 1127 1062 684 463 199 1862 12000 --
NM_015107chrX42422 2370 2320 1954 1627 ----
NM_015110chr962233 2064 893 584 472 430 1859 11754 22455 361
NM_015115chr473166 2456 2056 962 677 485 343 --33025 764 511 --
NM_015116chr1371549 1320 1282 644 596 170 89 1512 11305 --
NM_015124chr2232501 2463 2386 --12291 --
NM_015132chr721217 381 1779 ----
NM_015137chr8102572 1933 1918 1862 1741 1639 989 968 296 212 --22525 175 --
NM_015138chr1572820 1839 1068 980 960 828 577 12081 21805 790 --
NM_015141chr362764 2181 2146 1776 307 291 22680 1073 22604 465 --
NM_015143chr4------11236
NM_015144chr1663889 3745 3144 2511 1087 696 11258 23425 762 23837 1565
NM_015149chr131676 686 526 1501 --12067
NM_015153chr62787 763 --1739 --
NM_015155chr1053338 3297 2831 1315 666 12910 11327 --
NM_015156chr1483514 3425 3406 2750 1300 1279 730 690 23203 337 12683 --
NM_015161chr1681426 1204 1136 1023 616 359 283 240 --21156 439 --
NM_015163chr1451921 1733 1340 353 294 --1395 --
NM_015170chr832377 1727 563 21763 637 21788 833 12127
NM_015172chr171564 1478 1443 1329 1251 1211 296 11461 ----
NM_015173chr451678 1584 731 616 246 1349 ----
NM_015176chr191790 1773 1685 1364 1198 532 288 100 47 11181 1253 --
NM_015178chr822691 709 12308 ----
NM_015185chrX62884 2426 2201 792 472 24 --22605 262 --
NM_015192chr2053042 2999 2207 540 291 --11962 --
NM_015199chr3102985 2856 2803 2702 2435 2415 856 692 254 183 138 22310 2206 --
NM_015200chr462540 2391 732 528 472 55 --1345 --
NM_015206chr1553613 3115 1493 1233 190 --12835 11277
NM_015208chr18102677 1502 1279 1082 860 788 728 696 518 445 13158 13508 --
NM_015209chr142067 1691 904 800 ------
NM_015215chr173209 2584 2345 805 614 224 218 11282 12745 --
NM_015216chr561321 1213 1192 1131 386 24 11170 ----
NM_015225chr953082 2916 2455 2279 126 1600 22627 561 --
NM_015226chr1653451 3310 1366 908 487 ------
NM_015231chr112942 196 1769 1692 --
NM_015233chr1342176 651 457 270 2400 285 32228 2082 504 --
NM_015236chr441427 1416 1054 977 1247 ----
NM_015238chr51453 ------
NM_015245chr642571 578 307 253 12209 --12086
NM_015247chr16135335 5135 5071 4985 4289 3941 3833 3291 1374 1255 1202 876 435 24946 1025 ----
NM_015250chr931919 510 117 ----21750 1469
NM_015251chr1642309 1980 592 344 11989 1121 --
NM_015252chr23976 225 89 ----1194
NM_015254chr8103196 3156 3104 3033 2980 2028 1994 1235 966 23 --11088 --
NM_015256chr5------1518
NM_015263chr1531237 463 293 --11126 --
NM_015265chr272648 2641 2495 2462 934 834 690 ----12323
NM_015267chr1222163 2084 ------
NM_015268chr31299 ------
NM_015269chr12497 173 1441 ----
NM_015271chr4224251 3714 3502 3439 3106 2857 1724 1625 1571 1468 1320 1238 870 718 607 369 355 285 172 162 148 119 23565 3062 23842 3397 --
NM_015272chr1641863 1804 1524 253 --12016 1439
NM_015275chr1262193 1986 1961 1492 328 54 1732 11601 1574
NM_015277chr1841391 752 628 599 ------
NM_015278chr673476 3243 2620 2405 2337 1156 954 ------
NM_015285chr1832401 1869 561 12258 ----
NM_015286chr1552304 2035 279 146 67 1613 --1867
NM_015291chr193469 3414 2835 2162 1195 1026 859 780 478 22553 1364 32944 2169 2139 --
NM_015294chr174924 252 135 24 ------
NM_015296chr1331183 1153 1145 11033 ----
NM_015299chr1473938 3790 3552 3312 2812 1478 227 --21584 219 --
NM_015308chr114607 168 117 21 --1345 --
NM_015310chr8168045 7668 7503 6479 5298 5198 2796 2631 2316 2109 1229 1171 741 643 342 123 98436 8410 5430 5411 2406 2365 2086 1480 542 37701 2849 1297 36932 5705 5085
NM_015313chr11124533 4180 4047 3968 3890 3324 1905 1612 1455 1429 1151 381 13734 14365 21269 353
NM_015317chr242272 1097 127 30 --1788 12783
NM_015319chr121479 1490 ----
NM_015320chr2------11042
NM_015323chr661582 1568 1410 1391 1321 269 21155 1104 11686 --
NM_015326chr142839 2228 624 78 22985 88 ----
NM_015328chr742559 1187 1102 874 --12829 --
NM_015335chr1292470 2428 2270 1865 1676 639 613 229 214 21984 591 --1552
NM_015336chr1271969 1924 1709 806 637 264 223 11067 --11874
NM_015339chr203991 832 817 ------
NM_015344chr852171 2066 1708 1696 34 21368 709 ----
NM_015349chr642810 2354 2288 1069 42230 2144 1085 726 --1778
NM_015352chr2033926 358 248 13756 ----
NM_015355chr1771804 1608 1254 758 718 569 513 11264 ----
NM_015359chr892920 2482 2372 2315 2205 2018 964 380 283 11108 11856 --
NM_015361chr25909 899 803 127 77 --1261 --
NM_015365chrX113835 3626 2625 1538 1410 1254 1247 1158 1073 242 133 32934 949 637 23520 2753 --
NM_015375chr144819 4130 3671 479 13635 --24576 1680
NM_015378chr153016 2152 269 214 175 --1666 --
NM_015382chr145769 744 549 316 286 ------
NM_015385chr1043116 2778 2013 2004 13269 12739 12982
NM_015387chr271671 1618 1413 1358 1338 1308 574 --2457 97 --
NM_015393chr4113866 3660 3578 3474 3188 2929 2558 1339 557 384 164 ------
NM_015394chr1262296 2234 2082 1631 715 35 ------
NM_015396chr321411 1393 21195 494 21350 187 --
NM_015397chr971927 1806 1787 1734 1614 1488 1267 1553 137 --
NM_015412chr382355 2343 2126 958 809 630 317 309 32474 1995 1157 32804 2772 976 22956 935
NM_015423chr1151744 1414 1246 150 123 --31189 707 479 11535
NM_015431chr1113475 3334 3010 2896 2642 2489 1286 650 607 305 195 ------
NM_015435chr81304 1491 11176 1990
NM_015436chr4103211 3196 3089 2864 2281 2145 1233 1155 391 372 12662 --32979 2563 2532
NM_015442chr31211 ----1195
NM_015446chr151684 1321 1054 426 89 31631 1314 203 ----
NM_015455chr573210 2926 2887 2875 2572 1307 898 13112 21483 860 --
NM_015458chr8105307 5077 4484 3750 3332 1611 1411 1068 950 833 --35133 4570 4262 --
NM_015460chr371998 1898 1855 1489 1365 531 319 2797 179 22065 1688 --
NM_015461chr182165 77 ------
NM_015462chr17----1289 --
NM_015463chr24821 789 731 626 --1338 --
NM_015469chr92664 115 ------
NM_015474chr202436 102 --1143 --
NM_015475chr21300 --1866 --
NM_015477chr1541000 778 215 24 --2862 336 --
NM_015483chr721149 850 1229 ----
NM_015485chr12325 313 ----1135
NM_015496chr82301 237 ------
NM_015497chr156937 904 761 405 296 213 ------
NM_015508chr351470 1291 1280 571 323 --1578 --
NM_015509chr1231383 436 350 1411 2342 132 --
NM_015520chr362671 2661 2126 1860 1099 166 11772 ----
NM_015525chr641078 785 343 174 --3388 328 125 1200
NM_015530chr21784 --1895 180
NM_015532chr1572854 2616 2504 1050 600 162 102 21131 985 22091 310 --
NM_015535chr264161 3819 1437 1041 174 162 33486 2979 574 21585 1316 32939 2711 785
NM_015548chr63944 785 164 ------
NM_015549chr142450 202 ------
NM_015550chr7133590 3448 3210 2845 2712 2470 2368 1305 926 767 444 302 118 1173 12236 --
NM_015553chr695079 4981 4929 4474 4183 3883 1805 1227 119 11352 14623 11608
NM_015554chr1541088 1043 910 482 12095 1516 --
NM_015564chr5123506 3249 3156 1306 748 726 486 461 208 155 104 76 1512 23214 3192 --
NM_015565chr2141996 1952 770 202 1591 1261 1174
NM_015567chr1331310 165 134 1476 ----
NM_015568chr2094140 3772 3431 2982 2661 1695 1029 990 752 13476 14188 --
NM_015569chr1154410 4386 4325 3354 2996 2988 1900 1677 1543 1478 1199 938 677 616 556 14160 21490 778 11485
NM_015571chr6102547 2453 2440 1818 1762 1682 583 325 278 46 22014 743 1140 --
NM_015575chr243664 3493 945 776 32961 1219 972 2691 555 1923
NM_015576chr352576 2216 2168 804 429 12388 ----
NM_015577chr541807 1319 1203 148 21567 192 2452 119 --
NM_015578chr1951503 677 649 497 34 11706 31367 592 247 1155
NM_015601chr1041030 937 798 331 --1365 --
NM_015602chr151806 1785 1720 1583 349 --21340 461 --
NM_015605chr1061514 1308 1121 1077 41 23 --2569 254 11476
NM_015610chr752477 1934 1028 220 80 32535 1066 489 ----
NM_015626chr173934 410 112 ----173
NM_015630chr241129 1050 448 397 ------
NM_015633chr1231112 459 24 2954 409 --1861
NM_015640chr1185299 5238 5143 4672 4309 4128 3514 3450 1936 1759 1721 1551 1185 1088 534 482 243 162 13307 24942 2105 13586
NM_015657chr24947 892 418 297 ------
NM_015659chr1653232 3097 2748 2166 867 --12996 --
NM_015670chr172354 139 ------
NM_015675chr191647 ------
NM_015678chr1341560 1292 647 509 ------
NM_015695chr682113 2020 1798 1540 1482 1448 759 96 ------
NM_015696chr12483 448 ------
NM_015704chr221126 ------
NM_015833chr2162299 2172 1899 773 738 378 --1865 --
NM_015852chr7103667 3057 2892 2878 2699 1453 1350 1091 665 77 21303 1270 23144 3042 22953 2403
NM_015866chr121545 1230 1959 ----
NM_015872chr131830 1105 310 ------
NM_015878chr892168 1890 1839 1396 1371 721 587 275 79 11875 21968 1734 21423 426
NM_015879chr18168267 7810 6537 6223 6143 5775 5729 5556 3359 3303 2948 2787 2515 2464 1890 546 37719 6517 5763 26108 624 --
NM_015886chr8135727 5594 4642 4262 3846 3815 3547 1982 1032 931 535 496 194 44765 1396 1144 595 13714 --
NM_015888chr1183235 2949 2804 2430 2351 2296 2280 1330 1069 915 743 658 590 477 339 330 164 151 13395 1886 22235 280
NM_015891chr641423 630 216 86 21713 169 --1157
NM_015902chr85684 609 260 216 158 1379 ----
NM_015905chr7170 ------
NM_015906chr1104630 4423 4109 3636 1901 1154 997 420 139 80 24292 663 33543 3039 693 --
NM_015912chr862499 1937 609 379 372 204 1100 --12124
NM_015913chr12586 552 2794 783 ----
NM_015941chr82117 101 --1134 --
NM_015949chr7--1965 ----
NM_015954chr122488 127 1389 2415 233 --
NM_015955chr21125 ----1167
NM_015957chr113350 310 108 --1273 --
NM_015975chrX21167 417 --3531 522 350 --
NM_015981chr563213 3125 2274 1221 868 811 1180 ----
NM_015984chr11156 --1532 --
NM_015986chr1731341 509 103 1163 1556 --
NM_015995chr1565450 5330 5239 4280 3605 1077 24592 173 24019 1958 --
NM_015999chr15582 570 522 171 33 1138 157 --
NM_016002chr13735 156 49 1169 ----
NM_016003chr752477 1934 1028 220 80 32535 1066 489 ----
NM_016009chr1104924 4301 3910 3755 3226 1386 1064 420 253 36 43173 1961 1826 1564 14792 13203
NM_016018chr872701 1103 1081 1075 973 509 84 32759 1024 168 11837 --
NM_016021chr6123046 2736 2682 2632 2529 2062 1189 1038 851 549 512 249 12618 1461 12642
NM_016023chr8101987 1966 1884 1840 1752 1367 705 577 380 355 21904 167 ----
NM_016025chr163805 507 493 31714 737 334 11698 --
NM_016035chr91128 ------
NM_016037chr13944 294 221 ----163
NM_016040chr182556 893 875 732 534 484 366 128 --22103 267 12300
NM_016045chr2091851 1835 1437 1429 1318 1228 635 339 144 --21588 653 --
NM_016059chr63956 353 53 --1891 --
NM_016060chr1731127 797 144 ------
NM_016061chr251350 675 628 396 227 --11429 1437
NM_016072chr1271895 1747 1591 883 807 547 96 --2955 643 --
NM_016073chr1531141 785 417 ----1212
NM_016076chr132487 703 188 --23095 2884 --
NM_016078chr1731097 988 793 21115 126 ----
NM_016081chr462045 1802 1646 1484 899 440 ------
NM_016083chr683904 3470 2733 1163 854 831 631 344 21265 697 13194 33804 589 99
NM_016090chr113944 415 334 1834 ----
NM_016093chr52151 69 ------
NM_016096chr851942 1357 867 848 532 11441 31592 674 355 --
NM_016103chr54432 198 145 74 --1473 --
NM_016106chr141133 1195 ----
NM_016107chr531325 1075 385 1938 2855 273 --
NM_016120chrX2972 259 ------
NM_016121chr11198 4113 93 65 55 ----
NM_016131chr2122043 2000 1885 1833 1657 881 676 629 531 501 179 168 ------
NM_016132chr15133090 2872 2569 2270 1301 1245 1143 1119 665 380 360 162 110 --12622 --
NM_016133chr2101601 1533 1200 642 598 545 527 468 294 223 21423 78 11063 --
NM_016141chr33775 267 242 ------
NM_016152chr33246 192 173 1898 ----
NM_016156chr1162062 1964 1896 1665 895 519 --11934 1956
NM_016200chr75769 750 584 252 197 ------
NM_016206chr3298786 8615 7797 6947 6769 6379 6193 6114 6073 5671 5581 3305 3286 3098 2924 2604 2185 2017 1987 1758 1732 1681 1591 1567 1381 972 833 798 725 21796 1485 68860 7265 6540 5772 3356 2174 28957 3497
NM_016216chr31195 ------
NM_016217chr673218 2884 1281 1023 748 566 101 1882 43343 3061 367 90 22782 1291
NM_016220chr7102210 2074 1881 1765 1468 844 825 370 266 97 1798 --11922
NM_016224chr64352 318 69 46 --12225 --
NM_016227chr161544 1364 1293 1216 331 273 --2440 411 --
NM_016231chr1741229 660 97 40 --1570 11459
NM_016235chr16131 ------
NM_016248chr13113878 3848 3292 3246 3114 3023 2893 541 465 382 131 23923 3400 1568 --
NM_016252chr22629 182 ------
NM_016255chr683327 2984 2918 2739 2612 2514 1068 784 1338 --1615
NM_016258chr11640 1146 --2106 97
NM_016260chr2247651 7566 7465 7057 6762 6608 6508 6456 5737 5726 5393 5328 4981 4946 4938 2921 2324 2306 2234 1302 1207 1188 845 617 23039 2899 26060 832 32560 1539 427
NM_016262chr64575 544 459 77 ----2201 34
NM_016271chr18122115 2086 1937 1711 1525 1503 1476 803 657 578 203 84 22266 161 11773 1685
NM_016275chr3102796 2669 2651 2032 2013 1986 1055 986 494 230 --2842 309 11895
NM_016277chr651594 1328 398 232 210 1266 11461 --
NM_016281chr122288 201 ------
NM_016287chr141782 1286 628 164 1461 1212 --
NM_016289chr282341 2310 2198 2059 1948 814 687 553 ------
NM_016298chr35781 319 290 211 171 12818 ----
NM_016300chr31421 ------
NM_016306chr31116 1331 ----
NM_016308chr151918 1325 434 392 303 1424 --1201
NM_016312chr121547 ----1115
NM_016315chr281532 1292 1242 1236 1200 663 170 143 2723 517 2545 381 --
NM_016316chr23665 108 100 ----1742
NM_016322chr9102988 2835 2745 2693 2526 2512 1217 601 498 358 22784 306 ----
NM_016328chr7153 ------
NM_016333chr162514 458 ------
NM_016338chr51205 21067 299 ----
NM_016351chr72418 48 ----1548
NM_016356chr662575 1887 944 501 466 352 31136 1095 1044 --1162
NM_016357chr1251280 1183 948 472 108 --1124 1203
NM_016374chr151429 1378 1090 337 135 11327 ----
NM_016374chr151429 1378 1090 337 135 11327 ----
NM_016376chr1784079 3590 2725 2685 2658 1278 1122 336 13892 13201 --
NM_016377chr651611 1581 661 273 73 ------
NM_016396chr1572772 2562 2486 2463 2242 2109 1851 2879 514 13023 --
NM_016422chr1182333 2015 923 885 671 641 539 162 12033 --23023 575
NM_016427chr184363 266 105 80 ------
NM_016436chr2072701 2021 1957 1881 781 376 58 41837 903 822 280 11820 3580 465 115
NM_016441chr261875 1854 1797 928 915 110 11840 22296 1656 --
NM_016442chr5102333 1979 1765 1646 1504 927 536 520 205 171 --21517 79 --
NM_016447chr72206 196 --1216 --
NM_016451chr112310 38 ------
NM_016467chr261416 1293 1111 1100 327 43 ------
NM_016472chr1441458 1294 426 415 11366 --11447
NM_016480chr54763 594 359 39 2800 340 1609 --
NM_016485chr621974 531 1574 22074 404 --
NM_016486chr11333 ------
NM_016499chr111491 ----1542
NM_016500chrX1277 ------
NM_016507chr1742924 2915 2544 433 12597 12057 --
NM_016513chr693814 3546 3467 3414 3057 2415 756 313 301 32358 1128 480 ----
NM_016522chr1121645 586 ----1656
NM_016530chr1584105 3281 2624 1390 1044 817 757 576 ----13532
NM_016531chr484162 3156 1367 1099 1035 644 147 102 31671 821 561 ----
NM_016536chr191135 ------
NM_016542chrX31571 1377 1087 31779 1652 393 1203 --
NM_016545chr1--1656 2917 217 --
NM_016557chr35934 838 818 712 283 1369 1942 --
NM_016559chr351489 1393 968 613 478 182 1524 --
NM_016562chrX21083 1027 21348 1335 ----
NM_016569chr1231319 1311 285 31565 977 474 ----
NM_016578chr114172 111 81 28 1128 --1241
NM_016588chr64892 678 309 294 ------
NM_016599chr451450 1126 1079 576 222 1143 ----
NM_016603chr541811 1471 352 320 2734 312 11771 --
NM_016604chr531273 1068 885 ----11255
NM_016605chr532655 1972 1911 1323 11896 1688
NM_016614chr6149 ------
NM_016617chr1351938 1925 1792 435 302 1556 12130 1754
NM_016625chr31164 --177 --
NM_016626chr1861798 1691 1586 611 585 80 --1514 --
NM_016630chr152517 207 1594 ----
NM_016631chr2111042 1666 ----
NM_016644chr5133 --1371 --
NM_016654chr1521115 1034 2540 166 21075 326 --
NM_016656chrX2419 153 ----1403
NM_016824chr1091611 1200 627 616 562 506 462 387 157 --21721 580 --
NM_016834chr1754054 3875 2783 2545 1650 2202 171 --13328
NM_016835chr1754054 3875 2783 2545 1650 2202 171 --13328
NM_016841chr1754054 3875 2783 2545 1650 2202 171 --13328
NM_016931chr11149 ------
NM_016940chr212438 83 ------
NM_016946chr163271 2816 2649 2584 2257 1337 11346 1287 --
NM_016950chr441461 1428 346 290 1159 --11356
NM_016952chr1183763 3434 3335 1536 1369 1024 852 738 23886 34 12878 --
NM_016953chr2165548 5521 5373 5197 5065 4699 4144 4121 4079 4003 1713 1191 1167 937 509 469 25443 3948 35936 4918 1210 23828 1882
NM_017409chr121814 1641 1782 --
NM_017412chr831427 1235 333 1394 ----
NM_017413chrX42366 2000 1596 250 ------
NM_017415chr5124575 4272 3917 3540 3531 2991 1807 1645 1517 1454 588 134 21624 1411 14561 --
NM_017420chr1443468 2785 751 213 23856 625 --11080
NM_017423chr471644 1544 685 443 408 264 215 1529 21697 1359 --
NM_017437chr1442156 1907 845 602 11693 ----
NM_017440chr122654 44 --3246 176 121 --
NM_017444chr851894 1872 1812 1243 347 --1318 --
NM_017447chr21114414 4355 4111 3979 3757 3658 3344 3252 1498 347 60 21371 1064 33496 664 630 1815
NM_017452chr2061450 1370 1033 965 500 81 ----11503
NM_017453chr2061450 1370 1033 965 500 81 ----11503
NM_017454chr2061450 1370 1033 965 500 81 ----11503
NM_017455chr152793 785 ------
NM_017489chr871175 1154 1058 528 367 93 85 1428 ----
NM_017491chr41805 ------
NM_017519chr64909 504 348 163 21185 394 ----
NM_017522chr131328 1030 540 --11021 --
NM_017548chr35837 771 656 589 381 1365 12048 --
NM_017553chr1541335 1137 1102 21 ------
NM_017554chr351546 1385 197 151 70 1638 ----
NM_017563chr3136384 6305 6105 5333 5080 4831 4670 4153 3956 2529 2149 1072 364 55560 5261 4858 4097 346 ----
NM_017577chr361693 1093 1081 548 264 226 ------
NM_017580chr1042349 1769 242 225 1193 31926 1749 538 --
NM_017581chr4195 ----1133
NM_017588chr921978 277 ------
NM_017599chr1261939 1741 1727 1709 1602 601 21507 1410 --160
NM_017610chr1562070 1628 1517 1353 409 79 ----1803
NM_017612chr12----137 1526
NM_017617chr93581 232 139 ------
NM_017628chr4155164 4815 3659 3541 2111 2097 2080 2000 1989 1301 1145 1048 983 873 722 42068 513 312 99 32090 1892 1366 --
NM_017629chr151540 1200 528 494 275 ----196
NM_017633chr673549 3117 2793 2764 2702 2599 342 ----13508
NM_017634chr881952 1437 1284 753 719 485 368 171 31539 764 445 ----
NM_017635chr1151307 1297 1267 379 284 ------
NM_017637chr9159436 9309 8474 8215 7502 6864 6802 3321 2839 2770 1912 1380 998 597 454 57225 5915 5904 2208 479 59208 6752 6406 2002 585 17304
NM_017641chr1241079 1057 842 798 ------
NM_017643chr1792966 2634 2572 2214 2172 1026 1009 872 460 --53085 1910 1251 1182 300 --
NM_017644chr3185152 4581 4512 4407 3827 3293 3215 1908 1803 1554 1479 1318 803 587 505 397 196 122 32090 1718 75 11524 --
NM_017650chr7146042 6023 5808 5763 5069 4462 4391 4088 2400 2226 1984 1224 267 178 11323 34744 2284 462 --
NM_017655chr181622 1504 1435 1384 561 347 153 144 11311 --1111
NM_017657chr24962 942 932 311 1919 ----
NM_017658chr1494233 4222 3349 3017 1594 1423 876 855 108 14666 ----
NM_017661chr1541166 1049 966 344 1993 ----
NM_017664chr134915 364 137 120 ------
NM_017666chrX102244 1924 1635 1624 1473 1466 899 808 684 271 --32144 1851 346 22259 1860
NM_017667chr74528 194 168 106 ------
NM_017672chr1571175 1169 1124 1051 863 521 283 --1243 --
NM_017693chr1351626 1368 1334 450 346 21245 250 ----
NM_017694chr242032 1323 282 193 1587 1372 --
NM_017709chr1104070 3750 3374 3367 3337 1334 1250 1132 715 511 23641 3272 11090 12983
NM_017719chr351655 1012 691 231 216 ------
NM_017730chr32515 155 2570 490 ----
NM_017736chr1663065 2464 2258 1202 1108 290 1630 ----
NM_017737chr132132 2121 1457 --31558 1388 613 1150
NM_017738chr93894 470 39 ------
NM_017742chr1851632 1569 1234 749 231 ----11516
NM_017745chrX3563 550 179 ------
NM_017747chr51349 ------
NM_017754chr6155019 4600 4152 4049 3932 3224 3074 1917 1364 1276 1242 991 764 640 434 34812 4796 3544 14544 13338
NM_017762chr1582427 2300 2191 1844 1793 658 612 43 2760 590 --42278 694 576 96
NM_017769chr1492776 2657 2644 2628 2303 2105 2057 372 28 12545 2213 105 11207
NM_017770chr652530 2220 1057 538 232 --1101 22426 1841
NM_017774chr62383 100 ------
NM_017778chr81257 1273 11095 --
NM_017779chr142568 2558 993 39 --21804 891 --
NM_017784chr341169 1096 884 775 11004 ----
NM_017791chr1461688 1641 1258 393 385 295 ------
NM_017798chr203931 893 38 2876 336 ----
NM_017799chr1451814 1805 672 605 39 --21826 254 --
NM_017810chr165698 600 566 209 89 --1738 --
NM_017811chr973039 2993 2758 2491 2101 1911 1158 1466 13077 --
NM_017813chr8144787 4631 4594 4532 4278 4141 3953 3759 2255 2105 1753 985 455 112 55385 5088 4386 1296 67 54948 1120 1102 793 638 21881 404
NM_017822chr123533 223 40 ------
NM_017824chr1062679 2644 2560 2190 680 428 12496 12669 --
NM_017831chr18114630 4371 4149 3996 3244 3218 1826 999 966 916 165 ----14550
NM_017832chr91348 11173 1900 --
NM_017848chrX114319 3770 3240 3020 2923 1551 1129 610 546 354 45 34557 4298 172 13386 14147
NM_017849chr262900 2830 2650 2585 2440 535 ------
NM_017851chr1541224 798 440 53 ------
NM_017866chr831082 768 103 1917 1127 --
NM_017880chr2136 163 ----
NM_017890chr821705 423 1499 ----
NM_017902chr1085572 4152 4074 4042 3639 1389 1205 319 24026 194 25501 5200 15580
NM_017905chr132642 572 --1545 1562
NM_017906chr63250 98 65 ------
NM_017910chr24132 119 110 26 157 ----
NM_017915chr123995 739 65 ------
NM_017919chr9115761 5434 4583 4434 4410 4396 3899 3600 2269 893 580 35030 3614 649 25323 1541 14721
NM_017935chr43699 666 568 1127 1278 --
NM_017938chrX31899 1763 444 --11529 --
NM_017943chr141746 ------
NM_017944chr1173059 2192 1945 1249 1033 370 303 --11069 12247
NM_017948chr9--194 ----
NM_017953chr171183 1122 1041 760 293 178 33 --1359 --
NM_017954chr751484 1244 497 468 295 11318 ----
NM_017958chr252554 2382 2146 397 325 12683 2412 30 --
NM_017987chr1061932 1825 1607 1365 542 404 1373 12025 11854
NM_017988chr123915 839 164 1955 2798 296 --
NM_017994chr762975 2855 2760 1962 1954 1841 12177 11155 --
NM_017998chr961425 994 965 573 456 395 --11120 1546
NM_018011chr133122 100 44 ----158
NM_018014chr261337 1155 1143 967 909 443 ------
NM_018015chrX3344 278 211 --2358 269 21007 78
NM_018025chr19------1188
NM_018028chr19----21311 145 --
NM_018030chr181198 ----1323
NM_018036chr14184349 4273 4187 4146 3680 3597 3239 1435 1428 1344 1215 1180 664 392 384 167 136 89 43377 1296 1290 70 31733 1253 746 1733
NM_018037chr12257 250 --132 --
NM_018048chr1251857 1662 1609 1335 455 --11808 --
NM_018051chr71125 ------
NM_018078chr441005 957 910 783 ------
NM_018084chr293020 2790 2495 2342 2309 1317 1261 864 750 ------
NM_018086chr241743 1479 1182 184 --21617 584 1429
NM_018092chr1651285 1121 1095 1066 428 11185 11614 --
NM_018094chrX2301 92 1121 ----
NM_018098chr361209 907 289 260 221 66 11088 ----
NM_018105chr8----1441 1180
NM_018112chr961058 792 772 739 154 68 ------
NM_018117chr104777 563 299 290 ------
NM_018120chr821329 1227 21140 955 ----
NM_018121chr1082853 2689 2395 2149 1179 889 444 395 12702 1527 --
NM_018126chr481576 1436 1342 1312 1139 1001 436 114 --1298 1476
NM_018131chr104867 859 669 57 1719 ----
NM_018132chr6136 --1534 --
NM_018133chr351946 828 382 266 80 ------
NM_018137chr111330 2544 420 --21289 153
NM_018142chr81206 ------
NM_018151chr24727 562 524 143 2737 87 ----
NM_018155chr3133439 3267 3141 3060 2512 2488 1291 1190 1066 963 901 778 330 12567 43347 2728 2679 388 --
NM_018156chr153016 2152 269 214 175 --1666 --
NM_018157chr1253194 3109 2087 1990 446 21240 607 12071 1989
NM_018169chr123465 168 39 ------
NM_018176chr441638 1047 364 140 11513 1236 --
NM_018178chr161913 1849 1425 769 502 452 21790 143 ----
NM_018179chr12137 ------
NM_018181chr182493 435 11693 1220 --
NM_018184chr372187 2052 1921 1594 1478 419 402 ------
NM_018195chr1132145 610 454 12169 ----
NM_018196chrX21359 266 155 ----
NM_018197chr201261 ------
NM_018199chr1441124 1101 966 319 1490 --1819
NM_018200chr1552629 2566 2078 601 196 --1368 --
NM_018202chr12729 275 1215 ----
NM_018206chr161702 ------
NM_018211chr151683 1475 1406 847 234 11670 31743 1701 665 172
NM_018214chr631174 1159 1106 ----1223
NM_018221chr23420 394 382 192 ----
NM_018227chr483003 2748 1056 662 385 375 227 120 --22914 1229 --
NM_018230chr14572 486 477 188 195 ----
NM_018237chr102249 219 ------
NM_018241chr441013 855 801 185 ------
NM_018243chr494002 3760 3744 3614 3033 1281 1096 947 353 13184 ----
NM_018244chr2061299 1062 1049 902 475 306 11343 ----
NM_018246chr872520 2318 1978 1949 1067 720 221 32642 1987 510 1739 --
NM_018247chr692492 2215 1251 1126 950 571 416 299 63 23152 2290 42595 996 165 115 --
NM_018254chr182042 1604 1597 1500 790 766 442 380 22080 894 131 32381 2278 2086
NM_018266chr32994 952 1980 ----
NM_018270chr203822 654 630 ------
NM_018272chr12--2249 200 ----
NM_018279chr1262844 1201 774 703 494 62 --12371 --
NM_018287chr1031195 375 308 1258 11311 --
NM_018290chr461019 905 511 300 266 56 ------
NM_018293chr3102743 2616 2449 2423 2300 2285 2052 1114 542 101 ------
NM_018299chr862978 2446 1295 1037 835 706 180 63415 3215 3044 2301 893 325 --
NM_018302chr421931 870 11675 1653 1504
NM_018307chr171887 1775 ----
NM_018312chr1121727 515 --22116 370 --
NM_018313chr342146 1908 193 101 1880 12581 --
NM_018314chr115518 298 210 183 150 --1773 --
NM_018315chr441593 1496 1102 439 ------
NM_018317chr43283 229 92 1340 ----
NM_018318chr122601 168 1298 ----
NM_018323chr461799 1640 1221 637 264 176 1413 1322 1472
NM_018328chr2--1342 ----
NM_018339chr961784 1642 1530 1345 1333 738 ------
NM_018342chr481736 1699 1632 1492 1158 1085 542 201 --11681 --
NM_018348chr16277 43 127 3954 789 414 --
NM_018351chr1274111 3988 3679 3115 1869 532 408 2561 47 13868 --
NM_018360chrX2373 332 1301 148 --
NM_018361chr8124052 3554 3178 3166 2501 1416 1409 1228 728 637 611 335 2722 194 ----
NM_018362chr11103908 3897 3886 3762 3333 2931 1360 1137 436 61 --12828 1964
NM_018364chr173409 2990 2767 813 467 430 336 33160 1056 540 21152 32 12787
NM_018367chr1152285 1630 1024 852 121 12378 11718 --
NM_018369chr5------1664
NM_018370chr1241635 914 448 220 1132 ----
NM_018372chr13585 181 170 1136 --1574
NM_018374chr7144943 4452 4353 4202 3302 3204 1533 1433 1230 1220 517 496 352 334 45257 4564 4255 3600 44335 4149 1373 367 11884
NM_018375chr1451930 1522 1449 1405 709 1321 11832 --
NM_018383chr261820 1380 829 717 546 51 11849 11711 11952
NM_018386chr134322 294 263 57 --1135 --
NM_018387chr91457 --1512 1507
NM_018400chr1173659 2828 1626 1451 833 694 331 11680 22949 1302 --
NM_018403chr353900 2689 1199 587 69 14129 1481 --
NM_018409chr473084 3013 2564 2465 2447 2123 333 62381 1991 1315 1285 670 509 13301 --
NM_018413chr12139 ------
NM_018416chr1241985 1886 901 317 --21610 854 --
NM_018424chr951196 642 566 179 169 1681 ----
NM_018426chr6178 ------
NM_018429chr582669 2521 2431 2314 2069 1142 898 389 1869 --12377
NM_018433chr24558 538 499 235 --1216 --
NM_018439chr1862096 1908 248 221 136 28 11621 --11613
NM_018440chr8178583 8169 7751 7226 6773 6650 6623 5446 3163 2521 2450 2395 2310 2189 1930 1799 428 12770 38202 6826 1100 17313
NM_018442chr12341 306 ------
NM_018444chr862193 2172 2128 1679 1453 151 12380 1264 --
NM_018448chr121356 199 1435 --
NM_018456chr32137 46 --1100 --
NM_018462chr33723 621 347 ------
NM_018469chr1741279 1210 1151 1015 --11142 --
NM_018471chr22516 169 --2390 66 --
NM_018477chr141157 --11039 1867
NM_018482chr851909 1757 1640 1608 446 22431 754 12569 --
NM_018489chr132386 1905 211 ------
NM_018490chr1161785 1729 1650 692 418 243 ------
NM_018555chr1952205 1590 594 524 254 21984 609 ----
NM_018557chr261737 1609 1524 1373 606 326 ------
NM_018566chr1175141 5111 4890 4629 4541 4493 4101 3272 3241 1781 1671 1431 965 789 427 320 122 13682 13811 35038 1356 1122
NM_018569chr451604 1547 1419 1168 319 1187 1481 --
NM_018571chr21564 ------
NM_018590chr1051665 1378 569 468 460 11372 ----
NM_018602chr1551429 1112 1056 179 167 --11575 --
NM_018638chr12225545 5430 5288 5135 4989 4942 4709 4466 3562 3438 1991 1900 1795 1753 1517 1246 886 824 632 514 267 102 34687 4336 3813 35078 3975 256 21366 409
NM_018639chr1231200 1133 566 ----1950
NM_018640chr1252592 2555 2242 2232 933 1679 1459 32759 990 737
NM_018652chr154951 379 299 208 ------
NM_018657chr3----1551 --
NM_018662chr184240 4063 3468 3153 1727 567 242 217 23479 3164 ----
NM_018667chr1652639 2606 1943 710 338 --32648 2088 932 --
NM_018682chr71494 --1667 --
NM_018685chr751023 1004 727 437 235 1166 ----
NM_018695chr592177 2032 1976 1797 1633 920 913 768 387 12360 --12232
NM_018698chrX71972 1241 738 667 556 383 106 11733 21905 1400 11388
NM_018700chr551425 1343 1159 366 281 11466 21489 238 --
NM_018704chr162027 1828 1779 1738 785 66 ------
NM_018712chr111383 ----11018
NM_018718chr752002 1925 1907 1658 88 1827 11474 1428
NM_018834chr53918 810 695 --2936 250 --
NM_018837chr202616 341 ----1185
NM_018841chr183038 3020 2928 2582 1515 1402 1342 762 13000 23592 2909 --
NM_018846chr75859 851 803 681 259 1273 ----
NM_018847chr941979 1559 1368 643 11243 --11797
NM_018890chr761502 951 370 178 142 125 --1405 --
NM_018898chr542226 1918 1708 1631 11511 --22084 2052
NM_018899chr542226 1918 1708 1631 11511 --22084 2052
NM_018900chr542226 1918 1708 1631 11511 --22084 2052
NM_018901chr542226 1918 1708 1631 11511 --22084 2052
NM_018902chr542226 1918 1708 1631 11511 --22084 2052
NM_018903chr542226 1918 1708 1631 11511 --22084 2052
NM_018904chr542226 1918 1708 1631 11511 --22084 2052
NM_018905chr542226 1918 1708 1631 11511 --22084 2052
NM_018906chr542226 1918 1708 1631 11511 --22084 2052
NM_018907chr542226 1918 1708 1631 11511 --22084 2052
NM_018908chr542226 1918 1708 1631 11511 --22084 2052
NM_018909chr542226 1918 1708 1631 11511 --22084 2052
NM_018910chr542226 1918 1708 1631 11511 --22084 2052
NM_018911chr542226 1918 1708 1631 11511 --22084 2052
NM_018945chr653434 3147 2448 626 564 11119 23722 528 1971
NM_018970chr783196 2983 2732 2493 2466 1212 1191 404 ------
NM_018975chr161552 175 1813 --
NM_018976chr1261959 881 637 393 322 151 2507 73 22779 284 --
NM_018979chr1252512 2438 2262 1823 916 1238 3795 655 349 --
NM_018993chr2011510 1159 --1549
NM_018999chr1073253 3154 1983 1716 862 782 589 1465 ----
NM_019000chr531063 424 375 31162 228 49 1542 --
NM_019001chr3134669 4303 4241 3831 3808 3750 3585 3506 3397 1039 853 526 443 31893 888 632 2737 28 --
NM_019003chrX147 ------
NM_019004chr7102292 2254 2202 1976 1543 787 557 480 208 185 ----21861 156
NM_019006chr154583 235 178 52 1203 ----
NM_019022chr1853166 3115 2862 2163 655 2905 35 32504 915 474 1583
NM_019027chr422435 2421 11047 1342 12529
NM_019028chr111353 ------
NM_019030chr51167 ------
NM_019035chr432018 628 227 21956 1887 1452 --
NM_019036chr671237 1159 1079 875 815 279 228 142 2301 272 --
NM_019042chr761126 950 426 199 157 144 ------
NM_019045chrX2612 94 ------
NM_019050chr4112263 1895 1814 1690 1658 1476 871 713 631 256 116 1835 22185 579 11527
NM_019057chr5169 ------
NM_019063chr21897 1521 1661 1876
NM_019067chrX94898 4882 4774 4504 4359 4301 3975 1803 1429 --13285 --
NM_019071chr71626 136 ----
NM_019072chr5124261 2937 2718 1657 1490 1084 1049 834 819 498 372 282 24175 3371 33888 3772 3222 11283
NM_019074chr151951 ------
NM_019080chr1391534 1247 1110 1098 1043 1028 950 593 47 174 21084 366 --
NM_019083chr1101608 1252 1147 1048 556 434 334 271 145 134 1107 11470 --
NM_019084chr1072603 2363 2319 2051 658 434 73 1301 31686 1633 572 --
NM_019087chr551693 1387 1171 476 67 21479 539 ----
NM_019091chr25795 763 397 341 22 ----1209
NM_019094chr1293656 3376 2969 2857 2658 1400 555 533 498 --22994 1060 --
NM_019095chr202224 189 ------
NM_019098chr851591 357 314 128 66 2701 424 1374 1221
NM_019106chr2273369 3241 2866 1244 1193 1176 888 ------
NM_019114chr971682 898 840 657 577 152 141 1342 ----
NM_019116chr1663549 2569 1256 185 174 97 1220 12558 --
NM_019117chrX103410 3300 2821 2810 2566 2312 2156 1313 1226 135 43357 1389 1219 782 11198 2714 43
NM_019555chr331813 590 561 21117 599 ----
NM_019556chrX41384 1257 972 153 1270 121 --
NM_019590chr1041483 975 592 465 1497 ----
NM_019592chr94675 657 583 167 ------
NM_019593chr2083092 2481 2422 2087 1151 1056 988 671 32207 1213 652 ----
NM_019600chr151757 ------
NM_019610chr171869 1668 1662 816 196 186 146 12208 2834 264 --
NM_019613chr1741336 1290 1089 821 --21023 856 1277
NM_019842chr6--1350 ----
NM_019857chrX1397 21771 658 ----
NM_019884chr191391 ------
NM_019895chr3187 21055 411 11123 11116
NM_019903chr1091611 1200 627 616 562 506 462 387 157 --21721 580 --
NM_020061chrX189 ------
NM_020062chr201694 ------
NM_020066chr11987 ------
NM_020069chr11--1246 ----
NM_020116chr441783 1737 1373 1142 1314 182 --
NM_020122chr2126053 5969 5740 5266 4364 2099 1850 1629 1331 1044 510 177 31675 1599 849 --44629 4569 4551 95
NM_020123chr1071269 1198 1183 633 527 35 24 ------
NM_020130chr881262 1095 1064 1029 957 909 398 107 1200 ----
NM_020133chr6106167 6092 5807 5756 5378 5116 4710 4333 1598 267 15038 26371 5047 --
NM_020139chr421916 1513 11629 21957 1830 1723
NM_020141chr162158 2117 1904 421 392 204 21726 741 ----
NM_020144chr752118 1999 1691 635 331 1810 21401 361 --
NM_020150chr1071909 1814 1622 1375 859 72 60 --42159 1830 812 383 --
NM_020152chr213892 159 153 --1967 --
NM_020157chr203840 833 86 ------
NM_020159chr461333 1300 1220 1165 486 145 1189 2113 103 --
NM_020177chr5133068 3055 2872 2425 2346 2316 2118 2079 1292 1194 637 233 96 23147 595 --1961
NM_020178chr1721054 984 11028 --2816 491
NM_020180chr181527 1309 ----
NM_020182chr2073242 2902 2335 1382 1117 662 267 22644 706 --2350 340
NM_020184chr232202 600 260 1327 12027 --
NM_020189chr8172 ------
NM_020194chr2164 --1549 --
NM_020198chr1751576 1568 1307 1156 1081 2546 96 ----
NM_020199chr571276 1079 514 503 161 46 32 ------
NM_020228chr11102375 2158 2005 1815 1777 1746 1737 833 479 386 12227 1593 --
NM_020239chr162301 1958 1803 929 644 633 ------
NM_020243chr22171 --195 --
NM_020245chr643349 1927 718 521 13536 14663 14446
NM_020307chr31171 ------
NM_020336chr2053445 3132 2663 1170 246 13636 ----
NM_020337chr473051 2706 2311 2088 2012 1042 958 42939 1941 757 203 22059 1997 --
NM_020338chr1053743 3386 2442 1052 892 --1899 13279
NM_020341chr2062003 1944 1802 599 473 448 ------
NM_020342chr2102536 2504 2245 2231 1725 1676 1645 756 484 313 31828 668 364 ----
NM_020345chr35912 833 823 401 383 --1320 1905
NM_020346chr1141400 1341 1218 226 ------
NM_020347chr332326 2177 2032 22017 852 2666 601 --
NM_020348chr1052784 2042 1835 523 435 31873 953 815 32394 2232 412 22409 2346
NM_020353chr351762 1749 1582 1305 34 --21848 133 --
NM_020354chr103752 188 124 ------
NM_020357chr351505 1270 1199 207 170 11310 ----
NM_020361chr81265 ------
NM_020379chr14780 761 234 138 ------
NM_020381chr641674 1654 696 90 11835 11780 --
NM_020390chr3144826 4239 4066 4015 3263 3200 1923 1836 1436 1312 910 188 161 56 24738 3309 34870 3178 797 34906 3101 271
NM_020403chr1331720 1585 559 --1122 130
NM_020405chr1774325 3480 3450 3427 1297 629 73 --11486 1355
NM_020416chr452499 2209 928 778 369 ------
NM_020420chrY61877 1569 610 405 208 197 11517 ----
NM_020423chr1--2402 23 ----
NM_020429chr762890 2674 2378 752 527 60 11090 ----
NM_020432chr741999 1782 1418 879 12123 1388 --
NM_020440chr1113383 3207 3079 2834 2425 2154 505 417 324 307 273 12613 1587 23091 1132
NM_020443chr1105899 5420 2691 2358 2130 1893 1427 785 252 177 36069 4297 1925 36536 1118 289 15119
NM_020452chr122102 547 12178 ----
NM_020453chr461713 1418 562 467 250 82 ------
NM_020455chr692815 2660 2645 2076 988 840 786 745 82 1337 12679 12136
NM_020456chr1342303 2297 1795 407 3640 476 67 ----
NM_020463chr241350 1344 989 260 21227 375 ----
NM_020465chr1631730 1684 216 ------
NM_020466chr694162 3697 3650 3123 1570 1381 1198 1041 432 13766 24382 3114 11529
NM_020473chrX41818 1660 189 104 ------
NM_020474chr1861883 1246 787 586 156 148 11859 1738 --
NM_020532chr21769 1743 ----
NM_020638chr1271901 1892 1752 1382 842 440 258 ------
NM_020640chr372222 1959 1705 861 622 413 71 31808 808 136 --11662
NM_020644chr1141016 342 325 236 ------
NM_020647chr832210 1789 881 11753 ----
NM_020651chr291811 1789 1557 1452 612 501 261 190 153 --1405 --
NM_020654chr361485 1335 1103 1024 488 97 ------
NM_020657chr1951794 1596 569 388 335 --22003 1543 --
NM_020666chr54944 913 206 156 --1952 --
NM_020673chr20187698 7478 7121 6900 6442 5801 5736 5695 5452 5201 4879 3069 1899 1455 1312 1260 1072 188 31583 1532 742 32680 1765 395 --
NM_020686chr1632856 2484 929 22580 2268 ----
NM_020697chr841137 1058 904 292 ------
NM_020699chr1105397 5365 4979 4422 4394 3807 3458 1697 1353 69 14219 14850 --
NM_020711chr262632 2422 1688 1677 1043 894 1231 --11770
NM_020715chr14102184 2143 2063 1697 1614 697 623 482 354 187 ------
NM_020717chrX74475 4329 4266 3925 1690 1127 195 --21722 800 --
NM_020718chr16196243 6022 5555 5067 5051 4994 4910 4750 4591 4152 2335 2268 1719 1700 1373 1031 905 813 319 34960 2565 2537 14046 11685
NM_020726chr53573 455 133 1219 ----
NM_020727chr21103502 3492 2834 2557 1518 1368 1307 1132 920 563 33427 3210 501 --1174
NM_020728chr762491 2402 2024 892 780 730 --12449 23164 97
NM_020732chr64909 504 348 163 21185 394 ----
NM_020734chr1283077 2446 2391 1204 1166 903 570 40 --12665 1383
NM_020739chr15134094 4054 3905 3789 3751 3568 2615 1233 1081 895 537 193 175 34077 3685 943 44131 4106 3477 1357 23414 602
NM_020740chr172127 38 ------
NM_020742chrX52733 1012 1006 212 130 ----12414
NM_020747chr53947 177 83 ------
NM_020748chr1751731 813 695 584 306 1153 21698 337 11546
NM_020750chr631470 557 484 ----11437
NM_020752chr1072657 2242 1993 768 736 567 456 1669 32928 2764 581 --
NM_020760chr262021 1964 1488 1408 313 252 ------
NM_020762chr123786 187 36 1309 182 --
NM_020766chrX63472 3202 1777 889 206 59 ----13813
NM_020768chr552753 2187 659 477 424 12198 11127 --
NM_020772chr17247986 7788 7385 7264 7208 7046 6865 6531 6395 5964 5883 5374 5354 2970 2943 2656 2465 2367 1914 1818 1778 1067 733 200 36914 6211 2956 58267 2704 2517 1155 1017 --
NM_020774chr18185836 5421 5350 4865 4779 4619 4464 4451 3876 2289 2124 1468 929 787 651 605 311 238 56227 6150 4800 4152 2274 194 14665
NM_020775chr1--1137 ----
NM_020778chr1564880 4452 4287 851 466 410 24196 982 24409 1781 --
NM_020779chr272813 2598 1996 1013 820 686 161 12380 32987 2389 719 13172
NM_020782chr12154748 4486 4351 4229 3623 1843 1819 1704 1594 1180 969 958 928 899 190 14738 21929 1906 11861
NM_020783chr1852002 1984 1620 954 661 1833 1180 22127 159
NM_020792chr362671 1857 789 184 161 125 --1305 --
NM_020794chr141403 1356 1349 1332 11070 31368 1081 303 11115
NM_020795chr1731722 1507 377 ------
NM_020800chr341038 990 936 581 --1365 --
NM_020801chr522618 370 32301 2285 476 12533 --
NM_020802chr1163383 2797 2736 2275 410 376 23375 593 12588 --
NM_020803chr451502 526 496 335 147 ----1624
NM_020805chr183284 244 203 41976 1963 1300 564 ----
NM_020808chr12933 803 ------
NM_020810chr1463477 3130 3096 1192 277 230 33507 2202 149 --12267
NM_020819chr661024 878 814 493 206 128 3778 271 167 1801 1963
NM_020825chr1673807 3795 3432 2974 2482 1028 810 ------
NM_020830chr2102443 2168 986 783 739 679 647 546 502 244 ------
NM_020832chr11247 ------
NM_020834chr1441912 1737 1611 1277 ------
NM_020839chr371559 1442 1261 1103 1079 404 100 1383 ----
NM_020841chr1283463 3416 3354 1102 911 878 232 141 13742 34052 3097 1134 --
NM_020845chr1221548 1005 --1630 --
NM_020853chr1282287 2015 1985 1889 482 297 279 96 22419 422 32594 1941 1103 --
NM_020854chr1841368 302 261 116 ------
NM_020856chr1941420 418 233 77 --11290 --
NM_020858chr1532210 2177 1934 1782 1137 --
NM_020860chr451101 766 432 369 90 ------
NM_020861chr62871 344 1458 1887 1973
NM_020866chr132244 78 2941 874 ----
NM_020868chr261869 1854 1813 1671 1545 1308 11567 21385 518 1331
NM_020870chr492212 1973 721 550 388 337 312 253 88 22061 1837 ----
NM_020871chrX122455 1745 1645 1608 1569 833 819 448 375 330 198 174 1664 ----
NM_020872chr331161 327 193 11312 21490 109 11224
NM_020897chr12886 185 ----1868
NM_020909chr2174123 4070 4046 3729 3576 3299 2837 2686 1433 1263 1255 1130 749 514 449 268 223 31482 909 334 --1128
NM_020918chr10102350 2252 1141 1122 924 915 698 402 313 63 12624 ----
NM_020922chrX31386 751 542 ------
NM_020925chr13579 561 523 ----11203
NM_020926chrX1109 ------
NM_020927chr1622280 2129 1860 ----
NM_020935chr2114516 3887 3820 3775 3543 2919 1372 1213 614 470 184 43975 2824 899 653 24359 2896 --
NM_020940chr1092653 2537 2367 2031 2025 2003 867 435 317 22318 260 32484 565 444 --
NM_020943chr21195 175 ----
NM_020948chr1233411 3377 3050 2687 2435 2427 2398 2346 2321 1466 1263 1254 1130 1025 964 944 772 754 745 431 414 370 288 22656 356 --1128
NM_020952chr92843 828 --1153 --
NM_020961chr42500 247 161 1115 180
NM_020964chr1884857 4464 3532 1920 1414 622 465 158 34700 4357 1938 64540 4221 1165 1102 74 54 1952
NM_020975chr1031699 1641 1577 --21334 151 --
NM_020977chr461919 1795 747 348 223 57 1488 11488 --
NM_020987chr1031314 304 184 ------
NM_020989chr2123 ------
NM_020993chr1262797 2742 2453 1752 978 69 22872 555 ----
NM_021003chr143753 71 60 2140 92 ----
NM_021005chr154845 837 736 186 1154 171 --
NM_021032chr341823 795 628 408 --11586 --
NM_021033chr1383149 2939 2768 1390 1170 1104 592 461 2442 231 --1784
NM_021038chr363401 3358 3090 2946 2443 410 33078 2901 2835 --1827
NM_021061chr854516 3566 1601 803 634 21119 175 1995 33166 3105 966
NM_021069chr462033 1583 1452 1400 1383 606 31930 1832 1762 ----
NM_021072chr521674 421 1531 1721 22090 1883
NM_021076chr221151 ------
NM_021083chrX143660 3651 2896 2792 2756 2698 2602 2351 1415 1122 1069 1048 985 852 ----32743 1458 977
NM_021088chr261978 1684 869 798 745 33 ------
NM_021090chr22104537 4526 4128 3587 3454 3421 3236 724 250 231 --34044 1649 1187 --
NM_021097chr242524 2348 1930 1909 22747 121 ----
NM_021110chr83796 669 252 ------
NM_021116chr7109047 8972 7559 5533 5480 3403 2641 1519 1306 1079 26130 5902 18858 17430
NM_021120chrX32176 652 514 1615 ----
NM_021127chr1841483 1218 1099 163 --11122 --
NM_021132chr1021184 243 194 ----
NM_021136chr142536 236 ----1651
NM_021140chrX3815 439 279 --1226 1752
NM_021144chr92205 114 1167 ----
NM_021145chr72151 96 1270 ----
NM_021148chr762467 2454 2364 2184 995 392 ------
NM_021159chr441720 387 309 188 --2553 39 --
NM_021167chr712246 22863 1732 22222 1006 --
NM_021183chrX72162 1951 1868 1707 931 301 261 181 22568 2259 12427
NM_021190chr161379 1175 1134 1065 1000 253 1244 ----
NM_021191chr1272432 2231 2163 2070 923 455 309 1780 1621 --
NM_021201chr1132043 1878 1706 2401 235 41498 1422 176 160 11792
NM_021204chr4183 --1149 1936
NM_021205chr192919 2646 2217 1790 966 648 453 273 163 ------
NM_021215chr2062390 2214 2189 2178 2072 385 ------
NM_021222chr161470 1429 1179 585 573 519 ----11344
NM_021228chr19--1221 ----
NM_021229chr1241238 777 455 143 2333 55 --11168
NM_021238chr1292086 1284 751 724 411 347 315 242 157 1544 1836 --
NM_021239chr143569 145 103 11239 ----
NM_021249chr1411227 --21562 347 --
NM_021252chr1042105 1352 616 275 ------
NM_021255chr14103767 3547 2666 1628 1583 1425 1395 1371 597 571 53687 3275 3062 1199 669 22532 690 1623
NM_021572chr671295 469 414 395 359 336 296 ------
NM_021574chr226962 949 907 801 488 316 ----1870
NM_021614chr5161 1270 2310 243 1235
NM_021622chr1061997 1985 1764 1668 1620 555 21545 676 41646 383 354 181 --
NM_021627chr33790 767 163 --11121 11161
NM_021629chr394461 4036 3844 3823 2024 1485 1437 1065 217 34685 3787 1508 31708 1469 353 1509
NM_021635chr651555 1436 675 483 388 21348 112 ----
NM_021638chr475042 4952 4630 3112 1964 1846 223 14464 11262 14943
NM_021644chr104999 865 332 194 193 2418 72 --
NM_021647chr4113737 3489 3108 2942 1579 1392 1054 732 680 444 172 12884 13256 --
NM_021648chr682794 2683 2517 2470 1714 967 773 22 ------
NM_021649chr571724 1394 1152 741 655 549 145 --11512 --
NM_021722chr72377 48 ----1507
NM_021723chr72418 48 ----1548
NM_021728chr141846 1777 ----
NM_021809chr2041935 1842 900 843 --12472 --
NM_021813chr6135561 4846 4781 4773 4364 3672 1957 1749 1698 850 505 391 354 55748 5207 3530 1608 261 22078 906 14158
NM_021814chr681591 1438 1122 1060 558 486 336 128 --31155 651 549 --
NM_021818chr1421417 1177 11349 1318 1126
NM_021821chr126815 533 253 172 65 37 ------
NM_021911chr5175229 5206 5144 4939 4436 4186 4133 4000 3550 1736 1719 1336 1109 1096 895 656 299 --23994 3943 --
NM_021912chr1574139 3586 3362 3006 2637 1451 146 31168 792 30 12719 --
NM_021913chr1921850 577 11595 11415 --
NM_021914chr1492377 2319 2256 1709 909 758 378 309 38 --12075 12098
NM_021923chr421515 1477 ------
NM_021930chr72299 292 1108 ----
NM_021935chr34923 731 341 115 1677 ----
NM_021942chr42851 79 --1697 --
NM_021943chr631978 1512 609 ----12188
NM_021946chrX1461 ------
NM_021949chrX52889 2869 2862 2842 2235 21054 56 ----
NM_021951chr91629 ------
NM_021954chr13103640 3413 3193 3057 2873 1466 1173 949 903 469 32617 588 483 --1975
NM_021960chr181078 832 787 779 501 379 239 27 12021 42777 2594 306 88 --
NM_021961chr11147466 7454 7287 7069 6845 6015 5594 5312 5055 1737 1666 1594 1475 1390 44899 2208 1052 733 26293 2065 17314
NM_021964chr3126365 6143 6083 5985 5500 5237 4286 2417 2409 1932 1506 669 24358 1212 44151 2554 1619 1031 24221 4012
NM_021967chr55979 519 472 352 179 ----147
NM_021973chr41146 ------
NM_021988chr2031426 250 170 ------
NM_021998chrX31266 226 111 ----11377
NM_021999chr133596 583 270 ------
NM_022037chr25933 762 716 652 319 1862 --1849
NM_022041chr1652503 2294 954 715 378 --22643 2184 22339 626
NM_022048chr15136323 5668 5501 5015 4144 4107 2324 2126 1887 1225 1192 742 670 15942 46287 4032 3889 2346 --
NM_022051chr15619 536 173 133 59 1194 1707 --
NM_022073chr1461493 1404 1198 1157 654 463 --11279 --
NM_022079chr1041030 937 798 331 --1365 --
NM_022087chr71501 1467 --1569
NM_022093chr13954 713 704 1128 ----
NM_022114chr174099 1425 1418 1379 1320 550 525 11368 --13284
NM_022123chr142583 159 --1603 --
NM_022130chr541153 587 283 82 1462 2933 66 --
NM_022132chr53201 102 75 ------
NM_022138chr621476 45 11242 1277 --
NM_022140chr521821 1663 11530 1830 --
NM_022143chr751474 1351 254 184 59 --11453 --
NM_022166chr1665472 5211 2395 1483 911 345 12510 --11153
NM_022173chr25933 762 716 652 319 1862 --1849
NM_022351chr883545 3508 2788 2642 2481 1546 1318 356 33096 2842 964 1795 1156
NM_022373chr751004 856 828 812 679 171 188 140
NM_022374chr22395 189 ------
NM_022442chr2031426 250 170 ------
NM_022454chr86894 682 289 266 147 137 ------
NM_022456chr12147196 6888 6674 6056 5962 5601 2403 2066 1982 1735 1526 1110 349 229 23043 1604 46870 6498 4753 369 26775 1412
NM_022458chr763158 2636 2589 792 407 352 --23055 187 --
NM_022459chr13186121 5764 5405 5319 4984 4317 1695 1670 1561 1355 899 687 606 527 179 128 67 24 12182 46275 2472 2113 1068 22209 1237
NM_022465chr1273098 2968 2706 1230 1003 428 294 1422 ----
NM_022469chr183188 3063 2956 2909 2704 2594 2518 2372 ------
NM_022474chr1452683 2250 1126 860 486 11805 22529 778 1414
NM_022475chr43489 268 119 --1131 --
NM_022476chr1631058 978 769 --1923 --
NM_022491chr12153322 3278 3048 3034 3011 2892 2795 2775 2453 1423 985 739 202 178 92 11015 22689 2384 --
NM_022495chr144563 456 90 81 2554 540 ----
NM_022566chr151547 ------
NM_022571chr14136 ------
NM_022650chr54910 893 797 308 ------
NM_022716chr183068 2437 2013 1983 1957 1023 863 419 ------
NM_022726chr651393 1101 667 536 256 163 ----
NM_022728chr73274 253 182 1673 ----
NM_022733chr121133 905 ------
NM_022735chr1101835 1657 1486 1472 697 687 393 153 64 55 11278 ----
NM_022739chr1741041 970 350 269 1390 1862 --
NM_022753chr12439 261 ------
NM_022756chr171511 1372 1288 1212 967 132 24 1323 ----
NM_022763chr372813 2093 1215 784 618 356 253 11013 --1721
NM_022771chr123971 938 808 ------
NM_022776chr321491 353 --11300 --
NM_022780chr231221 487 128 21309 633 ----
NM_022781chr962940 2838 2407 2238 233 140 --21123 1088 --
NM_022802chr1051480 1466 1274 402 223 11045 ----
NM_022824chr5101941 1916 1886 1724 1545 1408 775 613 321 231 11218 --1247
NM_022828chr561668 1469 1151 563 326 64 11780 ----
NM_022831chr151793 1610 413 276 26 ------
NM_022832chr472291 1965 498 426 392 351 251 11702 1990 --
NM_022836chr151570 556 534 323 282 --21727 1526 --
NM_022841chr1562518 2490 2260 2061 1968 770 12475 11845 --
NM_022843chr1351294 1153 112 105 43 1488 11389 --
NM_022845chr1652267 2249 312 219 193 1430 21767 826 --
NM_022875chr52550 364 ------
NM_022877chr52550 364 ------
NM_022893chr283001 2924 2401 1948 920 785 329 304 22804 1198 ----
NM_022894chr231332 610 158 --1283 --
NM_022897chr531003 761 167 --1137 --
NM_022898chr14114854 4243 3665 1651 1558 1223 589 500 417 249 71 --33597 471 225 --
NM_022900chr761179 815 453 434 355 346 ------
NM_022901chr951579 1533 1349 531 433 21299 543 ----
NM_022910chr1631730 1684 216 ------
NM_022912chr2112732 2564 2556 2090 1068 909 861 646 470 410 318 --12626 --
NM_022918chr1162154 2085 1528 808 800 194 31589 1385 92 11619 --
NM_022970chr1041446 940 551 316 --1544 --
NM_022977chrX82527 2249 2098 1068 990 695 361 172 ------
NM_022978chr55979 519 472 352 179 ----147
NM_023000chr1421115 228 ----11567
NM_023001chr1421115 228 ----11567
NM_023010chrX4799 639 223 210 2297 194 ----
NM_023012chr125485 115 109 88 39 ------
NM_023016chr262782 2589 2343 2095 1131 1089 22216 631 22410 830 12528
NM_023035chr191329 ------
NM_023037chr1351144 1077 788 190 154 --2799 286 --
NM_023039chr51284 ------
NM_023072chr1911120 --11037 --
NM_023074chr193541 524 288 ----11339
NM_023079chr1741786 1626 559 544 ------
NM_023914chr321358 42 11340 21365 23 1263
NM_023929chr8122812 2752 2673 2551 2486 2323 1005 978 634 552 540 459 12687 2781 657 --
NM_024007chr583156 3148 3042 2933 2748 592 375 86 32010 990 873 12270 --
NM_024019chr421135 756 ------
NM_024052chr17103131 2905 2660 2616 2401 2375 905 897 745 53 --1285 --
NM_024061chr71614 --1567 191
NM_024067chr72529 501 ------
NM_024086chr1773583 3492 2393 1532 1312 901 39 ----13682
NM_024090chr421831 1586 31699 1374 1240 --2626 435
NM_024091chr52188 182 ------
NM_024094chr85721 715 177 88 69 1619 1628 --
NM_024095chr1241430 1408 1030 306 ------
NM_024295chr872040 1966 1936 1567 1524 517 477 ------
NM_024312chr1221281 1031 162 1296 2661 324
NM_024315chr74468 432 376 64 ----1401
NM_024334chr361876 1588 1491 1317 1271 256 21769 1644 ----
NM_024336chr16135 ------
NM_024345chr9146009 5779 5572 5440 4987 4515 4001 2111 2076 1996 1212 881 698 43 45906 4315 3700 485 ----
NM_024408chr1103381 3323 2892 2483 2389 1206 795 567 107 36 1830 ----
NM_024416chr961529 1065 579 493 416 348 ------
NM_024423chr18154164 3322 2960 2822 2697 1714 1605 1291 1066 1018 990 915 718 168 156 43917 3756 1442 290 13931 --
NM_024424chr114942 883 429 123 1100 ----
NM_024425chr114942 883 429 123 1100 ----
NM_024426chr114942 883 429 123 1100 ----
NM_024430chr1861919 1712 1640 1463 1244 127 --1537 --
NM_024491chr33667 654 154 --1165 1213
NM_024511chr4162973 2839 2373 2253 1388 1079 923 905 894 811 640 480 224 188 138 112 1944 12987 --
NM_024513chr353762 2509 1015 920 364 23380 2540 12360 122
NM_024520chr21272 ------
NM_024524chr362935 2913 2245 1156 745 124 12260 32430 2422 1291 13071
NM_024529chr131039 837 159 ----1799
NM_024532chr2------1180
NM_024541chr1061426 1316 1260 719 319 247 ------
NM_024546chr1331114 1056 425 ----1836
NM_024548chr331779 189 99 21120 621 21786 35 --
NM_024563chr561729 1189 548 471 430 324 ------
NM_024569chr152975 2452 2028 850 737 12856 ----
NM_024582chr43962 889 180 1129 ----
NM_024583chr22870 98 1881 2899 272 --
NM_024586chr12659 171 2544 225 1566 1207
NM_024590chr461861 791 738 401 359 142 131 ----
NM_024607chr873991 3711 3333 2793 899 806 102 33467 3319 1506 14128 --
NM_024611chr1573461 3099 2502 947 430 305 55 13804 23809 584 --
NM_024613chr841859 1546 1497 52 11243 ----
NM_024615chr5--1220 ----
NM_024617chr93756 605 141 1936 --1859
NM_024624chr231403 1240 511 1214 11659 --
NM_024630chr62782 534 ------
NM_024635chr91323 ------
NM_024638chr372504 2439 1644 959 645 536 233 --1896 --
NM_024639chr652564 1107 488 471 366 12108 22850 2778 --
NM_024641chr6103013 2834 2773 2627 2534 610 459 229 55 42 1470 12955 12937
NM_024646chr1103950 3900 3596 3424 3034 2674 2525 1402 1260 165 1358 ----
NM_024659chr23813 342 53 ------
NM_024665chr3114698 4302 4161 4054 3381 3104 3093 1386 875 695 479 14488 23128 1060 24427 1887
NM_024670chr1051282 1266 659 398 110 31429 1350 588 --1582
NM_024674chr152883 2770 2249 1021 282 12905 22777 706 --
NM_024680chr113584 216 27 --1466 --
NM_024697chr3134 ------
NM_024713chr1541631 1311 336 59 2217 211 1403 11531
NM_024721chr882579 2207 1892 1875 480 408 376 86 12257 --12451
NM_024725chr114724 622 213 180 ------
NM_024740chr11133953 3927 3779 3770 3583 3453 3232 3094 2757 661 638 554 214 --11376 --
NM_024744chr2102713 2393 2025 1683 1083 922 852 842 304 207 11038 140 --
NM_024749chr172320 2172 2028 1871 785 358 160 11560 22268 2138 --
NM_024751chr442081 1877 821 291 ------
NM_024753chr21561 --154 --
NM_024755chr154320 211 88 34 157 1184 --
NM_024757chr91889 ------
NM_024761chr995149 5098 3936 2121 2108 2073 1370 1008 406 13760 54555 3988 1720 1173 1117 --
NM_024766chr21325 ------
NM_024770chr2116471 5251 5144 5019 4720 4625 4154 2621 1580 319 303 36605 4239 1000 14513 14817
NM_024779chr1211017 ----1452
NM_024812chr852198 1593 793 563 33 11727 --11524
NM_024814chr7--1391 ----
NM_024817chr1595860 5167 5053 4941 4930 4558 1797 1788 1276 24201 3970 13669 --
NM_024824chr1441714 1255 515 154 ------
NM_024828chr991448 1198 1037 1022 563 539 491 415 58 11506 ----
NM_024830chr52682 675 11676 11529 --
NM_024834chr1061993 1593 1475 1369 1218 549 --196 1308
NM_024837chr1551930 1869 1560 660 121 1293 ----
NM_024884chr14134445 4216 4020 3851 3621 1705 1419 1233 1087 917 330 158 75 197 --13785
NM_024893chr20------1165
NM_024920chr441443 1105 502 286 1528 1533 --
NM_024921chrX51956 1584 1272 334 168 ----1584
NM_024927chr173163 143 23 ------
NM_024930chr592523 2282 2027 1960 1833 620 572 545 159 --22746 778 --
NM_024941chr531165 1098 176 --11281 1226
NM_024945chr941162 349 129 114 2882 108 ----
NM_024947chr3329457 9240 8876 8647 8525 8047 7740 7654 7612 7465 7280 7047 6475 5941 3554 3451 3439 3340 3267 3141 2191 2078 1941 1790 1367 1086 1006 445 342 290 209 73 35920 2611 2099 12836 12603
NM_024949chr4104572 3376 1636 1578 1133 1078 573 185 162 130 31594 1228 279 ----
NM_024953chr1292814 2717 2596 1752 916 833 767 707 103 --32667 1133 656 --
NM_024960chr20--183 ----
NM_024971chr92843 828 --1153 --
NM_024989chr2258158 7968 7405 7213 7158 7110 6957 6203 6144 5904 5828 5670 5564 3143 2998 2971 2958 2342 2045 1908 1679 1646 1358 382 31 57508 6172 2586 2136 2029 55108 5038 4946 1533 1111 --
NM_024991chr1043116 2778 2013 2004 13269 12739 12982
NM_024993chr231088 386 327 11142 ----
NM_025040chr1941906 1546 1527 161 2914 69 1293 22186 508
NM_025047chr32395 104 2442 187 ----
NM_025054chr8123838 3563 3517 2978 1659 1416 616 274 234 200 165 73 ----13301
NM_025073chr1144574 4437 4343 4026 3463 3319 1459 1156 860 848 744 567 308 236 24605 203 11791 14089
NM_025074chr483080 2676 2628 2157 2143 1919 1206 105 ------
NM_025107chr642273 1966 927 667 1328 ----
NM_025109chr17--1432 --1467
NM_025114chr12------145
NM_025125chr1061608 1401 515 326 225 79 1252 ----
NM_025133chr25992 940 755 278 46 --