TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4670-5p
miRNA Sequence: AAGCGACCAUGAUGUAACUUCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr141292 --1720 --
NM_000081chr11614 ----11629
NM_000084chrX56942 4950 1855 1653 677 26505 1986 ----
NM_000110chr1122 ------
NM_000115chr1312488 ------
NM_000168chr72942 377 ------
NM_000176chr52891 22 ------
NM_000194chrX1159 ------
NM_000210chr21430 ------
NM_000214chr202537 90 ------
NM_000216chrX23559 279 ------
NM_000217chr1225171 1648 ------
NM_000252chrX1399 ------
NM_000264chr92586 352 ------
NM_000267chr1713154 ------
NM_000304chr17----1145 --
NM_000314chr1012891 ------
NM_000325chr4187 ------
NM_000332chr621234 379 ------
NM_000362chr2211118 13515 ----
NM_000368chr934843 1053 306 ------
NM_000369chr1411205 21590 1230 ----
NM_000387chr3147 ------
NM_000399chr101909 ------
NM_000408chr213413 --11115 --
NM_000411chr2132769 610 158 ------
NM_000430chr1733719 3589 1230 ------
NM_000449chr1----1161 --
NM_000451chrX21592 844 ------
NM_000489chrX22224 863 ------
NM_000503chr821649 125 ------
NM_000522chr72422 56 ------
NM_000523chr21436 ------
NM_000611chr1135612 4850 1933 --11916 --
NM_000681chr10--11347 ----
NM_000698chr101403 ------
NM_000720chr3--1420 ----
NM_000724chr102231 138 ------
NM_000780chr81793 ------
NM_000806chr521253 653 ------
NM_000813chr51122 --1161 --
NM_000817chr2176 ------
NM_000818chr10--1210 ----
NM_000833chr16--11526 ----
NM_000841chr61284 ------
NM_000844chr31359 ------
NM_000859chr511408 ------
NM_000868chrX12557 ------
NM_000875chr1525145 2249 --1672 --
NM_000891chr1712944 ------
NM_000901chr4--12156 ----
NM_000925chr3124 ------
NM_000958chr511237 ------
NM_001001342chr1011030 --1392 --
NM_001001436chr161131 ------
NM_001001556chr15------1114
NM_001001664chr214089 ------
NM_001001971chr10--21403 564 ----
NM_001002032chr171726 ------
NM_001002033chr172826 26 ------
NM_001002243chr21251 ------
NM_001002252chr12----183 --
NM_001002762chr102810 321 ------
NM_001002914chr171811 11083 11059 --
NM_001002919chr2----1495 --
NM_001003406chr2233227 3185 2115 ------
NM_001003674chr1846996 5348 4345 1310 16637 ----
NM_001003675chr1846996 5348 4345 1310 16637 ----
NM_001004065chr933791 2478 311 ------
NM_001004317chr644162 1726 1677 38 ------
NM_001004360chr22316 80 1182 ----
NM_001005404chr1713125 ------
NM_001005861chr31906 ------
NM_001006115chr312797 ------
NM_001006612chrX--1104 ----
NM_001006613chrX--1104 ----
NM_001006614chrX--1104 ----
NM_001006623chr21157 ------
NM_001006938chrX--1561 ----
NM_001007024chr1721438 245 ------
NM_001007025chr1721438 245 ------
NM_001007098chr1--1899 ----
NM_001007246chr2111861 ------
NM_001007553chr111124 ------
NM_001007559chr18--22051 1367 ----
NM_001008220chr553901 3811 3522 2859 274 ------
NM_001008239chr1813587 11370 ----
NM_001008408chr71406 ------
NM_001008495chr811753 --12257 --
NM_001008564chr1332278 1501 724 ------
NM_001008925chr422944 912 --12589 --
NM_001009814chr13--179 ----
NM_001009899chr313948 21922 376 ----
NM_001009993chr21524 13087 14210 --
NM_001010861chr1----12154 --
NM_001010924chr101412 1305 ----
NM_001010986chrX32447 1817 1682 ------
NM_001011708chr2--12589 1494 --
NM_001011713chr1411545 ------
NM_001012732chr4------157
NM_001012968chrX22741 921 ------
NM_001013031chr101270 12628 11317 --
NM_001013415chr421198 619 ------
NM_001013438chr31403 ------
NM_001013439chr31249 ------
NM_001013699chr121181 ------
NM_001013839chr1741907 1685 1625 699 ------
NM_001013843chr151260 1578 ----
NM_001014812chr15--1378 ----
NM_001015877chrX12890 ------
NM_001017424chr1169 ------
NM_001017425chr1169 ------
NM_001017440chr72469 163 --17753 --
NM_001017969chr91659 ------
NM_001017977chr11369 ------
NM_001018067chr125053 4184 ------
NM_001018068chr125053 4184 ------
NM_001018069chr125053 4184 ------
NM_001018074chr52891 22 ------
NM_001018075chr52891 22 ------
NM_001018076chr52891 22 ------
NM_001018077chr52891 22 ------
NM_001020658chr111087 1595 1113 --
NM_001020658chr111087 1595 1113 --
NM_001020818chr1931717 1292 491 ------
NM_001020819chr1931717 1292 491 ------
NM_001020820chr1931717 1292 491 ------
NM_001020821chr1931717 1292 491 ------
NM_001023560chr61875 ------
NM_001023587chr31118 11006 ----
NM_001024094chr52891 22 ------
NM_001024649chr51957 ------
NM_001024808chr1232377 996 296 ------
NM_001024947chr51969 ------
NM_001024948chr112621 ------
NM_001024956chr1115412 15881 ----
NM_001025076chr1015468 ------
NM_001025077chr1026826 4948 ------
NM_001025079chr324076 615 13712 ----
NM_001025107chr1161 ------
NM_001025107chr1161 ------
NM_001025603chr1----1161 --
NM_001029835chr71407 ------
NM_001030007chr1643650 3553 2729 1424 ------
NM_001030055chr14------11842
NM_001031695chr2235376 3690 2072 ------
NM_001031702chr31778 ------
NM_001032367chr151442 ------
NM_001032393chrX2679 673 ------
NM_001033087chr2013105 ------
NM_001033551chr1733093 2851 1296 --11519 --
NM_001033557chr21131 ------
NM_001034850chr5--11697 ----
NM_001035511chr1----1323 --
NM_001035512chr1----1430 --
NM_001035513chr1----1430 --
NM_001035521chr21512 ------
NM_001037317chr1----12154 --
NM_001037334chr181476 --1712 --
NM_001037339chr11232 11219 ----
NM_001037340chr11232 11219 ----
NM_001037341chr11232 11219 ----
NM_001037341chr11232 11219 ----
NM_001037954chr1143139 2885 570 401 ------
NM_001038707chr112064 --12040 --
NM_001038707chr112064 --12040 --
NM_001039091chrX1365 ------
NM_001039538chr223673 977 ------
NM_001039577chr163047 2974 1179 1161 1143 380 12996 13807 --
NM_001039585chr11817 --24241 212 --
NM_001039590chrX13107 --12589 --
NM_001039591chrX13107 --12589 --
NM_001039711chr1----1728 --
NM_001039712chr1----1728 --
NM_001039802chr111273 ------
NM_001039840chrX25391 766 --12428 --
NM_001039844chr1032890 1950 905 ------
NM_001039937chr13--13809 ----
NM_001040100chr3146 ------
NM_001040167chr7--11173 ----
NM_001040402chr4----13006 --
NM_001040429chr1312525 ------
NM_001040441chr145226 4672 1865 193 ------
NM_001040455chr1111327 ------
NM_001040653chr3--1897 ----
NM_001040712chr91881 ------
NM_001042355chr161416 ------
NM_001042388chr18----1644 --
NM_001042412chr161416 ------
NM_001042413chr943454 552 188 45 ------
NM_001042475chr6176 ------
NM_001042492chr1713154 ------
NM_001042494chr1513132 ------
NM_001042495chr1513132 ------
NM_001042496chr1513132 ------
NM_001042497chr1513132 ------
NM_001042555chr1211032 ------
NM_001042603chr1222038 95 --13870 --
NM_001042604chr333797 3614 3548 ------
NM_001046chr522997 149 ------
NM_001106chr349351 7786 3686 2441 17691 ----
NM_001111chr1161 ------
NM_001117chr18154 ------
NM_001121chr1011619 ------
NM_001124chr111468 ------
NM_001128chr1643650 3553 2729 1424 ------
NM_001143chrY146 ------
NM_001149chr1011007 1943 ----
NM_001167chrX36229 5951 2617 ------
NM_001173chr14------11842
NM_001186chr2132855 946 85 ------
NM_001206chr912162 ------
NM_001222chr101650 ------
NM_001227chr10----11355 --
NM_001233chr721492 646 ------
NM_001235chr11--1644 ----
NM_001241chr231907 450 200 ------
NM_001241chr231907 450 200 ------
NM_001256chr17----1369 --
NM_001257chr1611327 1309 ----
NM_001278chr10--145 ----
NM_001284chr51170 ------
NM_001290chr41744 ------
NM_001304chr1711411 --11541 --
NM_001310chr1232016 1946 694 ------
NM_001315chr611632 --1469 --
NM_001316chr201140 1352 ----
NM_001329chr1011459 ------
NM_001351chr3135 ------
NM_001390chr18----13250 --
NM_001396chr2122329 784 11777 ----
NM_001406chr17----11593 --
NM_001408chr111627 ------
NM_001418chr11--144 ----
NM_001418chr11--144 ----
NM_001419chr19--1752 ----
NM_001438chr1--12705 ----
NM_001453chr621723 459 ------
NM_001457chr3150 --141 --
NM_001482chr151129 ------
NM_001518chr721095 816 ------
NM_001521chr21512 ------
NM_001614chr171174 ------
NM_001614chr171174 ------
NM_001616chr21151 11110 --1610
NM_001618chr1190 ------
NM_001621chr712191 1796 ----
NM_001621chr712191 1796 ----
NM_001656chr51473 ------
NM_001660chr32679 597 1166 ----
NM_001663chr14--1268 12026 --
NM_001681chr12145 ------
NM_001707chr7173 ------
NM_001709chr1112649 ------
NM_001730chr1311390 --11496 --
NM_001730chr1311390 --11496 --
NM_001746chr51957 ------
NM_001753chr711144 181 ----
NM_001777chr324076 615 13712 ----
NM_001791chr111273 ------
NM_001797chr161765 ------
NM_001800chr191391 ------
NM_001839chr11693 ------
NM_001845chr13--11327 ----
NM_001895chr201121 ------
NM_001896chr161295 ------
NM_001903chr51612 ------
NM_001904chr31361 ------
NM_001921chr4------157
NM_001949chr612494 ------
NM_001967chr3141 1521 ----
NM_001969chr14----21034 303 --
NM_001981chr112049 ------
NM_001999chr5--1369 ----
NM_002014chr121627 ------
NM_002026chr21988 1839 ----
NM_002040chr211418 ------
NM_002044chr15------1114
NM_002063chrX1205 ------
NM_002092chr434178 3620 1619 --13143 --
NM_002126chr171543 ------
NM_002146chr17----1168 --
NM_002214chr73446 227 114 ------
NM_002226chr14--1219 ----
NM_002232chr11462 ------
NM_002239chr2--1821 ----
NM_002264chr324519 811 --11541 --
NM_002270chr523994 1978 ------
NM_002296chr111165 ------
NM_002310chr554466 2588 2346 1374 764 160 14934 --
NM_002359chr1733935 3186 238 ------
NM_002372chr51454 ------
NM_002374chr223673 977 ------
NM_002397chr511602 12086 ----
NM_002398chr211498 ------
NM_002401chr1732130 76 29 ------
NM_002430chr221415 ------
NM_002478chr111482 ------
NM_002499chr151764 --1523 --
NM_002538chr5----1128 --
NM_002556chr112482 178 ------
NM_002577chr321247 454 ------
NM_002581chr934857 3898 1279 ------
NM_002582chr162271 38 ------
NM_002594chr2012424 ------
NM_002595chr1211224 --11767 --
NM_002600chr11232 11219 ----
NM_002613chr1643632 1602 1203 978 --1218 --
NM_002628chr311123 1991 ----
NM_002655chr833953 3371 1958 ------
NM_002699chr1----187 --
NM_002709chr223079 362 ------
NM_002716chr1111301 --13077 --
NM_002731chr11387 ------
NM_002734chr171139 ------
NM_002737chr1741904 1804 987 734 ------
NM_002745chr2243490 1687 865 274 ------
NM_002753chr41351 ------
NM_002756chr17----1974 --
NM_002765chrX1365 ------
NM_002821chr61758 ------
NM_002823chr21599 ------
NM_002834chr1233092 814 803 11386 12771 12505
NM_002839chr91881 ------
NM_002843chr11--12328 13395 --
NM_002845chr181525 ------
NM_002867chr12546 132 ------
NM_002874chr932365 1787 499 ------
NM_002892chr1411162 ------
NM_002897chr22751 509 ------
NM_002941chr31119 ------
NM_002951chr201250 ------
NM_002958chr31906 ------
NM_002998chr81776 ------
NM_003001chr1----1430 --
NM_003010chr171541 ------
NM_003011chr921498 1277 ------
NM_003024chr211893 --1258 --
NM_003045chr1321185 561 ----13084
NM_003069chrX1574 ------
NM_003070chr91793 ------
NM_003081chr2011011 ------
NM_003108chr246045 4908 4737 1953 ------
NM_003112chr712894 ------
NM_003144chr61743 ------
NM_003150chr171807 --12237 --
NM_003155chr822544 366 12404 ----
NM_003156chr111271 ------
NM_003161chr1733328 1054 314 ------
NM_003173chrX2273 213 ------
NM_003178chr331737 865 101 ------
NM_003194chr61221 ------
NM_003199chr1845128 4250 1322 889 ----14934
NM_003204chr1721349 272 ------
NM_003255chr171854 --1398 --
NM_003275chr911227 ------
NM_003291chr132564 273 ------
NM_003304chr311579 ------
NM_003338chr10--1731 ----
NM_003339chr51990 ------
NM_003341chr32624 279 ------
NM_003342chr1713154 --12225 --
NM_003344chr71637 --11421 --
NM_003345chr163569 528 84 ------
NM_003348chr1211509 ------
NM_003373chr1031632 479 85 ------
NM_003400chr22685 642 ------
NM_003405chr221632 --1190 --
NM_003407chr191553 ------
NM_003411chrY1220 ------
NM_003412chr311135 12027 ----
NM_003423chr1921053 445 ------
NM_003439chr722461 1360 --12800 --
NM_003468chr211300 1983 1453 --
NM_003471chr31673 1154 ----
NM_003473chr10--1423 ----
NM_003478chr1131244 750 330 ------
NM_003482chr121909 --11900 --
NM_003558chr91217 ------
NM_003566chr1233452 410 102 ------
NM_003567chr1----1280 --
NM_003574chr1854783 4421 4324 1485 365 14197 12288 --
NM_003590chr21384 ----13296
NM_003607chr11253 11655 ----
NM_003613chr15------1626
NM_003620chr172933 203 ------
NM_003633chr511950 --12323 --
NM_003659chr22833 311 ------
NM_003670chr311199 ------
NM_003671chr952359 786 730 339 105 12381 ----
NM_003710chr151442 ------
NM_003714chr522320 2204 ------
NM_003722chr312656 ------
NM_003743chr222208 113 ------
NM_003758chr152304 252 2259 216 ----
NM_003758chr152304 252 2259 216 ----
NM_003769chr12----1272 --
NM_003787chr18--1436 ----
NM_003794chr321073 145 1845 ----
NM_003822chr122971 839 ------
NM_003870chr1522081 304 ------
NM_003872chr2----12784 --
NM_003885chr1722170 471 --1559 --
NM_003887chr222205 570 ------
NM_003895chr2121923 1700 ------
NM_003913chr61257 ------
NM_003927chr181947 ------
NM_003930chr72923 143 1227 --1478
NM_003941chr732329 2236 1569 ------
NM_003947chr3----1230 --
NM_003958chr61482 ------
NM_003983chr1613966 ------
NM_004050chr1421796 238 ------
NM_004093chr1323022 2322 ------
NM_004100chr612351 --1248 --
NM_004116chr21152 ------
NM_004124chr14--12664 13039 --
NM_004130chr3--198 ----
NM_004157chr3------1865
NM_004161chr221078 256 ------
NM_004162chr31954 ------
NM_004171chr1128600 1973 --11485 --
NM_004200chr1121308 732 ------
NM_004210chr101629 --12144 --
NM_004232chr1823667 3561 11302 ----
NM_004263chr2----21797 1313 --
NM_004274chr141517 ----12915
NM_004281chr101209 ------
NM_004302chr121693 ------
NM_004316chr1211070 ------
NM_004338chr1846996 5348 4345 1310 16637 ----
NM_004346chr411401 ------
NM_004349chr82527 194 ------
NM_004352chr161517 ------
NM_004370chr621468 758 ------
NM_004379chr221730 671 ------
NM_004388chr1--182 ----
NM_004392chr131778 ------
NM_004393chr3----22266 662 --
NM_004395chr51788 ------
NM_004411chr71258 ------
NM_004424chr161145 ------
NM_004426chr121397 --1162 --
NM_004429chrX11456 ------
NM_004430chr8----11693 --
NM_004432chr9----11896 --
NM_004438chr222261 143 ------
NM_004457chr221534 505 ------
NM_004458chrX11010 ------
NM_004469chrX162 ------
NM_004481chr112344 ------
NM_004500chr141363 11492 ----
NM_004501chr133755 671 312 --11640 --
NM_004505chr1712008 ------
NM_004525chr211460 ------
NM_004529chr921231 437 ------
NM_004535chr2011625 ------
NM_004540chr211190 ------
NM_004586chrX11701 14671 14035 --
NM_004588chr1123131 1333 --1818 --
NM_004598chr51109 ------
NM_004602chr2011172 ------
NM_004612chr924409 3978 ------
NM_004616chr12151 ------
NM_004622chr231884 447 42 197 --12421
NM_004685chr1332628 1065 975 ------
NM_004694chr171782 ------
NM_004717chr711317 ------
NM_004725chr1011446 1414 ----
NM_004726chrX24790 3612 ------
NM_004730chr5----1294 --
NM_004736chr122103 835 --1578 --
NM_004747chr1021204 416 ------
NM_004779chr51251 1377 ----
NM_004788chr11--12446 --12499
NM_004801chr21266 ------
NM_004821chr52549 146 ------
NM_004834chr21715 12774 ----
NM_004841chr1--195 ----
NM_004850chr221726 277 ------
NM_004859chr17--12373 ----
NM_004871chr1721438 245 ------
NM_004902chr201709 ------
NM_004905chr1------2890 117
NM_004906chr6--1237 ----
NM_004938chr911260 11216 ----
NM_004947chr31458 ------
NM_004948chr1821411 1100 --1116 --
NM_004949chr1812078 ------
NM_004985chr1224372 994 ------
NM_004992chrX25866 5570 --18320 1356
NM_004992chrX25866 5570 --18320 1356
NM_005045chr72962 47 ------
NM_005056chr121339 --14114 --
NM_005087chr31249 ------
NM_005099chr121276 76 ------
NM_005109chr3158 ----1646
NM_005116chr2043755 1394 1346 512 ------
NM_005121chr17----1596 --
NM_005126chr3--11712 ----
NM_005134chr18----1644 --
NM_005135chr1513132 ------
NM_005139chr41322 ------
NM_005151chr181476 --1712 --
NM_005153chr162513 220 ------
NM_005156chr923306 1563 ------
NM_005180chr1011188 1551 --11119
NM_005188chr1117453 1774 12879 --
NM_005194chr201443 ------
NM_005197chr1426061 5830 1736 25044 2463 --
NM_005206chr172914 370 ------
NM_005219chr511608 --11530 --
NM_005225chr20----11108 --
NM_005241chr31428 ------
NM_005271chr102497 350 ------
NM_005316chr112415 316 ------
NM_005324chr1721654 184 1203 ----
NM_005334chrX11749 ------
NM_005336chr221975 1472 ------
NM_005339chr433468 1669 725 ------
NM_005358chr1331706 1524 746 1599 152 --
NM_005359chr18----14009 1799
NM_005392chr9--1214 ----
NM_005406chr1811154 ------
NM_005433chr182754 138 12698 ----
NM_005436chr1023577 1228 ------
NM_005440chr1733183 3106 573 ------
NM_005455chr111555 ------
NM_005493chr61121 1557 ----
NM_005497chr1725685 4439 --15345 --
NM_005502chr91348 ------
NM_005536chr8132 ------
NM_005570chr18150 ------
NM_005586chr61643 ------
NM_005596chr936282 2213 1141 ------
NM_005599chr121472 74 ------
NM_005602chr32427 181 ------
NM_005610chr11808 ------
NM_005618chr61239 ------
NM_005637chr18--22051 1367 ----
NM_005647chrX43137 877 648 63 12392 ----
NM_005656chr21129 ------
NM_005667chr21158 ------
NM_005669chr511994 1264 ----
NM_005678chr152656 403 ------
NM_005688chr3----21161 1154 --
NM_005730chr1221145 878 ------
NM_005736chr1011619 --11023 --
NM_005786chr18199 ------
NM_005796chr161290 ------
NM_005806chr2131309 927 532 ------
NM_005819chr132908 795 342 1863 ----
NM_005840chrX47431 7130 5269 2310 ------
NM_005842chr131714 ------
NM_005904chr18----1110 --
NM_005909chr51102 --12902 --
NM_005910chr1724124 1272 --13615 --
NM_005923chr61596 ------
NM_005924chr71243 --11027 --
NM_005935chr425115 4748 ------
NM_005955chr131031 782 414 --23751 597 --
NM_005964chr173368 356 321 --1329 --
NM_005966chr2--11733 ----
NM_006007chr9--13362 14032 --
NM_006010chr31188 ------
NM_006011chr1514313 ------
NM_006036chr2----11601 --
NM_006037chr233670 1752 1032 --11946 --
NM_006048chr1----1246 --
NM_006054chr1111476 162 ----
NM_006091chr15142 ------
NM_006100chr31115 ------
NM_006135chr11418 ------
NM_006158chr8--11558 ----
NM_006162chr1821495 1314 ------
NM_006186chr2--1182 ----
NM_006195chr911042 ------
NM_006197chr831436 1429 475 ------
NM_006216chr2----1613 --
NM_006259chr4--1929 ----
NM_006265chr811483 ------
NM_006287chr21159 ------
NM_006293chr1511024 ------
NM_006352chr111664 ------
NM_006374chr2----137 --
NM_006403chr6----11652 --
NM_006439chr41395 ------
NM_006451chr51749 ------
NM_006459chr1011701 ------
NM_006460chr1721381 207 ------
NM_006478chr22--1183 ----
NM_006504chr1022876 773 ------
NM_006534chr2023323 530 ------
NM_006542chr11167 ------
NM_006559chr1178 ------
NM_006561chr1015468 ------
NM_006575chr141531 ------
NM_006595chr111624 ------
NM_006599chr16--17877 ----
NM_006609chr211124 ------
NM_006624chr1021850 1610 ------
NM_006628chr1533799 3064 989 ------
NM_006650chr553901 3811 3522 2859 274 ------
NM_006653chr6----199 --
NM_006654chr1211032 ------
NM_006699chr1--1862 ----
NM_006703chr61151 ------
NM_006706chr5--1794 ----
NM_006750chr1638121 482 458 ------
NM_006754chr7--1928 ----
NM_006769chr1--1577 ----
NM_006772chr611611 ------
NM_006802chr11390 ------
NM_006826chr2--1926 ----
NM_006838chr121385 ------
NM_006852chr1711772 1516 ----
NM_006918chr1115412 15881 ----
NM_006922chr211663 --1206 --
NM_006927chr1631990 1497 805 --1526 --
NM_006951chr101699 ------
NM_006981chr91372 ------
NM_007005chr921161 512 ------
NM_007007chr121196 --11734 --
NM_007011chr1525599 964 11497 1277 --
NM_007017chr5------1743
NM_007067chr172208 81 ------
NM_007078chr1022743 669 --11942 --
NM_007106chr1322228 1960 ------
NM_007114chr3--12563 ----
NM_007122chr1----1603 --
NM_007126chr91421 ------
NM_007137chrX13417 15317 14340 --
NM_007146chr171985 ------
NM_007150chrX2526 80 ------
NM_007158chr111124 ------
NM_007174chr1231835 1817 1543 ------
NM_007203chr933791 2478 311 ------
NM_007214chr611319 ------
NM_007246chr41274 ------
NM_007249chr1323388 655 11699 ----
NM_007276chr71214 1822 ----
NM_007294chr1721167 1129 ------
NM_007295chr1721167 1129 ------
NM_007296chr1721167 1129 ------
NM_007297chr1721167 1129 ------
NM_007298chr1721167 1129 ------
NM_007299chr1721167 1129 ------
NM_007300chr1721167 1129 ------
NM_007302chr1721167 1129 ------
NM_007303chr1721167 1129 ------
NM_007304chr1721167 1129 ------
NM_007305chr1721167 1129 ------
NM_007358chr131677 1479 753 ------
NM_007363chrX1866 ------
NM_012081chr533726 635 68 ------
NM_012090chr111084 ------
NM_012120chr632701 878 697 ------
NM_012124chr111916 ------
NM_012137chr1123 ----1801
NM_012141chr13--13809 ----
NM_012164chr921530 346 --37357 5140 1847 --
NM_012176chr5155 ------
NM_012193chr1134544 3494 272 14292 11620 --
NM_012199chr113542 --1596 --
NM_012218chr1932772 2735 125 ------
NM_012224chr41767 ------
NM_012232chr1722191 1723 ------
NM_012238chr1011359 ------
NM_012249chr21420 --1482 --
NM_012252chr755055 1866 1251 1146 83 ------
NM_012255chr201164 ------
NM_012272chr12----1159 --
NM_012286chrX--1192 ----
NM_012294chr73706 95 72 ------
NM_012295chr22----1409 --
NM_012308chr11--1762 12009 --
NM_012309chr1124987 3297 ------
NM_012329chr1711238 ------
NM_012333chr111263 ------
NM_012347chr61269 ------
NM_012383chr9139 ------
NM_012412chr71658 ------
NM_012416chr9--1279 ----
NM_012428chr151236 ------
NM_012445chr42534 370 ------
NM_012446chr51426 ------
NM_012464chr41389 ------
NM_012479chr7--12434 ----
NM_013231chr1434189 2862 251 ------
NM_013233chr21261 ------
NM_013254chr121119 ------
NM_013279chr112178 163 ------
NM_013293chr71153 ------
NM_013322chr711191 ------
NM_013341chr2--12589 1494 --
NM_013354chr8--11020 ----
NM_013374chr3--1737 ----
NM_013381chr12--1611 ----
NM_013392chr21417 ------
NM_013396chr21184 ------
NM_013436chr22601 189 ------
NM_013438chr911541 ------
NM_013446chr711287 ------
NM_013958chr8134 1370 ----
NM_013959chr8134 1370 ----
NM_013961chr8134 1370 ----
NM_013962chr8134 1370 ----
NM_014000chr1031632 479 85 ------
NM_014016chr3--11352 ----
NM_014023chr1021829 178 ------
NM_014043chr31411 ------
NM_014089chr1332278 1501 724 ------
NM_014112chr834443 2039 1962 15293 ----
NM_014117chr1621877 134 1237 ----
NM_014153chr161227 ----1451
NM_014168chr2123 ------
NM_014181chr2--12886 ----
NM_014182chr121593 ------
NM_014212chr12--1710 ----
NM_014217chr1169 ------
NM_014240chr323891 275 --150 --
NM_014243chr42575 159 1250 1267 --
NM_014251chr71793 ------
NM_014271chrX1233 ------
NM_014280chr11377 ------
NM_014282chr921116 103 ------
NM_014283chr111325 ------
NM_014300chr151429 ------
NM_014309chr2235366 3680 2062 ------
NM_014319chr1231748 1244 469 ------
NM_014345chr61401 ------
NM_014372chr121618 411 ------
NM_014382chr3--11568 1662 --
NM_014399chr71178 ------
NM_014423chr5--23811 871 --14091
NM_014445chr312363 ------
NM_014454chr62828 304 ------
NM_014494chr1611882 11720 ----
NM_014562chr22746 66 ------
NM_014586chr2124517 3112 ------
NM_014587chr1611345 11203 ----
NM_014612chr911096 ------
NM_014616chr31295 ------
NM_014629chr811282 ------
NM_014630chr1532878 1493 869 ------
NM_014636chr914293 --1425 --
NM_014647chr1611883 ------
NM_014665chr853009 2885 2802 1420 1200 ----13083
NM_014670chr2----1155 --
NM_014676chr111087 1595 1113 --
NM_014677chr8167 ------
NM_014682chr8195 ------
NM_014705chr731843 519 166 --22121 577 --
NM_014707chr71550 ------
NM_014713chr21487 ------
NM_014717chr191543 ------
NM_014729chr8--1111 ----
NM_014751chr8--12066 ----
NM_014752chr111370 ------
NM_014755chr221627 1260 11309 11447 --
NM_014772chr1811263 --22455 723 --
NM_014781chr8--11155 ----
NM_014784chr11161 ------
NM_014787chr111780 ------
NM_014826chr11253 11655 ----
NM_014828chr1422431 2416 12009 ----
NM_014830chr1222797 1155 ------
NM_014832chr1321740 70 2743 212 ----
NM_014841chr6--11158 ----
NM_014846chr8190 ------
NM_014873chr143658 1506 1194 481 --11786 --
NM_014874chr11188 ------
NM_014877chr1746576 5132 4714 2280 ------
NM_014887chr131772 ------
NM_014893chrY21957 893 --11660 --
NM_014904chr1022541 1083 ------
NM_014912chr101559 --1885 --
NM_014917chr11971 ------
NM_014934chr1313105 ------
NM_014937chr10--11263 ----
NM_014946chr222559 2385 ------
NM_014947chr143107 2799 1127 626 12624 ----
NM_014949chr11777 --1289 --
NM_014962chr2022572 534 ------
NM_014974chr1021488 1296 ------
NM_014990chr141146 ------
NM_014994chr1532314 1804 712 ------
NM_015002chr1231454 190 134 ------
NM_015020chr1643218 2615 702 143 ------
NM_015023chr111807 --1592 1157
NM_015024chr821420 1258 ------
NM_015025chr222638 2067 ------
NM_015035chr2066531 6509 6096 5956 5484 4927 --11402 --
NM_015039chr111489 14334 ----
NM_015044chr1612818 --1427 --
NM_015068chr7----11597 --
NM_015071chr532144 1754 1569 1118 ----
NM_015085chr1714331 11009 ----
NM_015092chr1643134 3025 485 425 --14125 --
NM_015106chr32158 45 ------
NM_015115chr4----13006 --
NM_015143chr41282 ------
NM_015144chr1643217 948 262 81 ------
NM_015155chr1032925 2546 25 13022 13225 --
NM_015172chr111366 ------
NM_015191chr1141701 1680 687 163 1934 ----
NM_015192chr201573 ------
NM_015197chr1422561 592 13347 ----
NM_015219chr1741907 1685 1625 699 ------
NM_015229chr172861 275 ------
NM_015247chr161416 ------
NM_015263chr151342 ------
NM_015265chr222164 554 --12112 --
NM_015267chr121453 12209 ----
NM_015285chr182300 61 ------
NM_015288chr542386 2368 1182 355 ------
NM_015296chr131118 ------
NM_015316chr142523 310 ------
NM_015322chr15123 ------
NM_015326chr132411 2150 1903 ------
NM_015327chr111315 ------
NM_015338chr203576 336 277 ------
NM_015347chr1232705 815 584 --11955 --
NM_015358chr211323 ------
NM_015375chr144117 3857 909 525 ------
NM_015387chr211776 ------
NM_015397chr9--1258 1380 --
NM_015530chr21643 ------
NM_015537chr91137 ------
NM_015541chr31132 --1334 --
NM_015568chr2024282 3177 11046 ----
NM_015575chr211426 ------
NM_015609chr142807 67 53 30 ------
NM_015640chr125053 4184 ------
NM_015657chr2--1195 ----
NM_015840chr1161 ------
NM_015841chr1161 ------
NM_015850chr811498 21968 753 --1696
NM_015855chr111766 ------
NM_015872chr11621 ------
NM_015906chr144646 2933 400 91 ------
NM_015955chr2--1515 ----
NM_015981chr5128 ------
NM_015982chr17----1308 --
NM_016018chr821128 303 --1448 --
NM_016022chr11740 ------
NM_016025chr1631954 1677 1574 --11630 --
NM_016060chr1711108 ------
NM_016073chr151226 1887 ----
NM_016107chr52361 264 ------
NM_016131chr211971 ------
NM_016141chr31617 ------
NM_016169chr1013242 ------
NM_016185chr172826 26 ------
NM_016205chr41905 1539 ----
NM_016227chr111325 ------
NM_016258chr1134 ------
NM_016260chr211511 ------
NM_016271chr181309 ------
NM_016272chr222906 597 ------
NM_016281chr121100 ------
NM_016303chrX--1104 ----
NM_016322chr922114 950 --12561 --
NM_016422chr1122136 1159 127 ----
NM_016436chr2012669 ------
NM_016441chr21864 1237 21832 435 --
NM_016442chr5----1864 --
NM_016463chr51164 ------
NM_016467chr211122 ------
NM_016529chr1311124 1247 1471 --
NM_016575chr1223931 83 ------
NM_016577chr32614 51 11138 11573 --
NM_016587chr71214 1822 ----
NM_016607chrX1210 ------
NM_016621chr1113369 ------
NM_016628chr10--1656 ----
NM_016824chr1011619 ------
NM_016834chr1724124 1272 --13615 --
NM_016835chr1724124 1272 --13615 --
NM_016836chr22751 509 ------
NM_016839chr22751 509 ------
NM_016841chr1724124 1272 --13615 --
NM_017420chr1421509 788 ------
NM_017423chr4----12208 --
NM_017452chr2011172 ------
NM_017453chr2011172 ------
NM_017454chr2011172 ------
NM_017455chr151236 ------
NM_017519chr61252 ------
NM_017540chr523048 364 11999 ----
NM_017544chrX176 ------
NM_017545chr201121 ------
NM_017577chr311598 --1375 --
NM_017602chrX----1649 --
NM_017628chr434126 837 793 --1847 --
NM_017629chr131923 1804 1403 ------
NM_017633chr6----13336 --
NM_017645chr923068 2400 12775 ----
NM_017657chr21251 ------
NM_017658chr14----1172 --
NM_017715chr7124 ------
NM_017719chr312479 ------
NM_017730chr31250 ------
NM_017736chr16156 ------
NM_017742chr181781 ------
NM_017745chrX----1708 --
NM_017753chr92375 71 ------
NM_017778chr811085 ------
NM_017786chr81100 ------
NM_017798chr201129 ------
NM_017811chr9------1771
NM_017870chr111180 ------
NM_017926chr142302 41 ------
NM_017933chr211570 ------
NM_017938chrX32138 849 308 ------
NM_017944chr1122795 912 ------
NM_017972chr142302 41 ------
NM_017998chr9----1937 --
NM_018004chr31387 ------
NM_018011chr131496 ------
NM_018027chr1022193 937 --13118 --
NM_018030chr18----1281 --
NM_018046chr5--1595 ----
NM_018048chr1221957 267 ------
NM_018061chr11301 ------
NM_018067chr1----1501 --
NM_018086chr21343 ------
NM_018098chr3--1269 ----
NM_018117chr101754 1550 ----
NM_018120chr81201 ------
NM_018182chr17--1409 ----
NM_018214chr6--11083 ----
NM_018243chr422790 298 ------
NM_018247chr612542 12043 ----
NM_018254chr11567 ------
NM_018257chr201401 ------
NM_018293chr3--12080 ----
NM_018315chr421198 619 ------
NM_018323chr4--195 ----
NM_018348chr16167 ------
NM_018364chr133616 3518 454 11024 ----
NM_018367chr111353 ------
NM_018374chr71941 --13882 --
NM_018375chr1411905 ------
NM_018425chr1032218 2074 471 ------
NM_018436chr21100 ------
NM_018442chr11369 ------
NM_018452chr6_random33003 2821 2683 ------
NM_018462chr3131 ------
NM_018482chr81908 --11874 11630
NM_018488chr17138 ------
NM_018557chr211157 --11429 --
NM_018700chr531210 303 170 ------
NM_018712chr1121326 72 ------
NM_018847chr931929 447 371 ------
NM_018963chr2121367 1047 ------
NM_018976chr1211954 ------
NM_018979chr121888 ------
NM_018999chr1014081 ------
NM_019000chr5--11697 ----
NM_019001chr333797 3614 3548 ------
NM_019022chr1812740 ------
NM_019063chr212032 ------
NM_019106chr2211274 13421 ----
NM_019116chr1653064 2914 1377 1281 410 ------
NM_019555chr3--11587 ----
NM_019556chrX1460 ------
NM_019590chr10--1196 ----
NM_019593chr2022740 940 ------
NM_019597chrX2679 673 ------
NM_019600chr15------1564
NM_019605chr11126 ------
NM_019854chr121611 ------
NM_019903chr1011619 ------
NM_020116chr411265 ------
NM_020117chr51964 1255 ----
NM_020122chr245342 4913 3708 1582 15662 --14474
NM_020156chr72526 417 ------
NM_020177chr511259 ------
NM_020179chr111100 ------
NM_020182chr2033286 3185 2505 --12568 --
NM_020193chr111144 ------
NM_020198chr1721261 375 ------
NM_020225chr41356 ------
NM_020239chr112064 --12040 --
NM_020245chr644298 4221 2013 163 ------
NM_020341chr2011314 --11521 11561
NM_020342chr212128 ------
NM_020362chr11317 ------
NM_020403chr13----1619 --
NM_020437chr22--1328 ----
NM_020449chrX1201 ------
NM_020453chr411448 ------
NM_020463chr2----1335 --
NM_020630chr102647 530 ------
NM_020651chr211512 ------
NM_020693chr111474 ------
NM_020699chr121422 1313 ------
NM_020708chr2032288 2218 707 ------
NM_020718chr1646334 6206 5341 601 ------
NM_020728chr723059 2828 ------
NM_020732chr61252 ------
NM_020734chr1222277 789 ------
NM_020747chr52623 164 ------
NM_020766chrX54346 4023 3973 1159 968 ------
NM_020772chr1716048 --15760 --
NM_020774chr1816209 ------
NM_020783chr18--1122 ----
NM_020791chr1721315 943 ------
NM_020799chr10158 --1174 --
NM_020800chr3------179
NM_020801chr51263 ------
NM_020808chr11757 ------
NM_020810chr1421363 823 ------
NM_020818chr14--1333 ----
NM_020819chr61769 ------
NM_020850chr16----12994 --
NM_020856chr19------11248
NM_020860chr411047 ------
NM_020868chr22316 80 1182 ----
NM_020899chr172685 434 ------
NM_020918chr1022793 1336 ------
NM_020921chr1422533 888 13126 ----
NM_020940chr101723 12628 ----
NM_020958chr141134 ------
NM_020962chr151129 ------
NM_020987chr1011007 1943 ----
NM_020993chr1232377 996 296 ------
NM_021012chr173727 129 105 --159 --
NM_021035chr202948 321 ------
NM_021038chr323286 2622 12103 ----
NM_021072chr51270 ------
NM_021083chrX33605 3242 2807 ------
NM_021096chr2233227 3185 2115 ------
NM_021111chr911266 ------
NM_021132chr101946 ------
NM_021136chr14--1246 ----
NM_021145chr721131 141 ------
NM_021159chr41238 ------
NM_021183chrX22280 94 ------
NM_021188chr141447 ------
NM_021190chr1--1329 ----
NM_021215chr2022419 1642 ------
NM_021249chr1421463 1193 ------
NM_021255chr1432729 1512 1174 ------
NM_021627chr321216 1073 ------
NM_021728chr141928 ------
NM_021813chr614760 ------
NM_021911chr51122 --1161 --
NM_021946chrX----21297 220 --
NM_021951chr9--1802 ----
NM_021961chr1126163 4892 ----15521
NM_021964chr325423 5276 ----15166
NM_021973chr4----1534 --
NM_021998chrX11223 ------
NM_022075chr11227 ------
NM_022085chr61560 ------
NM_022351chr8--13442 ----
NM_022361chr6------1390
NM_022372chr162529 175 ------
NM_022465chr12----11076 --
NM_022557chr171186 ------
NM_022574chr712007 ------
NM_022658chr1221069 1062 ------
NM_022719chr2242510 2414 419 272 --1793 --
NM_022749chr821155 1064 ------
NM_022781chr91290 ------
NM_022802chr1011459 ------
NM_022822chr111877 ------
NM_022826chr21172 ------
NM_022831chr111675 ------
NM_022842chr322681 299 ------
NM_022893chr232319 428 412 ------
NM_022898chr14--11100 ----
NM_022918chr111179 ------
NM_022977chrX11010 ------
NM_023000chr1411162 ------
NM_023001chr1411162 ------
NM_023037chr13----1746 --
NM_023075chr182671 252 1868 ----
NM_023105chr811498 21968 753 --1696
NM_023106chr811498 21968 753 --1696
NM_023110chr811498 21968 753 --1696
NM_023111chr811498 21968 753 --1696
NM_023929chr81118 ------
NM_024007chr512761 ------
NM_024046chr311084 ------
NM_024055chr51615 ------
NM_024057chr121130 ------
NM_024090chr411847 ------
NM_024122chrX--1251 ----
NM_024329chr111181 ------
NM_024520chr2140 ------
NM_024539chrX1312 ------
NM_024554chr111457 --21168 170 --
NM_024595chr121193 172 ------
NM_024612chr172415 200 ------
NM_024615chr5----1249 --
NM_024636chr722079 2017 ------
NM_024686chr11500 ------
NM_024721chr812684 ------
NM_024725chr111865 ------
NM_024755chr151260 1578 ----
NM_024770chr254610 2132 1926 1142 861 ------
NM_024780chr1611035 1392 ----
NM_024811chr11----21316 719 --
NM_024834chr1031917 672 284 ------
NM_024837chr151484 ------
NM_024875chr10156 ------
NM_024949chr4--14631 24539 3040 --
NM_024989chr21834 ------
NM_025054chr824072 656 ------
NM_025076chr2176 ------
NM_025126chr121514 ------
NM_025133chr21362 ------
NM_025138chr1331444 397 155 11112 ----
NM_025160chr133588 3001 339 1199 ----
NM_025164chr1132239 1682 812 ------
NM_025187chr1621392 453 ------
NM_025195chr81570 --11761 --
NM_025222chr322588 2470 12980 ----
NM_030621chr1423364 996 --1550 --
NM_030625chr10182 ------
NM_030627chr51219 ------
NM_030629chr1621872 1522 ------
NM_030661chr7----2206 63 --
NM_030762chr12--11383 ----
NM_030772chr1157 1457 ----
NM_030795chr81461 ------
NM_030799chr512084 ------
NM_030806chr139292 1873 223 ----1518
NM_030810chr61560 ------
NM_030816chr113157 ------
NM_030918chr121485 312 1928 ----
NM_030920chr1----1507 --
NM_030939chr611101 ------
NM_030953chr511552 ------
NM_030962chr11------1147
NM_031244chr611138 ------
NM_031268chr1643632 1602 1203 978 --1218 --
NM_031309chr821541 904 --1597 --
NM_031314chr141363 11492 ----
NM_031439chr81263 ------
NM_031442chrX22443 737 ------
NM_031443chr71407 ------
NM_031445chr233382 2575 1234 ------
NM_031452chr15----1172 --
NM_031468chr72469 163 --17753 --
NM_031844chr133755 671 312 --11640 --
NM_031845chr223673 977 ------
NM_031847chr223673 977 ------
NM_032042chr52200 122 12722 ----
NM_032153chr312355 ------
NM_032160chr1814262 ------
NM_032182chr101615 ------
NM_032193chr1111268 ------
NM_032208chr223652 2319 1672 ----
NM_032211chr1011212 ------
NM_032221chr201414 ------
NM_032231chr15--1254 ----
NM_032291chr111238 ------
NM_032312chr22658 90 ------
NM_032373chr1044108 2278 2095 859 15508 ----
NM_032377chr191626 ------
NM_032379chr111827 ------
NM_032410chr821123 844 ------
NM_032445chr15----1428 --
NM_032452chr142291 34 ------
NM_032458chrX13220 ------
NM_032510chr1822136 705 ------
NM_032521chr201324 ------
NM_032539chrX1577 ------
NM_032549chr7124 ------
NM_032560chr14--1322 ----
NM_032574chr2--133 ----
NM_032595chr1711573 ------
NM_032632chr1411920 ------
NM_032646chr1711656 ------
NM_032682chr312980 --12601 --
NM_032711chr1733935 3186 238 ------
NM_032728chr9----1914 --
NM_032731chr1711479 ------
NM_032784chr6--1137 ----
NM_032810chr1011130 ------
NM_032812chr101319 ------
NM_032859chr1321093 607 1285 ----
NM_032875chr172702 608 ------
NM_032943chr111827 ------
NM_032947chr51122 ------
NM_032975chr18----13250 --
NM_032980chr18----13250 --
NM_032991chr411401 ------
NM_032998chr1----1728 --
NM_032999chr721095 816 ------
NM_033000chr721095 816 ------
NM_033001chr721095 816 ------
NM_033020chr144646 2933 400 91 ------
NM_033025chr192114 94 ------
NM_033027chr3141 ------
NM_033044chr111084 ------
NM_033056chr102757 686 ------
NM_033102chr11105 ------
NM_033102chr11105 ------
NM_033124chr12--1111 ----
NM_033211chr51339 ------
NM_033224chr735292 2419 395 13153 2891 826 --
NM_033225chr822427 327 ------
NM_033317chr19146 ------
NM_033331chr952359 786 730 339 105 12381 ----
NM_033338chr10----11355 --
NM_033339chr10----11355 --
NM_033340chr10----11471 --
NM_033360chr1224493 1115 ------
NM_033387chr942605 778 615 277 ------
NM_033425chr1143139 2885 570 401 ------
NM_033427chr71178 ------
NM_033480chr61269 ------
NM_033481chr61269 ------
NM_033512chr812941 --1765 --
NM_033624chr1231454 190 134 ------
NM_033632chr421198 619 ------
NM_044472chr12512 506 ------
NM_052834chr182300 61 ------
NM_052840chr1511533 ------
NM_052869chr1711656 ------
NM_052906chr2234219 3841 1657 ------
NM_052911chr18----158 --
NM_052917chr232446 727 393 13220 ----
NM_052918chr102469 154 12827 ----
NM_052927chr512092 12067 ----
NM_052928chr1721077 289 ------
NM_053016chr935190 3208 978 ----1482
NM_053023chr1122807 188 1898 ----
NM_053024chr311445 11313 ----
NM_053043chr71406 ------
NM_053044chr41914 ------
NM_053053chr12895 148 ------
NM_053056chr1113093 --12204 --
NM_058172chr4------11217
NM_058191chr211824 ------
NM_058229chr81165 ------
NM_058241chr231807 350 100 ------
NM_058241chr231807 350 100 ------
NM_079421chr191391 ------
NM_080391chr11547 ------
NM_080392chr11596 ------
NM_080546chr912169 ------
NM_080597chr18----1281 --
NM_080617chr201717 ------
NM_080645chr621468 758 ------
NM_080676chr2013105 ------
NM_080677chr17158 ------
NM_080752chr201407 ------
NM_080759chr131778 ------
NM_080760chr131778 ------
NM_080867chr1433901 1530 899 ------
NM_080881chr51788 ------
NM_080927chr3--13277 ----
NM_100264chr10--1656 ----
NM_100486chr10--1656 ----
NM_130387chr311194 ------
NM_130391chr91881 ------
NM_130392chr91881 ------
NM_130393chr91881 ------
NM_130435chr1022876 773 ------
NM_130436chr2122329 784 11777 ----
NM_130438chr2122906 1361 12354 ----
NM_130811chr2011011 ------
NM_133334chr436091 689 337 26275 390 ----
NM_133465chr91356 ------
NM_133467chr1----1419 --
NM_133468chr71613 ------
NM_133631chr31119 ------
NM_133638chr5----1966 --
NM_133647chr1513132 ------
NM_134442chr221730 671 ------
NM_138270chrX22224 863 ------
NM_138285chr2------125
NM_138373chr1931717 1292 491 ------
NM_138426chr71842 ------
NM_138576chr14--11100 ----
NM_138635chr71284 ------
NM_138713chr16--17877 ----
NM_138714chr16--17877 ----
NM_138729chr1199 ------
NM_138735chr21266 ------
NM_138799chr222047 281 ------
NM_138966chr18----1201 --
NM_138980chr41220 ------
NM_138981chr41351 ------
NM_138982chr41220 ------
NM_139012chr611632 --1469 --
NM_139035chrX1574 ------
NM_139045chr91793 ------
NM_139057chr1512695 --2816 21 --
NM_139159chr192855 214 ------
NM_139273chr111220 ------
NM_139276chr171807 --12237 --
NM_144568chr14----2639 219 --
NM_144571chr426281 583 137 14481 --
NM_144578chr1434792 3351 1325 12118 ----
NM_144628chr2021074 1014 1901 ----
NM_144635chr32831 228 ------
NM_144691chr19--1603 142 --
NM_144721chr4----1724 12652
NM_144963chr8122 ------
NM_144967chrX1909 ------
NM_144973chr12----24753 1463 --
NM_145014chr112339 310 ------
NM_145055chr1813587 11370 ----
NM_145109chr17----1974 --
NM_145117chr111254 ------
NM_145159chr14--1219 ----
NM_145251chr141117 ------
NM_145284chrX1589 ------
NM_145349chr1721613 564 ------
NM_145686chr21715 12774 ----
NM_145687chr21715 12774 ----
NM_145733chr22--11210 ----
NM_145735chr1342785 2060 2015 1086 ------
NM_145808chr722127 1144 ------
NM_145891chr16--1699 1227 --
NM_145892chr16--1699 1227 --
NM_145893chr16----1349 --
NM_147150chr933791 2478 311 ------
NM_147161chr11399 --1988 --
NM_147189chr81105 ------
NM_147223chr222391 296 ------
NM_147233chr222208 113 ------
NM_148177chr81165 ------
NM_148957chr131158 1808 ----
NM_152233chr1421463 1193 ------
NM_152236chr22--1183 ----
NM_152237chr22172 11677 ----
NM_152277chr52764 603 --1520 --
NM_152287chr1632330 727 440 ------
NM_152323chr121156 ------
NM_152375chr122636 394 ------
NM_152387chr21322 ------
NM_152409chr521235 1114 ------
NM_152414chr8--11158 ----
NM_152437chr1222363 242 ------
NM_152450chr1522004 407 ------
NM_152470chr18--23779 488 ----
NM_152520chr2--1833 ----
NM_152557chr72572 121 ------
NM_152609chr11386 ------
NM_152622chr511391 13411 ----
NM_152629chr943454 552 188 45 ------
NM_152688chr6------1395
NM_152736chr61875 ------
NM_152765chr822089 350 ------
NM_152787chrX1139 13032 ----
NM_152793chr725061 3454 ------
NM_152857chr62962 745 ------
NM_152858chr62962 745 ------
NM_152890chr11516 ------
NM_152896chr91620 ------
NM_152924chr1525599 964 11497 1277 --
NM_153038chr2--1821 ----
NM_153181chr18----1201 --
NM_153188chr523994 1978 ------
NM_153207chr1222477 538 ------
NM_153208chr161856 ------
NM_153235chr6--21824 1788 ----
NM_153251chr13--1253 ----
NM_153273chr312797 ------
NM_153321chr17----1145 --
NM_153322chr17----1145 --
NM_153426chr4187 ------
NM_153427chr4187 ------
NM_153499chr1222745 27 --1516 --
NM_153500chr1222745 27 --1516 --
NM_153631chr7----2206 63 --
NM_153632chr7----2206 63 --
NM_153810chr1035143 3418 190 11713 ----
NM_170665chr1243880 3736 2928 1465 ------
NM_170692chr1--195 ----
NM_170706chr111489 14334 ----
NM_170719chr1331444 397 155 11112 ----
NM_170721chr171420 ----135
NM_170731chr1112649 ------
NM_170732chr1112649 ------
NM_170733chr1112649 ------
NM_170734chr1112649 ------
NM_170735chr1112649 ------
NM_171825chr5128 ------
NM_172037chr811043 ------
NM_172058chr821649 125 ------
NM_172059chr821649 125 ------
NM_172060chr821649 125 ------
NM_172071chr147344 5035 4550 1080 --15895 --
NM_172103chr612351 --1248 --
NM_172105chr612351 --1248 --
NM_172159chr31673 1154 ----
NM_172160chr31673 1154 ----
NM_172169chr101650 ------
NM_172170chr101650 ------
NM_172171chr101650 ------
NM_172173chr101650 ------
NM_172226chr1222745 27 --1516 --
NM_172337chr141928 ------
NM_172373chr1311104 2938 261 ----
NM_172387chr1821448 1267 ------
NM_172388chr1821495 1314 ------
NM_172389chr1821495 1314 ------
NM_173054chr72962 47 ------
NM_173075chr421371 94 11388 ----
NM_173076chr2--1195 ----
NM_173171chr2--1182 ----
NM_173172chr2--1490 ----
NM_173173chr2--1182 ----
NM_173198chr91372 ------
NM_173200chr91372 ------
NM_173214chr16--17877 ----
NM_173469chr1521352 36 ------
NM_173494chrX----1636 --
NM_173495chrX22051 359 12274 ----
NM_173500chr151335 ------
NM_173510chr221655 1500 ----
NM_173511chr213940 ------
NM_173514chr51643 ------
NM_173557chr181126 1501 ----
NM_173560chr61512 ------
NM_173563chr61122 ------
NM_173576chr101144 ------
NM_173631chr1911190 1138 ----
NM_173694chrX32513 1883 1748 ------
NM_173797chr5189 ------
NM_173808chr123908 323 ------
NM_173809chr1011030 --1392 --
NM_173833chr81159 ------
NM_174911chr821277 379 ------
NM_175058chr1111418 ------
NM_175061chr7145 ------
NM_175607chr321169 1077 ------
NM_175612chr321169 1077 ------
NM_175630chr2152 ------
NM_175634chr82527 194 ------
NM_175635chr82527 194 ------
NM_175636chr82527 194 ------
NM_175709chr2222205 210 ------
NM_175736chr1225778 99 --15290 --
NM_175748chr1422064 1716 ------
NM_175854chr132447 419 ------
NM_175861chr1214758 ------
NM_175863chr61252 ------
NM_175866chr11263 ------
NM_175898chr1521469 22 ------
NM_176812chr202702 145 ------
NM_177438chr1423364 996 --1550 --
NM_177452chr1412088 ------
NM_177559chr201121 ------
NM_177560chr201121 ------
NM_177947chrX1210 ------
NM_177948chrX1210 ------
NM_177990chr2011314 --11521 11561
NM_178026chr201605 ------
NM_178031chr111180 ------
NM_178123chr21702 ------
NM_178314chr12--1846 ----
NM_178819chr81260 ------
NM_181354chr8----11327 --
NM_181358chr1--13781 ----
NM_181443chr2022572 534 ------
NM_181458chr2----1996 --
NM_181481chr1846996 5348 4345 1310 16637 ----
NM_181482chr1846996 5348 4345 1310 16637 ----
NM_181483chr1846996 5348 4345 1310 16637 ----
NM_181489chr335584 2626 2453 ------
NM_181504chr554167 2713 1381 890 459 --13180 --
NM_181523chr554167 2713 1381 890 459 --13180 --
NM_181524chr554167 2713 1381 890 459 --13180 --
NM_181571chr10141 ------
NM_181642chr151442 ------
NM_181659chr2023323 530 ------
NM_181659chr2023323 530 ------
NM_181672chrX31730 1718 569 ------
NM_181673chrX31730 1718 569 ------
NM_181711chr121652 ------
NM_181746chr11227 ------
NM_181838chr51990 ------
NM_182481chr21--1374 ----
NM_182482chr21--1374 ----
NM_182485chr4--1460 ----
NM_182487chr944402 3493 3179 1187 --12889 --
NM_182515chr1944762 1011 933 60 ------
NM_182646chr4--1460 ----
NM_182666chr32624 279 ------
NM_182691chr711144 ------
NM_182692chr711144 ------
NM_182697chr71637 --11421 --
NM_182715chr7--1928 ----
NM_182717chr102980 446 ------
NM_182718chr10141 ------
NM_182719chr10141 ------
NM_182720chr102980 446 ------
NM_182721chr102980 446 ------
NM_182722chr102980 446 ------
NM_182723chr102980 446 ------
NM_182724chr10141 ------
NM_182725chr10141 ------
NM_182765chr101536 ------
NM_182769chr10141 ------
NM_182770chr10141 ------
NM_182771chr10141 ------
NM_182772chr10141 ------
NM_182789chr51749 ------
NM_182850chr10141 ------
NM_182853chr102980 446 ------
NM_182948chr11387 ------
NM_182964chr111254 ------
NM_182970chr2034266 3205 3083 ------
NM_182972chr122005 893 ------
NM_183004chr14----21034 303 --
NM_183011chr102980 446 ------
NM_183012chr102980 446 ------
NM_183013chr102980 446 ------
NM_183060chr10141 ------
NM_183078chr61388 ------
NM_183323chr51749 ------
NM_183416chr111497 ------
NM_184234chr201709 ------
NM_194247chr233966 1638 1258 ------
NM_194259chr163569 528 84 ------
NM_194260chr163569 528 84 ------
NM_194261chr163569 528 84 ------
NM_194271chr121514 ------
NM_194328chr91290 ------
NM_194329chr91290 ------
NM_194330chr91290 ------
NM_194332chr91290 ------
NM_194434chr1854783 4421 4324 1485 365 14197 12288 --
NM_194442chr111165 ------
NM_194449chr18--1367 ----
NM_194463chrX1312 ------
NM_197941chr512867 ------
NM_198128chr181309 ------
NM_198212chr721454 608 ------
NM_198236chr11161 ------
NM_198268chr1--13781 ----
NM_198269chr1--13781 ----
NM_198273chr522943 2375 ------
NM_198279chrX11037 ------
NM_198318chr191175 ------
NM_198319chr191175 ------
NM_198321chr523048 364 11999 ----
NM_198335chr111246 ------
NM_198390chr1621872 1522 ------
NM_198484chr335928 5378 5362 24797 1410 32468 1239 558 --
NM_198485chr321722 306 12453 12295 --
NM_198513chr81549 1557 ----
NM_198576chr1159 ------
NM_198794chr141531 ------
NM_198859chr3--14123 ----
NM_198880chr31250 ------
NM_198900chr1225778 99 --15290 --
NM_198968chr1313105 ------
NM_198989chr131365 1494 ----
NM_199169chr2033286 3185 2505 --12568 --
NM_199170chr2033286 3185 2505 --12568 --
NM_199171chr2033286 3185 2505 --12568 --
NM_199262chr1732135 1983 583 ------
NM_199421chr1433901 1530 899 ------
NM_199436chr222559 2385 ------
NM_199462chr144117 3857 909 525 ------
NM_199482chr211776 ------
NM_201266chr2----12784 --
NM_201279chr2----12784 --
NM_201412chr161152 ------
NM_201428chr1111476 162 ----
NM_201429chr1111476 162 ----
NM_201430chr1111402 ------
NM_201436chr71658 ------
NM_201516chr71714 ------
NM_201517chr71658 ------
NM_201570chr102231 138 ------
NM_201571chr102231 138 ------
NM_201572chr102231 138 ------
NM_201590chr102231 138 ------
NM_201593chr102231 138 ------
NM_201596chr102231 138 ------
NM_201597chr102231 138 ------
NM_203301chr14----1267 --
NM_203303chrX1215 ------
NM_203327chr2043755 1394 1346 512 ------
NM_203329chr1135612 4850 1933 --11916 --
NM_203330chr1135612 4850 1933 --11916 --
NM_203331chr1135612 4850 1933 --11916 --
NM_203346chr221975 1472 ------
NM_203350chr111450 --1706 --
NM_203351chr1732130 76 29 ------
NM_203372chr221534 505 ------
NM_203403chr92378 149 ------
NM_203437chr21251 ------
NM_203446chr2122733 2510 ------
NM_203459chr12736 360 ------
NM_203487chr13----1619 --
NM_205768chr111664 ------
NM_205833chrX171 ------
NM_205842chr22601 189 ------
NM_205848chr122587 1984 ------
NM_205860chr122971 839 ------
NM_206594chr1--12705 ----
NM_206595chr1--12705 ----
NM_206852chr14--1246 ----
NM_206857chr14--1246 ----
NM_206866chr2132855 946 85 ------
NM_206876chr223079 362 ------
NM_206927chr111827 ------
NM_206928chr111827 ------
NM_206929chr111827 ------
NM_206930chr111827 ------
NM_207005chr1----1603 --
NM_207009chr101395 ------
NM_207292chr323286 2622 12103 ----
NM_207293chr323286 2622 12103 ----
NM_207294chr323286 2622 12103 ----
NM_207295chr323286 2622 12103 ----
NM_207296chr323286 2622 12103 ----
NM_207297chr323311 2647 12128 ----
NM_207299chr92375 71 ------
NM_207303chr1033273 1665 1143 ------
NM_207306chr151358 1034 786 642 176 ----11396
NM_207325chr19--11376 ----
NM_207343chr111338 ------
NM_207359chr3--1194 ----
NM_212471chr171139 ------
NM_212472chr171139 ------
NM_212474chr21988 1839 ----
NM_212475chr21988 1839 ----
NM_212476chr21988 1839 ----
NM_212478chr21988 1839 ----
NM_212482chr21988 1839 ----
NM_213606chr1011989 --11784 --
NM_213662chr171901 --12331 --