TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4674
miRNA Sequence: CUGGGCUCGGGACGCGCGGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1282112 1851 1599 1581 914 695 418 144 12039 2490 346 12288
NM_000033chrX10950 858 784 731 721 709 374 311 238 219 1637 2321 280 --
NM_000035chr9121 ------
NM_000038chr5----1436 --
NM_000074chrX4841 260 197 73 ------
NM_000081chr111194 1626 ----
NM_000084chrX86251 6068 5193 2659 2644 1777 1647 1217 --14867 16445
NM_000092chr263796 1658 1059 1002 630 146 12866 1217 1800
NM_000109chrX147 11678 ----
NM_000110chr1--1845 ----
NM_000118chr94801 600 346 64 --7781 747 734 724 644 134 36 --
NM_000125chr674076 3199 2987 1487 1299 1212 987 13503 12883 --
NM_000129chr621327 260 ------
NM_000135chr164415 232 69 27 --3822 813 321 1925
NM_000138chr1532462 1779 742 12209 11633 --
NM_000142chr451441 561 429 348 44 11035 21510 312 --
NM_000151chr1781759 1677 627 559 551 379 351 320 --1301 --
NM_000161chr1421551 180 --11873 --
NM_000168chr763276 3262 3209 2521 2266 1144 12416 ----
NM_000192chr121247 ------
NM_000202chrX41536 1494 1402 472 1732 ----
NM_000208chr1944458 4007 3802 1332 14651 21592 743 13124
NM_000214chr2061748 1733 658 441 299 274 ------
NM_000217chr1274695 3971 3753 3727 3468 3382 278 21219 44 1650 11090
NM_000222chr432002 1995 290 ------
NM_000232chr413156 ----1166
NM_000252chrX129 11463 1465 --
NM_000259chr1535701 2540 1986 ----14656
NM_000262chr2241583 1405 284 57 11620 144 --
NM_000264chr951326 1194 1165 1002 802 --22084 945 --
NM_000278chr10102182 2134 2016 1987 776 711 425 335 297 223 --2703 530 --
NM_000286chr172646 333 ------
NM_000291chrX2707 162 ------
NM_000304chr173421 312 263 193 ----
NM_000318chr862883 2775 2632 2238 1929 1903 12559 22640 2219 --
NM_000319chr122397 208 ------
NM_000325chr41159 ------
NM_000332chr666635 6413 6204 5477 4523 2831 36320 4681 4598 ----
NM_000334chr1792003 1978 1354 552 507 447 279 50 22 ------
NM_000335chr332007 1962 1544 21390 637 11789 --
NM_000337chr565849 5466 5347 5113 1240 96 11637 11569 --
NM_000345chr41959 ------
NM_000351chrX73256 3237 2637 1254 902 742 40 23768 2945 24242 4064 1155
NM_000362chr2241303 982 789 651 ------
NM_000367chr642175 2128 592 440 ------
NM_000369chr1431867 1300 278 ------
NM_000393chr2--22026 1886 ----
NM_000408chr232959 2469 2178 1957 --11221
NM_000425chrX5627 602 547 248 70 --1541 --
NM_000430chr1763494 3274 2402 2376 603 77 --12846 --
NM_000439chr5--12500 1310 1167
NM_000445chr89782 740 722 374 318 292 285 191 36 --1800 1355
NM_000448chr1143111 2608 1006 237 ----11122
NM_000449chr131011 381 108 ------
NM_000461chr363195 3153 1819 1600 1322 1061 14492 1701 --
NM_000462chr151367 ------
NM_000476chr991395 1238 1076 585 571 379 325 33 27 11366 ----
NM_000477chr4127 ------
NM_000489chrX22858 2357 1672 ----
NM_000500chr62425 312 ------
NM_000530chr14956 813 111 45 2801 58 2389 105 --
NM_000533chrX154 ------
NM_000539chr381577 1432 1265 1244 1212 1125 1079 221 ------
NM_000555chrX136784 6386 5876 2965 2570 2530 2197 2031 1997 1821 1446 269 44 37048 5768 2488 125 --
NM_000594chr62723 297 ------
NM_000599chr274469 4131 3695 3670 3273 1304 461 --12941 21369 402
NM_000609chr1072816 1179 1120 926 439 356 99 --140 11026
NM_000612chr1193661 3192 3079 2629 2603 1487 557 383 27 23363 3213 23088 3029 --
NM_000615chr1162808 2799 2235 2113 454 344 --12138 --
NM_000618chr1275948 5133 4807 2138 2128 2108 1092 22471 1549 11119 --
NM_000618chr1275948 5133 4807 2138 2128 2108 1092 22471 1549 11119 --
NM_000633chr18114806 4793 3866 3481 3387 1364 1319 1258 1164 1032 552 --11103 --
NM_000635chr1991602 1374 1202 1195 1016 501 482 251 184 11529 11415 1425
NM_000637chr81428 ------
NM_000663chr1692937 1099 870 568 486 390 245 227 32 --12652 22607 2308
NM_000678chr206806 669 565 194 168 81 ------
NM_000686chrX21573 1450 ------
NM_000698chr10--1343 ----
NM_000719chr12125968 4748 4520 4171 2653 2082 608 514 421 396 272 144 26339 4290 24328 2448 --
NM_000721chr172563 2079 1883 1822 1729 1065 652 --1884 --
NM_000739chr7168 --1134 --
NM_000780chr81249 --1413 --
NM_000792chr13855 276 118 11001 ----
NM_000793chr1454978 4637 4447 3417 87 24799 1104 1426 1833
NM_000800chr55614 279 168 115 107 11268 ----
NM_000813chr521475 281 ------
NM_000816chr52469 70 ------
NM_000826chr41128 ------
NM_000828chrX62142 1762 1475 862 848 436 ------
NM_000829chr1121899 444 11629 1174 --
NM_000831chr1165963 5889 5789 5506 5162 4872 4806 4757 4721 4595 3936 2176 2022 1656 845 132 --34253 471 385 14285
NM_000859chr521487 283 181 --11154
NM_000868chrX52400 2205 2124 989 930 ------
NM_000875chr15115595 4835 4626 4369 2149 2107 2031 1609 940 901 375 12101 26076 2186 11882
NM_000891chr1741302 1229 536 482 161 ----
NM_000894chr19128 ------
NM_000899chr1243729 3158 3053 2713 11562 11659 1964
NM_000901chr421880 544 12377 ----
NM_000908chr52258 150 ------
NM_000909chr421206 1083 ------
NM_000912chr842183 1414 479 242 12424 --1395
NM_000922chr115934 808 310 244 41 11107 ----
NM_000933chr20------1237
NM_000935chr32944 192 ------
NM_000945chr21139 ------
NM_001001132chr2121228 603 --11106 --
NM_001001323chr1243147 650 259 94 --22405 1969 --
NM_001001331chr352425 2208 2037 1918 1895 1887 ----
NM_001001342chr1011268 ------
NM_001001396chr144219 3946 3704 44 1959 1268 --
NM_001001481chr843373 916 829 182 ------
NM_001001484chr103954 202 68 42381 1773 943 194 ----
NM_001001485chr3163 1171 ----
NM_001001523chr15944 544 459 382 45 --2878 480 --
NM_001001549chr742553 2358 2341 434 ------
NM_001001550chr742553 2358 2341 434 ------
NM_001001555chr742553 2358 2341 434 ------
NM_001001791chr1041655 1588 589 390 --2381 372 --
NM_001001852chr223799 338 310 ------
NM_001001890chr2184243 4139 1003 192 106 99 83 27 --11345 --
NM_001001924chr821312 331 ----1784
NM_001001925chr821312 331 ----1784
NM_001001931chr821312 331 ----1784
NM_001001995chrX1560 11646 11614 --
NM_001002033chr17169 ------
NM_001002257chr233090 364 68 22596 309 12842 --
NM_001002295chr103951 39 26 191 1158 --
NM_001002838chrX2289 162 ------
NM_001002843chr151860 11046 169 --
NM_001002860chr1421036 893 --1632 --
NM_001002909chr1752029 1556 1377 845 707 --2719 416 --
NM_001003406chr22173322 3314 3252 3108 3090 3035 2956 2950 2920 2833 2643 2061 1279 1167 681 176 111 --22457 2140 --
NM_001003407chr1064306 1441 1367 1001 838 790 175 11478 --
NM_001003408chr1064306 1441 1367 1001 838 790 175 11478 --
NM_001003652chr1845834 3406 3154 2441 ------
NM_001003674chr1864354 2353 2102 1221 549 62 32056 735 674 12337 --
NM_001003675chr1864354 2353 2102 1221 549 62 32056 735 674 12337 --
NM_001003678chr111125 ------
NM_001003679chr11535 2664 524 1208 --
NM_001003682chr161417 1370 1338 504 362 71 --11295 --
NM_001003688chr4296 39 --1424 --
NM_001003698chr641624 1542 1423 205 11248 ----
NM_001003699chr641624 1542 1423 205 11248 ----
NM_001003712chr1232714 2563 1520 1529 ----
NM_001003792chr321207 1157 ------
NM_001003793chr321207 1157 ------
NM_001003800chr94670 603 582 336 --31409 968 814 1738
NM_001003945chr941903 1864 243 199 11639 1135 --
NM_001004065chr91404 13695 1389 --
NM_001004127chr131861 ------
NM_001004304chr1282986 2868 2635 2627 2276 799 731 450 1763 --12692
NM_001004317chr643492 1574 952 248 --13596 --
NM_001004323chr7127 ------
NM_001004360chr2--1166 ----
NM_001004419chr1234263 728 614 1795 ----
NM_001004439chr1541119 918 266 47 ------
NM_001004441chr51109 1263 ----
NM_001005266chr151636 ------
NM_001005267chr151636 ------
NM_001005268chr151636 ------
NM_001005269chr151636 ------
NM_001005271chr174811 735 338 165 159 ----
NM_001005273chr174811 735 338 165 159 ----
NM_001005335chr19121 ------
NM_001005354chr123584 142 124 1531 1474 --
NM_001005366chr122990 681 11019 ----
NM_001005375chrY11153 1662 ----
NM_001005377chr191213 ------
NM_001005473chr544968 1682 329 43 ------
NM_001005476chr2165 1562 ----
NM_001005505chr33544 164 90 1395 ----
NM_001005609chrX83503 3398 3244 2732 2352 1454 1123 213 43722 3203 1507 466 1847 --
NM_001005739chr21644 ------
NM_001005743chr142139 133 --11252 --
NM_001005744chr142139 133 --11252 --
NM_001005745chr142139 133 --11252 --
NM_001005920chr165945 182 150 127 99 ----1190
NM_001006600chr52702 353 ------
NM_001006626chr7168 --1134 --
NM_001006627chr7168 --1134 --
NM_001006628chr7168 --1134 --
NM_001006629chr7168 --1134 --
NM_001006630chr7168 --1134 --
NM_001006631chr7168 --1134 --
NM_001006632chr7168 --1134 --
NM_001006636chr21116 133 ----
NM_001006932chr6112470 2199 2105 1282 994 963 730 689 607 446 100 23392 2344 3649 292 72 --
NM_001007023chr1454978 4637 4447 3417 87 24799 1104 1426 1833
NM_001007097chr974805 4546 4489 4264 3813 3668 3211 21552 634 ----
NM_001007102chr621488 45 ------
NM_001007226chr1741317 1154 952 561 ------
NM_001007227chr1741317 1154 952 561 ------
NM_001007228chr1741317 1154 952 561 ------
NM_001007229chr1741317 1154 952 561 ------
NM_001007230chr1741317 1154 952 561 ------
NM_001007246chr2121731 287 131 ----
NM_001007267chr2--1120 ----
NM_001007271chr1061115 820 364 147 124 94 2942 346 ----
NM_001007466chr684285 3409 432 401 232 223 166 132 13883 25011 4305 --
NM_001007471chr91806 ------
NM_001007553chr111082 ------
NM_001007559chr1811688 21354 186 ----
NM_001008220chr5133731 3403 2816 2808 2742 916 734 666 576 487 411 254 22 1268 23144 754 --
NM_001008223chr12198 --1389 --
NM_001008225chr7--1657 ----
NM_001008392chr362799 2762 1436 1362 581 355 11325 12273 --
NM_001008407chr751792 1523 495 243 191 --1147 --
NM_001008408chr785959 4577 4343 3894 2515 1900 1860 1328 12341 ----
NM_001008495chr81336 1707 132 --
NM_001008529chr171196 11334 2513 332 --
NM_001008541chr1051950 1874 743 565 191 1630 ----
NM_001008541chr1051950 1874 743 565 191 1630 ----
NM_001008563chr941320 1208 389 274 --2866 457 1294
NM_001008701chr19122631 2601 2397 2308 1010 992 858 737 729 302 135 32 --22655 254 --
NM_001008707chr1421317 1244 11805 ----
NM_001008738chr531873 1048 334 12440 ----
NM_001008783chr61320 ------
NM_001008801chr1921530 1415 --11396 --
NM_001008938chr111384 ------
NM_001009899chr365147 4793 2086 1753 1398 974 --24524 325 --
NM_001009909chr1133710 1014 135 ------
NM_001009959chr221834 1017 ------
NM_001009993chr284243 4138 3962 3152 1763 1299 711 143 --14500 --
NM_001010854chr142565 471 1202 ----
NM_001010861chr12227 170 --12510 --
NM_001010867chr1186649 6128 5854 5640 5208 4321 4088 2616 2271 1604 1183 1036 884 830 651 370 178 112 --44738 2646 2032 231 26424 1702
NM_001010888chrX54067 3022 2880 1360 709 11324 ----
NM_001010891chr536684 4398 2320 --44550 2121 1345 874 --
NM_001010908chr101597 ------
NM_001010934chr7----1284 --
NM_001011513chr443867 3759 3280 2940 13673 ----
NM_001011515chr41188 ------
NM_001011516chr41188 ------
NM_001011546chr202619 257 ------
NM_001011553chr71210 ------
NM_001011554chr2051404 282 202 151 141 ------
NM_001011657chrX--2479 181 ----
NM_001011666chr7106147 6134 5846 5659 5348 4903 4892 4143 1620 1158 31129 972 312 ----
NM_001011708chr222351 1116 ------
NM_001011722chr11450 ------
NM_001011722chr11450 ------
NM_001012329chr162125 1821 1811 864 828 349 --12237 --
NM_001012393chr1154844 3852 1276 1236 368 24535 3978 11456 14469
NM_001012398chr161415 ------
NM_001012410chr32136 41 ------
NM_001012415chr98647 590 573 254 205 177 76 56 --1331 --
NM_001012420chr151452 12797 ----
NM_001012426chr6122923 2896 2477 2133 1325 1230 622 391 335 304 105 92 --23270 830 --
NM_001012427chr6122923 2896 2477 2133 1325 1230 622 391 335 304 105 92 --23270 830 --
NM_001012755chrX84550 3298 3140 1253 1102 1027 628 347 35032 4109 171 ----
NM_001012989chrX1600 ------
NM_001013620chr1268101 6824 6344 5758 3148 1195 --11070 --
NM_001013690chr1282281 2231 2155 2140 1848 1678 627 617 11703 ----
NM_001013693chr1122679 2470 2463 2292 1876 1081 967 713 371 357 304 226 22121 2009 32728 2302 834 11818
NM_001013693chr1122679 2470 2463 2292 1876 1081 967 713 371 357 304 226 22121 2009 32728 2302 834 11818
NM_001013839chr17121988 1702 982 798 678 527 431 395 358 345 183 148 --32450 902 577 --
NM_001014336chr122342 42 ------
NM_001014764chr171152 ------
NM_001014797chr10187996 7878 7703 7679 7656 7529 7066 6281 6018 5808 2885 2809 2794 2669 1980 1656 1426 41 ------
NM_001014809chr41815 ------
NM_001015045chr442383 771 497 414 --12257 --
NM_001015053chr1761463 1360 1283 1132 337 281 21077 293 1311 --
NM_001015877chrX42625 703 618 164 11078 ----
NM_001015881chrX21135 239 ------
NM_001015887chr311201 ------
NM_001017369chr421098 887 ------
NM_001017387chr161288 1379 ----
NM_001017395chr343136 2709 2315 2246 ------
NM_001017424chr1----1382 1101
NM_001017425chr1----1382 1101
NM_001017440chr7147281 6696 6499 6399 3011 2911 2870 2635 2539 1879 1834 1444 729 34 17571 22745 694 --
NM_001017926chr82580 350 ------
NM_001017970chr1451888 1880 1064 628 478 --1401 --
NM_001017995chr5104202 3346 1594 1263 1183 1173 832 456 414 27 13102 23399 1015 --
NM_001017999chr111426 11735 31985 1525 501 --
NM_001017999chr111426 11735 31985 1525 501 --
NM_001018000chr111426 11735 31985 1525 501 --
NM_001018000chr111426 11735 31985 1525 501 --
NM_001018001chr111426 11735 31985 1525 501 --
NM_001018005chr15164 ------
NM_001018050chr2262399 2312 2129 1255 1074 952 22470 2339 33358 3116 994 --
NM_001018052chr2262399 2312 2129 1255 1074 952 22470 2339 33358 3116 994 --
NM_001018065chr974971 2268 1622 1516 1258 1235 1092 22181 397 1280 --
NM_001018066chr974971 2268 1622 1516 1258 1235 1092 22181 397 1280 --
NM_001018067chr133903 3298 1765 ------
NM_001018068chr133903 3298 1765 ------
NM_001018069chr133903 3298 1765 ------
NM_001018111chr793372 2724 2604 1252 1224 1063 871 537 39 13338 31414 821 219 --
NM_001020658chr151535 1379 1176 404 48 ------
NM_001020658chr151535 1379 1176 404 48 ------
NM_001020825chr51526 ------
NM_001023567chr1522012 454 22189 467 ----
NM_001024401chr16142784 2770 2642 2250 2169 1851 1768 981 939 771 731 369 215 36 --22684 1862 --
NM_001024455chrX31858 759 602 12587 ----
NM_001024647chr1287404 6849 6388 5776 5750 5713 2928 2735 22304 1496 46286 2289 2165 1436 34721 2791 98
NM_001024649chr562988 2882 2701 2538 830 686 1580 ----
NM_001024666chrX141 ------
NM_001024808chr1262255 780 770 595 586 248 ----1656
NM_001024845chr161028 881 850 800 659 645 --1735 --
NM_001024858chr1482847 2480 976 539 527 130 122 55 --22095 2081 --
NM_001024947chr51408 ------
NM_001024948chr132378 2317 2245 ------
NM_001025076chr1035704 2060 1999 14378 15183 --
NM_001025081chr1831258 1140 156 ----1594
NM_001025090chr1831258 1140 156 ----1594
NM_001025092chr1831258 1140 156 ----1594
NM_001025101chr1831258 1140 156 ----1594
NM_001025105chr5----11530 --
NM_001025242chrX71230 1013 1001 967 440 361 77 11063 1111 --
NM_001025243chrX71230 1013 1001 967 440 361 77 11063 1111 --
NM_001025580chrX33299 2914 576 --11363 --
NM_001025595chr411583 ------
NM_001025603chr131011 381 108 ------
NM_001029858chr642372 1262 780 486 1159 ----
NM_001029859chr1162173 1651 549 151 44 33 --11731 --
NM_001029863chr663083 2121 1116 1026 866 438 1546 11999 --
NM_001029864chr2052388 2172 2083 351 76 22146 944 153 --
NM_001029875chr531999 1178 890 22520 2114 --12985
NM_001029989chr151665 --1646 --
NM_001030006chr171732 --1335 --
NM_001030007chr1683689 3597 2663 1533 1078 922 523 300 ------
NM_001031679chr1252600 2302 1185 927 676 --11085 --
NM_001031680chr162351 625 446 389 231 147 22215 766 ----
NM_001031690chr762402 2157 1946 1049 853 468 12939 ----
NM_001031695chr2274672 4066 3998 2020 1262 1227 852 14887 14157 --
NM_001031711chr521596 235 11427 1269 --
NM_001031732chr413280 1248 ----
NM_001031740chr131209 589 273 --1512 11124
NM_001031804chr1633905 1507 1141 --14238 --
NM_001031812chr511962 1901 ----
NM_001031855chrX125 --1251 --
NM_001032280chr6------1266
NM_001032288chr201996 ------
NM_001032289chrX1218 ------
NM_001032296chr1332540 2460 80 12963 12396 --
NM_001032380chr1031625 188 174 ----11519
NM_001032393chrX1271 ------
NM_001033045chr254072 3369 1417 1279 106 ------
NM_001033057chr331797 1549 671 2722 255 ----
NM_001033059chr631923 1747 562 1402 ----
NM_001033081chr141218 681 285 267 ------
NM_001033082chr141218 681 285 267 ------
NM_001033117chr3123897 1962 1934 1854 1722 1685 1662 1650 599 233 166 51 ------
NM_001033503chr51338 ------
NM_001033521chr201519 ------
NM_001033522chr201519 ------
NM_001033551chr17123389 3271 3078 2934 2678 1453 725 651 616 423 281 237 13303 33458 3423 1345 --
NM_001033557chr2--21444 1380 ----
NM_001033602chr1342712 1677 305 26 --11769 --
NM_001033723chr882551 2399 2377 1039 708 628 326 30 1688 ----
NM_001033952chr112240 218 ------
NM_001034850chr511539 ------
NM_001034954chr1062749 512 419 378 358 307 1395 ----
NM_001034955chr1062749 512 419 378 358 307 1395 ----
NM_001034956chr1062749 512 419 378 358 307 1395 ----
NM_001034957chr1062749 512 419 378 358 307 1395 ----
NM_001035chr121274 1193 ------
NM_001035003chr411138 ------
NM_001035004chr411138 ------
NM_001035521chr2--1234 ----
NM_001037126chr7--151 ----
NM_001037131chr22451 85 ------
NM_001037164chr711531 11982 ----
NM_001037174chr221876 267 ------
NM_001037290chr111652 1181 ----
NM_001037317chr12227 170 --12510 --
NM_001037331chr183987 925 127 ------
NM_001037334chr1822438 547 ------
NM_001037339chr12170 71 1648 ----
NM_001037340chr12170 71 1648 ----
NM_001037341chr12170 71 1648 ----
NM_001037341chr12170 71 1648 ----
NM_001037494chr121193 158 ----
NM_001037495chr121193 158 ----
NM_001037582chr441143 1130 578 347 21245 659 ----
NM_001037738chr5173 134 ----
NM_001037954chr1152918 2372 1383 521 415 --22870 2729 --
NM_001038707chr141762 913 849 55 --1250 --
NM_001038707chr141762 913 849 55 --1250 --
NM_001039350chr731527 1310 702 --1323 --
NM_001039360chr1861525 1479 633 274 57 25 --21513 223 --
NM_001039465chr141411 ------
NM_001039538chr233590 2244 46 1569 ----
NM_001039550chr22819 316 --2853 771 --
NM_001039570chr22133856 3823 3812 3711 3395 3255 2833 1834 1821 1169 704 239 182 ----144
NM_001039571chr22133856 3823 3812 3711 3395 3255 2833 1834 1821 1169 704 239 182 ----144
NM_001039573chr17------1178
NM_001039590chrX11384 156 1445 12578
NM_001039591chrX11384 156 1445 12578
NM_001039619chr14126 ------
NM_001039690chr1681965 1489 905 692 532 413 371 365 --2731 617 2942 706
NM_001039711chr121026 376 ------
NM_001039712chr121026 376 ------
NM_001039715chr13855 276 118 11001 ----
NM_001039716chr13919 340 182 11065 ----
NM_001039842chr17----139 --
NM_001039888chr1168 ------
NM_001039937chr1323800 981 23277 659 ----
NM_001040002chr172513 38 ----11472
NM_001040056chr166280 265 173 149 64 26 --2744 119 --
NM_001040101chr441529 1502 425 210 ------
NM_001040144chr1681965 1489 905 692 532 413 371 365 --2731 617 2942 706
NM_001040146chr1681965 1489 905 692 532 413 371 365 --2731 617 2942 706
NM_001040151chr1184254 4238 4147 3827 3549 3197 514 99 ------
NM_001040152chr744459 4108 4089 819 14043 1254 1764
NM_001040159chr42532 60 ------
NM_001040202chr422250 428 ------
NM_001040214chr671889 1591 764 699 410 354 27 1778 ----
NM_001040284chr1634439 423 90 ------
NM_001040424chr2142428 986 907 409 1673 ----
NM_001040429chr1343085 2933 924 692 1511 ----
NM_001040431chr17139 --1373 1138
NM_001040439chr1671205 1166 1089 446 278 269 263 --3960 404 294 --
NM_001040446chr531689 103 81 --1284 --
NM_001040619chr161460 1380 482 358 190 148 ----1311
NM_001040624chr822695 190 --1522 1985
NM_001040625chr822695 190 --1522 1985
NM_001040626chr822695 190 --1522 1985
NM_001040627chr822695 190 --1522 1985
NM_001040628chr822695 190 --1522 1985
NM_001040629chr822695 190 --1522 1985
NM_001040630chr822695 190 --1522 1985
NM_001040665chr784498 3297 3174 1384 1357 1338 1147 1097 24079 3736 ----
NM_001040709chr152477 2167 2092 1677 607 --1219 --
NM_001040715chr1641175 1167 887 790 2939 784 ----
NM_001042355chr1641621 837 340 42 11630 ----
NM_001042357chr101474 --1519 1301
NM_001042358chr101474 --1519 1301
NM_001042360chr101474 --1519 1301
NM_001042363chr101474 --1519 1301
NM_001042389chr101474 --1519 1301
NM_001042390chr101474 --1519 1301
NM_001042392chr101474 --1519 1301
NM_001042395chr101474 --1519 1301
NM_001042403chr1211016 ------
NM_001042412chr1641621 837 340 42 11630 ----
NM_001042413chr954067 3967 604 258 112 21302 101 ----
NM_001042425chr6------1266
NM_001042453chrX31141 88 44 1566 ----
NM_001042459chr3124 ------
NM_001042486chr2041330 1317 1260 298 1378 41460 1159 544 479 --
NM_001042494chr1552834 2353 166 143 70 23473 3041 ----
NM_001042495chr1552834 2353 166 143 70 23473 3041 ----
NM_001042496chr1552834 2353 166 143 70 23473 3041 ----
NM_001042497chr1552834 2353 166 143 70 23473 3041 ----
NM_001042510chr83758 703 219 ------
NM_001042511chr83758 703 219 ------
NM_001042539chr164289 222 181 149 ------
NM_001042601chr312459 13306 1232 --
NM_001042610chr16111423 1194 1003 972 965 465 366 303 272 254 234 --21309 881 --
NM_001042632chr20121697 1042 1002 949 892 766 520 487 371 349 283 34 --12000 21947 102
NM_001042633chr20121697 1042 1002 949 892 766 520 487 371 349 283 34 --12000 21947 102
NM_001042635chr141119 ------
NM_001042663chr171374 1350 1217 454 250 184 143 11069 21266 470 --
NM_001042664chr171374 1350 1217 454 250 184 143 11069 21266 470 --
NM_001042665chr171374 1350 1217 454 250 184 143 11069 21266 470 --
NM_001042681chr132191 1670 237 12371 1396 --
NM_001042682chr132191 1670 237 12371 1396 --
NM_001042682chr132191 1670 237 12371 1396 --
NM_001042683chr631666 1164 166 --11599 --
NM_001043318chr1463212 1528 861 719 480 247 13658 ----
NM_001044385chr232579 1612 1042 22465 969 23384 2601 12986
NM_001044722chr511962 1901 ----
NM_001044723chr511962 1901 ----
NM_001077628chr11163 ------
NM_001083620chr41128 ------
NM_001095chr1261698 1538 747 492 158 60 ------
NM_001096chr172175 85 ------
NM_001100108chr176726 5935 5903 5263 2032 1791 293 26300 1120 15639 11586
NM_001106chr3147866 6907 6796 6753 6685 6214 3817 3566 3169 3140 2827 2238 1124 297 18151 36672 2260 2115 --
NM_001113490chrX--13142 ----
NM_001116chr1662759 2614 2287 2155 1159 1108 ------
NM_001117chr1842339 1983 916 689 1586 ----
NM_001121chr1021546 421 ------
NM_001128chr1683689 3597 2663 1533 1078 922 523 300 ------
NM_001147chr82151 55 ------
NM_001148chr4------11966
NM_001172chr141518 ------
NM_001191chr2061104 978 933 595 294 103 --1134 --
NM_001196chr222891 80 ------
NM_001198chr622027 854 --12276 --
NM_001206chr92454 84 1185 12098 --
NM_001241chr211812 --1685 --
NM_001241chr211812 --1685 --
NM_001253chr6--1276 ----
NM_001256chr171755 ------
NM_001257chr1621276 1218 ------
NM_001282chr171732 --1335 --
NM_001292chr1521050 158 ------
NM_001293chr111383 ------
NM_001313chr41815 ------
NM_001315chr652299 2138 2126 709 454 ------
NM_001324chr201519 ------
NM_001326chr111404 ------
NM_001329chr1021382 408 ------
NM_001331chr1142588 2488 1782 496 --12275 --
NM_001351chr311123 1567 ----
NM_001352chr19131 ------
NM_001356chrX1952 11835 --1149
NM_001364chr11103569 3510 3499 3461 3406 2979 1521 1109 335 291 --13618 11423
NM_001387chr562948 2839 2432 984 855 400 --12258 --
NM_001389chr212232 193 ------
NM_001396chr2142436 1888 383 217 --1867 --
NM_001397chr1132484 1997 1983 1707 1635 1074 974 878 750 670 273 104 86 12408 31628 687 146 1738
NM_001399chrX83503 3398 3244 2732 2352 1454 1123 213 43722 3203 1507 466 1847 --
NM_001407chr341665 1340 1127 623 ----1467
NM_001408chr11140 ------
NM_001418chr111528 ------
NM_001418chr111528 ------
NM_001419chr19104402 3292 3160 3107 3048 1908 1273 657 622 565 --11394 --
NM_001420chr1952797 1113 776 501 127 --22987 747 186
NM_001422chr113398 291 22 ------
NM_001427chr731714 1660 607 1372 21350 488 1850
NM_001429chr22--195 ----
NM_001438chr111202 ------
NM_001444chr8152 ------
NM_001447chr551311 460 338 198 120 ------
NM_001448chrX21685 1466 1477 11246 --
NM_001453chr61161 ------
NM_001478chr124875 746 686 112 --1303 --
NM_001521chr2--1234 ----
NM_001530chr141204 1763 ----
NM_001533chr19121 ------
NM_001543chr5154415 4147 4104 3848 3585 3391 3029 2961 1943 1451 1309 1205 823 685 419 --43060 1832 672 282 --
NM_001552chr175716 279 208 113 94 2266 239 ----
NM_001560chrX42468 2389 557 124 ------
NM_001569chrX71230 1013 1001 967 440 361 77 11063 1111 --
NM_001584chr11------1884
NM_001634chr631923 1747 562 1402 ----
NM_001635chr7----128 --
NM_001659chr1271656 947 575 541 356 137 104 --11650 --
NM_001663chr1421984 621 ------
NM_001665chr11----1230 --
NM_001668chr11665 ------
NM_001670chr227678 638 626 590 518 98 24 --1292 --
NM_001677chr11230 ------
NM_001678chr1751739 1241 265 166 125 --11336 --
NM_001682chr1222861 364 --12119 --
NM_001683chr352425 2208 2037 1918 1895 1887 ----
NM_001684chr153936 3663 3421 1674 1588 1676 ----
NM_001699chr19------21481 274
NM_001701chr91620 ------
NM_001707chr73776 119 105 ------
NM_001709chr1162826 2008 1999 1991 1943 1148 ------
NM_001716chr1121021 600 21562 229 1209 --
NM_001731chr12------1218
NM_001737chr5122 ------
NM_001741chr112240 218 ------
NM_001746chr562988 2882 2701 2538 830 686 1580 ----
NM_001754chr2184243 4139 1003 192 106 99 83 27 --11345 --
NM_001755chr1632096 1879 1784 ------
NM_001759chr1255036 4712 4046 3737 3369 14312 12085 --
NM_001761chr1671752 617 585 410 340 305 158 --1200 --
NM_001773chr191351 1315 1150 1046 986 956 512 231 114 --11011 --
NM_001788chr71210 ------
NM_001792chr18----1196 --
NM_001802chr16--188 ----
NM_001830chrX53805 3257 2956 2921 862 --13901 33555 945 391
NM_001851chr6153 ------
NM_001858chr654319 1502 1382 912 53 31123 1067 775 --2684 627
NM_001866chrX144 ------
NM_001878chr13365 281 32 ------
NM_001892chr5----11530 --
NM_001893chr171117 ------
NM_001895chr20----146 --
NM_001903chr52929 132 --1197 --
NM_001907chr16--127 ----
NM_001931chr111955 ------
NM_001936chr731527 1310 702 --1323 --
NM_001938chr131875 689 264 11404 ----
NM_001939chrX42339 1341 913 275 22758 390 23581 1297 --
NM_001946chr121253 ------
NM_001949chr642560 2508 1151 1066 --12200 --
NM_001957chr442304 1582 1412 73 1525 ----
NM_001967chr31162 ------
NM_001969chr1463155 2702 2575 1156 487 401 23555 160 33177 1267 180 13625
NM_001977chr4193 11202 ----
NM_001981chr112186 ------
NM_001982chr122937 880 --1862 --
NM_001987chr1294314 3229 1031 1023 866 600 457 221 37 13093 ----
NM_001991chr1742171 1573 503 392 --2702 476 --
NM_001995chr41233 11367 ----
NM_002006chr444084 2161 579 97 --24651 1985 --
NM_002015chr1332419 2233 1351 22072 72 ----
NM_002023chr161567 1550 1173 202 108 34 21412 1083 ----
NM_002025chrX128667 8616 7702 6755 5904 2437 2142 1984 1472 1340 1212 300 ------
NM_002031chr61766 1327 ----
NM_002045chr3149 --1340 1407
NM_002046chr12168 ------
NM_002051chr103951 39 26 191 1158 --
NM_002063chrX2951 494 ------
NM_002077chr982059 1865 1771 1733 1502 1332 146 25 ------
NM_002080chr16----1882 --
NM_002081chr2101759 1505 1487 1228 1206 666 581 503 434 369 --41158 551 416 359 --
NM_002086chr1742020 805 624 536 --11968 --
NM_002092chr434220 3584 809 ------
NM_002094chr163171 140 56 ------
NM_002126chr1743127 2929 412 298 14131 ----
NM_002129chr4--187 ----
NM_002130chr541629 1233 632 140 ------
NM_002140chr92404 82 ------
NM_002145chr17167 ------
NM_002146chr1731015 138 57 ------
NM_002168chr15181 ------
NM_002196chr2041000 901 103 88 ------
NM_002196chr2041000 901 103 88 ------
NM_002199chr42213 187 --1972 --
NM_002202chr52433 376 ------
NM_002203chr562702 1641 1546 1435 786 267 ------
NM_002214chr754629 4301 3674 1886 1495 23598 1059 14218 24286 3827
NM_002221chr172457 2033 936 834 787 322 307 --42686 967 930 445 --
NM_002239chr21927 150 ----
NM_002241chr152412 1139 956 799 387 1687 2870 164 --
NM_002247chr1022102 275 ------
NM_002249chr11360 ------
NM_002252chr2------1451
NM_002254chr272171 1902 1878 613 546 291 203 ----11599
NM_002264chr334346 223 54 --168 --
NM_002265chr173824 467 453 ------
NM_002266chr171241 ------
NM_002267chr132855 435 12015 ----
NM_002270chr555037 5018 2212 220 67 ------
NM_002290chr61925 ------
NM_002309chr22132849 2797 2674 2549 2412 2399 2354 1254 1027 899 886 343 147 --32979 371 87 --
NM_002310chr532122 1545 227 1671 14715 --
NM_002313chr1064306 1441 1367 1001 838 790 175 11478 --
NM_002334chr1151747 1491 501 301 259 --1166 --
NM_002336chr1223867 405 13958 --11819
NM_002349chr2--1230 ----
NM_002355chr121544 1521 ----
NM_002359chr1763254 3248 1427 465 455 166 --2571 280 11348
NM_002361chr191247 ------
NM_002374chr233590 2244 46 1569 ----
NM_002385chr1831258 1140 156 ----1594
NM_002387chr584725 4536 3930 3451 3178 3138 766 265 13206 33217 221 72 --
NM_002390chr1761888 1633 1593 1441 1420 526 1298 12086 --
NM_002397chr511413 ------
NM_002399chr1521034 260 ------
NM_002401chr17121970 867 658 614 531 510 456 333 287 222 198 118 --21004 238 22198 956
NM_002419chr11126 ------
NM_002430chr2232501 2148 2023 1542 ----
NM_002442chr1291549 1322 1310 1259 1153 657 595 392 152 1411 --11607
NM_002444chrX41808 1727 784 276 ------
NM_002466chr203279 258 105 --124 --
NM_002481chr1147746 7091 7080 7028 6362 6032 5771 5516 5073 2723 2274 1546 1185 889 --37146 5636 5251 --
NM_002500chr211181 ----11056
NM_002501chr19104043 1582 926 787 501 239 224 211 194 127 --12995 13624
NM_002507chr1791940 1875 1812 1591 601 561 174 116 97 1510 31310 140 72 --
NM_002508chr141277 129 119 108 21767 1417 1378 --
NM_002519chr1111130 ------
NM_002522chr17103646 3276 2891 1269 1080 962 949 920 912 795 13634 2217 24 --
NM_002545chr1154844 3852 1276 1236 368 24535 3978 11456 14469
NM_002568chr81345 ------
NM_002572chr11--1312 ----
NM_002581chr974517 4502 4436 4406 3986 1095 258 ------
NM_002588chr551248 1223 1126 338 50 ----1550
NM_002589chr4174 ------
NM_002595chr12125 11565 ----
NM_002600chr12170 71 1648 ----
NM_002609chr531577 1341 730 21665 616 ----
NM_002611chr174757 738 688 177 ----1585
NM_002616chr174477 402 206 149 1411 131 --
NM_002636chr61108 ------
NM_002655chr864315 4181 3962 909 898 606 --1497 --
NM_002657chr20113386 3063 1569 1130 741 689 394 193 186 47 23 12982 11496 --
NM_002687chr141919 ------
NM_002698chr1972867 2565 2492 2102 720 271 51 12875 ----
NM_002699chr181098 963 577 447 202 180 117 53 ------
NM_002706chr2--2727 663 ----
NM_002716chr1183577 2990 2970 2952 2316 1083 691 557 --11356 --
NM_002717chr81437 ------
NM_002719chr1421973 30 2933 252 1188 --
NM_002731chr132776 2503 470 --21129 27 --
NM_002733chr122444 222 ------
NM_002736chr721628 57 12223 ----
NM_002742chr14--1616 ----
NM_002745chr2263012 1786 1219 653 186 92 --11120 --
NM_002753chr41819 2327 267 ----
NM_002761chr161109 ------
NM_002822chr122586 44 ------
NM_002832chr141461 1375 309 24 --11530 --
NM_002833chr1531378 1343 1136 --21077 66 --
NM_002834chr1252807 1264 1120 1070 1064 --11504 11082
NM_002842chr193421 184 28 --163 --
NM_002843chr1133089 2267 1125 --12735 12721
NM_002845chr18------1135
NM_002849chr121114 1258 ----
NM_002855chr11133622 3428 3040 3029 2756 2530 1151 873 837 753 663 295 266 11461 53237 2493 2357 1197 154 --
NM_002857chr192411 2246 1935 1893 1825 830 616 447 28 --21668 806 1785
NM_002859chr1281632 1521 1463 1218 1182 278 195 187 11548 ----
NM_002868chr1282319 2272 1761 737 507 488 404 107 ------
NM_002869chr1172194 1864 1620 673 496 369 36 ------
NM_002874chr922145 540 12390 ----
NM_002890chr51245 ------
NM_002892chr1411050 --11708 --
NM_002906chr1122419 151 ------
NM_002911chr1931104 445 40 11093 ----
NM_002912chr61178 ------
NM_002924chr1--159 ----
NM_002941chr31204 ------
NM_002942chr31311 ------
NM_002955chr641624 1542 1423 205 11248 ----
NM_002957chr9133017 2990 2647 2584 1408 1350 1283 1270 1052 471 329 194 78 --1249 --
NM_002959chr134010 3634 3356 12808 33673 3235 3006 --
NM_002971chr32327 62 ------
NM_002976chr2--159 ----
NM_003009chr19----122 --
NM_003010chr1712215 --12314 --
NM_003011chr92679 282 11127 ----
NM_003012chr8122738 2555 2397 2265 2081 2062 1153 871 778 563 526 31 --1696 12207
NM_003016chr172635 624 11379 ----
NM_003020chr15176 ------
NM_003028chr9153809 3530 3232 3111 3069 3001 1269 1157 957 567 460 417 339 75 35 12525 1920 --
NM_003034chr1275391 5132 4968 2241 1168 648 103 --36647 2252 1294 --
NM_003042chr352104 846 726 510 172 1679 1113 --
NM_003045chr13124299 3653 3565 1782 1694 1447 1080 980 756 291 189 158 13495 34205 3244 1776 --
NM_003068chr8--172 ----
NM_003069chrX2153 113 ------
NM_003074chr321927 912 ------
NM_003076chr1271687 1675 1515 1477 1169 562 50 ------
NM_003079chr172808 332 1758 1914 1151
NM_003081chr201108 ------
NM_003108chr2126450 5928 5638 5354 2866 2760 2666 2626 2550 2027 1340 886 15327 15590 --
NM_003112chr7--21167 639 ----
NM_003128chr222126 64 ------
NM_003131chr671651 885 858 831 458 391 141 130 11500 --
NM_003144chr622088 1599 1438 ----
NM_003145chr11189 ------
NM_003155chr831043 608 583 ------
NM_003156chr112912 555 11385 ----
NM_003157chr32749 264 ------
NM_003161chr1743070 1062 957 557 ------
NM_003162chr22216 199 11059 ----
NM_003166chr161288 1379 ----
NM_003174chr10123 ------
NM_003178chr33659 421 279 ------
NM_003189chr133313 2624 479 --23206 2195 --
NM_003200chr1971979 1918 1912 1462 762 198 188 11955 11527 --
NM_003201chr101136 ------
NM_003202chr521288 146 1684 31246 558 253 --
NM_003217chr1251930 1411 1233 523 317 ------
NM_003220chr6------1266
NM_003221chr643953 1639 1297 639 11147 12834 13750
NM_003236chr242695 2580 1406 1027 1542 1307 --
NM_003253chr212544 215 ----1774
NM_003257chr1511078 ------
NM_003270chrX1250 ------
NM_003272chr11195 ------
NM_003281chr1184336 4260 3999 3975 3775 3552 3478 3296 2191 2134 1658 624 615 554 496 416 62 31 --23602 3570 --
NM_003286chr20169 --11091 --
NM_003320chr1184108 3262 854 838 817 747 378 138 11645 23710 1303 11574
NM_003325chr223249 206 144 ------
NM_003326chr132541 103 94 --1255 --
NM_003330chr1231612 1461 268 ------
NM_003338chr101406 ------
NM_003342chr171756 ----1178
NM_003345chr161457 ------
NM_003348chr1231552 1339 112 ------
NM_003349chr201996 ------
NM_003373chr105758 573 291 272 64 --1412 --
NM_003379chr6------1402
NM_003382chr7101838 1701 1518 798 759 716 614 604 499 36 1554 ----
NM_003387chr21544 32244 2070 31 ----
NM_003392chr373781 3763 3007 1555 1140 1035 671 22885 938 ----
NM_003400chr21698 ------
NM_003404chr201132 --11657 --
NM_003405chr222718 208 --1199 --
NM_003411chrY1132 1433 ----
NM_003412chr31747 ------
NM_003413chrX11413 ----11819
NM_003432chr5--185 ----
NM_003439chr743332 1023 1000 534 ----13534
NM_003458chr393928 3379 3187 1233 1227 1127 729 566 509 1134 23330 3262 --
NM_003466chr271756 896 779 617 446 225 115 11730 12419 22124 365
NM_003468chr223901 3066 33521 3367 1226 32765 586 184 1790
NM_003482chr1272202 1108 1006 171 158 129 31 1398 ----
NM_003483chr1212410 ------
NM_003485chr1471389 1177 973 858 416 49 41 --21163 142 --
NM_003489chr2132155 380 258 11196 ----
NM_003498chr1662299 2122 920 883 477 282 ------
NM_003559chr1793648 3425 3388 2997 2883 1383 1327 432 405 ------
NM_003563chr1741317 1154 952 561 ------
NM_003564chr14549 470 96 88 ------
NM_003566chr1213326 ------
NM_003574chr1854819 2042 1431 247 92 24905 990 ----
NM_003576chr1332540 2460 80 12963 12396 --
NM_003583chr124952 240 76 51 13617 ----
NM_003590chr222473 312 13960 ----
NM_003597chr232196 2093 1825 ------
NM_003603chr431799 834 170 ------
NM_003607chr194182 3946 3874 3797 3737 2938 695 584 384 23681 179 33833 3348 1349 --
NM_003618chr21891 ------
NM_003621chr11--1390 139 --
NM_003624chr1951275 1103 967 399 353 --31306 1029 513 --
NM_003628chr2165 1562 ----
NM_003632chr171187 1899 ----
NM_003644chr17206135 5484 5397 5218 5200 4435 4411 4018 2643 2270 2100 2085 2075 2051 2022 1333 1217 464 185 155 --31451 531 65 --
NM_003654chr111129 ------
NM_003663chr321188 377 23171 3002 12711 --
NM_003670chr311388 ------
NM_003671chr932433 1166 918 ------
NM_003692chr91671 ------
NM_003701chr13--1998 ----
NM_003713chr121108 216 ------
NM_003714chr552734 2678 838 580 346 1809 ----
NM_003716chr32998 35 ------
NM_003722chr332283 1988 807 12386 ----
NM_003735chr551248 1223 1126 338 50 ----1550
NM_003736chr551248 1223 1126 338 50 ----1550
NM_003737chr112430 69 ------
NM_003744chr142139 133 --11252 --
NM_003746chr121193 158 ----
NM_003754chr11----1134 --
NM_003759chr443617 1558 595 576 ------
NM_003768chr151680 1449 725 692 184 11267 ----
NM_003778chr32150 105 ------
NM_003787chr1821209 218 ------
NM_003791chr16138 ------
NM_003800chr632217 1871 1854 --1372 --
NM_003811chr193195 36 22 --1202 --
NM_003822chr1--1597 12234 --
NM_003829chr9139 ------
NM_003877chr121642 ------
NM_003883chr5184 ------
NM_003885chr1742626 1657 357 182 ------
NM_003888chr1551577 1564 1148 1086 27 --2444 68 --
NM_003896chr21105 ------
NM_003913chr61473 ------
NM_003916chrX179 --11472 --
NM_003919chr7--1275 ----
NM_003939chr1073922 3538 3395 1122 521 463 182 13376 ----
NM_003941chr722191 669 --11747 --
NM_003954chr1771409 1336 953 535 499 384 189 ----1439
NM_003955chr1761124 1057 988 459 424 101 ------
NM_003958chr682741 2461 1305 1194 969 655 558 48 1619 13790 --
NM_003961chr161184 ------
NM_003980chr61485 --11081 --
NM_003983chr1684138 3905 2867 1350 610 516 367 99 --14080 21019 77
NM_003987chr10102182 2134 2016 1987 776 711 425 335 297 223 --2703 530 --
NM_003988chr10102259 2211 2093 2064 853 788 502 412 374 300 --2780 607 --
NM_003989chr10102118 2070 1952 1923 712 647 361 271 233 159 --2639 466 --
NM_003990chr10102118 2070 1952 1923 712 647 361 271 233 159 --2639 466 --
NM_003993chr1153 ------
NM_003994chr1243729 3158 3053 2713 11562 11659 1964
NM_004006chrX147 11678 ----
NM_004007chrX147 11678 ----
NM_004009chrX147 11678 ----
NM_004010chrX147 11678 ----
NM_004011chrX147 11678 ----
NM_004012chrX147 11678 ----
NM_004013chrX147 11678 ----
NM_004014chrX147 11678 ----
NM_004015chrX147 11678 ----
NM_004017chrX147 11678 ----
NM_004020chrX147 11678 ----
NM_004024chr151369 1289 391 267 148 ----1220
NM_004036chr24670 280 242 153 126 ----
NM_004050chr1452771 1807 1776 951 823 ----12478
NM_004067chr711152 ------
NM_004077chr12--147 11118 --
NM_004080chr731341 1245 1147 11007 ----
NM_004081chrY11153 1662 ----
NM_004086chr14--1321 ----
NM_004089chrX21135 239 ------
NM_004094chr1431974 1888 881 ----122
NM_004097chr26916 685 646 236 218 142 --1842 169
NM_004098chr101435 ------
NM_004100chr622480 410 ----1270
NM_004111chr113509 258 202 ------
NM_004112chr1731598 1436 367 --2417 148 --
NM_004117chr632102 264 25 11414 ----
NM_004119chr13--1609 ----
NM_004124chr1412276 ------
NM_004157chr32212 21 2883 314 ----
NM_004171chr1199114 8646 7727 6868 6292 6090 3465 2006 145 --11250 --
NM_004180chr2--1201 ----
NM_004187chrX41377 1035 919 139 11017 ----
NM_004200chr11183263 3024 2788 2758 2735 2528 2374 2246 2232 941 675 516 489 456 278 191 153 86 --136 --
NM_004205chr112473 375 1551 ----
NM_004206chr32102 33 ------
NM_004225chr821102 991 ------
NM_004232chr1833790 2664 2542 ----12706
NM_004236chr151596 ------
NM_004263chr281669 1577 1529 1432 405 371 353 156 --1295 --
NM_004267chr32100 79 ------
NM_004272chr51763 ------
NM_004286chr22102729 2661 2324 1117 882 758 662 372 263 121 ------
NM_004293chr933837 3597 2792 1253 ----
NM_004302chr1292926 2522 2215 2113 894 790 403 117 26 32747 2565 1017 21973 142 --
NM_004308chr1171786 1581 714 415 283 142 40 --11552 --
NM_004311chr1052683 2476 2145 855 491 1933 ----
NM_004321chr2133195 3179 2948 2797 2710 2263 2254 1395 1234 1146 595 103 33 13049 ----
NM_004329chr1021083 452 ------
NM_004338chr1864354 2353 2102 1221 549 62 32056 735 674 12337 --
NM_004342chr741955 1600 1476 214 128 145 --
NM_004349chr81963 ------
NM_004350chr162351 625 446 389 231 147 22215 766 ----
NM_004370chr621522 283 ------
NM_004379chr21355 ------
NM_004383chr154442 99 88 82 --1190 --
NM_004384chr511962 1901 ----
NM_004385chr52272 231 ------
NM_004387chr52295 95 ------
NM_004389chr22771 550 1556 ----
NM_004392chr1342600 2587 1994 1679 ------
NM_004397chr1144329 3991 3438 2763 1506 31216 623 127 --
NM_004408chr91372 ------
NM_004414chr21----1347 --
NM_004417chr51224 ------
NM_004420chr11122378 2329 2295 2195 2159 2085 1866 785 778 734 281 188 ------
NM_004423chr372707 2098 2074 865 847 622 614 ----1982
NM_004432chr92630 21 ------
NM_004434chr1421317 1244 11805 ----
NM_004436chr11171 ----1657
NM_004437chr152760 2379 2334 604 301 --23494 2805 12739
NM_004440chr62683 269 ------
NM_004451chr113772 671 556 --1665 --
NM_004457chr2----138 --
NM_004458chrX--22117 269 ----
NM_004459chr1711653 1143 ----
NM_004481chr182491 2420 2198 1929 1745 871 227 218 --1719 1773
NM_004494chr13498 147 24 ------
NM_004498chr151154 1133 ----
NM_004499chr51171 ------
NM_004500chr1411883 --21735 1649 --
NM_004501chr113650 --13414 13236
NM_004504chr232324 2316 511 --12364 --
NM_004508chr101737 ------
NM_004514chr1762678 2097 1955 1947 571 89 ------
NM_004515chr1------148
NM_004520chr51181 ------
NM_004527chr172513 38 ----11472
NM_004529chr921448 520 ------
NM_004535chr2051792 1618 296 107 31 2641 277 ----
NM_004554chr1451554 1230 617 422 369 1413 11378 --
NM_004555chr163495 95 88 ------
NM_004566chr1062435 844 744 736 229 127 1989 --12383
NM_004571chr2163291 1318 1189 966 535 396 1512 ----
NM_004576chr5------1143
NM_004580chr1541502 359 252 37 1506 11158 --
NM_004586chrX53951 3779 3545 3469 814 25178 3909 14427 --
NM_004598chr532590 328 259 --23158 3064 --
NM_004602chr2011069 ------
NM_004606chrX2251 47 ------
NM_004613chr20131648 1529 1271 1243 1126 1066 465 235 173 155 119 91 31 2533 506 ----
NM_004650chrX21165 503 ------
NM_004654chrY11345 155 1433 --
NM_004656chr351015 848 495 481 28 --41075 1056 420 116 --
NM_004660chrY1720 11765 --1140
NM_004663chr153999 319 39 ------
NM_004667chr15132 ------
NM_004684chr4----1428 --
NM_004685chr1332426 2177 529 ------
NM_004687chr1711640 --1105 --
NM_004703chr1732490 2099 192 --2752 412 --
NM_004709chrX1439 --11356 1134
NM_004716chr112669 54 ------
NM_004718chr2----1179 --
NM_004726chrX45163 4475 4467 1507 21238 1178 --11140
NM_004729chrX41994 683 505 43 --1567 --
NM_004730chr52736 210 --11684 --
NM_004734chr1332450 2350 325 --12467 --
NM_004736chr152229 850 383 161 125 11998 ----
NM_004744chr422946 496 2923 164 ----
NM_004745chr885420 4959 4635 4608 1809 1601 481 175 15269 34615 2766 167 --
NM_004748chr1533743 3598 1037 --2772 379 --
NM_004758chr177813 782 356 307 224 128 68 --3989 441 301 --
NM_004762chr17101760 1741 1340 683 674 609 568 249 226 42 --1309 --
NM_004770chr81245 ------
NM_004772chr531239 374 123 ------
NM_004774chr1711227 1743 1762 11142
NM_004805chr241371 1092 176 130 --21294 875 --
NM_004808chr1062621 2144 1016 708 517 143 12470 ----
NM_004809chr155652 509 490 162 122 --3631 134 27 --
NM_004815chr164563 4145 3883 3837 3439 1565 14223 24083 1551 --
NM_004820chr83165 141 58 ------
NM_004822chr17103982 3537 3325 2816 1529 803 454 390 357 241 1845 1823 --
NM_004831chr194984 818 121 115 --183 --
NM_004834chr221223 79 --12556 --
NM_004836chr2148 1748 ----
NM_004840chrX32176 1705 1527 22399 1826 11581 --
NM_004849chr61386 ------
NM_004863chr1465228 4162 3592 3562 918 243 14412 1361 --
NM_004869chr18----11334 --
NM_004898chr452617 2133 437 292 47 ------
NM_004902chr201744 1339 ----
NM_004904chr7106147 6134 5846 5659 5348 4903 4892 4143 1620 1158 31129 972 312 ----
NM_004906chr61503 ------
NM_004922chr102770 717 --2709 28 --
NM_004926chr142448 248 1120 ----
NM_004949chr1821562 1547 ----1171
NM_004952chr13663 83 60 ------
NM_004956chr734626 1832 783 ----14227
NM_004961chrX61334 1280 1007 416 388 182 11359 11240 --
NM_004964chr13554 173 35 --1150 --
NM_004969chr10------159
NM_004973chr611153 ------
NM_004974chr1--130 ----
NM_004976chr11224873 4509 4482 4287 4274 4047 4025 3936 3698 3448 1996 1886 1837 1659 1575 1449 1289 1089 505 301 155 107 --54554 3868 2061 1697 116 --
NM_004978chr161693 1647 1423 1077 448 42 ----1118
NM_004979chrX3938 869 358 1366 ----
NM_004981chr22138 ------
NM_004992chrX178097 7360 6913 6440 6022 3266 3169 2961 2861 2605 1706 1600 1555 1441 1413 722 672 36121 2500 1662 67589 7353 6711 6476 5948 5892 --
NM_004992chrX178097 7360 6913 6440 6022 3266 3169 2961 2861 2605 1706 1600 1555 1441 1413 722 672 36121 2500 1662 67589 7353 6711 6476 5948 5892 --
NM_004993chr1411223 ------
NM_004999chr62593 32 11109 ----
NM_005023chr51408 151 ----
NM_005028chr103843 733 640 ------
NM_005056chr1275329 5038 4837 3481 1270 525 172 15447 ----
NM_005057chr131743 1687 1548 1209 ----
NM_005060chr15944 544 459 382 45 --2878 480 --
NM_005063chr10102975 2932 2883 2758 2423 2412 909 474 328 226 43290 2838 1490 349 ----
NM_005065chr1454744 4613 4584 798 540 24221 3659 ----
NM_005077chr91165 ------
NM_005105chr131703 1654 333 1867 ----
NM_005109chr371976 1951 1641 331 304 283 267 1549 1456 --
NM_005121chr1732445 1422 1124 --13389 --
NM_005124chr61291 ------
NM_005126chr332318 1633 709 12280 ----
NM_005135chr1552834 2353 166 143 70 23473 3041 ----
NM_005144chr881084 1064 1011 1002 927 879 192 57 --1390 --
NM_005151chr1822438 547 ------
NM_005156chr924911 1805 176 23313 1845 --
NM_005159chr1521675 890 ------
NM_005160chr2266009 1803 830 603 544 149 25432 5025 1774 --
NM_005168chr21504 ------
NM_005188chr11188207 8002 7359 7259 6934 6744 6569 6046 5904 5181 5145 2320 2145 1944 1615 1266 519 288 16518 --13172
NM_005197chr1484589 4184 4078 2410 2400 2371 2139 935 2641 420 15592 --
NM_005202chr13289 272 257 --11883 1313
NM_005207chr2253399 2726 2536 1344 110 11365 13137 12577
NM_005215chr18----1679 --
NM_005220chr1731400 456 285 ------
NM_005225chr2071168 910 815 790 427 222 62 --1360 --
NM_005233chr3--1109 ----
NM_005238chr1132903 2587 1189 ------
NM_005241chr3--136 ----
NM_005249chr14176 ------
NM_005254chr1521097 141 ------
NM_005264chr10--1784 199 --
NM_005297chr222612 304 --1596 --
NM_005308chr104509 75 40 24 ------
NM_005311chr742553 2358 2341 434 ------
NM_005312chr9102415 2363 2212 1976 1923 859 734 464 157 98 --12237 --
NM_005324chr1721666 1409 --1620 --
NM_005336chr231996 697 313 11563 1141 --
NM_005339chr41562 ------
NM_005347chr911330 21565 136 11061 1526
NM_005359chr1896060 6021 5968 5956 3969 2149 808 317 21 --16292 11372
NM_005369chrX2466 54 ----190
NM_005370chr1951318 81 63 35 24 --2246 124 --
NM_005373chr141588 1510 1237 584 ------
NM_005374chr1792140 2076 1473 927 871 849 831 798 770 11844 --11511
NM_005376chr13958 285 109 ------
NM_005381chr2182 ------
NM_005382chr81147 ------
NM_005384chr92206 59 ------
NM_005392chr961633 1597 730 516 346 49 --21846 168 --
NM_005397chr793372 2724 2604 1252 1224 1063 871 537 39 13338 31414 821 219 --
NM_005398chr1011257 1396 ----
NM_005406chr181395 ------
NM_005417chr2061956 1795 439 416 345 270 --11364 --
NM_005418chr114616 128 62 41 --2742 25 --
NM_005436chr1053830 3571 2920 2578 309 1627 11398 13192
NM_005440chr1762749 2709 895 832 535 488 1357 23152 2965 --
NM_005458chr922116 190 --11729 1918
NM_005474chr1761463 1360 1283 1132 337 281 21077 293 1311 --
NM_005475chr1262574 2002 1141 449 410 170 12433 ----
NM_005477chr1592517 2408 2391 1876 708 491 453 404 384 ----11598
NM_005477chr1592517 2408 2391 1876 708 491 453 404 384 ----11598
NM_005491chrX81867 1794 756 690 666 410 399 327 --3679 154 37 --
NM_005494chr72144 135 ------
NM_005497chr17104885 4070 4037 2298 2188 1994 1916 1681 132 54 --14734 25105 4926
NM_005502chr91200 ------
NM_005512chr11132016 1795 1702 1432 1413 1315 698 508 470 438 424 120 37 --12004 --
NM_005517chr121166 395 ------
NM_005522chr731300 132 28 1884 31015 430 422 --
NM_005523chr741035 415 311 267 --1366 --
NM_005524chr31245 ------
NM_005529chr16936 795 749 735 682 313 2951 46 2720 274 --
NM_005539chr1031359 976 48 ------
NM_005540chr121448 147 163 1129 --
NM_005573chr5167 ------
NM_005575chr51135 ------
NM_005578chr334103 1836 668 23355 590 ----
NM_005587chr153803 690 371 ------
NM_005595chr11314 ------
NM_005596chr936364 4986 2367 14867 ----
NM_005613chr11886 2212 111 ----
NM_005614chr73881 724 131 ------
NM_005627chr6----1188 --
NM_005634chrX1214 ------
NM_005637chr1811688 21354 186 ----
NM_005638chrX31464 1347 577 --1518 --
NM_005647chrX53425 2716 1133 991 690 ------
NM_005668chr554139 3936 3462 3000 727 ------
NM_005688chr351216 885 844 328 64 ------
NM_005715chr652727 2059 1898 1081 1047 1314 41941 1908 544 507 12513
NM_005716chr196571 560 482 466 85 52 1113 199 --
NM_005717chr121010 396 ------
NM_005721chr2--1771 ----
NM_005724chr151296 --1683 --
NM_005730chr1293196 3014 2880 2440 2255 1423 1265 1109 675 21223 600 ----
NM_005734chr111247 125 ----
NM_005735chr25800 555 325 210 55 ------
NM_005737chr262653 2580 2042 1922 1072 243 ----1610
NM_005738chr711531 11982 ----
NM_005739chr1552181 2064 1960 1694 519 ------
NM_005748chr1223171 2770 --12739 --
NM_005759chr234249 3103 423 12957 14282 --
NM_005786chr182883 73 ------
NM_005808chr362799 2762 1436 1362 581 355 11325 12273 --
NM_005813chr222655 1005 1233 12495 --
NM_005817chr194754 212 59 27 ------
NM_005828chr1794707 3860 1653 1453 1291 808 702 610 210 ----1678
NM_005832chr31441 138 ----
NM_005840chrX117311 6926 6887 5218 2682 2653 2577 2131 1734 227 42 11527 24706 2477 --
NM_005842chr13------1199
NM_005852chr174811 735 338 165 159 ----
NM_005857chr121185 117 ------
NM_005860chr1981650 1634 1619 1178 1091 1077 1043 240 --1108 --
NM_005866chr94764 710 602 252 --175 --
NM_005880chr16------11391
NM_005883chr19113021 2776 2466 2399 2299 1927 975 914 597 272 122 --22407 950 3929 663 644
NM_005897chr11902 --31155 374 211 --
NM_005898chr1122520 229 ------
NM_005900chr4296 39 --1424 --
NM_005901chr1845834 3406 3154 2441 ------
NM_005909chr573923 3761 3269 2862 880 839 758 --14064 --
NM_005920chr1103473 2801 2621 2560 1480 1327 1001 825 383 369 --11526 23732 336
NM_005926chr153441 408 141 ------
NM_005933chr11112844 2701 2186 2147 1163 851 653 617 232 133 87 12107 32856 2322 297 --
NM_005934chr1991982 1951 1906 1890 819 298 190 134 22 --22282 2174 --
NM_005937chr17133257 3063 1328 1130 1084 1073 629 556 254 180 146 116 103 24045 3867 22545 1436 13486
NM_005941chr813531 11305 1369 --
NM_005943chr661473 1103 614 467 249 167 1440 21190 482 --
NM_005955chr145199 5189 1483 607 14845 11431 --
NM_005962chr1051950 1874 743 565 191 1630 ----
NM_005962chr1051950 1874 743 565 191 1630 ----
NM_005966chr2--22302 103 ----
NM_005990chr5102570 2485 2476 1745 1035 966 771 330 248 38 1113 ----
NM_006007chr953697 3047 2932 2883 1536 ------
NM_006016chr612031 ------
NM_006022chr131396 ------
NM_006030chr33544 164 90 1395 ----
NM_006034chr11122333 2309 2300 2158 1818 1744 1566 1542 846 782 640 22 ------
NM_006037chr274191 1861 877 795 313 165 53 1966 24859 3580 --
NM_006038chr2082006 1871 1858 1796 640 631 464 399 --1595 --
NM_006039chr1712991 941 929 857 848 767 380 327 319 302 148 52 --1885 1373
NM_006047chr2053419 1129 764 747 649 --1966 --
NM_006054chr112270 103 ------
NM_006067chr162702 379 --1670 --
NM_006076chr7152692 2254 2185 2111 1167 960 860 806 666 572 459 432 216 60 42 1442 11146 --
NM_006077chr103782 241 72 --1716 --
NM_006095chr413386 --1119 --
NM_006106chr1122626 285 ------
NM_006107chr171147 ------
NM_006109chr14126 ------
NM_006133chr1182322 2098 1806 1696 932 882 865 248 --129 1618
NM_006139chr22310 230 22058 1936 12833 --
NM_006167chr821515 440 1658 11482 --
NM_006186chr2--1104 ----
NM_006203chr544512 2187 2129 145 34335 1991 313 35057 4274 3848 --
NM_006218chr3127 1254 ----
NM_006224chr1752041 1824 970 845 217 --1202 --
NM_006237chr131124 ------
NM_006238chr672023 1676 1603 1434 1369 1327 114 --156 --
NM_006241chr31897 1236 ----
NM_006268chr1161077 949 913 840 347 236 --1287 --
NM_006275chr2022437 264 11689 ----
NM_006281chr81873 ------
NM_006281chr81873 ------
NM_006283chr874793 4590 4553 3435 3077 633 231 43453 3228 3118 22 ----
NM_006292chr11130 ------
NM_006293chr156967 645 414 346 142 85 ----1830
NM_006306chrX53691 1429 1218 811 293 21712 1274 31357 1001 417 12291
NM_006317chr51655 ------
NM_006321chr362043 1836 647 485 377 112 --1764 --
NM_006323chr41756 --1689 --
NM_006334chr9146 ------
NM_006336chr951343 261 96 81 69 ------
NM_006352chr121618 326 11437 ----
NM_006353chr62570 21 ------
NM_006357chr22486 135 ------
NM_006361chr174329 238 207 72 11710 11454 --
NM_006371chr395241 4845 3346 3335 1957 281 163 95 73 --23846 3700 --
NM_006373chr1731022 403 210 11149 1431 --
NM_006380chr1742809 1376 223 117 1732 ----
NM_006387chr194873 491 238 92 1768 --1898
NM_006389chr1161090 947 891 531 456 163 --11122 --
NM_006403chr631382 1352 443 ------
NM_006416chr6158 ------
NM_006421chr81238 ------
NM_006434chr1062749 512 419 378 358 307 1395 ----
NM_006449chr212046 --1227 12077
NM_006457chr443867 3759 3280 2940 13673 ----
NM_006458chr112329 312 ------
NM_006465chr1592238 1665 859 789 677 584 514 504 298 12129 41869 1849 646 88 12084
NM_006482chr124952 240 76 51 13617 ----
NM_006485chr224519 197 190 81 --1677 --
NM_006495chr17----1138 --
NM_006504chr1072661 2441 2408 2079 1976 780 353 ------
NM_006517chrX81907 1898 1835 1772 1752 1508 1440 722 2893 394 11456 22304 380
NM_006520chrX1180 ------
NM_006526chr2021664 476 ------
NM_006527chr42122 114 1220 ----
NM_006544chr1445468 1476 1413 1340 1591 ----
NM_006546chr17125934 5358 4726 4304 4284 2024 1992 1955 1534 1152 1133 1030 1201 45383 1986 1971 28 --
NM_006547chr721431 265 1647 ----
NM_006549chr1272592 2510 2352 1948 1906 767 110 ------
NM_006557chr92686 531 11157 ----
NM_006561chr1035704 2060 1999 14378 15183 --
NM_006565chr1621072 215 ------
NM_006572chr1732325 1161 246 23502 1410 ----
NM_006593chr21202 ------
NM_006614chr31576 --12445 --
NM_006618chr111367 ----1361
NM_006620chr644542 4063 1816 1479 23285 3125 21771 1630 --
NM_006621chr13574 249 27 --1377 --
NM_006628chr1554044 1832 1736 1374 1348 ------
NM_006629chr1842748 2011 1759 562 1827 2295 137 --
NM_006646chr1352804 2163 898 830 628 1707 1735 --
NM_006650chr5133731 3403 2816 2808 2742 916 734 666 576 487 411 254 22 1268 23144 754 --
NM_006667chrX2855 58 ------
NM_006690chr20102267 2174 2160 2126 1774 1495 853 642 300 105 --12276 --
NM_006695chr171256 ------
NM_006698chr2021373 541 ------
NM_006699chr142592 1991 746 297 ------
NM_006706chr5--1593 ----
NM_006720chr1064306 1441 1367 1001 838 790 175 11478 --
NM_006736chr291829 1426 1326 704 429 276 241 209 182 --31863 1781 735 --
NM_006738chr15103906 3516 2852 1753 1598 936 534 473 189 49 11669 13684 --
NM_006745chr421098 887 ------
NM_006750chr1666811 6055 2943 2244 2230 25 --1161 15779
NM_006751chr2--1133 ----
NM_006766chr832436 1001 296 ------
NM_006777chrX1229 1518 ----
NM_006826chr2--1818 ----
NM_006827chr14--12831 ----
NM_006832chr141990 11000 ----
NM_006838chr1241698 1560 1532 1494 1250 ----
NM_006839chr2182 ------
NM_006851chr1232841 2076 901 --12432 --
NM_006852chr1742617 1891 1758 396 ------
NM_006861chr12101866 1729 1591 1410 1297 710 458 394 193 57 151 ----
NM_006870chr202619 257 ------
NM_006874chr41271 ------
NM_006875chrX3310 209 120 ------
NM_006876chr111210 1517 ----
NM_006899chr20----1123 --
NM_006906chr113727 234 66 --1835 1704
NM_006908chr72566 105 ------
NM_006922chr22737 44 ------
NM_006924chr1723897 1643 --13801 --
NM_006925chr141411 ------
NM_006931chr1221678 1453 ------
NM_006940chr1221563 622 21628 1550 ----
NM_006943chr2073232 2365 2146 826 657 503 70 1188 1522 12804
NM_006946chr112612 483 --1156 --
NM_006951chr101718 ------
NM_006981chr942806 2665 2477 767 12044 12080 --
NM_006990chr182328 2042 1951 1822 1636 1014 858 736 --12252 --
NM_007006chr161879 --1666 1483
NM_007011chr15105928 5793 4571 2286 2204 1353 1097 683 474 172 14208 21026 430 --
NM_007013chr82307 27 ------
NM_007027chr31451 ------
NM_007030chr5165122 4715 4666 4481 4263 4247 1784 1561 1360 1351 1319 875 472 386 207 139 2989 952 11097 --
NM_007033chr132244 918 599 --1272 1413
NM_007035chr121637 ------
NM_007039chr1411984 11745 --1679
NM_007050chr20158021 7922 7542 5625 5210 5176 3121 2840 2728 2609 2535 2165 1079 208 90 35403 2804 1802 76459 6227 2271 1989 1924 1206 31 25440 249
NM_007067chr1731320 1227 1009 ------
NM_007073chr674207 3972 3882 1570 1443 636 213 ------
NM_007106chr1322449 697 --12512 --
NM_007125chrY21102 538 ------
NM_007146chr1732233 2178 949 12017 1829 --
NM_007153chr1913204 ----12960
NM_007157chrX22599 213 ------
NM_007158chr111082 ------
NM_007174chr1222214 1989 12050 2875 125 --
NM_007187chr132420 186 ------
NM_007189chr751296 438 402 312 30 --41465 1336 1163 1063 1321
NM_007200chr15103906 3516 2852 1753 1598 936 534 473 189 49 11669 13684 --
NM_007203chr91404 13695 1389 --
NM_007210chr1241665 561 220 27 11953 52141 1986 692 389 167 --
NM_007219chr205876 711 694 297 228 --2798 719 --
NM_007221chr13383 111 47 ------
NM_007222chr82580 350 ------
NM_007238chr20124742 4410 4058 3977 3319 3174 3050 1955 1891 1126 1075 303 --3717 599 292 --
NM_007249chr1398627 7511 6902 5922 5863 2884 2731 1816 786 11336 37669 7062 217 --
NM_007260chr16627 587 536 242 89 34 --1292 --
NM_007278chr17--188 ----
NM_007286chr561866 1485 1368 845 825 124 1675 ----
NM_007325chrX62142 1762 1475 862 848 436 ------
NM_007327chr991098 939 911 745 401 350 275 85 75 ------
NM_007345chr18----12025 --
NM_007350chr1224391 3395 ----13145
NM_007353chr782033 1913 1861 1849 1071 689 610 161 1619 21993 519 --
NM_007358chr11530 ------
NM_007365chr182243 2208 1639 1630 1496 1439 197 70 ------
NM_007375chr1----22551 2191 --
NM_012081chr533335 2357 424 --23712 2617 --
NM_012082chr82157 60 ------
NM_012090chr12890 293 --1222 --
NM_012096chr333755 2630 672 --13062 --
NM_012097chr221876 267 ------
NM_012098chr941302 1164 1114 329 --145 --
NM_012102chr132191 1670 237 12371 1396 --
NM_012104chr1143665 2825 1403 797 1509 13490 --
NM_012104chr1143665 2825 1403 797 1509 13490 --
NM_012121chr1751420 1374 542 370 29 ------
NM_012129chr742320 2267 2053 66 ------
NM_012134chr141915 1863 522 253 --51639 408 294 231 133 1482
NM_012137chr111011 11978 --11944
NM_012141chr1323800 981 23277 659 ----
NM_012161chr41330 ------
NM_012193chr1195087 4945 4645 4525 4494 1905 1841 1428 314 ----13770
NM_012197chr931504 1115 208 1296 ----
NM_012199chr184570 4459 4355 4300 4142 3752 3137 464 24361 3477 ----
NM_012214chr265916 4790 4263 4255 2009 1121 15209 ----
NM_012215chr1021448 639 --11940 --
NM_012252chr724374 1326 ----1229
NM_012264chr2271329 795 747 740 663 624 209 --21829 1533 11639
NM_012264chr2271329 795 747 740 663 624 209 --21829 1533 11639
NM_012286chrX2457 442 ------
NM_012287chr344392 2775 1304 216 11531 ----
NM_012288chr675330 4852 4709 4610 4546 2220 700 34755 4581 4054 161 --
NM_012289chr191194 2163 35 ----
NM_012290chr211677 ------
NM_012296chr11103960 3711 3396 3354 3013 2909 2456 1477 1461 755 1831 42942 2517 209 23 --
NM_012304chr512407 1696 ----
NM_012307chr1821047 125 --165 --
NM_012308chr1182451 993 902 653 507 336 133 64 --42402 2258 1581 1003 --
NM_012309chr1174951 4875 4680 1562 1407 1383 948 ------
NM_012316chr155486 5324 5217 4363 1791 --35561 4603 289 --
NM_012329chr1711141 ------
NM_012334chr554142 3691 3043 873 485 ------
NM_012346chr1971190 1174 1133 1013 975 914 21 ------
NM_012384chr2072107 1722 1699 982 816 644 323 1474 12016 --
NM_012398chr19171951 1927 1904 1178 1141 1113 898 643 444 435 342 252 184 159 90 84 33 11869 2826 764 --
NM_012402chr1141265 479 334 181 ----1550
NM_012408chr204746 209 135 129 ------
NM_012412chr7----1784 1683
NM_012416chr911046 1835 1361 --
NM_012417chr17------1521
NM_012421chr1----1165 --
NM_012428chr151635 ------
NM_012471chrX41464 1435 1296 223 ------
NM_012473chr223644 296 285 --2123 110 --
NM_012477chr21173 ------
NM_012479chr742585 1803 1096 456 ------
NM_013230chrY11119 21441 75 ----
NM_013233chr21389 ------
NM_013246chr111108 ------
NM_013262chr62447 218 ------
NM_013269chr1234190 655 541 1722 ----
NM_013279chr1161729 1665 1597 823 781 596 --41775 876 354 89 --
NM_013282chr1951300 1146 912 493 457 ------
NM_013286chr363332 2883 889 840 788 340 --22969 562 1899
NM_013309chr1522279 1762 ------
NM_013316chr7165 1372 ----
NM_013341chr222351 1116 ------
NM_013372chr1521061 132 ------
NM_013382chr1452000 1946 1870 1587 382 --22350 892 1105
NM_013388chr23601 241 29 ------
NM_013401chr114885 843 272 28 --1862 --
NM_013402chr1122446 1742 12704 32125 707 553 --
NM_013423chrX252 36 1304 ----
NM_013427chrX252 36 1304 ----
NM_013433chr1961765 1371 767 380 288 255 ------
NM_013436chr21614 ------
NM_013438chr91320 ------
NM_013444chrX2455 155 ------
NM_013447chr1963306 2784 1343 1307 919 241 --23250 2802 1363
NM_013448chr14--1516 ----
NM_013450chr21328 ------
NM_013951chr271756 896 779 617 446 225 115 11730 12419 22124 365
NM_013952chr281833 1595 973 856 694 523 302 192 11807 12496 22201 442
NM_013953chr281833 1595 973 856 694 523 302 192 11807 12496 22201 442
NM_013958chr81328 ------
NM_013959chr81328 ------
NM_013961chr81328 ------
NM_013962chr81328 ------
NM_013989chr1454978 4637 4447 3417 87 24799 1104 1426 1833
NM_013992chr281833 1595 973 856 694 523 302 192 11807 12496 22201 442
NM_013995chrX198 ------
NM_013999chr172550 75 ----11509
NM_014000chr105758 573 291 272 64 --1412 --
NM_014002chr13618 536 109 ----1571
NM_014007chr931288 1216 512 ------
NM_014011chr2--1458 ----
NM_014016chr31384 188 ----
NM_014023chr1042231 1875 1164 243 --32287 1906 833 --
NM_014048chr1685001 4301 3620 1653 1178 818 702 515 33915 1199 482 13709 --
NM_014056chr321554 380 --11713 --
NM_014057chr921447 1198 ------
NM_014106chr1512149 12136 ----
NM_014112chr844715 3463 1299 106 ------
NM_014141chr724693 361 --24375 1845 1569
NM_014155chr11106710 6623 6253 5868 5755 5645 5472 1904 1317 421 16554 17260 --
NM_014181chr262765 2433 2229 2009 1079 897 12277 ----
NM_014186chr1172213 2060 2039 1744 595 515 350 1337 22086 480 --
NM_014217chr1----1382 1101
NM_014231chr1241416 1362 441 109 1520 ----
NM_014233chr1741789 1603 270 44 1375 3851 172 37 --
NM_014238chr171243 --11440 --
NM_014240chr373328 2939 2916 1658 1539 700 384 11279 ----
NM_014246chr2262179 1570 858 736 402 247 --3297 165 88 156
NM_014251chr71120 ------
NM_014253chrX11745 ------
NM_014272chr15164 ------
NM_014283chr12500 282 1314 ----
NM_014293chr22133735 3621 3372 3316 3169 2838 914 842 626 536 410 231 22 --63908 3675 3059 2883 2621 1236 --
NM_014299chr1981861 1577 1408 636 469 460 129 74 ------
NM_014309chr2274662 4056 3988 2010 1252 1217 842 14877 14147 --
NM_014319chr1211369 11315 1215 --
NM_014321chr161139 1783 ----
NM_014323chr2221023 784 ------
NM_014325chr1242110 1538 1447 723 ------
NM_014332chrX161 ------
NM_014368chr951895 1687 1540 285 207 21594 1332 191 21785 1765
NM_014372chr111637 ----171
NM_014382chr32609 510 ------
NM_014392chr441529 1502 425 210 ------
NM_014393chr832336 2037 1984 ------
NM_014397chr941011 573 397 86 11397 ----
NM_014418chr1441863 1366 1297 188 --122 --
NM_014423chr533753 1773 1260 14474 ----
NM_014445chr32519 180 12180 --1896
NM_014447chr411582 ------
NM_014472chr102725 81 --1586 --
NM_014489chr114552 348 251 33 ------
NM_014491chr711058 ----1856
NM_014498chr31291 ------
NM_014570chr22183 11020 ----
NM_014574chr142418 164 ------
NM_014591chr1051275 1264 448 149 56 ------
NM_014612chr9173 ------
NM_014614chr21107 ------
NM_014620chr121607 ------
NM_014634chr22153450 3403 3194 2985 2903 2803 2734 2687 2548 1374 1209 1170 994 411 158 13382 53228 3064 1423 650 614 --
NM_014636chr963597 3131 1675 1236 369 303 21384 1152 63205 3125 1466 1044 641 268 --
NM_014644chr14840 830 246 135 ------
NM_014646chr1873101 2216 1100 1060 1026 672 184 --51313 1194 594 572 445 --
NM_014647chr161841 11993 ----
NM_014660chr72735 22 ------
NM_014661chr10143619 3316 3186 3058 2734 2688 1149 1090 1006 956 424 256 166 72 --63822 2960 1527 1229 1117 144 2660 88
NM_014665chr893486 2748 2602 2575 2559 1158 1041 436 222 32766 2380 722 1382 --
NM_014666chr511145 --2440 282 --
NM_014670chr221647 465 1612 ----
NM_014676chr151535 1379 1176 404 48 ------
NM_014677chr82526 112 ------
NM_014682chr8----11921 --
NM_014689chr2--1247 ----
NM_014690chr762402 2157 1946 1049 853 468 12939 ----
NM_014699chr162313 279 ------
NM_014701chr152584 471 ------
NM_014705chr722102 1304 ------
NM_014719chr72839 248 --1958 --
NM_014726chr1771377 1092 859 530 511 467 381 11407 1937 --
NM_014729chr811959 ------
NM_014730chr1264955 4097 1690 1392 1269 1127 14169 14899 --
NM_014730chr1264955 4097 1690 1392 1269 1127 14169 14899 --
NM_014731chr2071233 677 610 460 420 191 53 ------
NM_014735chrX82102 2083 1973 1412 1376 761 412 320 --1243 --
NM_014736chr151690 --1671 --
NM_014739chr634084 3428 688 ------
NM_014742chr2021417 468 ------
NM_014756chr111384 ------
NM_014757chr53556 210 92 ----1123
NM_014759chr891650 1634 1535 1486 1181 1061 373 183 61 ------
NM_014762chr152313 693 420 259 166 1131 4970 714 278 214 --
NM_014764chr12----11045 --
NM_014767chr1093528 3078 2868 1130 882 812 526 412 46 23642 3183 ----
NM_014770chr1221137 834 1211 1394 1373
NM_014772chr1882954 2627 1422 1202 1187 217 43 27 22526 204 23201 1446 --
NM_014776chr1222355 733 149 --12796
NM_014779chr31341 ------
NM_014798chr1781737 1656 1624 1609 1585 724 163 78 --31387 701 569 --
NM_014802chr12------125
NM_014803chr101411 ----11839
NM_014807chr116699 541 308 290 239 38 ------
NM_014810chr1142 1478 --22867 2752
NM_014813chr12422 205 --169 --
NM_014819chr542463 2418 802 513 ------
NM_014824chr1111959 ------
NM_014826chr194182 3946 3874 3797 3737 2938 695 584 384 23681 179 33833 3348 1349 --
NM_014828chr1432304 982 58 1783 1373 --
NM_014830chr12133252 3209 2926 2666 2553 1389 1380 1352 1312 1238 1119 999 29 13440 ----
NM_014832chr1321605 60 2723 77 ----
NM_014836chr1031625 188 174 ----11519
NM_014840chr1253332 2095 800 534 217 --13322 1398
NM_014841chr6------1986
NM_014850chr3123897 1962 1934 1854 1722 1685 1662 1650 599 233 166 51 ------
NM_014864chr144222 3557 1531 1501 ------
NM_014872chr922033 1962 11654 11699 --
NM_014873chr164024 1881 1271 907 629 350 1635 ----
NM_014883chr442383 771 497 414 --12257 --
NM_014890chr3124 ------
NM_014891chr751620 1069 454 280 116 ------
NM_014893chrY1349 ----1632
NM_014898chr1912445 12248 ----
NM_014900chr211027 ------
NM_014901chr571990 1454 690 476 156 145 90 2809 632 21907 65 --
NM_014902chr2041330 1317 1260 298 1378 41460 1159 544 479 --
NM_014904chr1033121 1228 294 --12955 --
NM_014912chr1011307 --21379 1069 --
NM_014914chr22451 85 ------
NM_014921chr19122631 2601 2397 2308 1010 992 858 737 729 302 135 32 --22655 254 --
NM_014923chr1332354 1949 1803 ------
NM_014926chr31785 ------
NM_014932chr3--11750 ----
NM_014935chr183769 3199 3135 3003 2686 2638 872 311 --23229 2401 --
NM_014938chr1292081 2008 1824 957 762 389 270 192 126 --12560 --
NM_014946chr222618 2137 22229 91 ----
NM_014947chr142593 2555 2085 1209 --32532 1142 319 --
NM_014948chr2042345 2174 371 302 1861 32135 575 249 --
NM_014961chr431958 1849 300 11495 ----
NM_014962chr2032723 71 29 ------
NM_014969chr12251 196 ------
NM_014974chr1051586 1454 1400 1386 250 --11557 --
NM_014982chr1415117 --1879 --
NM_014988chr432679 1024 83 21865 258 ----
NM_014991chr433267 814 613 --1731 --
NM_014992chr14132 ------
NM_015008chr343136 2709 2315 2246 ------
NM_015009chr31685 1122 ----
NM_015012chr111355 ------
NM_015020chr1662736 2649 1442 1013 945 806 --12951 11274
NM_015023chr151797 1741 1609 686 555 ----21619 538
NM_015026chr1253621 3008 1296 1225 658 ------
NM_015033chr9112543 2270 2054 907 872 323 315 179 96 45 31 --1787 --
NM_015035chr20145797 5082 5062 4627 4600 2382 2235 2156 1846 1027 993 968 156 150 21283 823 12501 14218
NM_015039chr173925 3842 3411 2650 1395 1237 938 23688 3150 11156 --
NM_015042chr1583967 3817 3294 3236 1148 1011 318 42 24218 1111 14096 --
NM_015044chr1662853 2391 2251 827 768 102 --22377 2269 12659
NM_015049chr242814 632 454 161 --22946 2748 22539 644
NM_015051chr953229 3118 2935 2372 1083 22582 2086 ----
NM_015052chr7--11374 ----
NM_015056chr2152328 908 753 375 221 22669 687 1707 --
NM_015057chr131607 ------
NM_015059chr15103650 3251 1514 1154 926 762 632 124 117 25 23120 669 13786 --
NM_015060chr71236 ------
NM_015063chr1971356 1231 518 429 243 204 178 --1927 --
NM_015075chrX121956 1675 1614 883 702 639 627 578 478 466 315 136 1273 --11889
NM_015076chr663212 3065 1422 1379 829 28 ----13369
NM_015082chr562490 2237 1989 1748 1735 453 --12258 11946
NM_015091chr141135 ------
NM_015092chr161239 ----13217
NM_015093chr631603 1213 147 ------
NM_015094chr22214294 4267 4024 3461 3262 3090 3030 3006 2995 2974 2853 1680 1563 1495 1321 1297 1283 829 689 567 209 --11627 --
NM_015103chr36986 663 430 394 380 328 --11029 --
NM_015107chrX102265 1973 1647 1546 849 775 572 470 384 362 ------
NM_015113chr1772161 2137 2028 493 400 250 158 ------
NM_015120chr2125 ------
NM_015133chr1671205 1166 1089 446 278 269 263 --3960 404 294 --
NM_015138chr15102593 2090 2011 1822 1129 953 897 408 354 211 ------
NM_015144chr1633375 2444 845 ------
NM_015149chr11757 1495 ----
NM_015155chr1033201 3151 2300 --21350 876 12416
NM_015163chr1421235 248 21355 1337 168 --
NM_015172chr12506 369 ------
NM_015176chr11558 ------
NM_015178chr8162573 2365 2005 1997 1978 1968 1860 987 825 668 521 480 288 259 175 132 --21645 104 1532
NM_015185chrX52706 2622 2477 2023 549 1969 11160 12523
NM_015193chr891400 1310 1066 995 940 423 374 189 125 11226 11114 --
NM_015194chr1791845 1599 592 457 407 122 107 59 45 --2610 29 --
NM_015208chr1834007 3193 935 ------
NM_015209chr111426 11735 31985 1525 501 --
NM_015215chr122637 709 11995 ----
NM_015219chr17121988 1702 982 798 678 527 431 395 358 345 183 148 --32450 902 577 --
NM_015221chr1061498 1445 1319 971 302 67 ----11027
NM_015225chr952793 2289 1995 1978 230 12016 ----
NM_015229chr174980 919 150 75 1359 1472 2820 52
NM_015230chr421377 642 21394 364 ----
NM_015233chr1342712 1677 305 26 --11769 --
NM_015245chr642479 2339 447 179 --22191 1001 --
NM_015247chr1641621 837 340 42 11630 ----
NM_015254chr892717 2499 2439 2145 1283 1200 622 568 52 --32049 820 85 --
NM_015263chr151907 ------
NM_015265chr212104 ------
NM_015268chr32516 47 ------
NM_015275chr122718 433 ------
NM_015277chr181127 --11215 11407
NM_015278chr612105 13329 --13138
NM_015282chr262350 2046 1055 450 419 105 --12285 12436
NM_015288chr5133857 2950 2392 1342 1222 1089 819 674 598 557 388 327 57 --21022 314 11506
NM_015299chr1493452 3198 3177 3150 3140 2973 424 73 54 11405 23261 2736 --
NM_015305chr1441704 1337 761 509 --41808 689 410 43 --
NM_015310chr8167710 7522 7106 7091 7033 6779 6466 5183 3185 3059 3040 2926 2787 2600 1917 1397 17041 ----
NM_015313chr1144476 4036 3042 1176 11633 ----
NM_015315chr572875 986 678 495 443 423 185 --23213 57 --
NM_015317chr222291 957 ------
NM_015326chr162523 2369 1869 1185 1123 433 --12385 --
NM_015331chr13561 441 29 --1473 --
NM_015335chr12--3904 475 57 ----
NM_015338chr202254 236 11780 --11829
NM_015345chr651932 918 412 286 107 --22214 1743 --
NM_015347chr12--1646 12653 --
NM_015349chr632509 1896 1190 --12535 12351
NM_015365chrX33299 2914 576 --11363 --
NM_015381chr222358 23 --2260 54 11606
NM_015382chr14--1633 ----
NM_015385chr1062749 512 419 378 358 307 1395 ----
NM_015394chr1211854 12457 ----
NM_015397chr921605 329 --1566 --
NM_015435chr82955 540 ------
NM_015443chr171513 ------
NM_015455chr511129 13551 --1185
NM_015475chr2------133
NM_015477chr151263 ------
NM_015484chr12723 107 ------
NM_015493chr1982051 1651 1390 893 158 133 111 86 --21600 778 --
NM_015514chr141577 ------
NM_015520chr342495 2247 1887 504 21791 953 142 --
NM_015526chr1961424 1404 1378 1198 64 33 --11167 --
NM_015535chr263187 2806 1602 1470 823 327 11555 21458 779 12575
NM_015537chr97972 914 877 765 433 425 417 --1862 --
NM_015542chr10159 ------
NM_015553chr664104 3580 3467 3345 1841 1262 24827 430 1256 --
NM_015554chr151369 ------
NM_015557chr1173496 3466 3406 3400 3264 2966 2786 2625 2272 2215 969 957 747 583 507 470 172 23172 2884 1193 23315 2477
NM_015564chr523337 591 1101 ----
NM_015568chr2043661 3458 1663 1108 162 21241 1066 --
NM_015569chr133893 3466 336 14080 23994 1106 --
NM_015570chr751827 655 637 334 202 ------
NM_015575chr263042 3034 2496 1014 851 519 ------
NM_015609chr172833 2583 2531 1954 1150 1048 805 --12658 --
NM_015635chr931660 856 798 --12087 --
NM_015640chr133903 3298 1765 ------
NM_015652chr101177 ------
NM_015678chr13--11101 ----
NM_015686chrX51791 1758 1558 820 586 12132 ----
NM_015696chr11214 ------
NM_015831chr76911 836 677 251 70 33 ------
NM_015855chr116741 583 572 164 151 63 1183 ----
NM_015878chr851930 1845 1648 670 293 ------
NM_015891chr621409 612 --21595 703 --
NM_015904chr2----1595 --
NM_015906chr134385 1025 484 ------
NM_015912chr882054 1962 1772 1735 1682 1006 740 298 --11553 --
NM_015955chr2162 ------
NM_015975chrX41444 663 318 236 --153 --
NM_015980chr51575 11429 ----
NM_015982chr171399 ------
NM_015995chr15124860 4775 4358 3719 3458 2167 1478 1400 695 539 99 45 15265 45305 4469 1531 391 --
NM_016009chr153215 1792 1762 1511 266 --14117 --
NM_016018chr82797 674 1317 ----
NM_016020chr6125 ------
NM_016021chr622850 2255 ----31002 941 739
NM_016025chr16129 ------
NM_016041chr171302 ------
NM_016045chr20----1430 --
NM_016061chr2--1571 1546 11053
NM_016072chr121133 ------
NM_016076chr122717 133 --12987 --
NM_016081chr411764 ------
NM_016083chr623866 1560 23130 52 ----
NM_016096chr83758 703 219 ------
NM_016100chr20178 ------
NM_016103chr51338 ------
NM_016131chr232320 410 276 1250 ----
NM_016132chr1523348 2833 ------
NM_016147chr1181034 778 752 404 314 214 187 35 ------
NM_016169chr10123078 2500 2236 2177 1272 1261 694 688 422 367 188 139 --3797 751 37 --
NM_016173chr3113817 3787 3600 3581 3483 3416 3060 1766 552 465 419 11358 41332 1159 930 77 --
NM_016185chr17169 ------
NM_016188chr7135 ------
NM_016206chr397193 3296 2685 2667 2567 2492 2452 883 221 21101 699 22548 48 --
NM_016210chr37507 496 427 270 228 180 58 ------
NM_016227chr12500 282 1314 ----
NM_016231chr17------11619
NM_016250chr141650 ------
NM_016257chr172781 2706 2540 2522 684 584 115 12689 ----
NM_016258chr11589 ------
NM_016260chr221574 263 ------
NM_016269chr42975 23 ------
NM_016272chr22102511 1837 1798 1715 723 533 430 401 160 140 11010 22609 2104 --
NM_016287chr11785 41937 1702 1418 650 ----
NM_016289chr221917 149 ------
NM_016315chr211449 ------
NM_016319chr12275 64 --1270 1607
NM_016340chr53482 112 95 ------
NM_016376chr1794351 4339 4239 4229 2916 1157 910 739 398 ------
NM_016395chr151253 --11276 21675 40
NM_016396chr1512623 ------
NM_016399chr122642 35 ------
NM_016403chr111606 ------
NM_016418chr22183758 3752 3659 3557 3298 3232 2395 1167 1132 1069 1023 1009 999 987 597 532 176 57 13193 2587 207 13675
NM_016424chr1731652 657 392 ------
NM_016427chr181122 ------
NM_016485chr652016 1822 1789 71 52 ------
NM_016516chr21644 ------
NM_016531chr422971 602 23649 1330 --1639
NM_016542chrX31141 88 44 1566 ----
NM_016553chr1971190 1174 1133 1013 975 914 21 ------
NM_016563chr154956 525 488 22 ------
NM_016588chr61857 ------
NM_016603chr51453 ------
NM_016605chr542568 2313 89 68 --21833 1055 --
NM_016621chr11144374 3950 3813 3787 3456 3426 3315 3260 3247 3162 1769 1625 1521 1179 43650 1598 1103 438 1788 --
NM_016626chr18--1362 1311 --
NM_016647chr891342 1263 1257 1140 1016 536 257 140 118 11466 1349 --
NM_016654chr1521097 141 ------
NM_016734chr971990 1945 1733 1520 577 291 163 21964 1886 188 --
NM_016824chr1021546 421 ------
NM_016848chr91105 ------
NM_016929chr663496 2983 1212 943 655 223 --33203 1742 288 --
NM_016946chr141365 865 614 120 1892 1510 --
NM_016950chr42532 60 ------
NM_016953chr256108 4273 3752 89 59 ------
NM_017412chr81376 11107 ----
NM_017413chrX72327 1870 1626 1583 624 565 222 1712 22278 132 --
NM_017420chr1432919 2670 578 --13427 --
NM_017447chr2143636 3089 1415 1354 --13855 --
NM_017452chr2011069 ------
NM_017453chr2011069 ------
NM_017454chr2011069 ------
NM_017455chr151635 ------
NM_017456chr17101760 1741 1340 683 674 609 568 249 226 42 --1309 --
NM_017488chr241429 592 558 332 ----173
NM_017545chr201415 ------
NM_017548chr321510 317 ------
NM_017551chr10112583 2106 2044 1819 1717 1683 1656 670 516 358 306 --1501 --
NM_017563chr3102462 1923 1661 1271 635 354 276 210 83 62 22145 1727 16028 14372
NM_017577chr331656 1276 1159 ------
NM_017582chr13689 321 278 --21569 544 --
NM_017590chr2292392 2382 2282 2203 913 672 593 351 337 22091 692 21050 821 1331
NM_017594chr932788 1354 571 --11322 --
NM_017607chr192391 153 ------
NM_017610chr1511976 11350 ----
NM_017612chr121143 --1165 --
NM_017615chr10--137 ----
NM_017617chr951358 1234 1006 487 91 1423 ----
NM_017622chr173651 498 73 --143 --
NM_017628chr433805 3753 1573 13566 ----
NM_017632chr41294 ------
NM_017633chr622628 2426 ------
NM_017635chr1141585 1541 614 515 ------
NM_017637chr978639 8062 7950 7855 6027 3192 2984 26351 1253 13408 16968
NM_017643chr1732075 1939 563 ------
NM_017661chr151860 11046 169 --
NM_017664chr13253 35 ------
NM_017670chr111826 ------
NM_017684chr151202 ------
NM_017693chr1331508 1258 88 ------
NM_017709chr153056 2923 1610 308 67 13453 32636 932 385 --
NM_017715chr72564 33 ------
NM_017719chr31205 ------
NM_017737chr12716 709 ------
NM_017740chr16177 ------
NM_017742chr181182 11465 ----
NM_017761chr111125 21490 1109 1512 --
NM_017770chr61764 136 32801 970 848 --
NM_017778chr811057 31073 352 240 ----
NM_017787chr1082439 2162 2023 1100 841 477 438 424 12911 --12248
NM_017789chr21616 ------
NM_017791chr1451490 1042 423 410 369 ------
NM_017798chr2011215 --1986 --
NM_017801chr32617 59 21676 280 ----
NM_017813chr835545 1798 1081 ------
NM_017830chr4----2715 82 --
NM_017848chrX34490 3210 1332 33301 1828 68 23846 290 --
NM_017851chr1541165 1108 1021 227 --196 --
NM_017860chr11363 1570 ----
NM_017893chr1071433 1230 1087 210 204 156 40 ------
NM_017902chr10145633 5404 4829 4315 3966 3561 1683 1661 1246 1237 1150 1043 270 131 1679 1622 --
NM_017915chr121875 ------
NM_017921chr1732013 1442 422 11434 21662 34 11702
NM_017938chrX4598 350 241 209 ------
NM_017944chr1152368 2323 1023 656 149 --12353 --
NM_017958chr241205 1145 576 506 ------
NM_018014chr261135 337 250 152 142 132 --11247 --
NM_018015chrX21041 112 ------
NM_018017chr1011011 ------
NM_018027chr1052445 883 861 114 91 --11267 11037
NM_018032chr166711 688 658 606 175 41 ------
NM_018036chr1433281 1528 56 --33037 791 50 --
NM_018045chr192808 2623 2414 2349 1982 959 812 788 440 2689 608 ----
NM_018051chr71323 ------
NM_018052chr161340 --2173 25 178
NM_018053chr16733 722 713 549 242 225 ------
NM_018063chr101160 ------
NM_018071chr145828 700 675 330 83 ------
NM_018078chr41372 ------
NM_018084chr232636 2508 531 --12905 --
NM_018092chr1631138 630 442 ------
NM_018098chr3--1402 ----
NM_018110chr1631204 870 101 1497 ----
NM_018117chr102270 81 ------
NM_018121chr1062888 2221 2177 2114 1082 51 1841 ----
NM_018125chr11450 ------
NM_018133chr32364 90 1478 ----
NM_018157chr1221116 476 --12522 12462
NM_018171chr123879 648 358 ------
NM_018178chr131823 1688 1455 ------
NM_018184chr3----1395 --
NM_018198chr191393 1387 1194 1170 963 458 403 317 228 ------
NM_018199chr1411188 ------
NM_018200chr153775 554 395 21845 1612 32124 1887 994 --
NM_018207chr14471 333 88 54 1382 21407 627 11488
NM_018208chr141142 1031 1006 786 ----1142
NM_018211chr11358 ------
NM_018214chr62442 74 ------
NM_018223chr128930 906 855 791 728 428 203 187 ------
NM_018227chr422851 2464 ------
NM_018244chr2031186 401 254 ------
NM_018246chr852747 2720 2682 2220 840 --1728 --
NM_018247chr631983 1908 285 --12583 --
NM_018254chr11707 ------
NM_018266chr311047 ------
NM_018270chr203666 256 233 --1119 --
NM_018299chr843373 916 829 182 ------
NM_018323chr4186 11454 ----
NM_018325chr961463 1313 449 152 57 21 ------
NM_018339chr931245 728 172 --1470 --
NM_018340chr1664331 3828 1931 882 153 102 ------
NM_018351chr1223640 1744 34505 1881 740 --1859
NM_018357chr151436 ------
NM_018364chr123347 627 ------
NM_018371chr811438 1258 1404 --
NM_018375chr1421711 1351 11824 1128 --
NM_018381chr192634 358 ----172
NM_018388chrX11295 ------
NM_018398chr3--1111 ----
NM_018400chr1184254 4238 4147 3827 3549 3197 514 99 ------
NM_018403chr393672 3413 3065 2768 2498 1430 407 383 31 11064 1110 --
NM_018416chr1272537 2406 2237 1709 766 76 28 1800 ----
NM_018425chr1051869 876 233 218 111 --22108 1890 --
NM_018439chr1832618 2364 2155 --1443 --
NM_018440chr882826 2409 1891 1595 1521 1293 874 846 27678 2304 36968 1693 1608 15251
NM_018448chr12----11229 --
NM_018457chr123584 142 124 1531 1474 --
NM_018469chr171492 --11354 --
NM_018471chr2136 ------
NM_018509chr1711646 1568 11659 --
NM_018527chr132400 40 ------
NM_018566chr144597 1813 917 28 24739 3921 2479 372 --
NM_018571chr21516 ----1652
NM_018584chr1----1989 --
NM_018638chr1224967 3852 ------
NM_018644chr1191547 1429 1422 702 652 528 492 299 226 --1142 --
NM_018667chr16112480 2450 2063 1908 1880 1107 796 744 591 208 48 --21824 1054 11803
NM_018685chr711156 ------
NM_018695chr52702 353 ------
NM_018710chr811356 ------
NM_018712chr11178 ------
NM_018715chr162167 1947 1869 1768 1623 808 ------
NM_018717chr492609 1825 989 885 775 449 429 319 285 --11002 --
NM_018718chr761671 1487 832 768 543 488 ------
NM_018837chr202293 194 ------
NM_018890chr72566 105 ------
NM_018898chr532178 1870 101 ------
NM_018899chr532178 1870 101 ------
NM_018900chr532178 1870 101 ------
NM_018901chr532178 1870 101 ------
NM_018902chr532178 1870 101 ------
NM_018903chr532178 1870 101 ------
NM_018904chr532178 1870 101 ------
NM_018905chr532178 1870 101 ------
NM_018906chr532178 1870 101 ------
NM_018907chr532178 1870 101 ------
NM_018908chr532178 1870 101 ------
NM_018909chr532178 1870 101 ------
NM_018910chr532178 1870 101 ------
NM_018911chr532178 1870 101 ------
NM_018912chr551248 1223 1126 338 50 ----1550
NM_018913chr551248 1223 1126 338 50 ----1550
NM_018914chr551248 1223 1126 338 50 ----1550
NM_018915chr551248 1223 1126 338 50 ----1550
NM_018916chr551248 1223 1126 338 50 ----1550
NM_018917chr551248 1223 1126 338 50 ----1550
NM_018918chr551248 1223 1126 338 50 ----1550
NM_018919chr551248 1223 1126 338 50 ----1550
NM_018920chr551248 1223 1126 338 50 ----1550
NM_018921chr551248 1223 1126 338 50 ----1550
NM_018922chr551248 1223 1126 338 50 ----1550
NM_018923chr551248 1223 1126 338 50 ----1550
NM_018924chr551248 1223 1126 338 50 ----1550
NM_018925chr551248 1223 1126 338 50 ----1550
NM_018926chr551248 1223 1126 338 50 ----1550
NM_018927chr551248 1223 1126 338 50 ----1550
NM_018928chr551248 1223 1126 338 50 ----1550
NM_018929chr551248 1223 1126 338 50 ----1550
NM_018947chr735036 4456 941 ----11986
NM_018948chr121060 393 ------
NM_018951chr72971 98 ------
NM_018968chr2----1100 --
NM_018976chr1221939 30 ------
NM_018979chr1272351 2218 1974 1010 364 155 79 ------
NM_018993chr201463 ------
NM_018999chr103580 190 115 33249 979 333 ----
NM_019000chr511539 ------
NM_019004chr732234 1900 314 1601 ----
NM_019005chr7165 --1330 --
NM_019008chr2273706 3569 3275 3091 2433 598 314 23065 2901 ----
NM_019024chr21318 ------
NM_019027chr422348 823 ----1679
NM_019044chr2134650 4511 4478 3508 3394 3253 3130 2942 1763 1221 966 537 445 13758 22880 1864 --
NM_019063chr21775 1788 ----
NM_019072chr543213 3116 1436 1395 123 ----
NM_019084chr1022474 854 ----11956
NM_019088chr192333 80 ------
NM_019102chr71144 ------
NM_019102chr71144 ------
NM_019106chr2293287 2658 2515 2495 2464 2303 613 242 190 --21018 672 --
NM_019114chr912543 ------
NM_019116chr1693482 3319 2730 2292 1210 867 795 717 22 11036 13033 --
NM_019556chrX------11311
NM_019593chr2063087 3070 2876 2193 2122 323 ------
NM_019596chr2121878 273 11013 12041 --
NM_019597chrX1271 ------
NM_019884chr195532 127 97 72 40 ------
NM_019885chr272117 1031 970 625 235 165 25 ------
NM_019903chr1021546 421 ------
NM_020039chr1261698 1538 747 492 158 60 ------
NM_020122chr2105798 5509 5476 5293 3967 3746 2081 1710 1524 1395 23883 466 1664 --
NM_020127chr161528 1303 504 454 290 54 ------
NM_020134chr26344 294 263 135 118 49 --1254 1282
NM_020140chr12--135 ----
NM_020142chr125519 421 402 214 47 ------
NM_020144chr72763 392 ------
NM_020150chr10----32105 556 496 --
NM_020168chr152199 151 --1891 --
NM_020177chr512909 22435 697 ----
NM_020182chr2063352 3094 3037 2629 2596 734 12447 13337 --
NM_020184chr282103 1965 1490 627 500 453 137 81 --154 --
NM_020194chr21104 ------
NM_020200chr1031075 442 275 ------
NM_020205chr133080 2475 116 148 ----
NM_020210chr153934 272 126 --1689 --
NM_020228chr1152236 674 493 296 78 ------
NM_020235chr32317 130 ----179
NM_020239chr141762 913 849 55 --1250 --
NM_020245chr684191 3315 338 307 138 129 72 38 13789 24917 4211 --
NM_020248chr162125 1821 1811 864 828 349 --12237 --
NM_020310chr17102381 1936 1808 834 563 483 419 394 251 95 ------
NM_020336chr2043834 3178 2822 2391 11305 ----
NM_020342chr21525 1629 --1135
NM_020348chr1022661 2049 ------
NM_020354chr102864 766 ------
NM_020357chr31623 11431 ----
NM_020374chr1221500 1338 1113 11381 --
NM_020420chrY11153 1662 ----
NM_020424chr162804 637 ------
NM_020429chr782500 2412 2242 2086 2014 649 329 31 --23097 476 --
NM_020438chr91122 ------
NM_020440chr113025 ----22668 600
NM_020443chr186952 6587 5955 5589 4569 1813 1648 1632 22097 1153 1509 15073
NM_020465chr165665 417 398 322 255 --2788 551 11727
NM_020526chr151484 1221 631 251 37 --21415 657 1276
NM_020631chr171374 1350 1217 454 250 184 143 11069 21266 470 --
NM_020651chr21556 1520 ----
NM_020654chr3179 1446 ----
NM_020673chr2046835 5108 617 570 27397 7165 37206 5648 2182 22247 1383
NM_020686chr1692937 1099 870 568 486 390 245 227 32 --12652 22607 2308
NM_020698chr1272389 2367 2213 1935 390 266 210 13115 ----
NM_020699chr164894 4768 4283 1271 1215 717 1910 34548 3871 3730 14975
NM_020708chr20101587 695 603 352 343 250 200 139 55 25 --21992 511 11681
NM_020711chr221834 1017 ------
NM_020713chr20173051 2856 2823 2778 2636 2575 2565 2499 2480 2436 2415 2281 2250 1033 1009 893 800 --32449 1232 913 --
NM_020717chrX64390 3747 1816 1343 1080 951 24262 3980 34187 3052 1264 --
NM_020718chr1685868 5267 5250 4741 4330 2003 1847 455 ------
NM_020727chr21--23786 421 ----
NM_020734chr12----11009 --
NM_020739chr1533743 3598 1037 --2772 379 --
NM_020749chr821312 331 ----1784
NM_020753chr178752 737 707 294 180 144 128 38 ------
NM_020754chr341080 1059 995 159 --21272 1028 1890
NM_020760chr241924 1630 1279 170 1385 ----
NM_020766chrX24256 487 11522 ----
NM_020772chr1747314 2027 1832 1051 --16856 --
NM_020773chr492267 1061 980 944 880 838 592 197 40 ------
NM_020778chr15144710 4485 4017 3618 3073 1641 1385 1252 1147 595 584 361 321 192 --64745 4650 3761 1649 710 567 13508
NM_020792chr332280 615 30 ------
NM_020794chr111508 ------
NM_020795chr1761850 1712 1610 1375 515 178 --1695 --
NM_020796chr552321 2304 2245 779 61 ------
NM_020801chr551918 1825 665 256 164 ------
NM_020807chr1671437 1320 1164 439 225 102 71 1368 2646 52 11804
NM_020813chr1961137 1031 823 812 540 260 11967 1636 --
NM_020821chr151202 ------
NM_020830chr252798 1188 917 869 378 ------
NM_020832chr13560 195 43 ----1234
NM_020834chr141726 ------
NM_020839chr351245 547 389 231 74 ------
NM_020841chr1232714 2563 1520 1529 ----
NM_020850chr1683039 2669 2485 2075 1242 798 647 389 --52642 2570 2551 2313 110 22431 557
NM_020868chr2--1166 ----
NM_020871chrX2754 719 ------
NM_020888chr141623 534 497 385 --1435 1747
NM_020899chr176998 776 728 463 125 93 --1135 --
NM_020920chr142327 106 ------
NM_020921chr1411457 23277 86 ----
NM_020922chrX2289 162 ------
NM_020927chr1631872 373 98 1311 1499 --
NM_020933chr1941872 1211 126 79 --1355 --
NM_020935chr242926 1741 332 119 --21382 421 --
NM_020939chr661323 1314 902 541 427 65 --11243 11186
NM_020940chr1062896 2750 2447 1946 1932 1174 ------
NM_020951chr1921659 442 ------
NM_020952chr91806 ------
NM_020956chr19124191 4048 3454 3194 1615 1501 1414 1037 887 822 138 132 24119 248 33798 3473 3263 --
NM_020962chr1561739 1575 967 450 371 291 ------
NM_020967chr2041145 1081 1038 321 ----1426
NM_020977chr4------11966
NM_020988chr1621243 369 11348 1389 --
NM_020993chr1262255 780 770 595 586 248 ----1656
NM_021003chr141160 156 ----
NM_021013chr171261 --188 --
NM_021020chr8113359 3126 2812 2648 2561 2216 1146 906 869 590 197 --53072 2402 1301 991 684 --
NM_021061chr844010 3399 1506 568 23315 69 34214 3505 1338 --
NM_021064chr631450 568 511 2344 28 --31678 714 44
NM_021069chr431799 834 170 ------
NM_021079chr17113062 2867 2858 2755 2423 2381 2122 959 841 739 630 ----12926
NM_021096chr22173322 3314 3252 3108 3090 3035 2956 2950 2920 2833 2643 2061 1279 1167 681 176 111 --22457 2140 --
NM_021097chr252622 2535 2485 808 227 --11882 --
NM_021135chr6112470 2199 2105 1282 994 963 730 689 607 446 100 23392 2344 3649 292 72 --
NM_021136chr14------1274
NM_021140chrX1382 ------
NM_021148chr721939 903 ------
NM_021159chr411083 ------
NM_021161chr14--1102 ----
NM_021183chrX42553 890 422 106 ------
NM_021191chr1282443 2157 1665 935 389 260 199 126 ------
NM_021198chr281479 1060 1022 515 413 318 252 192 11154 1926 --
NM_021202chr2062782 2551 1934 1115 707 514 1976 21191 494 --
NM_021238chr1231813 1436 1295 ------
NM_021239chr141263 ------
NM_021255chr1422496 1208 12940 23331 1045 --
NM_021260chr1481315 1162 1128 870 522 459 152 22 ------
NM_021569chr991098 939 911 745 401 350 275 85 75 ------
NM_021629chr331968 1802 59 13583 ----
NM_021633chr151001 531 388 363 39 ------
NM_021638chr494918 4334 3225 1924 1818 875 362 158 130 --43949 3271 1989 1698 --
NM_021648chr642349 2042 2026 740 --1836 1887
NM_021738chr10123 ------
NM_021783chrX32131 1515 23 21657 266 --11972
NM_021814chr621664 1269 --11464 1440
NM_021907chr2128 ------
NM_021908chr71826 ------
NM_021911chr521475 281 ------
NM_021913chr19------21481 274
NM_021914chr1471635 773 713 462 160 114 53 ------
NM_021925chr21714 11463 1536 11770
NM_021943chr662133 1961 1881 1859 1382 686 --22140 1932 --
NM_021945chr672907 2722 2580 1058 600 412 115 21228 156 12447 11162
NM_021947chr1741106 1048 1025 409 11074 ----
NM_021954chr13103607 3299 2672 1435 651 573 412 400 276 123 ------
NM_021956chr61291 1323 ----
NM_021961chr1184783 4567 2757 2396 2365 1406 322 268 34731 2988 2873 ----
NM_021964chr345691 4556 4201 2126 1636 ----
NM_021977chr61597 --13213 --
NM_021984chrX61334 1280 1007 416 388 182 11359 11240 --
NM_021987chrX61334 1280 1007 416 388 182 11359 11240 --
NM_021988chr201996 ------
NM_021990chrX61334 1280 1007 416 388 182 11359 11240 --
NM_021998chrX1457 ------
NM_022048chr1576071 5893 5542 5218 4300 4168 1128 15439 ----
NM_022060chr1441095 917 899 519 21189 1085 ----
NM_022075chr11177 ------
NM_022080chr2042779 2283 1940 349 --21784 291 --
NM_022090chr5--1550 ----
NM_022091chr611833 ------
NM_022114chr1104689 4508 4079 3686 3486 3322 3302 3041 1749 72 13056 33464 1291 575 --
NM_022118chr131572 ------
NM_022130chr511322 ------
NM_022166chr16145354 4207 2521 2212 2111 1942 1870 1314 1280 1024 683 676 643 444 ------
NM_022336chr242193 2077 272 264 1544 21485 712 --
NM_022340chr363679 2354 1447 493 470 429 13460 3618 334 30 --
NM_022351chr823424 1043 22423 181 ----
NM_022361chr62534 86 ------
NM_022368chrX168 1115 ----
NM_022442chr201996 ------
NM_022456chr1287404 6849 6388 5776 5750 5713 2928 2735 22304 1496 46286 2289 2165 1436 34721 2791 98
NM_022459chr1365127 4150 2506 2295 1100 120 26098 462 24393 503 --
NM_022462chr1933695 204 104 --12910 12848
NM_022465chr1292853 2452 2233 2138 2009 1174 733 679 26 ------
NM_022476chr161415 ------
NM_022477chr2021611 34 1183 11582 --
NM_022484chr7--1511 ----
NM_022497chr372994 1162 927 742 662 590 74 23625 2873 33783 2594 1030 13014
NM_022574chr762038 1978 1923 1883 1614 564 --11876 --
NM_022650chr51245 ------
NM_022652chr121253 ------
NM_022659chr8173 ------
NM_022716chr152239 2191 1260 1254 304 ------
NM_022733chr11307 1918 ----
NM_022742chr7130 ------
NM_022748chr752504 1104 733 116 75 --22129 1072 --
NM_022749chr851102 925 903 500 425 --1399 --
NM_022753chr132680 1951 1020 12292 ----
NM_022755chr972291 2074 1830 1815 929 817 596 --11713 --
NM_022756chr131197 511 39 ------
NM_022758chr672890 2522 2453 2384 2020 1276 1017 --23006 2071 --
NM_022763chr32950 557 --11186 --
NM_022781chr953079 2538 2127 1305 381 ------
NM_022784chr151813 1105 ----
NM_022802chr1021382 408 ------
NM_022817chr252197 2127 915 666 21 ------
NM_022823chr21467 ----170
NM_022824chr531351 688 22 ------
NM_022829chr2051404 282 202 151 141 ------
NM_022831chr131484 1406 1160 --1166 1135
NM_022836chr131715 1478 1132 --41392 735 129 35 --
NM_022845chr1632050 1833 1738 ------
NM_022893chr232833 2515 310 ------
NM_022894chr221553 663 ------
NM_022897chr5187 1154 ----
NM_022901chr931496 1403 42 ------
NM_022902chr51384 1401 ----
NM_022910chr165665 417 398 322 255 --2788 551 11727
NM_022912chr242827 1185 893 830 ------
NM_022917chr94941 810 253 203 1919 11144 1821
NM_022965chr451441 561 429 348 44 11035 21510 312 --
NM_022977chrX--22117 269 ----
NM_023000chr1411050 --11708 --
NM_023001chr1411050 --11708 --
NM_023011chr132733 325 ------
NM_023033chr122515 239 ------
NM_023076chr16102357 2257 2184 2090 2017 1204 763 702 151 117 ------
NM_023079chr17138 ------
NM_023929chr822474 220 ------
NM_024003chrX5627 602 547 248 70 --1541 --
NM_024007chr532730 2603 566 12723 ----
NM_024015chr1761068 985 884 388 99 85 ----1765
NM_024043chr16111423 1194 1003 972 965 465 366 303 272 254 234 --21309 881 --
NM_024076chr19102414 2178 2031 1981 1701 553 502 329 230 128 12213 11998 --
NM_024086chr1763701 3322 1437 1151 1116 88 ------
NM_024090chr441279 1204 725 30 11707 ----
NM_024107chr174794 616 290 279 --1629 178
NM_024294chr672890 2522 2453 2384 2020 1276 1017 --23006 2071 --
NM_024297chr173465 73 57 1446 ----
NM_024332chrX1659 ------
NM_024408chr153369 3251 1140 554 306 11217 ----
NM_024411chr202133 106 11025 --11011
NM_024416chr921447 1198 ------
NM_024511chr453456 2931 2386 2161 1090 ------
NM_024525chr11569 --1519 --
NM_024551chr1282241 1953 1922 1025 915 724 133 95 1233 ----
NM_024551chr1282241 1953 1922 1025 915 724 133 95 1233 ----
NM_024594chr511446 11902 ----
NM_024595chr121016 795 --1881 --
NM_024607chr894019 3387 3278 3259 3187 2913 1639 296 46 1893 ----
NM_024612chr172157 143 ------
NM_024639chr642753 2237 564 120 12061 195 1241
NM_024659chr21116 133 ----
NM_024665chr324456 106 --14370 --
NM_024666chr1541579 1449 521 68 --1585 --
NM_024692chr22705 632 2460 26 21787 57 --
NM_024701chr1031443 1410 122 --1490 1267
NM_024721chr8----1583 --
NM_024722chr172366 57 ------
NM_024742chr16101907 1901 1625 1337 1237 1209 736 708 585 131 --41883 579 513 444 --
NM_024744chr231661 955 554 12017 ----
NM_024762chr194851 373 327 138 ------
NM_024769chr11------2254 73
NM_024770chr296754 6414 6392 1934 1719 1485 845 594 136 1462 26703 711 15353
NM_024778chrX125 --1251 --
NM_024786chr51828 --3697 191 137 --
NM_024792chr173999 409 282 1250 1809 --
NM_024817chr15195323 5290 4327 4247 3984 1891 1812 1331 1322 1197 1093 848 735 609 549 484 298 100 91 12133 14587 1410
NM_024828chr911355 ------
NM_024830chr552119 2073 1791 307 58 2875 122 1510 --
NM_024831chr82293 215 ------
NM_024887chr141780 1708 673 129 ------
NM_024900chr44911 840 760 299 21871 1546 ----
NM_024900chr44911 840 760 299 21871 1546 ----
NM_024911chr1------183
NM_024923chr361405 1059 993 978 178 41 --21262 1024 --
NM_024939chr1661250 1202 1017 423 305 280 11506 21193 63 1138
NM_024947chr389132 7370 7150 3273 2464 2139 1627 454 ------
NM_024949chr4124377 4345 4226 4212 4185 4111 3987 3974 1689 1489 1167 760 --11586 --
NM_024963chr7205707 5495 4367 4126 4056 3867 3713 3673 1932 1549 1536 1492 1388 700 666 453 415 341 319 54 1688 45217 5079 1279 582 --
NM_024969chr21307 ------
NM_024971chr91806 ------
NM_024989chr235701 5339 2247 ----12967
NM_024991chr1062749 512 419 378 358 307 1395 ----
NM_024997chr163228 106 94 11173 --11194
NM_025027chr191312 ------
NM_025054chr844029 2873 2584 349 ------
NM_025074chr472350 2168 1143 1011 631 573 432 --11974 --
NM_025106chr171864 1858 1272 1178 500 461 300 ------
NM_025133chr2--2321 148 ----
NM_025134chr16--12423 ----
NM_025140chr121449 ------
NM_025152chr142530 296 11295 ----
NM_025164chr1131780 1612 759 --12036 --
NM_025165chr15125 --1113 --
NM_025179chr1----34680 4249 739 --
NM_025181chr22238 21 ------
NM_025221chr411138 ------
NM_025224chr20102284 1853 1810 1766 821 768 550 515 433 381 --1444 --
NM_025235chr1041864 728 627 427 ------
NM_025248chr1773019 3005 2968 2751 2376 2272 344 --13057 --
NM_030576chr1762484 2154 2039 1749 497 291 --12585 --
NM_030579chr1623014 182 --1759 --
NM_030621chr1433904 2604 1262 ------
NM_030623chr22598 458 21681 1485 --1266
NM_030625chr10------11875
NM_030645chr151231 509 377 267 148 --155 --
NM_030647chr745955 4297 2313 59 --14225 --
NM_030648chr465375 5179 4299 4239 3379 1508 --24691 539 --
NM_030660chr1411223 ------
NM_030664chr103954 202 68 42381 1773 943 194 ----
NM_030674chr1243963 943 614 394 --25651 4876 15679
NM_030761chr142615 2494 1690 41 12127 1488 --
NM_030766chr122241 197 1855 ----
NM_030795chr81389 ------
NM_030797chr22265 189 ------
NM_030799chr521423 408 ------
NM_030802chr174603 285 219 92 1308 ----
NM_030806chr1188646 8343 8231 8138 7625 7499 7043 6771 6725 6567 3186 3080 1571 1051 866 836 799 472 38045 7862 6846 29285 8588 --
NM_030813chr114899 755 350 137 --1210 --
NM_030816chr163704 3066 2728 1060 781 416 12889 ----
NM_030820chr64398 241 193 26 ------
NM_030912chr101282 ------
NM_030915chr262180 2139 1536 1472 318 206 ------
NM_030918chr1125070 4558 4511 4394 4327 4310 3852 3350 1894 1710 1598 253 11065 ----
NM_030920chr141915 692 673 290 ------
NM_030952chr161082 937 862 135 106 25 --31013 327 260 --
NM_030958chr81186 ------
NM_030979chr13--1371 ----
NM_031216chr18171 ------
NM_031262chr92347 25 ------
NM_031263chr92404 82 ------
NM_031266chr51171 ------
NM_031284chr153873 767 696 ------
NM_031286chr12327 119 ------
NM_031289chr124885 814 281 125 ------
NM_031292chr1211203 ------
NM_031298chr171152 ------
NM_031304chr192187 23 ------
NM_031306chr1--1279 3911 756 688 --
NM_031309chr8132372 2357 2252 2198 1956 1853 1624 774 671 428 210 128 98 --11501 --
NM_031314chr1411883 --21735 1649 --
NM_031411chr532178 1870 101 ------
NM_031417chr1982692 1028 921 494 293 269 137 131 32234 1871 609 22293 2226 1651
NM_031439chr851821 1507 428 210 136 1470 ----
NM_031442chrX32364 471 408 12267 ----
NM_031444chr22112353 2146 1942 847 622 353 278 137 124 77 57 --11595 1540
NM_031445chr262421 2336 1177 1020 730 564 12845 13271 1200
NM_031453chr1062488 1955 1784 831 619 369 12268 ----
NM_031468chr7147281 6696 6499 6399 3011 2911 2870 2635 2539 1879 1834 1444 729 34 17571 22745 694 --
NM_031476chr1642652 1096 745 386 1905 11737 --
NM_031844chr113650 --13414 13236
NM_031845chr233590 2244 46 1569 ----
NM_031847chr233590 2244 46 1569 ----
NM_031849chr532178 1870 101 ------
NM_031857chr532178 1870 101 ------
NM_031860chr532178 1870 101 ------
NM_031866chr103972 318 241 ------
NM_031890chr2272986 2618 2207 2004 713 631 40 12095 --11079
NM_031892chrX3745 296 41 ------
NM_031899chr371214 401 364 327 65 46 24 --11277 --
NM_031905chr71944 ----11168
NM_031908chr511130 ------
NM_031935chr1--11044 ----
NM_031938chr111652 1181 ----
NM_032012chr944826 4475 1507 60 --21632 1488 --
NM_032013chr2021611 34 1183 11582 --
NM_032017chr1141921 1823 1808 1793 1614 1306 724 666 655 604 317 223 136 78 2508 386 21586 1576 --
NM_032027chr1130 ------
NM_032041chr822695 190 --1522 1985
NM_032042chr522460 2300 11153 1115 --
NM_032050chr2221023 784 ------
NM_032052chr2291408 1169 1005 966 919 365 295 243 225 --1929 --
NM_032088chr551248 1223 1126 338 50 ----1550
NM_032092chr551248 1223 1126 338 50 ----1550
NM_032102chr11--1382 --12093
NM_032105chr1147879 7224 7213 7161 6495 6165 5904 5649 5206 2856 2407 1679 1318 1022 --37279 5769 5384 --
NM_032121chrX2988 704 1319 ----
NM_032144chr231720 525 345 ------
NM_032147chr1211016 ------
NM_032148chr121367 ------
NM_032199chr1063671 3472 2551 2491 1504 183 23027 24 22383 137 11227
NM_032208chr253430 3012 2249 1359 94 23277 3196 --1439
NM_032211chr104345 316 252 79 ----1445
NM_032213chr22224 106 --1290 --
NM_032228chr1122283 246 1203 ----
NM_032229chr132285 52 ------
NM_032242chr3173263 3142 3040 2988 2966 2884 2865 2711 2628 2024 892 877 786 541 505 472 349 --13001 1527
NM_032268chr1663230 3068 2390 2062 867 238 --22570 2245 --
NM_032281chr1952797 1113 776 501 127 --22987 747 186
NM_032289chr551781 1676 1489 735 244 --1139 --
NM_032294chr1761732 1720 1435 483 287 60 1670 ----
NM_032321chr263325 2615 1022 692 580 391 ------
NM_032373chr1035293 5247 834 ------
NM_032403chr551248 1223 1126 338 50 ----1550
NM_032408chr731231 911 236 --1299 --
NM_032434chr21247 ------
NM_032436chr132752 217 ------
NM_032438chr621488 45 ------
NM_032439chr1021121 446 --11499 --
NM_032440chr1072966 2315 2233 1944 1184 815 296 ------
NM_032441chrX--2479 181 ----
NM_032445chr1532196 829 793 12392 ----
NM_032452chr1411202 1496 11015 --
NM_032457chr432964 1194 525 ------
NM_032458chrX52955 2132 1033 948 494 ------
NM_032466chr831631 1318 152 145 ----
NM_032468chr831631 1318 152 145 ----
NM_032482chr19132455 2304 2214 2119 1947 1867 1853 1045 581 548 339 307 126 --12141 --
NM_032486chr1652646 2284 940 831 35 --1522 --
NM_032491chr12----1983 --
NM_032512chrX51104 739 49 31 25 --1834 --
NM_032521chr2022872 773 22967 200 1350 --
NM_032538chr662409 2093 2017 1815 797 186 ------
NM_032560chr141213 ------
NM_032561chr224515 192 163 87 2232 31 150 --
NM_032581chr71104 --11525 --
NM_032582chr171695 11721 ----
NM_032590chr1221162 853 11191 ----
NM_032596chr91111 ------
NM_032603chr23601 299 216 --2487 243 --
NM_032626chr16188 ------
NM_032632chr1421277 163 ------
NM_032663chr1251781 1451 1435 394 101 11925 11476 --
NM_032689chr1911434 --1662 --
NM_032711chr1763254 3248 1427 465 455 166 --2571 280 11348
NM_032717chr42938 779 ------
NM_032727chr1041501 1054 246 67 ------
NM_032780chr116902 845 420 287 272 252 --1839 --
NM_032781chr113727 234 66 --1835 1704
NM_032800chr132609 2506 2130 22432 1954 12037 --
NM_032810chr10----1105 --
NM_032828chr1954707 3051 1707 1265 415 ----11869
NM_032837chr1721550 1400 12108 12017 --
NM_032842chr71450 ------
NM_032867chr111650 ------
NM_032873chr1154478 3534 1740 219 101 1820 ----
NM_032876chr143796 112 58 11368 ----
NM_032892chr152138 128 ------
NM_032924chr761039 1026 1001 448 348 48 1959 1838 --
NM_032932chr17116370 6318 5958 5708 5499 5026 4281 4215 2189 561 518 12207 35343 4553 2398 --
NM_032966chr1121021 600 21562 229 1209 --
NM_032968chrX53282 2615 882 836 372 21104 996 ----
NM_032969chrX53282 2615 882 836 372 21104 996 ----
NM_032973chrY63277 2614 882 836 762 372 21104 996 ----
NM_032982chr752498 2024 738 262 64 11894 ----
NM_032983chr763312 2838 2074 1076 878 379 12708 ----
NM_032995chr251536 1121 413 337 309 --41622 1200 592 23 --
NM_032998chr121026 376 ------
NM_033012chr13--1998 ----
NM_033014chr921447 1198 ------
NM_033020chr134385 1025 484 ------
NM_033030chr2--129 ----
NM_033036chr1161663 347 314 153 115 91 --152 --
NM_033044chr12890 293 --1222 --
NM_033119chr165621 326 301 215 143 ------
NM_033129chr2091816 1685 1617 1430 1364 821 705 413 53 1514 ----
NM_033132chr133497 80 44 ------
NM_033136chr54460 349 296 288 11449 ----
NM_033137chr54460 349 296 288 11449 ----
NM_033138chr741955 1600 1476 214 128 145 --
NM_033139chr741955 1600 1476 214 128 145 --
NM_033140chr741955 1600 1476 214 128 145 --
NM_033147chr2128 ------
NM_033148chr2128 ------
NM_033157chr741955 1600 1476 214 128 145 --
NM_033181chr623866 1560 23130 52 ----
NM_033201chr1631007 117 86 21059 863 --180
NM_033215chrX1414 ------
NM_033224chr767845 6891 6663 6551 6440 3170 --37806 6979 6138 --
NM_033226chr161165 ------
NM_033244chr15151188 1109 887 785 488 428 369 251 239 207 153 127 112 97 82 --148 --
NM_033266chr16157 --1148 --
NM_033274chr5103390 3358 2712 2552 1338 1251 908 184 102 35 12706 11091 --
NM_033278chr112329 312 ------
NM_033281chr53859 805 247 ------
NM_033315chr1771780 1543 1421 829 642 339 166 1578 11973 --
NM_033331chr932433 1166 918 ------
NM_033342chr51341 --187 --
NM_033375chr1761483 1299 1159 1017 542 116 --11258 --
NM_033389chr1744607 4469 3738 3344 ------
NM_033394chr21240 11169 ----
NM_033425chr1152918 2372 1383 521 415 --22870 2729 --
NM_033429chr1592589 2236 874 614 567 381 252 226 21 --11002 1780
NM_033449chr591809 1777 1756 1748 1548 1503 1361 809 311 --21975 549 --
NM_033505chr266378 4976 2281 2004 761 180 26591 421 15078 --
NM_033535chr41330 ------
NM_033540chr32347 284 ------
NM_033549chr57921 893 860 731 284 188 24 ----1164
NM_033551chr572875 986 678 495 443 423 185 --23213 57 --
NM_033626chrX71454 698 621 341 298 219 144 ----11229
NM_033631chr163535 3510 2373 1431 1051 229 1208 ----
NM_033637chr1073922 3538 3395 1122 521 463 182 13376 ----
NM_033656chr2125033 4706 44469 3972 2157 1134 14509 13941
NM_048368chr182529 244 --3537 39 27 1106
NM_052818chr1331928 1659 87 21708 854 --11764
NM_052845chr1283192 2885 2740 2718 1321 406 390 132 13094 195 12277
NM_052847chr1973505 3372 3207 2345 2298 882 789 1100 ----
NM_052849chr151298 --1109 1805
NM_052880chr2231173 329 50 --21123 24 --
NM_052885chr1244820 3811 919 105 ------
NM_052896chr13866 608 38 --11815 1812
NM_052897chr123639 65 56 ------
NM_052898chr81723 ----1755
NM_052905chr231438 330 154 ------
NM_052906chr22134473 4352 4341 4296 4287 1978 1740 1688 1602 878 599 531 105 --23668 1570 --
NM_052910chr1361841 1409 772 267 249 143 ------
NM_052913chr611062 ------
NM_052927chr522151 1653 ------
NM_052934chr1101831 1808 1782 1771 1723 1585 1446 713 182 68 --32002 423 234 --
NM_052978chr1411847 --1116 --
NM_053001chr83280 269 35 ------
NM_053002chr31946 ------
NM_053016chr957838 7338 6520 6402 6168 37328 6420 5668 26793 6650 --
NM_053023chr1142632 1079 517 33 --11293 --
NM_053024chr311064 ------
NM_053025chr321765 380 ------
NM_053026chr321765 380 ------
NM_053027chr321765 380 ------
NM_053028chr321765 380 ------
NM_053031chr321765 380 ------
NM_053032chr321765 380 ------
NM_053043chr785959 4577 4343 3894 2515 1900 1860 1328 12341 ----
NM_053064chr1442143 908 84 26 12952 ----
NM_053067chr91320 ------
NM_053279chr892065 1882 934 924 736 601 227 171 133 12188 1916 --
NM_054016chr1----1181 --
NM_054016chr1----1181 --
NM_054016chr1----1181 --
NM_054025chr1191547 1429 1422 702 652 528 492 299 226 --1142 --
NM_054111chr6175 1281 1418 --
NM_057161chr66530 398 391 340 206 33 ------
NM_057169chr1222355 733 149 --12796
NM_057170chr1222355 733 149 --12796
NM_058172chr41495 11354 ----
NM_058241chr211712 --1585 --
NM_058241chr211712 --1585 --
NM_058243chr191170 ------
NM_078485chr6153 ------
NM_078487chr913232 13155 --1104
NM_080491chr11103960 3711 3396 3354 3013 2909 2456 1477 1461 755 1831 42942 2517 209 23 --
NM_080546chr9----11755 1568
NM_080588chr141461 1375 309 24 --11530 --
NM_080599chr10159 ------
NM_080621chr2061302 1256 1090 1063 457 420 1126 2519 48 1250
NM_080645chr621522 283 ------
NM_080650chr1521134 802 ------
NM_080671chr23852 557 185 ------
NM_080672chr20--187 ----
NM_080717chr121247 ------
NM_080738chr152052 1597 1574 662 548 21896 1696 1720 --
NM_080743chr622571 2327 22106 567 21853 182 --
NM_080759chr1342600 2587 1994 1679 ------
NM_080760chr1342600 2587 1994 1679 ------
NM_080792chr2031861 924 613 --21757 1576 1697
NM_080867chr1413601 11280 11062 --
NM_130385chr1142928 2644 607 283 32306 2182 79 12813 --
NM_130435chr1072661 2441 2408 2079 1976 780 353 ------
NM_130436chr2142436 1888 383 217 --1867 --
NM_130438chr2163013 2465 960 794 561 529 ------
NM_130439chr1051950 1874 743 565 191 1630 ----
NM_130439chr1051950 1874 743 565 191 1630 ----
NM_130459chr961583 1434 1409 1323 1049 214 ------
NM_130797chr731527 1310 702 --1323 --
NM_130807chr19122221 2100 2072 1867 1761 1529 885 495 379 263 194 155 12171 ----
NM_130811chr201108 ------
NM_130838chr151367 ------
NM_130839chr151367 ------
NM_130846chr121114 1258 ----
NM_133170chr20158021 7922 7542 5625 5210 5176 3121 2840 2728 2609 2535 2165 1079 208 90 35403 2804 1802 76459 6227 2271 1989 1924 1206 31 25440 249
NM_133264chr1753238 2533 1114 149 93 --13324 --
NM_133265chrX--13142 ----
NM_133266chr113199 76 22 --1351 --
NM_133370chr413280 1248 ----
NM_133372chr531873 1048 334 12440 ----
NM_133433chr51165 ------
NM_133445chr953383 3316 1011 176 48 --11379 --
NM_133452chr1961051 1010 921 306 245 149 ----1160
NM_133478chr262125 1809 980 814 308 237 --1795 --
NM_133496chr133677 2971 745 ------
NM_133631chr31204 ------
NM_133634chr2161651 1545 1460 1322 486 108 ------
NM_133635chr2161298 1192 1107 969 601 133 ------
NM_133646chr265505 4525 4518 2115 1894 1210 ------
NM_133647chr1552834 2353 166 143 70 23473 3041 ----
NM_134325chr181366 1343 1317 1306 1258 1120 610 248 --31537 515 488 --
NM_134442chr21355 ------
NM_138270chrX22858 2357 1672 ----
NM_138300chr141325 1062 276 171 11335 ----
NM_138317chr14--1102 ----
NM_138318chr14--1102 ----
NM_138333chr91304 11839 ----
NM_138338chr2262399 2312 2129 1255 1074 952 22470 2339 33358 3116 994 --
NM_138340chr18153 ------
NM_138348chr566447 6268 4354 4204 2644 116 --12538 --
NM_138357chr1011127 1196 ----
NM_138426chr712036 ----12331
NM_138444chr1374219 3959 1786 1403 1213 566 68 ------
NM_138457chr6122923 2896 2477 2133 1325 1230 622 391 335 304 105 92 --23270 830 --
NM_138468chr274915 4746 4256 1797 1610 1324 702 25880 4463 14137 --
NM_138471chr111380 ------
NM_138473chr12114862 3756 3713 3583 1933 1608 1433 996 845 549 287 14422 ----
NM_138479chr151627 1333 1324 822 129 ------
NM_138559chr261125 327 240 142 132 122 --11237 --
NM_138578chr2061104 978 933 595 294 103 --1134 --
NM_138612chr16178 ------
NM_138638chr1471635 773 713 462 160 114 53 ------
NM_138768chr111769 1124 1727 --
NM_138782chr5--21756 953 --1524
NM_138795chr191573 1424 1330 1121 647 139 120 91 60 --11565 --
NM_138923chrX2251 47 ------
NM_138959chr1116330 4940 4448 2725 2068 1390 1378 1362 882 363 299 15728 11235 --
NM_138962chr171354 ------
NM_138971chr1143665 2825 1403 797 1509 13490 --
NM_138971chr1143665 2825 1403 797 1509 13490 --
NM_138972chr1143665 2825 1403 797 1509 13490 --
NM_138972chr1143665 2825 1403 797 1509 13490 --
NM_138973chr1143665 2825 1403 797 1509 13490 --
NM_138973chr1143665 2825 1403 797 1509 13490 --
NM_138980chr41688 2196 136 ----
NM_138981chr41819 2327 267 ----
NM_138982chr41688 2196 136 ----
NM_139012chr652299 2138 2126 709 454 ------
NM_139014chr662379 2218 2206 789 534 77 ------
NM_139035chrX2153 113 ------
NM_139057chr15142725 2462 2208 2125 2115 2032 1990 1954 1136 1019 731 458 65 30 ------
NM_139071chr1271687 1675 1515 1477 1169 562 50 ------
NM_139157chr114616 128 62 41 --2742 25 --
NM_139167chr8189 ------
NM_139182chr421377 642 21394 364 ----
NM_139207chr121764 148 ----
NM_139241chr12--150 ----
NM_139279chr253524 3197 2800 2768 754 33104 1417 711 1870 --
NM_139280chr1751253 1241 1235 1139 121 ------
NM_139283chr122809 187 1707 11029 --
NM_139316chr7----128 --
NM_139323chr201132 --11657 --
NM_144571chr466852 5035 4682 2648 1525 524 1300 12337 --
NM_144574chr142576 251 1451 ----
NM_144578chr1444978 2091 1521 785 24953 3959 --14986
NM_144579chr2152845 2338 2202 2089 2078 1873 1061 757 740 704 659 590 495 377 117 --12792 --
NM_144582chr251906 1778 659 227 133 ------
NM_144583chr231766 1553 1239 1374 1414 --
NM_144586chr22158 119 ------
NM_144607chr1732577 956 632 22649 890 21788 1619 --
NM_144610chr17------1378
NM_144618chr12489 233 ------
NM_144632chr211867 ------
NM_144635chr361031 991 793 105 96 57 --3499 436 375 11184
NM_144642chr31121 ------
NM_144664chr1121935 794 ------
NM_144667chr1241140 875 719 369 --1423 --
NM_144726chr5----1499 --
NM_144767chr15103906 3516 2852 1753 1598 936 534 473 189 49 11669 13684 --
NM_144949chr2--1458 ----
NM_144967chrX----1428 11030
NM_144969chrX--1290 ----
NM_144973chr1254548 3920 1391 918 743 128 23367 959 --
NM_144982chr121500 ------
NM_145011chr1042137 1719 1701 378 --1431 11960
NM_145024chr16----179 --
NM_145025chr62775 206 ------
NM_145065chr115822 367 245 74 64 --2802 769 --
NM_145113chr143349 236 227 ------
NM_145119chrX168 1115 ----
NM_145171chr14181 ------
NM_145174chr2231504 473 319 ------
NM_145175chr231112 518 137 --1345 --
NM_145206chr1062873 2801 2442 978 744 641 --11210 --
NM_145207chr464795 4380 1788 948 655 644 25168 474 --11815
NM_145246chr101433 11233 ----
NM_145251chr1421264 493 ------
NM_145277chr11146 ------
NM_145279chr171685 1291 722 689 578 314 79 --21694 1469 --
NM_145284chrX----1175 --
NM_145305chrX31053 544 428 ------
NM_145307chr1021389 632 13227 --13863
NM_145313chr10101301 1253 1187 1066 1059 571 502 470 362 207 ------
NM_145349chr17101536 1489 839 815 737 728 719 647 553 243 1751 31566 807 39 --
NM_145686chr221223 79 --12556 --
NM_145687chr221223 79 --12556 --
NM_145727chr631117 1081 497 ------
NM_145733chr2261076 447 304 284 253 92 ------
NM_145793chr10--1784 199 --
NM_145800chrX1866 ------
NM_145802chrX1815 ------
NM_145808chr712643 ------
NM_145861chr152052 1597 1574 662 548 21896 1696 1720 --
NM_145912chr22134504 4394 4247 4091 3927 3695 3595 3162 1870 1643 920 621 317 21114 257 34042 3970 3267 --
NM_147147chr674207 3972 3882 1570 1443 636 213 ------
NM_147150chr91404 13695 1389 --
NM_147156chr101941 ------
NM_147157chr94764 710 602 252 --175 --
NM_147168chr91111 ------
NM_147181chr411138 ------
NM_147182chr411138 ------
NM_147183chr411138 ------
NM_147189chr82516 185 11812 ----
NM_147202chr992114 1989 1844 1744 840 748 508 483 448 31701 860 416 12331 --
NM_147223chr24595 158 146 118 12448 ----
NM_148174chr851930 1845 1648 670 293 ------
NM_148898chr711058 ----1856
NM_148899chr711058 ----1856
NM_152237chr22121758 1749 1573 1506 1406 1310 1227 1099 700 290 209 185 --21726 258 --
NM_152247chr223797 742 634 --2729 86 --
NM_152253chr22134183 4128 4020 3864 1654 1575 1513 1189 757 601 478 428 110 --24115 3472 --
NM_152263chr175716 5346 5256 2205 1582 973 251 --23683 1462 --
NM_152277chr531978 1356 628 1549 ----
NM_152280chr142885 2378 2334 1411 1646 ----
NM_152335chr151183 --3466 101 93 1434
NM_152344chr1721244 1088 --11042 --
NM_152371chr191334 784 695 684 379 257 229 189 68 31764 1751 1238 ----
NM_152375chr1102477 2168 2018 1977 1729 651 614 558 549 456 12385 ----
NM_152388chr232579 1612 1042 22465 969 23384 2601 12986
NM_152414chr821482 286 11051 ----
NM_152420chr92577 259 ------
NM_152424chrX84224 3632 3352 1847 1357 1322 886 714 11531 24106 3123 --
NM_152437chr1242420 2129 854 622 --1378 --
NM_152450chr15--12103 --1464
NM_152523chr2----1686 --
NM_152529chr254072 3369 1417 1279 106 ------
NM_152538chr311201 ------
NM_152545chr41147 2677 498 ----
NM_152546chr51109 ------
NM_152556chr72593 29 ------
NM_152594chr1511541 --1114 --
NM_152622chr52921 629 1366 ----
NM_152629chr954067 3967 604 258 112 21302 101 ----
NM_152641chr1232119 2045 1036 12826 ----
NM_152667chr201240 ----11021
NM_152671chr21356 ------
NM_152694chrX1311 ------
NM_152699chr343601 3044 1503 546 ------
NM_152740chr7265 53 ------
NM_152749chr721009 100 ----1809
NM_152753chr692059 1994 1864 1398 655 555 480 351 310 11877 ----
NM_152754chr722890 943 ----12909
NM_152756chr52584 201 ------
NM_152758chr842419 2352 1880 858 ------
NM_152769chr199915 888 876 786 646 367 226 72 31 --1233 --
NM_152787chrX51423 956 897 707 282 --23394 928 --
NM_152788chr12--135 ----
NM_152793chr765205 3753 1665 568 364 34 24224 3340 1264 --
NM_152835chr111005 --1283 --
NM_152838chr2053419 1129 764 747 649 --1966 --
NM_152857chr61700 ------
NM_152858chr61700 ------
NM_152868chr22138 ------
NM_152903chr1321781 915 ------
NM_152919chr1963306 2784 1343 1307 919 241 --23250 2802 1363
NM_152924chr15105928 5793 4571 2286 2204 1353 1097 683 474 172 14208 21026 430 --
NM_152989chr1221563 622 21628 1550 ----
NM_152999chr784498 3297 3174 1384 1357 1338 1147 1097 24079 3736 ----
NM_153000chr181255 ------
NM_153020chr61230 ------
NM_153029chr16104079 3928 3918 3608 3501 1450 1047 707 663 56 --2899 655 --
NM_153035chr142186 586 491 155 --1529 --
NM_153038chr22588 578 1680 ----
NM_153042chr61451 ------
NM_153183chrX2115 90 ------
NM_153188chr555037 5018 2212 220 67 ------
NM_153257chr191940 --1994 --
NM_153321chr173421 312 263 193 ----
NM_153322chr173421 312 263 193 ----
NM_153335chr1761249 1222 1005 443 240 108 --1944 --
NM_153347chr1162169 1862 896 696 516 471 2690 213 22461 47 --
NM_153350chr1681256 543 501 373 216 117 101 71 11420 3604 492 452 --
NM_153367chr10103654 3573 3458 1547 1228 1160 822 325 292 279 23660 43 53864 3832 1376 993 809 --
NM_153426chr41159 ------
NM_153427chr41159 ------
NM_153456chr1395778 4765 4310 4265 2089 1842 1647 1606 1505 35566 2033 1016 ----
NM_153487chr6144626 4604 4515 4492 4064 4018 3467 3145 2999 1277 1244 861 547 468 24436 3491 ----
NM_153499chr1282690 2608 2450 2046 2004 865 208 33 ----194
NM_153500chr1282690 2608 2450 2046 2004 865 208 33 ----194
NM_153607chr523116 3104 12185 --1506
NM_153619chr1553259 996 876 403 125 1840 ----
NM_153620chr751691 523 419 326 107 21275 189 11406 --
NM_153633chr121607 ------
NM_153687chr122562 55 ------
NM_153715chr72971 98 ------
NM_153718chr1971190 1174 1133 1013 975 914 21 ------
NM_153719chr1971190 1174 1133 1013 975 914 21 ------
NM_153757chr421015 31 ------
NM_153810chr1021176 100 21222 985 14942 --
NM_153819chr11170 ------
NM_170606chr7121 ------
NM_170665chr1253580 3192 3069 2913 933 11361 13061 11570
NM_170674chr1521034 260 ------
NM_170675chr151710 ------
NM_170676chr151710 ------
NM_170677chr1521034 260 ------
NM_170679chr51966 ------
NM_170696chr1551577 1564 1148 1086 27 --2444 68 --
NM_170697chr1551577 1564 1148 1086 27 --2444 68 --
NM_170706chr173925 3842 3411 2650 1395 1237 938 23688 3150 11156 --
NM_170731chr1162826 2008 1999 1991 1943 1148 ------
NM_170732chr1162826 2008 1999 1991 1943 1148 ------
NM_170733chr1162826 2008 1999 1991 1943 1148 ------
NM_170734chr1162826 2008 1999 1991 1943 1148 ------
NM_170735chr1162826 2008 1999 1991 1943 1148 ------
NM_170743chr182945 962 946 750 495 376 132 83 --11993 --
NM_170782chr11360 ------
NM_171998chrX5860 448 260 232 117 --1357 --
NM_172020chr761542 807 380 219 154 72 21741 1276 ----
NM_172071chr186823 6202 5465 5403 5043 4703 2122 870 --26628 5752 11584
NM_172103chr622480 410 ----1270
NM_172105chr622480 410 ----1270
NM_172206chr1761732 1720 1435 483 287 60 1670 ----
NM_172216chr1272592 2510 2352 1948 1906 767 110 ------
NM_172226chr1282690 2608 2450 2046 2004 865 208 33 ----194
NM_172315chr1521034 260 ------
NM_172316chr1521034 260 ------
NM_172373chr1311012 ------
NM_172375chr141203 2368 327 1429 --
NM_173064chr182945 962 946 750 495 376 132 83 --11993 --
NM_173065chr1103642 2271 1447 1192 1073 829 780 454 245 65 --12690 --
NM_173075chr441861 1714 1670 1538 ------
NM_173156chr181892 1680 1594 862 724 217 143 69 ------
NM_173163chr163489 89 82 ------
NM_173171chr2--1104 ----
NM_173172chr2--1412 ----
NM_173173chr2--1104 ----
NM_173191chr1051275 1264 448 149 56 ------
NM_173192chr1051275 1264 448 149 56 ------
NM_173193chr1051275 1264 448 149 56 ------
NM_173194chr1051275 1264 448 149 56 ------
NM_173195chr1051275 1264 448 149 56 ------
NM_173198chr942806 2665 2477 767 12044 12080 --
NM_173200chr942806 2665 2477 767 12044 12080 --
NM_173354chr2152065 1382 752 729 515 --21510 1358 --
NM_173355chr21292 248 22 ----
NM_173359chr321660 1204 1316 ----
NM_173468chr424329 346 13791 ----
NM_173469chr15--11408 1351 --
NM_173473chr1042389 1893 1672 709 ------
NM_173476chr16142263 2020 1863 1840 1834 1551 692 593 387 370 312 234 52 42 1171 21772 1619 1266
NM_173503chr17126 ------
NM_173510chr2232685 1964 687 ------
NM_173535chr23546 421 413 ------
NM_173547chr173681 637 21 ----1647
NM_173552chr311747 1880 ----
NM_173560chr6----1211 --
NM_173576chr10--1455 1851 --
NM_173589chr112548 62 ------
NM_173595chr12104374 3873 3721 3686 3465 3272 1436 1013 803 643 ------
NM_173602chr1223268 2708 --22658 906 --
NM_173609chr151636 ------
NM_173642chr1128936 8054 7725 7491 6735 6610 3438 3275 2492 2414 2263 2206 36111 1926 325 --18195
NM_173657chr33779 752 633 1115 ----
NM_173667chr521925 134 11819 ----
NM_173681chr772013 1717 518 493 446 404 118 --11724 --
NM_173694chrX21618 734 22349 1983 ----
NM_173807chr1--150 ----
NM_173808chr12936 553 1985 ----
NM_173809chr1011268 ------
NM_173822chr232136 1922 1867 ------
NM_173832chr8153709 2645 2629 2443 1090 892 872 801 685 508 496 392 146 41 27 --43287 2702 2309 638 --
NM_173851chr833868 3708 851 ------
NM_174856chr20----1123 --
NM_174893chr17160 ------
NM_174902chr1151776 1594 1407 731 22 ------
NM_174911chr851301 1128 1062 122 102 --13159 --
NM_174921chr41724 11175 ----
NM_174934chr1193339 2942 2782 734 725 502 146 66 34 12863 1913 --
NM_175056chr3192 ------
NM_175058chr1151213 1191 221 214 52 11083 ----
NM_175077chr2041229 1035 449 49 1109 ----
NM_175607chr311163 1680 ----
NM_175610chr1511078 ------
NM_175612chr311163 1680 ----
NM_175623chr1287404 6849 6388 5776 5750 5713 2928 2735 22304 1496 46286 2289 2165 1436 34721 2791 98
NM_175624chr1287499 6944 6483 5871 5845 5808 3023 2830 22399 1591 46381 2384 2260 1531 34816 2886 193
NM_175625chr1287499 6944 6483 5871 5845 5808 3023 2830 22399 1591 46381 2384 2260 1531 34816 2886 193
NM_175634chr81963 ------
NM_175635chr81963 ------
NM_175636chr81963 ------
NM_175734chr17----166 --
NM_175852chr1102963 2359 2209 2069 618 528 458 85 58 43 12525 12677 1393
NM_175854chr1332396 1821 729 11098 ----
NM_175856chr51648 ------
NM_175866chr11977 1281 1574 --
NM_175920chr51135 ------
NM_175921chr5------1802
NM_176814chr71244 ------
NM_176816chr541710 1700 1542 451 --11835 --
NM_177414chr121108 216 ------
NM_177424chr11484 11809 --21691 1379
NM_177438chr1433904 2604 1262 ------
NM_177441chr174794 616 290 279 --1629 178
NM_177552chr161288 1379 ----
NM_177559chr20----146 --
NM_177560chr20----146 --
NM_177952chr141160 156 ----
NM_177968chr21896 ------
NM_177969chr2--2727 663 ----
NM_177972chr1184108 3262 854 838 817 747 378 138 11645 23710 1303 11574
NM_177985chr221876 267 ------
NM_177999chr9173647 3490 3233 2637 2629 2573 2546 2448 2362 2300 1344 1074 706 603 146 80 73 --12748 --
NM_178010chr1221563 622 21628 1550 ----
NM_178011chr1033019 1209 732 ------
NM_178013chr1482569 2077 1984 1100 1013 978 742 127 22391 2157 52343 641 397 210 183 --
NM_178026chr202562 55 ------
NM_178126chr1742073 1865 396 343 --2359 200 11759
NM_178140chr5--22365 884 21764 576 --
NM_178148chr63526 469 213 --1150 --
NM_178151chrX136784 6386 5876 2965 2570 2530 2197 2031 1997 1821 1446 269 44 37048 5768 2488 125 --
NM_178152chrX136784 6386 5876 2965 2570 2530 2197 2031 1997 1821 1446 269 44 37048 5768 2488 125 --
NM_178153chrX136784 6386 5876 2965 2570 2530 2197 2031 1997 1821 1446 269 44 37048 5768 2488 125 --
NM_178175chrX3578 105 47 ------
NM_178427chr11665 ------
NM_178441chr1481315 1162 1128 870 522 459 152 22 ------
NM_178496chr3196 ------
NM_178539chr1221547 536 --1527 --
NM_178553chr2179 ------
NM_178554chr393058 2528 1201 914 877 722 493 451 81 ----1589
NM_178585chr433267 814 613 --1731 --
NM_178586chr1421973 30 2933 252 1188 --
NM_178835chr43624 611 247 ----1632
NM_178857chr85191 174 144 87 40 ------
NM_178863chr162457 139 ------
NM_178864chr111702 ------
NM_181054chr141350 1909 ----
NM_181077chr1522010 454 1467 ----
NM_181093chr1----1125 --
NM_181302chr142576 251 1451 ----
NM_181308chr142576 251 1451 ----
NM_181349chr782500 2412 2242 2086 2014 649 329 31 --23097 476 --
NM_181351chr1162808 2799 2235 2113 454 344 --12138 --
NM_181358chr143709 3527 2656 709 12976 1131 --
NM_181361chr31441 138 ----
NM_181443chr2032723 71 29 ------
NM_181458chr22932 54 ------
NM_181461chr2150 ------
NM_181481chr1864354 2353 2102 1221 549 62 32056 735 674 12337 --
NM_181482chr1864354 2353 2102 1221 549 62 32056 735 674 12337 --
NM_181483chr1864354 2353 2102 1221 549 62 32056 735 674 12337 --
NM_181486chr121247 ------
NM_181491chr9193050 2967 2955 2827 2765 2757 2699 2619 2140 2017 1193 812 706 543 510 300 181 130 30 12430 22541 828 --
NM_181504chr5--21052 176 --11187
NM_181521chr16127071 6368 6261 4949 2028 1758 1200 800 487 462 185 152 25525 510 21885 1553 16346
NM_181523chr5--21052 176 --11187
NM_181524chr5--21052 176 --11187
NM_181527chr20178 ------
NM_181528chr201133 ------
NM_181571chr1031023 730 453 11142 ----
NM_181655chr173507 253 103 --1204 --
NM_181672chrX140 --1558 --
NM_181673chrX140 --1558 --
NM_181674chr5------1143
NM_181675chr5------1143
NM_181676chr5------1143
NM_181677chr5------1143
NM_181678chr5------1143
NM_181713chr21878 ------
NM_181746chr11177 ------
NM_181780chr3--11393 ----
NM_181782chr622182 87 ------
NM_181828chr22183758 3752 3659 3557 3298 3232 2395 1167 1132 1069 1023 1009 999 987 597 532 176 57 13193 2587 207 13675
NM_181829chr22183758 3752 3659 3557 3298 3232 2395 1167 1132 1069 1023 1009 999 987 597 532 176 57 13193 2587 207 13675
NM_181830chr22183758 3752 3659 3557 3298 3232 2395 1167 1132 1069 1023 1009 999 987 597 532 176 57 13193 2587 207 13675
NM_181832chr22193773 3767 3674 3572 3313 3247 2410 1182 1147 1084 1038 1024 1014 1002 612 547 191 72 28 13208 2602 222 13690
NM_181836chr512153 1442 ----
NM_182470chr153195 189 53 --1589 --
NM_182471chr153195 189 53 --1589 --
NM_182485chr432862 2291 1147 ------
NM_182492chr222333 222 ------
NM_182524chr41250 --1504 --
NM_182526chr14132904 2757 2471 2436 2174 2115 2067 1246 1206 609 580 242 136 ------
NM_182527chr22141922 1855 1833 1747 1567 1536 830 810 775 653 620 552 385 139 --1817 11977
NM_182551chr233090 364 68 22596 309 12842 --
NM_182553chr114556 513 210 177 --128 --
NM_182557chr1192064 1930 1915 1758 1450 871 432 339 271 11946 ----
NM_182580chr172233 2107 1948 953 874 852 215 --1392 --
NM_182641chr1711653 1143 ----
NM_182646chr432862 2291 1147 ------
NM_182647chr2061640 1550 1132 122 106 36 --3322 67 45 --
NM_182648chr14--1516 ----
NM_182678chr22486 135 ------
NM_182691chr71569 11020 ----
NM_182692chr71569 11020 ----
NM_182717chr1031428 1135 338 11547 ----
NM_182718chr1031023 730 453 11142 ----
NM_182719chr1031023 730 453 11142 ----
NM_182720chr1031428 1135 338 11547 ----
NM_182721chr1031428 1135 338 11547 ----
NM_182722chr1031428 1135 338 11547 ----
NM_182723chr1031428 1135 338 11547 ----
NM_182724chr1031023 730 453 11142 ----
NM_182725chr1031023 730 453 11142 ----
NM_182729chr1231612 1461 268 ------
NM_182742chr1231612 1461 268 ------
NM_182743chr1231612 1461 268 ------
NM_182760chr3--128 ----
NM_182765chr1041941 1906 213 105 11610 ----
NM_182769chr1031023 730 453 11142 ----
NM_182770chr1031023 730 453 11142 ----
NM_182771chr1031023 730 453 11142 ----
NM_182772chr1031023 730 453 11142 ----
NM_182797chr20------1257
NM_182798chr56536 311 296 91 57 32 --11363 --
NM_182799chr56536 311 296 91 57 32 --11363 --
NM_182801chr56536 311 296 91 57 32 --11363 --
NM_182830chr14------1918
NM_182850chr1031023 730 453 11142 ----
NM_182853chr1031428 1135 338 11547 ----
NM_182898chr7106147 6134 5846 5659 5348 4903 4892 4143 1620 1158 31129 972 312 ----
NM_182899chr7106147 6134 5846 5659 5348 4903 4892 4143 1620 1158 31129 972 312 ----
NM_182907chr622027 854 --12276 --
NM_182920chr321274 971 ----11077
NM_182943chr32944 192 ------
NM_182948chr132776 2503 470 --21129 27 --
NM_182970chr20284296 4246 4140 4091 3998 3928 3881 3869 3787 3750 3661 3522 3295 3239 2986 2959 2730 1422 1397 1376 1324 1198 1172 995 510 260 150 71 12921 43983 3668 584 504 --
NM_182972chr11937 11130 1837 --
NM_183004chr1463155 2702 2575 1156 487 401 23555 160 33177 1267 180 13625
NM_183006chr2041330 1317 1260 298 1378 41460 1159 544 479 --
NM_183011chr1031428 1135 338 11547 ----
NM_183012chr1031428 1135 338 11547 ----
NM_183013chr1031428 1135 338 11547 ----
NM_183047chr204746 209 135 129 ------
NM_183048chr204746 209 135 129 ------
NM_183060chr1031023 730 453 11142 ----
NM_183078chr672647 2367 1211 1100 875 561 464 1525 13696 --
NM_183234chr1541502 359 252 37 1506 11158 --
NM_183235chr1541502 359 252 37 1506 11158 --
NM_183236chr1541502 359 252 37 1506 11158 --
NM_183244chr20--187 ----
NM_183246chr20--187 ----
NM_183360chr2128 ------
NM_183361chr2128 ------
NM_183393chr32998 35 ------
NM_183394chr32998 35 ------
NM_183416chr122003 56 --11889 --
NM_183419chr82955 540 ------
NM_183422chr131396 ------
NM_184234chr201744 1339 ----
NM_194247chr274312 3242 3222 3204 1501 1057 809 ------
NM_194259chr161457 ------
NM_194260chr161457 ------
NM_194261chr161457 ------
NM_194278chr1463212 1528 861 719 480 247 13658 ----
NM_194282chr442798 2698 1010 979 --12679 --
NM_194285chr1112242 11194 ----
NM_194313chr951591 514 373 71 32 21379 472 ----
NM_194314chr134949 1666 1475 23440 1109 ----
NM_194328chr953079 2538 2127 1305 381 ------
NM_194329chr953079 2538 2127 1305 381 ------
NM_194330chr953079 2538 2127 1305 381 ------
NM_194332chr953079 2538 2127 1305 381 ------
NM_194434chr1854819 2042 1431 247 92 24905 990 ----
NM_197941chr562770 2186 2019 1949 1905 904 11981 ----
NM_197966chr222891 80 ------
NM_197967chr222891 80 ------
NM_197970chr2--129 ----
NM_198056chr332007 1962 1544 21390 637 11789 --
NM_198057chrX21135 239 ------
NM_198074chr151199 1092 491 397 388 --1437 1109
NM_198086chr143796 112 58 11368 ----
NM_198181chr151540 22566 553 ----
NM_198196chr341741 901 672 604 32402 802 796 ----
NM_198225chr1031625 188 174 ----11519
NM_198256chr221646 1394 ------
NM_198268chr143709 3527 2656 709 12976 1131 --
NM_198269chr143709 3527 2656 709 12976 1131 --
NM_198291chr2061956 1795 439 416 345 270 --11364 --
NM_198324chr12--147 11118 --
NM_198381chr113398 291 22 ------
NM_198392chr692133 1995 1552 1531 1444 762 451 364 77 --22114 415 --
NM_198446chr11211 ------
NM_198465chrX52965 2379 1172 747 587 ------
NM_198503chr1--22350 2168 1441 --
NM_198513chr831392 724 53 1778 ----
NM_198527chr152444 32 --1159 --
NM_198530chr171136 11274 2453 272 --
NM_198573chr96370 167 135 106 54 39 --126 --
NM_198581chr296662 6481 5435 5206 4702 4667 4599 2922 2086 14631 27021 6788 12792
NM_198595chr494918 4334 3225 1924 1818 875 362 158 130 --43949 3271 1989 1698 --
NM_198597chr102770 717 --2709 28 --
NM_198679chr9102415 2363 2212 1976 1923 859 734 464 157 98 --12237 --
NM_198681chr171374 1350 1217 454 250 184 143 11069 21266 470 --
NM_198686chr1472560 2457 859 851 336 147 22 --3944 462 113 --
NM_198829chr72566 105 ------
NM_198830chr172175 85 ------
NM_198834chr17102028 1748 1671 1664 1541 1509 808 498 471 190 ------
NM_198836chr17102028 1748 1671 1664 1541 1509 808 498 471 190 ------
NM_198837chr17102028 1748 1671 1664 1541 1509 808 498 471 190 ------
NM_198838chr17102028 1748 1671 1664 1541 1509 808 498 471 190 ------
NM_198839chr17102028 1748 1671 1664 1541 1509 808 498 471 190 ------
NM_198844chr172964 653 ------
NM_198859chr344836 4430 1970 1276 14044 11299 --
NM_198896chr1172194 1864 1620 673 496 369 36 ------
NM_198902chr151296 --1683 --
NM_198903chr52469 70 ------
NM_198904chr531576 469 70 ------
NM_198925chr153934 272 126 --1689 --
NM_198990chr742980 2947 1232 459 1179 1700 --
NM_198993chr1771495 1460 1311 1268 1146 408 146 --2544 305 11670
NM_198995chr181488 ------
NM_199000chr731962 834 234 ------
NM_199005chr91120 --195 1241
NM_199129chr204947 498 395 138 --1124 --
NM_199131chr1083380 3061 2237 1457 1415 764 757 749 --1319 --
NM_199132chr1921530 1415 --11396 --
NM_199144chr201996 ------
NM_199160chr951836 1628 1481 226 148 11535 132 21726 1706
NM_199169chr2063352 3094 3037 2629 2596 734 12447 13337 --
NM_199170chr2063352 3094 3037 2629 2596 734 12447 13337 --
NM_199171chr2063352 3094 3037 2629 2596 734 12447 13337 --
NM_199203chr201996 ------
NM_199245chr1251822 1768 1611 847 515 1926 ----
NM_199262chr1751808 1634 1508 532 54 --21732 1698 --
NM_199320chr442292 774 419 61 12427 ----
NM_199320chr442292 774 419 61 12427 ----
NM_199321chr172964 653 ------
NM_199324chr442792 2591 2373 616 1512 ----
NM_199355chr1631680 1405 130 1172 ----
NM_199415chr2042345 2174 371 302 1861 32135 575 249 --
NM_199421chr1413601 11280 11062 --
NM_199436chr222618 2137 22229 91 ----
NM_199437chr1152236 674 493 296 78 ------
NM_199438chr1152236 674 493 296 78 ------
NM_199439chr1152236 674 493 296 78 ------
NM_199454chr1104689 4508 4079 3686 3486 3322 3302 3041 1749 72 13056 33464 1291 575 --
NM_199478chrX154 ------
NM_199487chr2031186 401 254 ------
NM_201378chr89782 740 722 374 318 292 285 191 36 --1800 1355
NM_201379chr89782 740 722 374 318 292 285 191 36 --1800 1355
NM_201380chr89782 740 722 374 318 292 285 191 36 --1800 1355
NM_201381chr89782 740 722 374 318 292 285 191 36 --1800 1355
NM_201382chr89782 740 722 374 318 292 285 191 36 --1800 1355
NM_201383chr89782 740 722 374 318 292 285 191 36 --1800 1355
NM_201384chr89782 740 722 374 318 292 285 191 36 --1800 1355
NM_201403chr171685 1291 722 689 578 314 79 --21694 1469 --
NM_201428chr112270 103 ------
NM_201429chr112270 103 ------
NM_201430chr112196 29 ------
NM_201432chr17206135 5484 5397 5218 5200 4435 4411 4018 2643 2270 2100 2085 2075 2051 2022 1333 1217 464 185 155 --31451 531 65 --
NM_201433chr17206135 5484 5397 5218 5200 4435 4411 4018 2643 2270 2100 2085 2075 2051 2022 1333 1217 464 185 155 --31451 531 65 --
NM_201436chr7----1784 1683
NM_201516chr7----1840 1739
NM_201517chr7----1784 1683
NM_201535chr141650 ------
NM_201536chr141650 ------
NM_201537chr141650 ------
NM_201538chr141650 ------
NM_201539chr141650 ------
NM_201540chr141650 ------
NM_201541chr141650 ------
NM_201568chr181892 1680 1594 862 724 217 143 69 ------
NM_201569chr181892 1680 1594 862 724 217 143 69 ------
NM_201627chr53317 289 127 ------
NM_201632chr521288 146 1684 31246 558 253 --
NM_201634chr531387 1256 245 1783 31345 657 352 --
NM_201999chr41271 ------
NM_202004chr11146 ------
NM_202467chr196571 560 482 466 85 52 1113 199 --
NM_202468chr196571 560 482 466 85 52 1113 199 --
NM_202469chr196571 560 482 466 85 52 1113 199 --
NM_202470chr196571 560 482 466 85 52 1113 199 --
NM_202494chr196571 560 482 466 85 52 1113 199 --
NM_203301chr1411217 --1343 --
NM_203341chr12771 227 ------
NM_203342chr152760 2379 2334 604 301 --23494 2805 12739
NM_203343chr152760 2379 2334 604 301 --23494 2805 12739
NM_203346chr231996 697 313 11563 1141 --
NM_203351chr17121970 867 658 614 531 510 456 333 287 222 198 118 --21004 238 22198 956
NM_203372chr2----138 --
NM_203390chr8------11486
NM_203394chr122297 47 1756 ----
NM_203417chr21----1347 --
NM_203418chr21----1347 --
NM_203434chr941022 471 393 31 1451 1297 --
NM_203459chr1--21590 197 ----
NM_203500chr191194 2163 35 ----
NM_203506chr1742020 805 624 536 --11968 --
NM_205768chr121618 326 11437 ----
NM_205842chr21614 ------
NM_205848chr162493 1787 702 591 419 89 --32377 2060 1089 --
NM_205860chr1--1597 12234 --
NM_205861chr141780 1708 673 129 ------
NM_206594chr111202 ------
NM_206595chr111202 ------
NM_206852chr14------1274
NM_206853chr633353 2857 93 1544 1488 --
NM_206854chr634614 4118 1354 11805 11749 --
NM_206855chr655579 5083 2319 961 731 ------
NM_206857chr14------1274
NM_206886chr1174 ------
NM_206909chr8167710 7522 7106 7091 7033 6779 6466 5183 3185 3059 3040 2926 2787 2600 1917 1397 17041 ----
NM_206914chr1251892 1581 883 857 69 22053 1441 ----
NM_206944chr91806 ------
NM_206945chr91806 ------
NM_206946chr91806 ------
NM_206947chr91806 ------
NM_207032chr2041181 218 87 21 11601 ----
NM_207042chr11171 ----1657
NM_207043chr142104 1905 342 214 11657 1225 --
NM_207044chr142104 1905 342 214 11657 1225 --
NM_207045chr11171 ----1657
NM_207046chr11171 ----1657
NM_207047chr142104 1905 342 214 11657 1225 --
NM_207111chr772065 2017 1105 1022 743 731 35 1791 22152 390 --
NM_207113chr7191 11258 ----
NM_207116chr772065 2017 1105 1022 743 731 35 1791 22152 390 --
NM_207170chr12723 107 ------
NM_207343chr111379 ------
NM_207361chr1366332 5923 4860 4112 1850 752 11804 22103 882 --
NM_207371chr104628 520 108 80 ----1500
NM_207380chr15113240 3015 2812 2792 2584 1412 1252 1174 948 768 27 22288 1393 33107 1352 589 --
NM_207406chr485398 5126 4318 2578 2103 2065 1265 279 26119 6056 --184
NM_207429chr1152330 1985 881 456 148 ------
NM_207517chr1511658 11349 11452 --
NM_212460chr711531 11982 ----
NM_212461chr122444 222 ------
NM_212464chr1541931 1550 805 46 11527 ----
NM_212543chr32150 105 ------
NM_212551chr141128 235 97 64 ------
NM_212558chr952864 1108 1092 85 47 ------
NM_213589chr275250 4700 2237 1193 409 88 54 11327 ----
NM_213593chr13855 276 118 11001 ----
NM_213594chr12----1983 --
NM_213606chr102192 186 12158 ----
NM_213618chr114616 128 62 41 --2742 25 --
NM_213648chr521288 146 1684 31246 558 253 --
NM_213652chr11146 ------
NM_213653chr11146 ------
NM_213662chr1762307 2241 2229 2008 1705 43 --11535 --