TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4675
miRNA Sequence: GGGGCUGUGAUUGACCAGCAGG

<
mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511094 ------
NM_000020chr1292206 2185 1555 523 460 428 331 163 136 42112 1851 914 144 11812 --
NM_000033chrX5982 957 759 612 305 3858 784 709 1335 1636
NM_000034chr161190 ------
NM_000037chr862254 2225 2212 2037 1604 251 11574 11689 12139
NM_000038chr51511 ------
NM_000044chrX1122 134 ----
NM_000046chr582649 2610 2308 2138 1182 366 315 260 --11107 11225
NM_000052chrX63215 2969 2438 2318 1121 174 21302 1042 ----
NM_000053chr1341792 1778 1490 66 --1195 --
NM_000068chr1981196 1023 620 338 250 225 70 23 ------
NM_000080chr174348 290 274 257 2592 176 ----
NM_000084chrX116913 6557 6509 6148 5767 5247 5204 2760 2603 1726 1625 36251 5193 1777 17005 --
NM_000088chr1721194 502 21202 1099 ----
NM_000090chr2--1315 ----
NM_000092chr253985 3311 2956 1010 635 23796 1059 ----
NM_000109chrX11991 --1901 --
NM_000125chr692927 1552 1279 1266 1216 1106 1005 284 194 11487 1229 13199
NM_000129chr671058 1047 962 553 434 390 274 ------
NM_000134chr431394 1088 581 ----21710 24
NM_000135chr163882 308 152 127 1668 --
NM_000138chr1511705 12462 1780 --
NM_000142chr471368 1235 1002 983 406 105 65 144 ----
NM_000163chr542232 1800 1622 643 --12214 --
NM_000165chr6----1112 --
NM_000168chr722626 693 43276 2521 2415 2266 ----
NM_000176chr541368 1066 600 287 --1832 --
NM_000192chr1231057 972 470 ------
NM_000214chr203283 242 193 1441 ----
NM_000216chrX33339 3030 462 --11401 --
NM_000217chr1254652 4057 3335 1705 1598 33727 278 43 11889 13382
NM_000237chr841372 342 166 136 --1604 --
NM_000248chr353061 2265 2088 1124 1098 --12886 1134
NM_000252chrX11460 ------
NM_000259chr1595078 4594 2516 2404 2299 1943 1798 1290 1129 15701 14140 12540
NM_000264chr952405 2114 2088 1170 801 ------
NM_000272chr231281 886 251 11437 ----
NM_000278chr10122143 1773 1767 1420 922 875 810 709 326 237 126 38 32134 425 297 ----
NM_000284chrX71874 1865 1609 1494 1247 782 384 ------
NM_000286chr17194 ------
NM_000291chrX1958 2707 162 134 --
NM_000304chr171251 3421 312 92 ----
NM_000314chr1013101 --13085 --
NM_000322chr611662 1301 --21290 1071
NM_000328chrX124 ------
NM_000330chrX41393 883 434 341 --1705 --
NM_000332chr656612 6517 5853 1269 308 14597 15397 --
NM_000335chr381531 766 664 440 171 127 85 39 21962 636 22006 587 --
NM_000337chr565528 5417 4466 1347 770 729 15466 35625 4706 1599 --
NM_000345chr41678 ------
NM_000346chr1721928 536 11626 ----
NM_000358chr53407 363 37 ------
NM_000361chr203516 311 93 --21534 437 --
NM_000362chr2262941 2768 2684 2211 1410 934 1651 13083 --
NM_000368chr974669 4445 4117 1805 1669 470 141 11701 --13165
NM_000376chr12102687 2632 2566 2380 2127 1236 829 651 112 85 31242 465 145 2631 471 --
NM_000386chr171115 ----2525 245
NM_000398chr225650 322 254 105 23 2684 631 ----
NM_000399chr10128 1183 ----
NM_000428chr1462440 2392 1785 967 786 121 1567 ----
NM_000430chr1712436 1603 12306 --
NM_000434chr61120 ------
NM_000435chr193889 728 685 1164 1987 --
NM_000442chr1731260 1057 900 --1510 --
NM_000445chr86847 788 329 317 255 195 2292 36 1165 --
NM_000449chr11129 ------
NM_000461chr344422 3368 452 288 24491 3195 13230 11322
NM_000462chr1531727 661 573 --11174 --
NM_000474chr7179 ------
NM_000476chr961191 954 422 276 250 143 2571 27 --11076
NM_000477chr4--127 ----
NM_000484chr211133 --1315 --
NM_000489chrX83378 3145 2924 2902 2666 2390 669 404 12357 1658 --
NM_000494chr102199 118 2785 308 122 --
NM_000500chr61504 1312 ----
NM_000503chr84517 343 187 30 ------
NM_000525chr1191657 1308 1282 1264 1255 417 300 93 61 1100 1542 --
NM_000533chrX1773 ----154
NM_000539chr361606 1436 1393 1119 1018 69 --1182 --
NM_000546chr1741018 883 872 847 --133 --
NM_000555chrX107786 7434 6837 5749 3100 2919 869 501 493 336 15767 --36784 6386 1446
NM_000567chr131169 958 903 ------
NM_000572chr13863 697 90 ------
NM_000595chr6------1119
NM_000599chr2124079 3368 3302 1406 1395 1342 1272 905 871 590 418 46 44131 3670 1304 461 ----
NM_000602chr731425 1295 1202 ------
NM_000609chr1092389 2204 2157 2052 940 898 601 373 44 11179 179 --
NM_000610chr1152383 2084 966 601 421 --12035 12875
NM_000612chr11113755 3548 3524 3291 3210 3113 2506 174 133 46 25 13192 --11487
NM_000615chr1152347 2322 1964 884 267 --12002 --
NM_000618chr1275543 5409 5181 4433 2136 2049 1171 12470 --11548
NM_000618chr1275543 5409 5181 4433 2136 2049 1171 12470 --11548
NM_000625chr172114 56 ------
NM_000633chr1864235 3240 3197 3188 1685 174 13866 1273 23387 1319
NM_000635chr1951328 1144 441 321 241 21374 1202 --11528
NM_000637chr8--1428 ----
NM_000671chr43877 414 105 --188 --
NM_000680chr82428 72 ------
NM_000683chr43489 156 62 --131 --
NM_000686chrX11324 ----11573
NM_000689chr9155 ------
NM_000719chr12106483 4470 4464 2636 2373 1271 834 626 477 257 36338 5968 4171 35866 5762 2045 --
NM_000721chr182690 2027 1930 1033 981 658 448 78 21822 1065 2712 651 --
NM_000724chr1031945 1341 222 ------
NM_000725chr1231042 128 107 ------
NM_000738chr116966 864 797 777 80 34 2381 143 ----
NM_000756chr81439 ------
NM_000757chr15888 664 542 149 32 --2837 594 --
NM_000767chr1951403 1376 1148 952 337 ------
NM_000780chr861157 975 439 431 344 266 --169 --
NM_000792chr11938 ----11000
NM_000795chr116781 303 275 215 60 26 3720 248 237 1742 --
NM_000806chr5130 ------
NM_000807chr44605 558 207 68 ------
NM_000813chr595568 5351 4562 4391 4268 4258 1807 814 589 1281 2246 59 --
NM_000826chr432309 443 380 ------
NM_000827chr562574 2036 2007 1596 944 49 12044 ----
NM_000831chr1175815 5740 5723 5410 5351 4930 4890 4430 4257 4224 3848 1821 830 578 399 323 237 25889 4595 24068 355 25506 5162
NM_000832chr97819 809 749 351 327 158 34 1624 ----
NM_000833chr1621045 975 1365 --1567
NM_000840chr7164 ------
NM_000844chr31157 ------
NM_000866chr321906 1528 ------
NM_000868chrX11712 1989 ----
NM_000870chr551241 1007 609 492 30 ------
NM_000875chr15156228 6173 6060 4847 4645 2817 1871 1588 1022 969 963 911 864 620 147 14626 ----
NM_000891chr1712630 11229 ----
NM_000899chr1232927 769 401 --11676 --
NM_000901chr422080 999 12376 ----
NM_000903chr1611138 --11353 --
NM_000912chr833581 700 533 22423 479 ----
NM_000924chr1241370 422 353 260 ------
NM_000926chr1159348 9031 7981 7818 2171 --27573 3520 11789
NM_000939chr2190 ------
NM_000944chr422149 421 ------
NM_000949chr51114 ------
NM_000950chrX21455 420 --11135 --
NM_000961chr20122901 2499 2451 1559 1499 1333 1203 1028 472 63 53 43 23283 2532 --1748
NM_000965chr32992 829 ------
NM_000966chr121200 --1333 --
NM_000977chr162355 310 ----1147
NM_001001323chr123939 602 159 ------
NM_001001330chr101351 ----1270
NM_001001331chr342260 2159 1099 931 42208 2037 1895 886 1880 --
NM_001001342chr1031309 996 283 --11436 --
NM_001001389chr1152383 2084 966 601 421 --12035 12875
NM_001001390chr1152383 2084 966 601 421 --12035 12875
NM_001001391chr1152383 2084 966 601 421 --12035 12875
NM_001001392chr1152429 2130 1012 647 467 --12081 12921
NM_001001395chr1232576 2467 2083 ------
NM_001001396chr1123869 3820 3702 3408 3396 3050 2726 1698 1579 1131 238 53 14219 1255 --
NM_001001433chr2072718 2572 2413 2323 660 365 94 22759 2163 ----
NM_001001481chr832190 1283 1224 2829 182 ----
NM_001001484chr1052113 1897 1840 1826 977 32380 193 68 1941 --
NM_001001485chr32202 142 ----1170
NM_001001486chr32144 84 ----1112
NM_001001487chr32144 84 ----1112
NM_001001522chr115156 101 54 41 30 1356 ----
NM_001001523chr161248 1095 985 866 220 117 2944 544 ----
NM_001001549chr7102219 2033 1985 1802 944 921 849 695 598 578 22553 434 1937 12341
NM_001001550chr7102219 2033 1985 1802 944 921 849 695 598 578 22553 434 1937 12341
NM_001001555chr7102219 2033 1985 1802 944 921 849 695 598 578 22553 434 1937 12341
NM_001001557chr841636 1527 693 166 1194 1129 1537
NM_001001664chr234033 3601 2552 13428 ----
NM_001001669chr552023 927 739 279 141 12727 12178 --
NM_001001701chr422313 565 11868 ----
NM_001001791chr1041088 440 359 304 1390 --11588
NM_001001890chr21124198 4151 3911 3705 2975 1259 717 711 269 222 173 141 --13098 14139
NM_001001974chr1031995 1535 880 21689 1483 ----
NM_001001995chrX2480 59 --139 --
NM_001002258chr242020 1701 1382 717 1637 11766 --
NM_001002269chr91451 ------
NM_001002755chr2132 ------
NM_001002756chr2132 ------
NM_001002757chr2132 ------
NM_001002838chrX31873 1442 703 ----1162
NM_001002860chr1431639 911 561 ------
NM_001002901chr11434 ------
NM_001002909chr1761667 1626 1484 1400 902 116 32029 1556 1377 ----
NM_001003396chr6146 1168 1499 155
NM_001003397chr6146 1168 1499 155
NM_001003398chr12370 58 31 --142 --
NM_001003652chr1848453 6929 5436 640 --38663 5963 5654 --
NM_001003674chr18116303 5583 5559 5338 4586 2218 1807 1669 1469 1204 1155 34354 2102 1221 22505 2480 --
NM_001003675chr18116303 5583 5559 5338 4586 2218 1807 1669 1469 1204 1155 34354 2102 1221 22505 2480 --
NM_001003678chr11------1125
NM_001003679chr132121 1966 53 2535 523 12077 --
NM_001003681chr2221923 348 21643 1544 ----
NM_001003683chr2137 ------
NM_001003694chr31405 ------
NM_001003698chr651583 659 453 184 173 --1204 11423
NM_001003699chr651583 659 453 184 173 --1204 11423
NM_001003712chr12--1528 --12714
NM_001003722chr9166 ------
NM_001003789chr224979 804 440 66 ------
NM_001003792chr3--11157 --11207
NM_001003793chr3--11157 --11207
NM_001003794chr3153104 2800 2747 2581 2420 1989 1973 1955 1144 973 554 535 486 423 309 1628 --12675
NM_001003799chr71534 1210 1577 --
NM_001003800chr9102875 2659 2280 972 877 845 644 595 447 214 --11307 --
NM_001003845chr21482 ------
NM_001003894chrY----1207 189
NM_001003940chr15143546 3472 3032 2975 2932 1304 1291 1229 1046 857 840 815 608 539 13128 23384 2819 --
NM_001003942chr15143546 3472 3032 2975 2932 1304 1291 1229 1046 857 840 815 608 539 13128 23384 2819 --
NM_001003943chr15143550 3476 3036 2979 2936 1308 1295 1233 1050 861 844 819 612 543 13132 23388 2823 --
NM_001003945chr941610 1448 262 141 --21276 316 --
NM_001004051chrX274 30 ------
NM_001004065chr953227 2865 2671 494 334 1404 12425 --
NM_001004304chr12102995 2882 2479 2298 2128 2082 2070 983 484 172 22868 762 22922 2022 --
NM_001004317chr633554 3293 1732 13492 23887 3080 --
NM_001004342chr1106078 5877 5568 5066 4491 4021 2298 1454 878 192 21104 996 25368 3724 22276 1359
NM_001004419chr1233595 3589 835 2794 728 ----
NM_001004426chr224580 547 48 24 1412 ----
NM_001005209chr26542 452 106 76 46 37 ------
NM_001005271chr175815 396 367 146 82 158 ----
NM_001005273chr175815 396 367 146 82 158 ----
NM_001005336chr95559 532 476 173 161 ------
NM_001005353chr131179 310 291 1431 ----
NM_001005353chr131179 310 291 1431 ----
NM_001005366chr122746 647 ------
NM_001005375chrY41506 1187 1172 1138 ----1661
NM_001005386chr222457 1783 --21713 819 --
NM_001005404chr1733972 2962 1667 1293 --11676
NM_001005417chr12518 283 1252 160 --
NM_001005463chr1022282 250 ----1186
NM_001005473chr556560 5651 5540 4565 1459 1329 --11682
NM_001005474chr3152 11604 ----
NM_001005502chr12104930 3666 3478 1880 1697 1674 1537 1368 569 497 11713 1996 --
NM_001005505chr331266 529 495 --11220 --
NM_001005609chrX143469 3427 2971 2950 2410 2395 1534 1525 1480 1060 811 752 619 107 33202 1506 465 11072 --
NM_001005612chrX2445 292 ------
NM_001005732chr213484 471 31 140 ----
NM_001005733chr213441 428 31 140 ----
NM_001005785chrY41506 1187 1172 1138 ----1661
NM_001005786chrY41506 1187 1172 1138 ----1661
NM_001005862chr172617 187 ------
NM_001005920chr1621000 365 2127 99 --2182 150
NM_001006115chr3102272 2177 2168 2069 1789 1742 1714 1107 1068 940 --1680 --
NM_001006600chr532380 1974 727 1353 ----
NM_001006617chr921070 107 --11080 --
NM_001006619chr921070 107 --11080 --
NM_001006620chr921070 107 --11080 --
NM_001006621chr921070 107 --11080 --
NM_001006636chr21736 132 ----
NM_001006641chr971775 1574 1364 1317 351 63 49 --1369 1456
NM_001006642chr971775 1574 1364 1317 351 63 49 --1369 1456
NM_001006643chr971775 1574 1364 1317 351 63 49 --1369 1456
NM_001006939chr101713 1184 ----
NM_001006944chr111615 1680 ----
NM_001007097chr984917 4161 3597 3420 1559 1417 1184 780 24546 4489 --14805
NM_001007098chr12640 283 ------
NM_001007102chr621498 207 ------
NM_001007156chr1571838 1682 1609 1536 1268 390 245 ------
NM_001007214chr11113 ------
NM_001007226chr1721021 47 1952 --11317
NM_001007227chr1721021 47 1952 --11317
NM_001007228chr1721021 47 1952 --11317
NM_001007229chr1721021 47 1952 --11317
NM_001007230chr1721021 47 1952 --11317
NM_001007246chr21128 ------
NM_001007257chr11453 ------
NM_001007271chr104954 919 860 139 21115 364 1288 --
NM_001007273chr10149 1210 ----
NM_001007277chr116739 390 175 52 42 26 ------
NM_001007466chr684152 3845 3655 2068 1015 527 419 374 23882 3409 43904 3874 3854 1045 --
NM_001007471chr92618 42 ------
NM_001007559chr1841735 318 150 41 21688 1353 11988 --
NM_001008220chr5123868 3652 3599 3490 3442 3426 2566 2529 598 368 227 151 33403 576 22 23499 3454 --
NM_001008225chr71137 ------
NM_001008392chr332277 1137 74 22799 355 13192 11362
NM_001008393chr442278 1807 446 422 ------
NM_001008405chr731265 653 106 ------
NM_001008407chr7111801 1687 674 608 561 527 514 451 262 96 61 1243 1585 --
NM_001008408chr7106061 5682 3961 1892 1715 1603 1377 1028 758 473 22515 1860 12349 12340
NM_001008529chr1741321 1124 1116 530 11333 ----
NM_001008540chr21482 ------
NM_001008541chr1021574 494 2743 629 1756 --
NM_001008541chr1021574 494 2743 629 1756 --
NM_001008660chr111451 ------
NM_001008701chr19122957 2489 2236 1906 1225 1083 1051 1009 999 770 443 222 42631 2397 737 302 1143 --
NM_001008707chr143693 485 255 11317 ----
NM_001008738chr532098 1919 464 11873 1505 1334
NM_001008801chr1911446 11530 --11415
NM_001008860chr152748 676 --1808 --
NM_001008892chr152748 676 --1808 --
NM_001008894chr152748 676 --1808 --
NM_001009554chr454773 4470 3722 3647 1151 ------
NM_001009554chr454773 4470 3722 3647 1151 ------
NM_001009555chr43567 484 469 ------
NM_001009566chr131172 199 65 --11056 --
NM_001009569chr102129 116 --11146 --
NM_001009813chr19246 26 ------
NM_001009899chr395756 5362 4893 4769 2092 2052 1445 543 453 25147 1398 ----
NM_001009909chr1133914 861 206 ------
NM_001009958chr72218 66 ------
NM_001009993chr253974 3537 914 629 59 1143 ----
NM_001010861chr122095 1893 --12359 --
NM_001010862chrX62962 2931 2824 2508 2143 1157 1836 12515 --
NM_001010867chr1246715 5958 5787 5644 5402 5255 5097 4617 4451 4319 4155 4118 2666 2226 2098 1534 1456 1409 1387 1368 1267 1231 872 738 11604 35217 1075 785 15208
NM_001010888chrX32972 1560 529 1709 24488 1063 --
NM_001010891chr576356 5944 5674 5640 5198 2615 2467 ------
NM_001010895chr931795 1387 289 ------
NM_001010924chr10--199 1772 --
NM_001010935chr131074 681 21 ------
NM_001010986chrX31551 831 716 11916 ----
NM_001011537chr332403 944 578 ------
NM_001011546chr201600 --1154 --
NM_001011645chrX1122 134 ----
NM_001011657chrX41114 404 104 48 ------
NM_001011658chrX41403 699 368 86 11448 12020 --
NM_001011666chr7135967 5513 4867 4490 4430 4405 2331 1709 1126 1029 788 351 288 34892 1620 311 1486 --
NM_001011708chr252401 2216 1109 423 204 ------
NM_001011713chr1431231 243 109 ------
NM_001011885chr1531755 1214 446 ------
NM_001012267chr951893 1695 1650 665 310 31908 1737 448 11922 11970
NM_001012329chr1112282 1970 1951 1935 1866 1638 1480 814 489 146 83 1864 ----
NM_001012393chr1165001 3329 3285 1753 1337 604 33977 3852 1276 ----
NM_001012410chr32445 120 1136 ----
NM_001012420chr1542658 2616 2569 105 12796 1567 --
NM_001012423chr1542616 2569 1994 105 12796 1567 --
NM_001012426chr6163350 2796 2790 2658 2414 2400 2091 1261 1093 940 913 894 875 504 321 139 --33191 562 81 --
NM_001012427chr6163350 2796 2790 2658 2414 2400 2091 1261 1093 940 913 894 875 504 321 139 --33191 562 81 --
NM_001012614chr42590 22 ------
NM_001012751chr1011648 1263 ----
NM_001012755chrX54615 3359 1481 1300 95 35031 1253 1107 ----
NM_001012756chr1912453 ------
NM_001012758chr1--125 ----
NM_001012979chrX149 ------
NM_001012980chrX----1183 --
NM_001013031chr101398 ------
NM_001013399chr62709 399 ------
NM_001013415chr421336 388 ------
NM_001013624chr1751035 978 267 103 37 ------
NM_001013690chr1262117 1997 1755 1566 483 34 32281 2231 1678 ----
NM_001013693chr182686 2375 2199 915 780 629 402 125 2967 713 1438 --
NM_001013693chr182686 2375 2199 915 780 629 402 125 2967 713 1438 --
NM_001013839chr1792215 2100 1808 1717 1590 1028 1002 661 424 31702 982 358 2630 182 1395
NM_001014336chr12162 ------
NM_001014797chr10107755 6821 5866 5344 2832 2393 2009 1456 706 364 17996 --26281 2885
NM_001014831chr197774 767 671 588 527 286 95 --1621 --
NM_001014832chr197774 767 671 588 527 286 95 --1621 --
NM_001014834chr197774 767 671 588 527 286 95 --1621 --
NM_001014835chr197774 767 671 588 527 286 95 --1621 --
NM_001015045chr471584 958 914 580 111 82 70 12383 ----
NM_001015053chr1771477 1181 429 218 172 152 111 21076 292 ----
NM_001015508chr81267 ------
NM_001015881chrX4860 511 387 117 ------
NM_001015887chr311595 11201 ----
NM_001015892chr51163 ------
NM_001017368chr17142 --11961 --
NM_001017392chr1941348 1180 331 309 ------
NM_001017395chr323232 673 --2649 263 --
NM_001017424chr12448 30 --11203 --
NM_001017425chr12448 30 --11203 --
NM_001017440chr7157908 7867 7491 7194 6805 5889 5747 5645 4989 2968 2842 2830 569 377 328 21879 34 47222 5906 2710 1713 12635
NM_001017535chr12102687 2632 2566 2380 2127 1236 829 651 112 85 31242 465 145 2631 471 --
NM_001017926chr811421 1350 --1580
NM_001017979chr41164 ------
NM_001018009chr31341 --21102 232 --
NM_001018038chr9175 ------
NM_001018050chr2282711 2558 2518 2434 2303 526 306 32 ------
NM_001018052chr2282711 2558 2518 2434 2303 526 306 32 ------
NM_001018054chr121008 40 11129 ----
NM_001018057chr115919 549 289 190 161 ------
NM_001018060chr222213 84 ------
NM_001018074chr541368 1066 600 287 --1832 --
NM_001018075chr541368 1066 600 287 --1832 --
NM_001018076chr541368 1066 600 287 --1832 --
NM_001018077chr541368 1066 600 287 --1832 --
NM_001018090chr1522661 989 ------
NM_001018091chr1522771 1099 ------
NM_001018102chr1522661 989 ------
NM_001020658chr121325 1050 ----11176
NM_001020658chr121325 1050 ----11176
NM_001023567chr1522011 1775 12188 1570 --
NM_001023587chr32940 42 ------
NM_001024094chr541368 1066 600 287 --1832 --
NM_001024218chr142574 77 --1665 --
NM_001024226chr12946 148 1734 1895 --
NM_001024227chr12946 148 1734 1895 --
NM_001024228chr12946 148 1734 1895 --
NM_001024380chr852032 1987 1803 875 326 1778 ----
NM_001024381chr852032 1987 1803 875 326 1778 ----
NM_001024401chr1682790 2776 2213 2206 966 910 133 34 22169 1851 12707 2981 731
NM_001024455chrX52489 2367 1707 995 252 22586 602 ----
NM_001024463chr152396 226 1107 ----
NM_001024649chr542469 2109 951 700 22701 2538 ----
NM_001024807chr19--177 ----
NM_001024808chr1272289 2265 2124 2055 1135 1052 698 1595 1683 1248
NM_001024847chr361905 1658 943 552 361 257 11549 ----
NM_001024858chr14132687 2584 2437 2269 2239 1899 1160 1129 925 619 503 457 235 22480 55 12473 --
NM_001024912chr1951465 518 484 97 80 --11554 --
NM_001024934chr62673 259 ------
NM_001024935chr62673 259 ------
NM_001024936chr62673 259 ------
NM_001024937chr175771 274 242 54 41 1598 ----
NM_001024948chr123187 2953 12245 ----
NM_001024959chr31225 ------
NM_001024960chr31225 ------
NM_001025076chr10135722 5222 5167 5161 5042 4973 4628 4119 4066 3868 2248 2016 1871 15704 32301 2190 2005 14377
NM_001025077chr10117080 6580 6525 6519 6400 6331 5986 5477 5424 5226 65 17062 --15735
NM_001025105chr521339 395 ------
NM_001025108chr274077 3854 3735 2835 2796 1110 714 12757 2704 211 --
NM_001025158chr57435 109 102 83 77 68 24 ------
NM_001025161chr22124 ------
NM_001025205chr33389 176 126 122 1315 --
NM_001025266chr394217 3830 3793 1697 1254 1234 975 677 370 1571 43555 3542 762 25 14877
NM_001025366chr631478 1432 681 --1131 --
NM_001025366chr631478 1432 681 --1131 --
NM_001025367chr631478 1432 681 --1131 --
NM_001025367chr631478 1432 681 --1131 --
NM_001025368chr631478 1432 681 --1131 --
NM_001025368chr631478 1432 681 --1131 --
NM_001025369chr631494 1448 697 --1147 --
NM_001025369chr631494 1448 697 --1147 --
NM_001025370chr631478 1432 681 --1131 --
NM_001025370chr631478 1432 681 --1131 --
NM_001025579chr176930 815 803 747 251 172 --1411 --
NM_001025580chrX23484 1641 23299 1368 23312 2962 22914 576
NM_001025595chr42519 126 ------
NM_001025603chr11129 ------
NM_001025780chr911030 ------
NM_001029863chr642622 2034 1972 1039 1545 ----
NM_001029864chr2072537 2322 965 831 792 86 29 22172 351 1367 --
NM_001029875chr542405 2011 1100 71 11999 ----
NM_001029989chr151961 1665 ----
NM_001030001chr141398 1362 ----
NM_001030007chr1653848 2878 1278 765 278 ------
NM_001030272chr11265 27 ------
NM_001030273chr11265 27 ------
NM_001031680chr192193 1908 1839 1798 615 468 274 211 167 3765 625 231 12233 --
NM_001031685chr12380 336 ------
NM_001031690chr773044 2607 1162 1132 810 129 85 1468 21155 721 12157
NM_001031695chr22105420 5186 4990 3968 3562 1657 1254 990 845 663 34886 4672 2020 2654 33 --
NM_001031716chr24978 898 306 248 ------
NM_001031717chr33799 375 273 1328 ----
NM_001031732chr453064 2930 2563 479 202 ----1247
NM_001031740chr141664 598 144 77 2589 273 1132 --
NM_001031746chr1031208 488 266 --1192 --
NM_001031804chr1613318 11507 ----
NM_001031812chr51578 ------
NM_001032221chr951290 1196 701 497 103 --1679 --
NM_001032282chr8----1125 --
NM_001032293chr17168 ------
NM_001032296chr13102861 2564 2546 2508 2464 2317 2168 210 173 156 ------
NM_001032380chr1011537 --11369 --
NM_001032999chr20135074 4639 4584 4333 3931 3474 3427 1479 894 449 309 285 215 13887 44987 4870 4220 159 --
NM_001033045chr264114 3309 1278 812 601 433 --11632 --
NM_001033047chr422480 952 ------
NM_001033057chr32794 734 ----1721
NM_001033081chr181581 1388 1276 437 353 187 136 105 ------
NM_001033082chr181581 1388 1276 437 353 187 136 105 ------
NM_001033117chr3104914 4315 4161 4003 1862 1668 1411 1257 699 241 21962 166 --151
NM_001033506chr111293 ------
NM_001033551chr17273776 3768 3708 3670 3537 3525 3489 3477 3427 3270 3247 2976 2685 2553 1642 1633 1430 1349 1077 965 723 645 361 285 207 97 88 1616 22615 2523 11453
NM_001033557chr241377 1353 585 86 ------
NM_001033566chr173956 199 192 1372 1691 --
NM_001033568chr173956 199 192 1372 1691 --
NM_001033677chr122386 376 ------
NM_001033723chr842403 2317 783 686 12551 12161 11039
NM_001033756chr631412 1366 615 --165 --
NM_001033756chr631412 1366 615 --165 --
NM_001033925chr1042120 1771 1613 749 ------
NM_001034837chr5125 ------
NM_001034838chr5125 ------
NM_001034841chr1685441 4724 4095 3681 3561 1790 1509 786 34087 2204 1515 21449 1330 1170
NM_001034853chrX2942 789 ------
NM_001034954chr1083011 2889 2357 2308 605 432 348 259 1419 --12749
NM_001034955chr1083011 2889 2357 2308 605 432 348 259 1419 --12749
NM_001034956chr1083011 2889 2357 2308 605 432 348 259 1419 --12749
NM_001034957chr1083011 2889 2357 2308 605 432 348 259 1419 --12749
NM_001035256chr2190 ------
NM_001035260chr1011632 --176 --
NM_001035511chr162163 1604 1563 1353 245 133 ------
NM_001035512chr172270 1711 1670 1460 352 240 81 ------
NM_001035513chr172270 1711 1670 1460 352 240 81 ------
NM_001035521chr21647 1233 1181 --
NM_001035534chr941352 1252 1044 68 ------
NM_001037164chr721371 473 ------
NM_001037174chr211512 11876 ----
NM_001037317chr122095 1893 --12359 --
NM_001037334chr1832396 2197 1646 1547 ----
NM_001037339chr11658 3647 170 71 ----
NM_001037340chr11658 3647 170 71 ----
NM_001037341chr11658 3647 170 71 ----
NM_001037341chr11658 3647 170 71 ----
NM_001037494chr122191 91 157 ----
NM_001037495chr122191 91 157 ----
NM_001037535chrX2503 345 --11516 --
NM_001037536chrX2503 345 --11516 --
NM_001037540chrX2503 345 --11516 --
NM_001037582chr451430 1112 625 320 281 31143 658 578 ----
NM_001037954chr1143361 3119 2747 151 ------
NM_001038707chr112203 155 2558 185 --
NM_001038707chr112203 155 2558 185 --
NM_001039111chr31104 ------
NM_001039140chr203465 458 36 ------
NM_001039141chr22102735 2540 2419 2227 1981 1814 1094 957 731 481 --22270 630 --
NM_001039199chr20104575 4304 3717 3550 3253 1683 1641 1509 1035 702 11741 1128 11894
NM_001039350chr771722 1436 1429 1278 1198 337 193 1702 1270 --
NM_001039360chr1851753 1563 622 40 32 31479 274 25 ----
NM_001039457chr1162 ------
NM_001039459chr75767 350 304 161 145 1240 ----
NM_001039465chr141486 ------
NM_001039569chr253141 2975 2482 2443 1217 ----1954
NM_001039574chr12932 874 1414 ----
NM_001039577chr1103845 3707 3379 3301 3290 1453 1370 859 660 122 13314 ----
NM_001039590chrX43226 804 732 396 --12958 21384 55
NM_001039591chrX43226 804 732 396 --12958 21384 55
NM_001039618chr1165801 4646 4398 1364 824 268 11519 ----
NM_001039619chr142307 252 --1366 --
NM_001039690chr1642158 1843 1810 1666 11965 ----
NM_001039709chr20135074 4639 4584 4333 3931 3474 3427 1479 894 449 309 285 215 13887 44987 4870 4220 159 --
NM_001039715chr11938 ----11000
NM_001039716chr111002 ----11064
NM_001039771chr1441091 893 251 34 ------
NM_001039802chr131176 506 30 1935 ----
NM_001039840chrX55972 5898 5823 3886 927 --11588 --
NM_001039888chr11588 168 ----
NM_001039916chr126927 860 485 432 235 189 ------
NM_001039917chr126927 860 485 432 235 189 ------
NM_001039918chr126927 860 485 432 235 189 ------
NM_001039919chr126927 860 485 432 235 189 ------
NM_001039920chr126927 860 485 432 235 189 ------
NM_001039937chr1313756 ------
NM_001040092chr8125 ------
NM_001040100chr3153 --1895 --
NM_001040107chr122674 69 --1154 --
NM_001040110chr731470 1202 486 --11450 --
NM_001040134chr1981241 1193 1039 916 361 339 53 23 1352 31513 963 92 --
NM_001040142chr231635 1584 947 --2880 46 --
NM_001040143chr231635 1584 947 --2880 46 --
NM_001040144chr1642158 1843 1810 1666 11965 ----
NM_001040146chr1642158 1843 1810 1666 11965 ----
NM_001040151chr1143586 3463 3076 1250 24254 3197 --14238
NM_001040152chr765016 3524 1447 1096 1067 693 14042 ----
NM_001040159chr42319 58 ------
NM_001040172chr551241 1007 609 492 30 ------
NM_001040173chr551241 1007 609 492 30 ------
NM_001040195chr14624 499 112 53 1204 ----
NM_001040202chr411867 1428 ----
NM_001040214chr632208 2057 706 31591 354 27 1606 --
NM_001040272chr952390 2158 1577 956 758 1531 1333 --
NM_001040284chr1654746 4565 1566 1153 136 ------
NM_001040402chr431174 970 154 ------
NM_001040429chr1312251 --12292 1692
NM_001040436chr122623 457 ------
NM_001040439chr1641289 964 244 65 21205 263 ----
NM_001040446chr53674 102 50 ----181
NM_001040450chr1552732 2465 1119 549 539 ------
NM_001040453chr1552732 2465 1119 549 539 ------
NM_001040619chr121370 1342 2358 190 ----
NM_001040624chr832693 2528 341 ------
NM_001040625chr832693 2528 341 ------
NM_001040626chr832693 2528 341 ------
NM_001040627chr832693 2528 341 ------
NM_001040628chr832693 2528 341 ------
NM_001040629chr832693 2528 341 ------
NM_001040630chr832693 2528 341 ------
NM_001040653chr361899 1624 963 812 343 113 1333 ----
NM_001040665chr723905 21 34078 3174 1357 --13735
NM_001040715chr165885 859 243 178 91 11175 ----
NM_001042355chr1675314 4943 3621 3583 1744 1544 1078 ----21621 837
NM_001042371chr1652101 1869 1616 1391 377 1675 ----
NM_001042388chr181745 --1394 --
NM_001042404chr13530 347 91 ------
NM_001042412chr1675314 4943 3621 3583 1744 1544 1078 ----21621 837
NM_001042413chr973902 3830 3130 2505 1537 1387 736 2604 100 21604 832 --
NM_001042424chr452471 2394 922 98 51 1213 22988 234 --
NM_001042453chrX21784 329 1565 ----
NM_001042459chr3--124 ----
NM_001042473chr1022139 865 ------
NM_001042476chr1661897 1834 1592 838 760 414 11641 22013 772 21884 195
NM_001042479chrX51710 1675 1328 408 25 --1126 --
NM_001042480chrX51710 1675 1328 408 25 --1126 --
NM_001042481chr1422071 1040 ------
NM_001042486chr2041171 1104 524 386 21330 298 11549 1377
NM_001042494chr1563039 2852 2623 1328 572 424 170 ----
NM_001042495chr1563039 2852 2623 1328 572 424 170 ----
NM_001042496chr1563039 2852 2623 1328 572 424 170 ----
NM_001042497chr1563039 2852 2623 1328 572 424 170 ----
NM_001042506chrX2996 77 ------
NM_001042510chr8--1219 ----
NM_001042511chr8--1219 ----
NM_001042537chrX42393 2124 1631 975 ------
NM_001042555chr1221284 550 ------
NM_001042573chr1792059 1710 1698 1482 1434 888 698 618 479 32145 878 843 ----
NM_001042599chr246341 5792 5387 254 --24833 2634 --
NM_001042601chr322932 2244 ------
NM_001042603chr1261772 1381 974 959 555 219 ----11026
NM_001042604chr323513 979 11827 ----
NM_001042632chr2021708 901 2892 34 1882 --
NM_001042633chr2021708 901 2892 34 1882 --
NM_001042663chr141322 1184 352 217 21217 250 151 --
NM_001042664chr141322 1184 352 217 21217 250 151 --
NM_001042665chr141322 1184 352 217 21217 250 151 --
NM_001042678chr12145 74 ------
NM_001042679chr12145 74 ------
NM_001042681chr1----2558 217 --
NM_001042682chr1----2558 217 --
NM_001042682chr1----2558 217 --
NM_001042728chr121200 --1333 --
NM_001042749chrX11761 ------
NM_001042750chrX11761 ------
NM_001042751chrX11761 ------
NM_001042762chr7139 ------
NM_001043318chr14133833 3592 3419 3407 3376 2722 1452 1373 1353 985 662 497 484 --23825 917 --
NM_001043351chr131963 1511 64 --1350 --
NM_001044305chr611604 ------
NM_001044722chr51578 ------
NM_001044723chr51578 ------
NM_001071775chr13----1226 --
NM_001079874chr142085 1794 497 135 --1219 --
NM_001083620chr432307 442 379 ------
NM_001083621chr1144548 4201 4007 3844 1528 1518 1489 923 900 845 653 613 129 59 --33267 1437 781 11539
NM_001087chr21126 ------
NM_001092chr17142268 2213 2016 1672 1552 903 616 499 459 306 193 187 50 41 21022 380 32034 1563 328 11990
NM_001094chr174853 688 679 612 ------
NM_001095chr1291511 1256 1245 700 673 620 542 472 290 2747 492 11349 --
NM_001096chr172120 72 1175 ----
NM_001099678chr366050 4987 4821 4187 2556 178 --25181 4009 --
NM_001100108chr147467 6138 5663 5345 36299 5935 293 11706 15903
NM_001106chr388149 8131 8009 7309 6898 3830 2640 821 16214 ----
NM_001113490chrX43347 3226 2873 867 --12581 --
NM_001116chr1652607 2299 2237 952 129 22614 1159 1583 --
NM_001117chr182996 75 2689 585 2720 34 --
NM_001122679chr511094 ------
NM_001128chr1653848 2878 1278 765 278 ------
NM_001144chr161148 ------
NM_001149chr10----1410 --
NM_001153chr21120 ------
NM_001156chr101585 ------
NM_001157chr101709 --2223 98 --
NM_001163chr93970 929 234 --1791 --
NM_001167chrX96099 5760 5532 5428 5263 4971 4270 4105 1334 16264 ----
NM_001174chrX72045 858 798 753 525 401 181 1613 1932 --
NM_001177chr1241848 1745 839 62 11864 11824 --
NM_001178chr11265 27 ------
NM_001186chr2142748 2257 1219 341 ------
NM_001189chr46891 763 363 130 124 63 ------
NM_001191chr2061428 1323 1068 1060 1019 923 1103 ----
NM_001196chr2221003 50 1891 ----
NM_001198chr632061 305 90 --22093 1808 --
NM_001200chr201152 ------
NM_001201chr443657 3607 2922 2780 12875 ----
NM_001206chr91591 ------
NM_001219chr781856 1810 1748 1616 1460 767 681 48 ------
NM_001222chr10102017 1780 1652 1638 595 465 161 138 90 54 --1297 --
NM_001257chr1621255 92 ------
NM_001259chr776343 5386 1593 1571 1308 815 345 --11627 --
NM_001260chr132295 60 ------
NM_001265chr132327 103 ------
NM_001267chr173450 176 23 --199 --
NM_001273chr121431 --1134 --
NM_001280chr192528 147 ------
NM_001292chr155985 971 708 245 206 --1700 --
NM_001293chr111448 ------
NM_001304chr1733638 2500 233 11028 --1672
NM_001310chr1262989 2413 2323 1127 672 467 ------
NM_001328chr42590 22 ------
NM_001331chr1132645 2279 1925 --1131 --
NM_001343chr551463 1247 1107 344 76 ------
NM_001351chr321156 1141 ----1566
NM_001358chr4138 ------
NM_001364chr11104565 4236 4215 4015 3527 3509 3039 2942 1881 388 13461 ----
NM_001365chr171141 ------
NM_001382chr11132 ------
NM_001387chr5103094 2979 2776 2438 2068 1988 1278 877 526 202 --1556 --
NM_001396chr2131765 1091 793 --1913 12436
NM_001397chr1142405 2231 2168 2001 1958 1840 1717 995 936 605 583 573 85 66 31983 1707 692 ----
NM_001399chrX143469 3427 2971 2950 2410 2395 1534 1525 1480 1060 811 752 619 107 33202 1506 465 11072 --
NM_001406chr1771643 1192 549 270 114 96 35 21524 638 --1339
NM_001407chr361672 1568 1333 126 95 29 11665 ----
NM_001408chr161459 1237 1192 1119 503 398 ------
NM_001412chrX53673 3068 2741 1248 1042 ------
NM_001417chr1251476 516 230 209 169 1554 ----
NM_001419chr1993650 3515 3486 3420 3274 3231 3017 526 275 24402 3292 13725 --
NM_001420chr1972927 2825 2438 2377 1168 811 106 32797 776 501 12369 --
NM_001431chr621187 174 1361 ----
NM_001438chr143408 819 744 581 ------
NM_001440chr831797 1025 299 --12242 --
NM_001447chr521237 324 1120 2524 395 --
NM_001448chrX21559 1168 ------
NM_001453chr611207 1161 ----
NM_001458chr73152 30 24 1700 1499 --
NM_001478chr123879 815 227 ------
NM_001494chr101494 ------
NM_001495chr861186 854 493 394 200 53 ------
NM_001497chr952629 2583 2320 1801 1708 ------
NM_001521chr21647 1233 1181 --
NM_001530chr14--1762 --1204
NM_001541chr111153 ------
NM_001543chr5124549 4389 4298 3767 3402 3349 1345 1279 1083 815 544 500 24415 3585 ----
NM_001552chr173914 393 380 2265 113 --1238
NM_001560chrX42252 2045 600 507 1124 ----
NM_001610chr112776 500 182 ----
NM_001616chr252994 2410 1360 486 265 --12729 --
NM_001619chr113884 130 120 --1254 1893
NM_001620chr11151 1214 ----
NM_001658chr12946 148 1734 1895 --
NM_001659chr1232248 553 68 --12459 --
NM_001660chr32693 576 ------
NM_001663chr1422538 2250 1621 ----
NM_001670chr222522 28 1638 ----
NM_001679chr32216 61 ------
NM_001681chr121554 ------
NM_001682chr122653 316 ------
NM_001683chr342260 2159 1099 931 42208 2037 1895 886 1880 --
NM_001684chr193586 3537 3419 3125 3113 2767 1415 1296 848 13936 ----
NM_001689chr242020 1701 1382 717 1637 11766 --
NM_001693chr82925 299 --1801 --
NM_001701chr921529 1379 --11011 --
NM_001706chr32181 33 ------
NM_001707chr7--1776 1603 --
NM_001709chr1122496 190 12008 ----
NM_001710chr6145 ------
NM_001717chr1541150 539 419 188 1212 ----
NM_001718chr621097 523 ----1513
NM_001730chr1331566 478 257 ------
NM_001730chr1331566 478 257 ------
NM_001731chr123662 207 107 ------
NM_001742chr71184 ------
NM_001743chr21384 ------
NM_001746chr542469 2109 951 700 22701 2538 ----
NM_001754chr21124198 4151 3911 3705 2975 1259 717 711 269 222 173 141 --13098 14139
NM_001755chr1621500 473 --1621 11784
NM_001759chr1244689 4454 3665 3554 14712 --14311
NM_001760chr62779 612 ------
NM_001773chr131360 1271 325 --1140 21351 1046
NM_001783chr193322 90 47 162 ----
NM_001789chr331459 1401 91 129 ----
NM_001791chr131176 506 30 1935 ----
NM_001792chr1811105 ------
NM_001810chr204831 559 320 180 ------
NM_001829chr42614 387 ------
NM_001830chrX73503 2575 2495 1193 899 883 593 1862 ----
NM_001833chr9167 ------
NM_001838chr173932 728 118 ------
NM_001842chr93533 456 170 ------
NM_001854chr111063 ------
NM_001858chr633737 1246 642 11502 11412 11122
NM_001859chr983815 3649 2659 2610 2495 1519 763 169 --13125 --
NM_001865chr6144 ------
NM_001866chrX------144
NM_001873chr41151 ------
NM_001874chr12104930 3666 3478 1880 1697 1674 1537 1368 569 497 11713 1996 --
NM_001892chr521339 395 ------
NM_001893chr171296 ------
NM_001895chr201325 --11161 --
NM_001901chr62406 395 --1817 --
NM_001904chr33319 300 243 ------
NM_001918chr1168684 8407 7646 7556 7203 6797 5837 3239 2778 2607 2443 1874 1567 1038 547 381 --13189 --
NM_001927chr24456 103 97 67 1518 1117 1170
NM_001936chr771722 1436 1429 1278 1198 337 193 1702 1270 --
NM_001939chrX93571 2755 2545 1494 1488 626 545 249 68 1275 12713 --
NM_001946chr121442 ----1253
NM_001949chr641295 1040 975 526 --21103 615 --
NM_001957chr42684 522 21582 1412 ----
NM_001968chr41906 ------
NM_001969chr1452935 2849 2710 2385 1207 1487 ----
NM_001970chr171454 --1414 --
NM_001981chr13853 598 379 ------
NM_001987chr1254051 3779 1665 1294 698 21031 37 11631 --
NM_001995chr42586 180 ------
NM_002006chr465086 3932 2043 1100 531 350 22161 579 1500 --
NM_002010chr132425 98 ------
NM_002013chr141208 ------
NM_002015chr1342896 2574 2264 2038 32071 1351 71 33078 2116 542 --
NM_002017chr11----11214 --
NM_002023chr141185 1151 1065 174 31550 1411 1082 1391 --
NM_002025chrX76440 6202 3688 3093 2851 1919 1743 11472 28726 278 --
NM_002031chr61191 ----1766
NM_002035chr1853211 2600 1272 794 48 23387 2561 1587 12892
NM_002040chr215359 310 296 260 111 ------
NM_002045chr32139 75 ------
NM_002061chr141951 1786 1476 1311 ------
NM_002069chr71430 --1495 --
NM_002072chr9----1209 --
NM_002073chr2271506 1287 1007 996 624 526 432 --1608 --
NM_002076chr1242949 2716 2166 711 11280 ----
NM_002077chr941738 439 317 261 11502 22032 387 --
NM_002083chr142114 43 ------
NM_002086chr1762005 1917 1492 878 422 87 1536 11902 --
NM_002090chr42252 113 ------
NM_002092chr484641 4175 4042 3632 3112 1044 854 585 14220 24229 3800 1809
NM_002101chr22424 129 1492 ----
NM_002106chr4150 ------
NM_002114chr61157 ------
NM_002126chr1743620 3050 524 237 13127 ----
NM_002129chr4--186 ----
NM_002130chr511447 ------
NM_002131chr641285 1150 236 59 ------
NM_002143chr16727 528 499 306 273 40 ------
NM_002146chr1741316 1077 926 564 ------
NM_002158chr252885 1468 1239 817 274 ------
NM_002181chr21282 ------
NM_002187chr53942 356 214 1866 11095 --
NM_002193chr2101654 570 494 359 274 245 161 103 65 44 ------
NM_002205chr127817 631 406 379 266 101 41 1127 ----
NM_002211chr10----1983 --
NM_002221chr162788 2695 2335 2311 562 340 --1411 --
NM_002222chr321366 332 ------
NM_002228chr1------11038
NM_002249chr1--1360 ----
NM_002252chr2157 ------
NM_002254chr2102332 1865 1856 1828 1721 754 644 566 428 51 --2525 369 --
NM_002264chr374788 4443 4433 1913 1734 1086 627 --174 1223
NM_002267chr131749 ------
NM_002270chr534282 2024 24 --21907 1011 --
NM_002271chr1331508 586 331 1939 ----
NM_002272chr12--2338 24 ----
NM_002282chr122224 217 ------
NM_002285chr274077 3854 3735 2835 2796 1110 714 12757 2704 211 --
NM_002290chr62979 480 ------
NM_002293chr142508 1786 873 344 1457 12700 --
NM_002309chr2272952 2945 2452 2423 2144 734 388 32797 899 147 12565 --
NM_002310chr532424 1090 846 1670 ----
NM_002319chr77768 740 339 251 199 178 92 ------
NM_002332chr125699 640 513 308 84 ------
NM_002333chr1941096 804 340 58 11166 131 --
NM_002336chr1254940 3721 3325 629 450 ------
NM_002355chr12487 57 35 23 1520 ----
NM_002356chr612524 ------
NM_002359chr17123978 3928 3813 3657 3380 3275 3196 3133 2800 1372 535 440 33254 465 455 23260 715 --
NM_002360chr782420 1775 1032 829 527 493 444 420 1136 21663 354 --
NM_002372chr5----1284 --
NM_002382chr1451102 1045 351 342 297 --1168 --
NM_002390chr1781779 1660 1646 640 604 333 240 45 11888 1214 1297
NM_002395chr63583 499 121 ------
NM_002397chr511759 11413 1812 --
NM_002398chr241378 1100 104 70 ------
NM_002399chr152426 104 ------
NM_002401chr17132438 2406 2373 2226 1893 1827 1772 1716 871 551 279 205 182 1118 12332 --
NM_002406chr51929 --163 --
NM_002408chr14126 ------
NM_002409chr2293233 2357 2082 2072 1207 923 795 356 50 22610 2579 ----
NM_002428chr1681449 1202 1119 997 465 340 287 100 1560 1573 --
NM_002430chr2282235 2223 2011 988 920 885 778 696 ------
NM_002442chr1291403 1163 1146 616 291 248 157 91 32 1410 ----
NM_002473chr225861 836 413 281 203 --150 --
NM_002479chr11114 1284 1478 --
NM_002480chr122542 393 --1290 --
NM_002481chr1127800 6892 6110 6051 5976 5289 3184 2909 2299 1716 1414 68 47746 6362 1185 889 17510 17028
NM_002486chr922314 1903 --1384 --
NM_002499chr1521710 186 ------
NM_002501chr19214037 3911 3723 3712 3702 3639 3395 3054 1491 1401 1081 949 850 838 779 652 481 276 193 177 23 2224 127 33373 3361 807 --
NM_002508chr161995 1601 659 413 382 315 21766 119 11719 --
NM_002515chr1421601 778 ------
NM_002518chr241080 883 353 236 ------
NM_002519chr111157 11130 ----
NM_002522chr1783810 3191 2678 2504 1257 1117 247 168 41269 1080 912 795 42843 948 819 139 --
NM_002526chr651530 1347 1191 481 325 --1602 --
NM_002533chr11178 134 ----
NM_002545chr1165001 3329 3285 1753 1337 604 33977 3852 1276 ----
NM_002547chrX3757 673 110 23274 2887 13960 --
NM_002569chr1591434 1323 628 496 472 343 307 272 266 ------
NM_002576chr1141170 861 831 465 ------
NM_002579chr1981241 1193 1039 916 361 339 53 23 1352 31513 963 92 --
NM_002581chr9114176 1812 1759 1235 973 924 757 587 563 250 71 --23652 1377 13986
NM_002585chr11243 ------
NM_002588chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_002594chr2052080 977 788 304 42 1752 ----
NM_002599chr1141041 967 944 489 --2460 45 --
NM_002600chr11658 3647 170 71 ----
NM_002601chr23515 151 135 ------
NM_002609chr581202 1174 737 695 664 658 570 205 31577 1341 615 ----
NM_002611chr173770 763 287 1177 ----
NM_002613chr1694767 3982 3752 3662 1915 1445 354 301 281 --25207 1152 --
NM_002616chr171434 2206 149 1366 --
NM_002622chr55838 589 562 167 78 1779 ----
NM_002628chr321171 775 ------
NM_002632chr14------1707
NM_002634chr17----267 46 --
NM_002645chr1132400 383 180 ------
NM_002648chr611070 ------
NM_002653chr54935 895 764 131 1101 2840 639 --
NM_002655chr854096 1715 976 938 872 --24764 1189 --
NM_002657chr2043552 2880 708 589 43063 2981 689 23 22944 1482 --
NM_002660chr2061096 1031 451 199 110 80 ------
NM_002663chr172503 457 1409 ----
NM_002668chrX1153 ------
NM_002698chr1972440 1029 814 807 157 40 31 12874 1841 --
NM_002706chr23660 636 127 ------
NM_002709chr233245 1275 667 --12267 --
NM_002711chr72759 249 ------
NM_002717chr8------1437
NM_002721chr91375 ------
NM_002730chr195970 386 271 263 84 1281 21043 255 --
NM_002731chr142635 2564 704 609 ------
NM_002733chr121236 1222 ----
NM_002737chr17145760 4795 4597 4389 2508 2396 2124 1943 1792 1074 1042 92 41 34 --35320 2626 526 11186
NM_002738chr161732 ------
NM_002739chr195724 602 194 123 57 --1186 --
NM_002763chr1143 1553 ----
NM_002776chr1951994 1336 593 586 275 --11627 --
NM_002811chr161507 ------
NM_002814chrX1174 ----1574
NM_002819chr1951411 496 358 229 76 ----1192
NM_002822chr12--1586 1662 --
NM_002824chr124449 337 142 64 ------
NM_002827chr2031277 1167 487 --21254 358 --
NM_002828chr181143 ------
NM_002830chr21389 ------
NM_002833chr1541027 496 147 34 11343 ----
NM_002834chr1253106 2912 1496 988 912 21269 1064 ----
NM_002837chr1244437 2800 1699 516 23116 647 ----
NM_002840chr161579 1334 601 543 88 58 ----1125
NM_002841chr31707 ------
NM_002844chr621063 1019 11380 ----
NM_002846chr25478 419 226 167 115 129 ----
NM_002849chr121166 ----1257
NM_002855chr11133166 2927 2504 2390 2361 1451 1442 946 532 347 162 126 44 32530 1460 753 11179 13622
NM_002859chr121354 21632 278 --11547
NM_002867chr11293 186 ----
NM_002868chr1261946 1859 1760 938 755 390 12319 1137 --
NM_002869chr11--11864 --21620 369
NM_002874chr931703 1655 401 --12051 12145
NM_002880chr35719 639 572 310 255 --1752 --
NM_002884chr131074 681 21 ------
NM_002885chr16988 930 920 398 238 117 --1379 --
NM_002886chr374297 3764 3318 3295 1212 451 334 ------
NM_002892chr1421123 208 11050 ----
NM_002896chr111112 ------
NM_002906chr1181649 1578 954 685 672 598 527 462 --1802 --
NM_002918chr1991036 1026 916 703 416 382 311 262 92 --1400 --
NM_002923chr12194 96 ------
NM_002924chr11462 ------
NM_002942chr321234 141 ------
NM_002948chr33472 303 50 ------
NM_002955chr651583 659 453 184 173 --1204 11423
NM_002957chr9173356 3034 2889 2865 1501 1487 1233 948 812 801 616 504 479 470 335 222 72 22584 1350 22906 127 --
NM_002959chr1114165 4111 3409 3162 1608 1355 950 544 449 397 109 23634 2807 2517 487 --
NM_002965chr1567 61 46 40 34 ------
NM_002966chr1174 ------
NM_002971chr331127 1113 203 ------
NM_002977chr253320 2728 2691 858 710 --131 --
NM_002996chr1691594 798 786 479 319 287 230 173 40 21720 1470 1355 --
NM_003000chr1--136 ----
NM_003001chr172270 1711 1670 1460 352 240 81 ------
NM_003011chr931541 1425 51 ------
NM_003012chr8102893 2192 2157 1080 1004 735 623 306 260 168 --11278 1871
NM_003013chr42115 74 ------
NM_003016chr1711363 --1745 11378
NM_003017chr621443 1018 ------
NM_003027chr15------1428
NM_003028chr9173661 3469 3444 3345 3085 3012 2705 2665 1539 1512 1182 845 835 829 694 308 217 175 21403 1337 11157
NM_003035chr13826 278 121 1344 ----
NM_003036chr14810 238 221 70 195 --1458
NM_003038chr251916 1694 780 690 368 12520 22689 636 --
NM_003045chr13184209 3788 3728 3471 3412 3350 3186 1963 637 490 432 415 310 208 175 150 123 34 53494 980 756 291 158 --11080
NM_003047chr141039 985 515 247 11329 2156 139 --
NM_003071chr351748 1684 1539 736 556 ------
NM_003074chr31487 --1114 --
NM_003075chr12192 --162 --
NM_003076chr1241253 1072 580 573 ------
NM_003079chr173827 375 220 1808 --1332
NM_003081chr20--1108 ----
NM_003090chr15171 ------
NM_003091chr201197 ------
NM_003106chr31162 ------
NM_003108chr296917 6715 5324 2811 2101 2040 1959 1831 1189 ----1886
NM_003112chr722603 1065 ------
NM_003113chr2----1174 --
NM_003128chr252066 1871 1857 516 504 --22344 1958 --
NM_003131chr661871 535 426 403 197 127 --12246 11651
NM_003136chr14----1347 --
NM_003139chr113792 288 164 ------
NM_003143chr7138 ------
NM_003146chr11194 ------
NM_003150chr1761877 1632 859 593 565 73 12213 1913 --
NM_003153chr12----134 --
NM_003155chr8--11043 11941 --
NM_003156chr114887 291 284 30 ------
NM_003157chr3178 ------
NM_003161chr1722334 681 2957 557 ----
NM_003162chr2------11058
NM_003173chrX51406 1109 459 324 199 ------
NM_003178chr332256 1390 152 ------
NM_003185chr203384 135 87 ------
NM_003186chr115156 101 54 41 30 1356 ----
NM_003187chr51163 ------
NM_003189chr1102436 2398 2187 1094 907 727 591 397 356 263 12624 --13313
NM_003199chr1855529 4948 4697 1726 57 ----1284
NM_003200chr1952311 2134 1605 63 40 21979 1954 ----
NM_003201chr102930 901 1136 ----
NM_003202chr571481 1327 1286 1176 130 82 21 --1695 --
NM_003206chr61364 ------
NM_003214chr671387 1146 1052 905 310 267 224 ------
NM_003215chr441072 1028 282 145 11557 11157 --
NM_003217chr1261623 1321 1295 652 481 379 11930 11276 --
NM_003221chr673133 3084 3072 826 616 592 463 11639 ----
NM_003236chr232670 757 134 1541 12232 --
NM_003242chr361905 1658 943 552 361 257 11549 ----
NM_003244chr182156 121 ------
NM_003253chr2121194 442 ------
NM_003255chr1771687 1033 906 697 569 289 67 11756 12361 --
NM_003269chr6----1987 --
NM_003274chr2152294 1157 471 419 376 --1319 12483
NM_003285chr1----1394 --
NM_003289chr9129 ------
NM_003290chr193967 330 221 21084 810 ----
NM_003291chr131688 ------
NM_003292chr11525 ------
NM_003317chr143711 704 286 126 ----
NM_003320chr1164323 3481 912 898 721 34 1854 171 --
NM_003322chr61160 ------
NM_003325chr222584 282 1144 ----
NM_003326chr152174 2128 943 857 657 1103 ----
NM_003337chr531587 1281 1211 ------
NM_003339chr511309 ------
NM_003340chr441214 1170 1085 988 ------
NM_003342chr1732984 2109 900 ------
NM_003344chr771519 1496 1117 665 393 305 274 ------
NM_003348chr122126 83 11552 1557 --
NM_003360chr4174 ------
NM_003369chr1132511 1917 712 --22162 263 1551
NM_003371chr991939 1584 1484 590 444 431 236 177 54 11547 ----
NM_003374chr51118 ------
NM_003376chr631478 1432 681 --1131 --
NM_003376chr631478 1432 681 --1131 --
NM_003380chr10175 ------
NM_003390chr112405 238 ------
NM_003392chr331482 1091 24 33763 1555 937 ----
NM_003400chr21656 ------
NM_003404chr2021461 160 1132 1125 --
NM_003405chr221116 1718 ----
NM_003406chr821424 525 ------
NM_003409chr1821256 1094 ------
NM_003411chrY31708 1575 1275 ------
NM_003412chr322563 605 --1916 --
NM_003413chrX2710 413 --1810 --
NM_003416chr8145 ------
NM_003427chr63548 502 232 ------
NM_003439chr743378 3161 2494 2329 --2195 91 --
NM_003445chr194769 545 523 228 2747 331 3712 629 576 --
NM_003455chr1151654 361 176 80 35 --2460 389 --
NM_003457chr17168 ------
NM_003458chr3113728 3571 3096 2867 2700 1616 1334 1126 728 375 86 13187 53288 1610 874 476 308 --
NM_003459chr27714 499 163 157 151 145 45 ------
NM_003463chr622709 178 23255 2715 12692 12107
NM_003466chr2102445 2028 1629 1613 975 740 510 322 283 48 2896 446 52452 1965 1531 865 459 --
NM_003467chr21482 ------
NM_003468chr253659 2789 2732 1271 641 1189 21106 551 --
NM_003470chr1641564 607 525 375 --1639 158
NM_003478chr1122444 2091 ------
NM_003482chr1262483 1022 264 239 212 85 1397 32110 2036 369 --
NM_003483chr122840 258 12410 22921 216 --
NM_003485chr1441151 941 904 414 31389 1177 49 11044 1973
NM_003489chr2132587 1182 468 21195 380 ----
NM_003502chr165522 449 258 206 61 1246 ----
NM_003505chr741971 504 272 147 ------
NM_003508chr7180 ------
NM_003557chr1164 11332 --11044
NM_003559chr17103266 3084 2950 2770 2605 2570 1272 1149 821 141 21327 405 11441 --
NM_003560chr224580 547 48 24 1412 ----
NM_003563chr1721021 47 1952 --11317
NM_003564chr16532 497 435 268 205 132 ------
NM_003566chr122894 220 --12376 --
NM_003576chr13102861 2564 2546 2508 2464 2317 2168 210 173 156 ------
NM_003580chr81561 ------
NM_003583chr1223857 1049 23616 952 1382 --
NM_003590chr233794 920 899 13959 12547 1312
NM_003601chr41173 ------
NM_003603chr41347 ------
NM_003607chr153801 3455 3315 2705 1296 23737 178 11271 12938
NM_003612chr153540 509 494 141 ----
NM_003613chr15147 1689 ----
NM_003624chr1951288 1207 419 334 131 ----1967
NM_003626chr1131329 1215 983 1491 ----
NM_003629chr153486 2974 2280 622 147 ------
NM_003632chr173667 50 32 ------
NM_003633chr562377 2349 2143 1880 712 297 --11972 --
NM_003635chr101117 ------
NM_003644chr1771948 998 878 843 782 656 491 32100 1338 464 35243 4095 204 22643 155
NM_003654chr11--1129 ----
NM_003655chr171275 ------
NM_003676chr12672 162 --1922 --
NM_003677chr1262303 2212 1932 727 683 550 ------
NM_003682chr112822 249 131 2785 577 --
NM_003685chr191376 ------
NM_003707chr3160 ------
NM_003709chr21392 ------
NM_003713chr12406 262 ------
NM_003714chr552233 2049 1971 904 406 2838 808 12787 --
NM_003718chr71107 --1375 --
NM_003735chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_003736chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_003737chr114359 150 128 82 ------
NM_003746chr122191 91 157 ----
NM_003749chr1342429 579 519 80 --1453 --
NM_003758chr1511053 --1359 --
NM_003758chr1511053 --1359 --
NM_003759chr433928 3719 3228 ----11558
NM_003763chr2072718 2572 2413 2323 660 365 94 22759 2163 ----
NM_003778chr32616 190 ----1105
NM_003780chr12518 283 1252 160 --
NM_003787chr18199 1218 ----
NM_003800chr632107 237 155 12217 ----
NM_003818chr204425 327 208 170 ------
NM_003822chr143200 2803 2549 632 --2483 233 1596
NM_003825chr153508 456 323 --1143 --
NM_003861chr1422054 907 1541 ----
NM_003870chr153829 584 293 122 21770 54 11528
NM_003872chr272378 2214 2083 1961 603 474 173 12187 1685 --
NM_003873chr103888 562 26 11752 --11907
NM_003884chr311799 ------
NM_003885chr1741069 828 762 121 --11716 --
NM_003887chr231785 1718 554 2916 104 --1431
NM_003888chr1551652 1438 1200 72 31 11564 ----
NM_003893chr102484 106 --2374 56 --
NM_003895chr2121590 354 11888 1274 1806
NM_003896chr21675 1105 159 --
NM_003930chr73957 866 568 --182 --
NM_003931chr62673 259 ------
NM_003939chr10113890 3864 3727 3413 3393 3179 3111 1575 810 565 413 53922 3375 1122 521 182 ----
NM_003941chr722248 446 12191 ----
NM_003942chr111615 1680 ----
NM_003951chrX4314 277 36 27 ------
NM_003953chr162593 2369 2156 1047 853 842 21877 71 ----
NM_003954chr1771438 1415 1125 392 360 107 41 1535 11361 1953
NM_003958chr663699 2856 2735 2480 534 173 41194 969 618 558 13195 --
NM_003975chr11102 ------
NM_003983chr1663982 3558 2909 2816 1230 271 ------
NM_003987chr10122143 1773 1767 1420 922 875 810 709 326 237 126 38 32134 425 297 ----
NM_003988chr10112220 1850 1844 1497 952 887 786 403 314 203 115 32211 502 374 ----
NM_003992chr15268 54 ------
NM_003993chr11313 153 ----
NM_003994chr1232927 769 401 --11676 --
NM_004006chrX11991 --1901 --
NM_004007chrX11991 --1901 --
NM_004009chrX11991 --1901 --
NM_004010chrX11991 --1901 --
NM_004011chrX11991 --1901 --
NM_004012chrX11991 --1901 --
NM_004013chrX11991 --1901 --
NM_004014chrX11991 --1901 --
NM_004015chrX11991 --1901 --
NM_004016chrX11905 --1815 --
NM_004017chrX11991 --1901 --
NM_004018chrX11905 --1815 --
NM_004020chrX11991 --1901 --
NM_004021chrX11905 --1815 --
NM_004022chrX11905 --1815 --
NM_004023chrX11905 --1815 --
NM_004034chr101585 ------
NM_004035chr1785137 5052 4421 4081 3626 1964 1247 535 ------
NM_004036chr22681 127 --2462 231 125
NM_004045chr5------124
NM_004047chr1162 ------
NM_004050chr1411005 --21872 316 --
NM_004060chr521079 383 ------
NM_004064chr122834 462 ------
NM_004068chr33389 176 126 122 1315 --
NM_004071chr2183 ------
NM_004075chr121235 ------
NM_004077chr1221270 189 ------
NM_004079chr182890 2513 1897 1096 927 611 394 227 11942 ----
NM_004081chrY41506 1187 1172 1138 ----1661
NM_004087chr321673 1409 ------
NM_004089chrX4860 511 387 117 ------
NM_004090chr1762390 2261 2209 1310 1256 511 --42669 1096 487 143 --
NM_004093chr1353204 3158 2959 618 158 2761 626 11075 --
NM_004094chr1411023 ------
NM_004096chr104589 264 119 108 ------
NM_004098chr10------1435
NM_004100chr632498 2452 384 --1463 --
NM_004104chr175777 588 577 522 495 1114 ----
NM_004112chr1771566 1515 1400 549 321 113 73 --11283 11436
NM_004113chr32675 574 ------
NM_004114chrX172 ------
NM_004117chr631368 638 40 21413 269 2672 156 --
NM_004118chr20293 24 ------
NM_004119chr131526 ----1608
NM_004124chr1423549 2263 ------
NM_004134chr51543 ------
NM_004157chr32589 574 1882 ----
NM_004162chr321120 990 2319 81 ----
NM_004171chr11138817 8590 7987 7791 6719 6013 3544 2058 1677 1620 1389 1257 785 37727 6868 2006 28500 6353 13465
NM_004172chr521539 531 1659 --177
NM_004177chr1151427 689 588 243 175 ------
NM_004181chr41104 ------
NM_004185chr11170 ------
NM_004186chr34914 749 612 152 134 3603 306 270 --
NM_004187chrX51457 1424 502 200 186 ------
NM_004193chr101377 --1155 --
NM_004200chr1172993 2147 1233 1009 393 293 175 --1515 1191
NM_004225chr811336 ------
NM_004227chr772658 2061 2005 1169 791 717 64 --63059 3042 2649 2508 2445 944 --
NM_004229chrX21707 65 ------
NM_004232chr1823408 299 ----22664 2542
NM_004235chr91650 ------
NM_004236chr151185 1596 ----
NM_004241chr10----1171 --
NM_004263chr271647 1604 1460 1417 1375 1240 96 ------
NM_004267chr31181 ----179
NM_004269chr92105 21 ------
NM_004270chr52104 71 ------
NM_004272chr511541 ------
NM_004274chr1412749 12964 ----
NM_004276chr122386 376 ------
NM_004279chr71697 ----11547
NM_004280chr6193 ------
NM_004286chr22102837 2416 2364 2246 2113 1968 840 793 114 95 --12803 --
NM_004295chr172517 174 ------
NM_004296chr14134030 3821 3525 2942 2784 2614 2451 1517 969 908 758 667 473 2939 293 1231 --
NM_004302chr1252842 460 443 100 51 32522 1016 403 1855 12564
NM_004308chr11111696 1659 1471 1398 1372 1191 631 379 141 39 24 11581 21769 153 --
NM_004309chr177452 424 345 260 200 177 70 --1851 --
NM_004311chr1052690 2630 2061 904 873 2855 491 1105 --
NM_004316chr1241050 463 402 170 ------
NM_004321chr2143525 3253 3025 2923 2790 2537 2319 2300 1336 1022 515 352 83 23 138 1420 1103
NM_004329chr1021322 212 11083 --1452
NM_004337chr812189 --1328 22102 738
NM_004338chr18116303 5583 5559 5338 4586 2218 1807 1669 1469 1204 1155 34354 2102 1221 22505 2480 --
NM_004339chr2181900 1820 1658 1398 545 436 120 21 156 21488 162 --
NM_004341chr22254 227 ------
NM_004342chr731436 797 171 ------
NM_004346chr431304 966 260 ----11015
NM_004349chr831017 1011 846 1963 ----
NM_004350chr192193 1908 1839 1798 615 468 274 211 167 3765 625 231 12233 --
NM_004379chr251764 1597 1336 1297 389 --1650 --
NM_004380chr1642331 2288 2110 1627 ------
NM_004384chr51578 ------
NM_004385chr51538 2272 231 ----
NM_004387chr5----149 --
NM_004389chr2190 1555 ----
NM_004393chr362232 1863 1844 699 353 229 1803 12094 --
NM_004395chr54174 123 94 54 --169 --
NM_004397chr1123865 375 --1504 --
NM_004416chr1231051 965 123 182 1408 --
NM_004418chr21566 --186 --
NM_004420chr11152412 2392 2366 2358 2270 2217 2188 2107 2078 1981 830 549 538 35 21 2785 734 11568 --
NM_004421chr16640 321 187 161 146 22 ------
NM_004423chr3122661 1949 1787 1049 930 901 869 813 575 542 185 21 12098 ----
NM_004426chr1221702 301 41685 1224 327 27 11677 --
NM_004427chr16996 965 485 470 366 277 ----1877
NM_004429chrX61324 1230 1142 1074 452 36 --1298 --
NM_004430chr851706 900 855 261 126 ------
NM_004434chr143693 485 255 11317 ----
NM_004437chr173599 2937 2278 1417 1152 537 483 1301 ----
NM_004438chr242875 2135 1102 404 --1852 --
NM_004440chr611944 ------
NM_004441chr32513 298 ------
NM_004444chr74889 354 282 80 ------
NM_004448chr172617 187 ------
NM_004449chr211574 145 ----
NM_004450chr141275 ------
NM_004451chr114545 507 132 58 --1101 --
NM_004456chr7136 ------
NM_004459chr171472 ----1142
NM_004463chrX5499 487 402 255 71 187 ----
NM_004464chr42927 93 ------
NM_004468chr12557 84 ------
NM_004474chr1143 ------
NM_004475chr1761115 1091 804 484 40 31 ------
NM_004491chr19104218 3725 3144 3099 2756 2709 2655 1110 957 307 11339 31503 651 487 11008
NM_004496chr1431205 1128 33 ------
NM_004501chr133987 1156 373 --12673 --
NM_004503chr121156 1537 ----
NM_004519chr8----1156 --
NM_004528chr11105 ------
NM_004529chr92272 216 ----11448
NM_004530chr164282 113 106 93 --1407 --
NM_004535chr2031652 718 590 3640 276 31 31703 1145 700 --
NM_004549chr1171306 1214 1074 1056 553 407 298 ------
NM_004576chr51155 ------
NM_004580chr152407 198 1505 ----
NM_004586chrX74354 3549 1735 1568 1362 1227 633 13469 24014 606 --
NM_004588chr11113192 3050 2907 1373 1067 1051 871 714 482 257 21 1474 13638 --
NM_004593chr31244 ------
NM_004598chr51400 --22767 569 --
NM_004600chr141421 574 395 64 ------
NM_004602chr2051530 1250 1164 443 415 --1518 --
NM_004606chrX129 147 ----
NM_004614chr1661543 898 726 641 352 228 22065 1578 1443 11680
NM_004621chr1121305 424 1448 ----
NM_004622chr22407 178 --11575 --
NM_004631chr121008 40 11129 ----
NM_004634chr31405 ------
NM_004641chr102129 116 --11146 --
NM_004646chr191358 --170 --
NM_004654chrY1321 ----11345
NM_004656chr371225 1210 961 934 859 255 189 128 11091 --
NM_004663chr1511463 ------
NM_004673chr121479 51 --11015 --
NM_004675chr12614 24 ------
NM_004687chr1761562 1339 1311 759 499 267 11640 ----
NM_004698chr12163 50 ------
NM_004709chrX31512 1503 1494 1439 ----
NM_004711chr2283370 3193 1305 1249 745 508 102 60 22522 156 33352 2700 821 --
NM_004726chrX53907 3606 1946 1442 731 14475 ----
NM_004729chrX41894 1667 410 251 21994 43 ----
NM_004730chr542127 1924 1515 172 1210 ----
NM_004734chr1333231 893 22 12450 12210 --
NM_004736chr12736 382 ------
NM_004742chr331815 1686 68 --1178 --
NM_004745chr886033 5508 5038 4580 4287 1599 1589 497 14608 24374 1840 --
NM_004747chr1041385 996 388 60 ------
NM_004762chr1771558 1422 1307 750 697 562 266 11340 ----
NM_004768chr111128 --1106 --
NM_004772chr5----1344 --
NM_004774chr1732094 1924 1198 --1981 --
NM_004775chr184605 582 532 156 1125 ----
NM_004776chr2022823 50 ------
NM_004783chr161118 ------
NM_004786chr18----147 --
NM_004788chr1162506 2274 2180 1104 647 426 --11053 --
NM_004801chr2--1433 11071 --
NM_004805chr24566 529 217 201 11092 1881 1130
NM_004807chr262381 2242 2227 947 598 461 3770 531 200 31050 697 479 --
NM_004808chr1083157 2992 2581 2382 2152 2135 2063 964 --12748 12144
NM_004815chr154605 4556 4480 4128 1459 13439 --14222
NM_004822chr17173676 3119 3066 2834 2743 2495 1580 1427 1383 1293 1061 1031 946 535 506 344 164 12816 2626 576 13325
NM_004834chr252589 1128 906 314 109 11223 13346 --
NM_004836chr2146 --1263 --
NM_004840chrX31914 1848 373 11825 ----
NM_004841chr121009 71 ------
NM_004844chr31341 --21102 232 --
NM_004845chrX84099 3628 3080 3041 1583 546 426 177 2512 109 ----
NM_004846chr21164 ------
NM_004849chr621461 535 ------
NM_004850chr231760 1595 1453 ------
NM_004854chr221248 1202 ----1294
NM_004863chr14125131 4910 4742 4556 4499 4285 4212 4059 1601 966 686 394 34411 3592 243 149 15228
NM_004865chr61142 ------
NM_004879chr113617 268 53 ------
NM_004884chr1561199 1159 1141 505 176 155 ------
NM_004887chr53967 833 461 ------
NM_004891chr21254 --1230 --
NM_004896chr1011547 ------
NM_004898chr432854 2533 217 12617 --1437
NM_004902chr201789 ------
NM_004904chr7135967 5513 4867 4490 4430 4405 2331 1709 1126 1029 788 351 288 34892 1620 311 1486 --
NM_004926chr142485 37 ----1248
NM_004929chr81525 ------
NM_004930chr12167 116 --1485 --
NM_004932chr51126 1227 ----
NM_004935chr71197 ------
NM_004943chr1981151 1053 759 393 382 200 122 42 --1185 --
NM_004948chr1831443 1135 958 11232 ----
NM_004956chr723904 3574 ----11832
NM_004959chr971486 1187 976 596 294 123 68 --21495 1450 --
NM_004960chr16131 ------
NM_004961chrX41132 432 301 285 21007 416 --11280
NM_004962chr103227 197 182 ----1103
NM_004963chr12143 ------
NM_004965chr212627 595 ------
NM_004973chr611546 ------
NM_004974chr1------129
NM_004975chr202344 272 --2366 238 --
NM_004976chr11164987 4872 4054 3872 3766 3439 3297 3249 2015 2003 1701 1418 1293 585 555 237 13936 31568 828 383 14274
NM_004977chr194592 585 532 392 --1190 --
NM_004978chr171595 1537 1266 423 399 136 55 21077 448 ----
NM_004980chr1----1206 --
NM_004982chr122683 24 ------
NM_004992chrX288385 8169 7655 6841 6799 6689 6545 6492 6466 6404 5962 5918 3414 3369 3177 3136 2998 2973 1794 1500 1396 1350 1317 966 647 585 435 206 48097 6120 3266 2499 47969 5860 5273 426 --
NM_004992chrX288385 8169 7655 6841 6799 6689 6545 6492 6466 6404 5962 5918 3414 3369 3177 3136 2998 2973 1794 1500 1396 1350 1317 966 647 585 435 206 48097 6120 3266 2499 47969 5860 5273 426 --
NM_004995chr1471115 467 436 286 243 233 114 11328 ----
NM_004996chr1671556 1361 1231 668 637 327 152 1381 1268 --
NM_005011chr731470 1202 486 --11450 --
NM_005016chr12178 ------
NM_005023chr5----11422 --
NM_005026chr171721 1498 1314 634 470 458 181 11370 ----
NM_005028chr1042103 1821 705 169 ------
NM_005029chr101230 --152 --
NM_005032chrX2237 25 ------
NM_005044chrX84295 3664 3626 3186 3077 1491 1327 1045 --34217 4050 3656 --
NM_005053chr192492 196 2515 222 --1143
NM_005056chr1273409 2016 1625 1218 1203 799 463 1172 --11270
NM_005060chr161248 1095 985 866 220 117 2944 544 ----
NM_005065chr1454683 4298 3350 1892 1359 24584 540 24867 3307 --
NM_005069chr211106 --31556 396 320 --
NM_005080chr222612 106 ------
NM_005093chr20135074 4639 4584 4333 3931 3474 3427 1479 894 449 309 285 215 13887 44987 4870 4220 159 --
NM_005095chr1----1842 --
NM_005103chr113298 250 21 --1286 --
NM_005109chr3--41976 1951 548 304 1531 --
NM_005110chr53752 622 130 --1275 --
NM_005116chr2094077 3999 1757 1708 1692 1655 1417 297 264 ------
NM_005121chr1721384 721 11124 --11422
NM_005124chr6138 ------
NM_005126chr321971 1506 32318 2279 709 11632 --
NM_005134chr181745 --1394 --
NM_005135chr1563039 2852 2623 1328 572 424 170 ----
NM_005137chr2262305 1801 898 730 509 94 21013 692 1156 --
NM_005144chr861183 1135 1101 952 891 407 157 1317 --
NM_005151chr1832396 2197 1646 1547 ----
NM_005154chr151661 1511 ----
NM_005155chr62601 461 ------
NM_005156chr985152 4903 3977 1905 1890 1422 886 338 175 ----
NM_005161chr1141925 647 239 36 --1454 11971
NM_005165chr171265 --123 --
NM_005166chr19--177 ----
NM_005169chr111507 --168 --
NM_005180chr10170 --11626 --
NM_005184chr1971434 1061 1021 503 474 392 316 ------
NM_005187chr1691749 1630 1483 1406 1378 1362 1348 1299 54 --31997 1743 1527 --
NM_005190chr62709 399 ------
NM_005197chr14115863 5497 5168 5037 4423 3792 2409 1995 1696 1225 614 34589 4184 2139 ----
NM_005202chr191869 1433 1418 743 700 644 546 427 392 --2405 344 1257
NM_005206chr1731436 1319 1269 ------
NM_005207chr2283174 3118 2522 2423 1417 848 825 690 22726 2536 11105 --
NM_005216chr11510 ------
NM_005219chr571562 1276 343 328 231 165 26 ------
NM_005220chr1751447 1247 566 485 260 ------
NM_005224chr191133 ------
NM_005225chr204762 399 88 53 2910 222 11006 --
NM_005229chrX41001 416 216 187 11158 ----
NM_005230chr12----1476 --
NM_005233chr342290 1687 708 287 ------
NM_005235chr246341 5792 5387 254 --24833 2634 --
NM_005238chr1122629 50 ------
NM_005241chr31517 ------
NM_005254chr152473 80 ------
NM_005256chr111756 ------
NM_005259chr21112 ------
NM_005271chr103333 279 147 ----1820
NM_005274chr11141 ------
NM_005275chr61112 ------
NM_005276chr1241605 1159 522 190 11365 ----
NM_005276chr1241605 1159 522 190 11365 ----
NM_005277chr421885 223 ------
NM_005281chr16871 852 841 804 701 86 ----1233
NM_005295chr71289 ------
NM_005311chr7102219 2033 1985 1802 944 921 849 695 598 578 22553 434 1937 12341
NM_005312chr992590 2491 2322 2016 1874 613 216 128 51 --12085 --
NM_005324chr1721721 1378 --11298 --
NM_005327chr42537 239 ------
NM_005329chr1622038 896 1391 1170 --
NM_005339chr443514 3237 640 397 ------
NM_005347chr941572 1342 1329 133 ------
NM_005359chr1875296 4247 3973 2196 1707 1415 297 12149 ----
NM_005370chr1931133 306 129 135 21070 443 --
NM_005374chr17132348 2342 2184 2117 1820 724 670 610 603 586 534 506 97 31843 927 770 32246 2154 127 --
NM_005375chr621081 208 ------
NM_005376chr1186 ------
NM_005382chr81323 ------
NM_005384chr9--159 ----
NM_005385chr342137 642 594 72 --12439 --
NM_005388chr921296 520 ------
NM_005389chr62138 104 ------
NM_005392chr981588 1350 1260 597 414 383 328 242 --1283 --
NM_005399chr154181 4055 587 447 246 1713 ----
NM_005400chr252655 2428 1932 945 114 ------
NM_005402chr731688 1431 710 ------
NM_005406chr181374 1395 ----
NM_005407chr1431368 518 50 1360 1631 --
NM_005415chr2----2743 200 --
NM_005418chr113626 529 66 1128 ----
NM_005426chr12380 336 ------
NM_005433chr1832499 686 500 --12566 --
NM_005436chr1033505 1426 164 ------
NM_005437chr1051501 1363 1245 1219 25 1585 ----
NM_005455chr13593 526 247 ------
NM_005458chr951612 765 529 458 382 --1572 --
NM_005460chr52558 461 ------
NM_005461chr205539 383 105 99 38 ------
NM_005465chr131699 742 73 --11802 --
NM_005474chr1771477 1181 429 218 172 152 111 21076 292 ----
NM_005475chr12102790 2727 2613 2332 2269 750 707 681 276 29 32574 2002 449 12736 22432 1141
NM_005477chr1592337 2302 1784 828 822 752 616 383 372 11876 ----
NM_005477chr1592337 2302 1784 828 822 752 616 383 372 11876 ----
NM_005479chr1051175 1037 328 309 29 1482 --11127
NM_005483chr191369 ------
NM_005487chr2221923 348 21643 1544 ----
NM_005493chr6164 ------
NM_005494chr7------1135
NM_005497chr17166084 6025 5939 5628 5554 5378 4991 4812 4798 4590 4473 4308 1871 1728 1689 1291 31916 1681 54 24947 4774 14070
NM_005501chr1771118 1112 1000 835 464 421 309 --11206 180
NM_005505chr123110 62 54 1694 2118 102 --
NM_005509chr511730 ------
NM_005522chr7198 1883 31279 1052 375 128
NM_005529chr14407 346 172 44 1950 ----
NM_005539chr104974 169 148 125 --1255 --
NM_005540chr151447 1152 1040 383 46 162 ----
NM_005546chr592388 942 928 546 291 185 167 131 112 193 ----
NM_005554chr12----132 --
NM_005557chr17----125 --
NM_005570chr1841202 1158 470 237 1849 ----
NM_005575chr51615 ------
NM_005578chr324700 3175 23354 668 ----
NM_005584chr13------1287
NM_005595chr1----1915 --
NM_005596chr985701 4363 3883 1100 931 673 661 337 16364 ----
NM_005603chr1841658 1462 586 458 2727 294 ----
NM_005604chr642169 2081 663 69 ------
NM_005607chr81844 --1108 --
NM_005610chr1--1138 ----
NM_005611chr1631079 519 49 --1107 --
NM_005614chr71414 --1819 --
NM_005626chr11472 ------
NM_005631chr751073 976 944 769 257 1377 ----
NM_005632chr1661040 999 721 342 270 253 1129 1189 --
NM_005634chrX2568 520 --1290 --
NM_005637chr1841735 318 150 41 21688 1353 11988 --
NM_005638chrX--1577 ----
NM_005639chr1221229 665 11745 ----
NM_005647chrX133290 2703 2616 2385 2235 1302 1228 1152 759 723 274 251 68 --12829 --
NM_005652chr162796 202 --154 --
NM_005660chrX2203 193 1181 ----
NM_005665chr13748 612 154 1793 13985 --
NM_005667chr2144 ------
NM_005668chr533381 1842 774 23462 727 ----
NM_005669chr522299 2192 ------
NM_005677chr341395 1033 531 456 ----1570
NM_005688chr341087 1044 893 326 ------
NM_005708chr132476 405 ------
NM_005711chr511036 ------
NM_005715chr642100 826 593 261 22727 1898 2790 305 --
NM_005718chr31225 ------
NM_005721chr221043 817 ------
NM_005722chr222457 1783 --21713 819 --
NM_005730chr1252605 1124 1041 148 25 22440 1222 2842 107 --
NM_005736chr1021351 636 21547 1326 11568 --
NM_005737chr232912 770 338 22042 243 12579 --
NM_005738chr721371 473 ------
NM_005739chr151544 ----22064 1960
NM_005740chr226609 590 583 573 317 67 ------
NM_005742chr21710 ------
NM_005746chr72421 91 ------
NM_005748chr1243445 2975 2749 1053 --11101 --
NM_005751chr71114 ------
NM_005754chr531153 316 24 --21073 68 --
NM_005759chr2104233 3906 3219 3153 3048 1465 1423 1294 1007 439 ------
NM_005761chr121153 ------
NM_005766chr134457 199 141 125 ------
NM_005779chr563517 3484 2426 1119 976 739 --1118 153
NM_005792chr162457 214 ------
NM_005795chr232275 2116 168 ------
NM_005801chr172324 95 ------
NM_005803chr6128 ------
NM_005808chr332277 1137 74 22799 355 13192 11362
NM_005811chr12154 ------
NM_005822chr661826 727 448 349 343 27 1588 --1261
NM_005828chr1795033 4373 4361 4096 3902 3595 3585 3525 3207 33860 808 210 ----
NM_005834chrX3233 199 85 ------
NM_005839chr11203 ------
NM_005840chrX25762 2618 27311 227 ----
NM_005852chr175815 396 367 146 82 158 ----
NM_005857chr121381 65 ------
NM_005868chr71202 ------
NM_005871chr10----1759 --
NM_005872chr11205 ------
NM_005884chr197774 767 671 588 527 286 95 --1621 --
NM_005885chr51426 ------
NM_005896chr21338 1238 1150 --
NM_005898chr1162776 1997 1169 634 476 376 ------
NM_005901chr1848453 6929 5436 640 --38663 5963 5654 --
NM_005902chr15104451 4127 3896 3562 1748 1438 452 328 295 188 1498 14231 21636 348
NM_005904chr183972 571 457 ------
NM_005907chr6----21217 500 --
NM_005909chr554026 3548 2987 2672 1181 13761 ----
NM_005910chr1793949 3498 2683 2596 1347 1236 1131 748 80 13102 23742 1623 --
NM_005911chr241003 596 406 108 --1429 --
NM_005920chr173280 3162 2509 1535 894 692 27 --11420 11327
NM_005933chr1172946 2848 2755 2040 2019 1032 107 12186 ----
NM_005934chr19112507 2012 1732 1048 880 403 362 322 310 273 52 11951 2133 113 --
NM_005937chr17113501 3033 2726 2569 1370 904 843 610 604 469 244 24044 3866 13055 --
NM_005941chr882670 1302 1103 724 642 530 218 108 --1691 --
NM_005943chr641354 1282 1253 489 3439 249 167 11444 21473 1103
NM_005955chr175021 4287 3798 1960 1807 1563 605 14844 24597 1072 --
NM_005957chr1174902 3465 3306 3265 3035 1774 1677 1539 1500 1361 1241 1069 986 559 351 337 184 1806 23868 3490 --
NM_005962chr1021574 494 2743 629 1756 --
NM_005962chr1021574 494 2743 629 1756 --
NM_005964chr17--1136 ----
NM_005966chr242290 1925 174 118 1102 ----
NM_005977chr131794 ------
NM_005990chr542052 2008 473 122 21745 112 ----
NM_005996chr1221239 98 134 1165 --
NM_006007chr984489 4319 4245 4219 3744 3046 1314 805 13697 1189 --
NM_006015chr131061 979 360 ------
NM_006016chr621607 509 --12052 --
NM_006022chr13185 ------
NM_006029chr14142 ------
NM_006030chr331266 529 495 --11220 --
NM_006037chr264207 3539 875 445 205 136 ------
NM_006038chr2021553 23 21796 640 12066 1631
NM_006039chr173807 438 431 2991 327 1966 --
NM_006047chr2033202 3160 1167 --1555 --
NM_006051chr5180 ------
NM_006076chr783036 2455 2265 2178 2126 828 664 290 22254 2111 32244 414 305 12692
NM_006095chr464268 4204 3800 3682 3592 1223 13386 ----
NM_006109chr142307 252 --1366 --
NM_006113chr142085 1794 497 135 --1219 --
NM_006121chr122145 90 --1330 --
NM_006133chr11102316 2206 2031 1664 1566 925 625 478 280 256 22098 1806 ----
NM_006135chr121049 459 ------
NM_006136chr71991 ------
NM_006141chr1642703 2434 1809 782 --12256 --
NM_006145chr193969 289 256 11064 1842 --
NM_006154chr1522604 2474 --12554 --
NM_006156chr142204 81 ------
NM_006157chr111375 ------
NM_006164chr21115 ------
NM_006166chr1222284 2121 ------
NM_006185chr11195 1539 1525 --
NM_006186chr22136 83 1103 ----
NM_006190chr221047 166 ------
NM_006191chr121169 ------
NM_006195chr9199 187 1249 --
NM_006201chrX71070 1056 831 344 322 282 63 3938 873 368 ----
NM_006202chr1951379 742 575 569 512 ------
NM_006203chr5105546 4989 4326 4215 4153 2199 1946 1630 1469 1244 2312 145 15453 14512
NM_006209chr8125 ------
NM_006210chr191178 ------
NM_006224chr1762197 2021 1950 544 98 61 12041 22393 2271 --
NM_006228chr8185 --1280 --
NM_006237chr1321929 797 ------
NM_006238chr6101890 1775 1752 1572 1497 739 588 191 148 84 21434 1327 21968 1466 --
NM_006243chr12768 157 1692 ----
NM_006245chr62699 286 --141 133
NM_006246chr1421098 953 ------
NM_006251chr531310 469 57 ------
NM_006252chr1137556 7102 5637 5548 5506 5178 5172 5113 2390 2255 2171 1819 628 22308 945 26918 877 12768
NM_006256chr111912 --12688 --
NM_006258chr10257 40 ------
NM_006264chr41180 ------
NM_006265chr81589 ------
NM_006268chr116887 784 483 291 165 132 2949 347 --11077
NM_006275chr2022166 2145 --11951 --
NM_006277chr21238 ----134
NM_006282chr2094283 3839 3151 1807 1255 1019 606 161 29 1860 14074 --
NM_006283chr864596 4233 3169 1620 1224 689 34553 3435 3117 23319 168 --
NM_006288chr1131172 1121 973 --21007 879 --
NM_006289chr93344 326 146 2295 34 1335 --
NM_006293chr155953 405 337 239 197 2645 85 1882 --
NM_006306chrX65745 4971 4330 3777 3697 1361 11273 14053 --
NM_006310chr172934 69 ------
NM_006313chr121211 ------
NM_006315chr4144229 4125 3748 3739 3178 3039 1226 1177 1155 1110 686 600 250 202 34205 1525 764 ----
NM_006320chr411005 ------
NM_006323chr4--1756 ----
NM_006328chr111508 1451 1573 --
NM_006334chr9--146 ----
NM_006335chr12102 74 ------
NM_006336chr9101442 1375 1357 1208 1009 1001 611 493 367 299 169 1985 --
NM_006341chr11210 ------
NM_006350chr52377 316 --1242 --
NM_006351chr192117 25 ------
NM_006352chr111616 11436 ----
NM_006357chr2170 ------
NM_006359chrX42393 2124 1631 975 ------
NM_006367chr11129 2245 228 1344 1326
NM_006369chr1121 ------
NM_006373chr1771416 1337 988 880 467 311 87 21148 403 ----
NM_006378chr961330 1080 954 366 137 113 ------
NM_006379chr71415 ------
NM_006380chr1733557 1662 959 31376 731 117 ----
NM_006387chr1951034 446 429 416 228 1767 --2873 92
NM_006389chr1131171 556 222 ----1163
NM_006393chr1083216 3150 1546 1397 1018 704 505 404 33002 1439 884 14264 --
NM_006400chr122318 60 ------
NM_006421chr81161 1238 ----
NM_006424chr461888 1371 1220 496 469 132 --31545 1472 1297 --
NM_006434chr1083011 2889 2357 2308 605 432 348 259 1419 --12749
NM_006440chr22147 ------
NM_006454chr4102813 2621 2605 2138 1949 994 915 257 83 54 52551 2252 2236 610 468 1781 --
NM_006458chr111295 ----1312
NM_006459chr1051912 1228 475 469 198 ------
NM_006471chr182215 86 ------
NM_006472chr131257 987 87 ------
NM_006482chr1223857 1049 23616 952 1382 --
NM_006489chr1421601 778 ------
NM_006494chr19190 ------
NM_006500chr112871 47 1200 11005 --
NM_006516chr13272 39 21 ----11466
NM_006517chrX62255 1460 744 705 566 35 21772 722 --21440 892
NM_006526chr2021662 832 1476 11940 --
NM_006527chr4--1114 133 --
NM_006529chr41655 11420 ----
NM_006532chr19111672 1627 1401 672 581 341 268 253 200 177 129 11708 ----
NM_006538chr253588 651 633 405 98 11101 13546 11190
NM_006539chr161134 --138 --
NM_006540chr851498 588 416 220 198 ------
NM_006544chr1462292 1247 899 147 108 66 ------
NM_006546chr17115882 5873 5611 5508 4769 4732 2666 1372 462 373 177 11030 25277 4488 --
NM_006547chr711524 ------
NM_006548chr341472 1440 77 42 ----11458
NM_006557chr921552 22 21156 686 1679 --
NM_006558chr8243 28 ------
NM_006561chr10135722 5222 5167 5161 5042 4973 4628 4119 4066 3868 2248 2016 1871 15704 32301 2190 2005 14377
NM_006599chr1698272 5921 5647 5601 5240 2585 1665 626 482 16203 ----
NM_006603chrX11761 ------
NM_006609chr242845 1924 976 838 ------
NM_006614chr362516 1365 1205 987 508 384 ------
NM_006618chr121497 105 --11033 11367
NM_006621chr111778 2249 27 1595 --
NM_006622chr5------1515
NM_006624chr1021548 110 ------
NM_006626chr922599 954 ------
NM_006628chr1544401 3551 607 109 ----11374
NM_006629chr1841925 932 497 329 ------
NM_006650chr5123868 3652 3599 3490 3442 3426 2566 2529 598 368 227 151 33403 576 22 23499 3454 --
NM_006651chr491524 1350 1245 597 374 305 189 90 21 --1115 --
NM_006653chr6146 ------
NM_006654chr1221284 550 ------
NM_006660chr15271 31 ------
NM_006667chrX1893 ----158
NM_006690chr2072342 2291 782 424 219 125 74 22174 2126 1344 --
NM_006698chr2031460 419 93 11373 ----
NM_006700chr124817 701 257 215 ------
NM_006709chr6--179 --145
NM_006711chr163722 626 606 149 ----
NM_006722chr353061 2265 2088 1124 1098 --12886 1134
NM_006726chr411130 ------
NM_006729chrX64550 4242 4062 3708 3413 1896 35105 4699 1540 11693 --
NM_006734chr631226 1048 448 --1462 --
NM_006746chrX2503 345 --11516 --
NM_006749chr83988 120 27 ------
NM_006754chr71811 ------
NM_006763chr142111 1901 1702 1614 ------
NM_006764chr32446 193 ------
NM_006766chr862099 1807 1029 946 839 387 ------
NM_006769chr11113 ------
NM_006772chr651711 1668 1317 1230 1083 ------
NM_006775chr652759 2654 2022 1206 570 ------
NM_006777chrX2561 349 1229 ----
NM_006788chr1862061 1953 1654 661 614 588 21793 677 ----
NM_006795chr1171456 1362 1274 1081 1002 291 278 21213 1146 ----
NM_006800chrX1589 ------
NM_006802chr121105 758 2843 36 ----
NM_006803chr8296 79 ------
NM_006805chr531442 236 210 --21329 1274 156
NM_006807chr17--1146 1354 --
NM_006811chr204882 860 844 255 ------
NM_006813chr63911 368 142 ------
NM_006814chr2072697 2452 2038 258 237 177 137 ------
NM_006819chr111342 ------
NM_006827chr1472780 2736 2601 2553 1332 771 765 ------
NM_006836chr121136 1250 1494 --
NM_006852chr1742702 929 244 192 ------
NM_006856chr1231100 253 201 ------
NM_006861chr12121908 1650 1296 726 594 562 511 457 357 192 80 49 21866 394 ----
NM_006870chr201600 --1154 --
NM_006874chr4--1271 ----
NM_006885chr1613251 1409 23947 967 --
NM_006888chr1423539 342 12475 --1983
NM_006892chr20--1227 1365 --
NM_006892chr20--1227 1365 --
NM_006896chr761107 358 281 179 138 36 11144 --1717
NM_006897chr12131 1473 1630 --
NM_006898chr21623 --1750 --
NM_006902chr142285 743 506 150 22395 460 159 --
NM_006904chr83926 906 325 ------
NM_006906chr115619 135 115 53 41 1727 ----
NM_006908chr71238 1566 1471 --
NM_006915chrX32269 1962 1827 ------
NM_006920chr231346 1299 704 --145 --
NM_006924chr1724402 3618 13897 12906 --
NM_006925chr141486 ------
NM_006927chr1672024 1848 752 542 470 381 56 3796 100 30 ----
NM_006931chr12--11453 21548 444 --
NM_006940chr121159 11549 ----
NM_006941chr2271131 1055 873 842 799 48 35 ------
NM_006943chr2093137 3024 2558 2369 1050 388 256 246 109 22146 187 1755 1826
NM_006946chr114572 467 173 60 ----1612
NM_006981chr932115 396 116 ------
NM_006990chr162497 2473 2450 1970 1540 438 12042 22418 356 1736
NM_006991chr33908 393 227 ------
NM_007006chr16153 ------
NM_007007chr1223233 40 --34380 4370 1004 --
NM_007011chr15236158 6054 5959 5633 5467 4937 4858 4643 4620 4296 4220 2345 2303 2215 2015 1977 1870 1800 1351 788 631 159 31 14571 22248 461 --
NM_007017chr52105 99 --1177 --
NM_007023chr21313 140 ----
NM_007024chr32548 511 1227 1505 --
NM_007030chr5144311 4281 3438 3258 3203 1788 1359 1329 1267 1261 1138 1047 886 631 34486 4263 988 25150 1509 1951
NM_007032chr22102735 2540 2419 2227 1981 1814 1094 957 731 481 --22270 630 --
NM_007034chr11835 ------
NM_007039chr14147 11744 ----
NM_007042chr362281 1907 970 466 400 174 ------
NM_007043chr12----12027 1364
NM_007050chr20157772 7337 7295 7247 5659 5618 5223 4983 2829 1906 1864 1679 1178 624 239 57542 5176 3121 2803 2165 21815 1367 --
NM_007067chr1711433 21227 1009 ----
NM_007081chr224979 804 440 66 ------
NM_007096chr9167 ------
NM_007106chr1321824 97 ------
NM_007118chr51788 ------
NM_007125chrY1274 ----21102 538
NM_007126chr91137 --1101 --
NM_007135chr91157 1124 ----
NM_007144chr17194 --1946 --
NM_007146chr1742728 2603 2210 581 ----12178
NM_007153chr19104279 3769 3088 3034 2966 1603 1489 805 368 30 ------
NM_007156chrX147 ------
NM_007159chr32639 125 ------
NM_007166chr111451 ------
NM_007170chr12816 206 --174 --
NM_007174chr1252189 1709 812 738 577 --1550 --
NM_007175chr831117 809 484 1378 12652 11323
NM_007178chr12167 ------
NM_007182chr31740 ------
NM_007189chr771512 1354 1212 254 173 125 49 2402 312 ----
NM_007191chr12144 --1659 --
NM_007195chr1852811 1466 1282 397 317 11235 12364 --
NM_007197chr122719 279 ------
NM_007203chr953227 2865 2671 494 334 1404 12425 --
NM_007209chr9127 ------
NM_007212chr132142 1456 41 ------
NM_007213chrX6569 549 254 219 186 157 153 ----
NM_007214chr61340 --1493 --
NM_007216chr112884 253 1941 ----
NM_007217chr3194 ------
NM_007221chr12314 278 2383 111 ----
NM_007222chr811421 1350 --1580
NM_007235chr121433 ------
NM_007245chr165603 587 186 161 87 --1335 --
NM_007249chr1397605 3178 2515 2304 2131 1518 1254 577 555 --17159 --
NM_007270chr731489 511 492 1576 --11333
NM_007271chr681651 1281 571 551 479 470 318 218 ------
NM_007275chr32400 351 ------
NM_007276chr71278 ------
NM_007278chr171148 ------
NM_007282chr34795 352 250 226 ------
NM_007283chr3153104 2800 2747 2581 2420 1989 1973 1955 1144 973 554 535 486 423 309 1628 --12675
NM_007285chr16154 ------
NM_007286chr552093 1963 787 168 93 2845 674 ----
NM_007292chr1785137 5052 4421 4081 3626 1964 1247 535 ------
NM_007294chr1761283 1181 986 306 138 96 ------
NM_007295chr1761283 1181 986 306 138 96 ------
NM_007296chr1761283 1181 986 306 138 96 ------
NM_007297chr1761283 1181 986 306 138 96 ------
NM_007298chr1761283 1181 986 306 138 96 ------
NM_007299chr1761283 1181 986 306 138 96 ------
NM_007300chr1761283 1181 986 306 138 96 ------
NM_007302chr1761283 1181 986 306 138 96 ------
NM_007303chr1761283 1181 986 306 138 96 ------
NM_007304chr1761283 1181 986 306 138 96 ------
NM_007305chr1761283 1181 986 306 138 96 ------
NM_007308chr41678 ------
NM_007320chr192334 131 ------
NM_007326chr225650 322 254 105 23 2684 631 ----
NM_007327chr9101134 1124 1064 837 739 473 349 187 124 69 2939 75 ----
NM_007331chr432553 700 300 --12138 --
NM_007350chr1234456 3802 97 ------
NM_007353chr7113028 2150 1911 1133 1053 733 668 530 523 274 37 ------
NM_007358chr111531 ------
NM_007363chrX1876 ------
NM_007373chr103649 485 148 --11841 --
NM_012064chr122853 64 ------
NM_012069chrX82073 1938 1932 561 324 313 118 97 --11077 --
NM_012081chr513473 13335 ----
NM_012082chr82807 682 160 --1157
NM_012083chr1041105 913 321 95 ------
NM_012090chr121071 967 ------
NM_012095chr1083248 3083 2660 2370 2257 2217 983 385 --12926 --
NM_012097chr211512 11876 ----
NM_012098chr911325 --1214 --
NM_012099chr1941151 1131 804 107 --1218 --
NM_012102chr1----2558 217 --
NM_012104chr1193220 2829 2702 1368 1128 1049 753 668 287 ------
NM_012104chr1193220 2829 2702 1368 1128 1049 753 668 287 ------
NM_012120chr621170 872 --1904 --
NM_012124chr11--1268 ----
NM_012129chr742156 2116 1930 1608 ------
NM_012134chr151898 1739 1726 1235 366 ------
NM_012137chr11506 --22867 1091 --
NM_012141chr1313756 ------
NM_012154chr83731 92 79 ------
NM_012158chr1321432 277 ------
NM_012164chr9136669 6369 6293 5935 2323 2096 1765 1362 1171 819 693 390 74 24803 4656 15792 --
NM_012193chr1164175 3851 3782 3775 1511 1234 --35219 4043 2173 11428
NM_012199chr184495 4389 3724 2870 1472 691 364 341 24570 3476 --14355
NM_012215chr1021654 83 ------
NM_012229chr1021244 1076 ------
NM_012234chr373511 3458 2604 1329 1239 1016 760 --1594 --
NM_012238chr1031628 1110 396 ------
NM_012244chr1441304 712 687 188 --1621 --
NM_012247chr1011020 ------
NM_012249chr233446 354 65 ------
NM_012250chr112449 29 --11346 --
NM_012257chr73985 911 732 1665 ----
NM_012259chr61203 ------
NM_012262chr153901 3852 1238 74 67 ----14232
NM_012264chr2291683 1600 835 354 345 213 167 67 38 --1746 1740
NM_012264chr2291683 1600 835 354 345 213 167 67 38 --1746 1740
NM_012286chrX------1442
NM_012287chr351475 1351 1312 660 55 21530 1304 --14392
NM_012288chr6175315 5060 4623 4390 4364 3754 2209 1607 1444 1357 1056 983 873 735 603 424 114 24754 4053 24976 2135 --
NM_012289chr19------134
NM_012290chr221580 1104 ------
NM_012293chr262211 2141 912 729 706 387 ------
NM_012294chr773460 3339 3272 2819 2641 1081 969 1288 12778 11314
NM_012296chr11163523 3244 3160 3033 2686 2648 2530 2504 2420 1394 876 854 665 427 287 121 43396 3354 1477 1461 1382 --
NM_012297chr41980 --196 --
NM_012300chr542395 2354 1957 90 1143 11638 --
NM_012301chr732076 1953 1527 ------
NM_012304chr552097 1626 612 601 582 --1101 22407 695
NM_012306chr12142881 2585 2528 2364 2330 2192 1373 1308 1224 1213 980 947 495 109 21140 138 13447 11103
NM_012307chr181999 1125 --11047
NM_012309chr11124984 4583 4136 4102 3542 1759 1480 1359 1223 450 410 266 11567 21636 1122 --
NM_012316chr1135506 5176 5012 4697 4485 4188 4004 3886 3665 2067 1852 1359 59 ------
NM_012325chr2011348 --11104 11282
NM_012326chr24802 714 319 32 ------
NM_012333chr141443 1212 368 232 ------
NM_012334chr5143435 3403 3089 3076 3051 3035 1710 1593 1554 910 686 525 288 203 1873 --13043
NM_012343chr5----1273 --
NM_012384chr2061743 1707 1581 922 874 857 11722 11820 --
NM_012399chr2241796 1373 481 77 --11504 --
NM_012402chr1151390 1264 363 253 51 ------
NM_012405chr153493 2761 2661 766 46 13736 ----
NM_012408chr20189 1746 ----
NM_012425chr1042439 2273 2186 519 ------
NM_012428chr15------1635
NM_012433chr2133 ------
NM_012448chr1772514 2267 2222 1971 1714 907 841 --1934 --
NM_012460chr14145 ------
NM_012461chr142665 284 --1187 --
NM_012463chr1281731 1452 1383 1267 1209 610 408 121 ------
NM_012464chr422828 278 ------
NM_012465chr1052525 2202 452 337 134 ------
NM_012471chrX31246 425 144 11464 ----
NM_012473chr223134 72 58 1296 ----
NM_012479chr752653 935 685 610 216 ------
NM_012482chr11665 ----1274
NM_013233chr231276 1146 247 ------
NM_013246chr116845 822 759 330 152 63 ------
NM_013253chr115919 549 289 190 161 ------
NM_013261chr493763 3494 2888 2597 1169 1150 624 602 195 12991 ----
NM_013269chr1233522 3516 762 2721 655 ----
NM_013272chr151291 ------
NM_013279chr1192281 1736 1531 939 729 660 649 448 103 --11794 --
NM_013282chr192491 387 11146 ----
NM_013296chr1197 ------
NM_013305chr184880 593 187 131 ------
NM_013309chr1542327 2170 144 100 12279 ----
NM_013312chr19124 156 ----
NM_013313chr2293537 2642 2621 2567 2318 1181 774 611 445 1909 21235 88 --
NM_013316chr71793 165 178 --
NM_013335chr2268 27 ------
NM_013336chr361848 1632 1415 1374 730 324 11738 11444 --
NM_013341chr252401 2216 1109 423 204 ------
NM_013372chr1543381 2236 207 41 11061 ----
NM_013382chr1482008 1968 717 707 355 194 135 23 --11617 --
NM_013390chr931449 474 345 1533 11230 --
NM_013396chr2141545 1506 349 314 ------
NM_013409chr5132 ------
NM_013410chr131179 310 291 1431 ----
NM_013423chrX31007 301 201 152 ----
NM_013427chrX31007 301 201 152 ----
NM_013434chr2121995 1951 1765 1558 1499 1244 775 431 244 160 72 31 21505 1326 11634 11869
NM_013434chr2121995 1951 1765 1558 1499 1244 775 431 244 160 72 31 21505 1326 11634 11869
NM_013438chr921582 1285 ------
NM_013449chr1262121 1023 825 768 526 451 ------
NM_013450chr21825 ------
NM_013951chr2102445 2028 1629 1613 975 740 510 322 283 48 2896 446 52452 1965 1531 865 459 --
NM_013952chr2102522 2105 1706 1690 817 587 399 360 125 62 2973 523 52529 2042 1608 942 536 --
NM_013953chr2102522 2105 1706 1690 817 587 399 360 125 62 2973 523 52529 2042 1608 942 536 --
NM_013958chr8------1328
NM_013959chr8------1328
NM_013960chr84544 300 252 162 --1288 --
NM_013961chr8------1328
NM_013962chr8------1328
NM_013992chr2102522 2105 1706 1690 817 587 399 360 125 62 2973 523 52529 2042 1608 942 536 --
NM_014002chr13671 517 185 1109 1474 --
NM_014007chr92194 142 --1896 --
NM_014016chr331570 1442 534 187 ----
NM_014023chr1072209 2140 2023 1144 1081 1019 363 ------
NM_014028chr623092 2160 12663 ----
NM_014045chr142399 81 ------
NM_014048chr1674723 4342 3514 1502 535 468 142 13914 23465 399 1818
NM_014057chr911479 ------
NM_014079chr33747 293 21 1113 ----
NM_014106chr152686 181 12135 1410 --
NM_014112chr845042 4341 4030 638 --23756 3673 --
NM_014154chr321521 473 ------
NM_014155chr1196910 6617 6155 4861 2206 1364 919 657 196 16623 16709 --
NM_014181chr232788 2144 1855 --11030 12276
NM_014191chr126964 756 738 332 152 92 ------
NM_014217chr12448 30 --11203 --
NM_014220chr31112 ------
NM_014231chr1241891 1809 705 223 31362 441 109 11677 --
NM_014232chr1741250 302 145 87 --11453 --
NM_014232chr1741250 302 145 87 --11453 --
NM_014233chr1751653 264 206 190 25 1374 ----
NM_014240chr373760 3597 3375 3336 3085 2584 949 23328 1539 --1384
NM_014246chr2281781 1702 749 702 410 400 353 116 ----12179
NM_014250chr2221923 348 21643 1544 ----
NM_014253chrX42466 661 442 248 ------
NM_014263chr1051308 1066 945 574 479 --1248 --
NM_014271chrX--154 ----
NM_014275chr55815 614 589 213 35 1705 194 --
NM_014283chr12520 58 ------
NM_014288chr11111 ------
NM_014289chrX2923 469 11058 1220 --
NM_014292chr2271674 1607 1400 1286 1182 601 86 1234 31280 665 402 --
NM_014294chr8195 ------
NM_014299chr1981942 1905 1755 1743 1664 1543 1381 261 1460 ----
NM_014309chr22105410 5176 4980 3958 3552 1647 1244 980 835 653 34876 4662 2010 2644 23 --
NM_014316chr1661897 1834 1592 838 760 414 11641 22013 772 21884 195
NM_014319chr1231334 781 397 11314 ----
NM_014323chr222972 273 ------
NM_014326chr1531378 379 345 2539 80 ----
NM_014333chr1122064 532 ------
NM_014351chr2261008 979 473 225 200 43 ------
NM_014368chr971982 1724 1637 1471 1422 347 43 21593 1331 1260 11687
NM_014372chr122120 1397 ------
NM_014382chr31163 1510 ----
NM_014390chr74538 399 43 28 1484 ----
NM_014405chr17102135 2034 1923 1866 1809 1629 1528 589 113 30 --1582 11512
NM_014408chr12203 25 ------
NM_014417chr195856 754 160 150 120 1167 ----
NM_014423chr522199 1094 14473 ----
NM_014445chr31596 ----1519
NM_014447chr42519 126 ------
NM_014454chr62912 847 ------
NM_014458chr1172 --1959 --
NM_014470chr122724 327 ----1552
NM_014488chr111456 ------
NM_014491chr76974 888 870 817 804 150 --1126 --
NM_014494chr163654 102 79 1669 12063 --
NM_014507chr2241215 926 838 752 ------
NM_014520chr172465 26 --1170 --
NM_014554chr127689 308 298 91 80 61 45 ------
NM_014563chrX41403 699 368 86 11448 12020 --
NM_014567chr162108 51 ------
NM_014569chr741242 1034 334 139 --11307 --
NM_014574chr1411472 ------
NM_014592chr5125 ------
NM_014601chr1991304 1272 644 475 456 417 320 218 41 --11462 --
NM_014603chr17101617 1601 1531 1311 1244 631 280 271 224 21 2212 167 ----
NM_014614chr221316 160 ------
NM_014615chr1642309 1240 778 693 --1334 --
NM_014630chr1583760 3448 3221 3098 2657 840 414 164 --2470 200 --
NM_014634chr22153393 3117 3111 3089 2638 2391 1372 955 596 568 501 430 308 259 156 12734 33280 2676 1441 --
NM_014636chr9124230 3835 3799 3187 1381 922 776 385 188 134 115 73 1303 23419 609 --
NM_014637chr81478 ------
NM_014646chr1832889 598 91 33101 1100 184 32827 2799 2031 --
NM_014657chr201279 --1273 --
NM_014659chr152396 226 1107 ----
NM_014660chr72799 118 ----122
NM_014661chr10133844 2617 2569 2379 1233 1121 914 900 818 464 266 228 201 1256 32979 2751 48 12688
NM_014665chr8163524 3433 3323 3097 3075 2994 2906 2522 2491 2329 2291 1047 997 694 671 645 22765 2379 12737 --
NM_014666chr51850 ------
NM_014667chr342084 2026 643 60 --1929 --
NM_014676chr121325 1050 ----11176
NM_014682chr8----1673 --
NM_014683chr1721546 63 ----1483
NM_014686chr1941691 307 160 96 --1328 --
NM_014690chr773044 2607 1162 1132 810 129 85 1468 21155 721 12157
NM_014705chr71103 12102 ----
NM_014711chr1611750 ------
NM_014712chr164439 251 156 74 ------
NM_014718chr125599 592 577 183 123 2727 708 ----
NM_014719chr721122 1007 1839 ----
NM_014725chrX41132 541 376 80 --2882 328 --
NM_014726chr1741165 903 875 176 1511 ----
NM_014727chr19183 ------
NM_014729chr832214 839 72 ------
NM_014730chr12115093 5026 4907 4487 1401 1027 948 841 232 201 165 14168 11922 --
NM_014730chr12115093 5026 4907 4487 1401 1027 948 841 232 201 165 14168 11922 --
NM_014731chr2051438 1427 1323 570 339 1191 11530 --
NM_014733chr531683 1638 1458 11964 ----
NM_014735chrX22106 236 ----11376
NM_014736chr151986 1690 ----
NM_014737chr2093408 1696 1656 1300 1247 1235 594 453 114 23361 1013 31546 830 169 --
NM_014739chr624158 1439 --1308 --
NM_014742chr2051488 1386 582 547 519 --1513 --
NM_014743chr431962 1235 170 ------
NM_014747chr1125711 5026 4795 3704 3521 1518 1473 1332 1193 1157 863 585 23740 1771 1898 --
NM_014748chr21397 ------
NM_014751chr842016 1877 808 631 22176 1722 ----
NM_014752chr1121448 441 ------
NM_014755chr243647 1432 1369 1198 12726 23489 3228 --
NM_014757chr551584 1473 959 710 691 1210 12037 --
NM_014758chr1151642 859 609 447 99 11965 11785 --
NM_014759chr841256 1206 220 193 21650 61 ----
NM_014761chr1631136 1091 399 ------
NM_014762chr182517 2210 2031 1590 778 772 575 455 1166 1544 1130
NM_014765chr132221 535 69 11705 ----
NM_014767chr10173545 3337 3262 3194 3092 3077 2696 2655 2559 2480 1466 1338 1323 1255 940 916 622 23641 412 ----
NM_014770chr1251165 1141 1009 987 461 1210 1145 --
NM_014771chr1631078 839 116 1216 11010 --
NM_014772chr18163301 3228 3208 2912 2518 2256 1244 1191 1172 852 818 772 616 554 366 202 127 22865 626 --
NM_014774chr133260 2544 82 11155 ----
NM_014784chr11718 1214 ----
NM_014786chr1171245 1111 1064 870 859 291 48 168 ----
NM_014788chr992757 2464 2135 2058 1968 1224 552 418 329 12486 31992 495 24 --
NM_014797chr662654 2442 656 528 323 50 ------
NM_014798chr1751504 1437 1311 635 100 21614 78 ----
NM_014800chr75767 350 304 161 145 1240 ----
NM_014803chr1032397 2342 372 ------
NM_014806chr91508 ------
NM_014807chr112560 323 2541 38 ----
NM_014810chr143520 3453 2553 1407 --1172 --
NM_014812chr13530 347 91 ------
NM_014819chr511976 12463 ----
NM_014826chr153801 3455 3315 2705 1296 23737 178 11271 12938
NM_014827chr11419 1547 11469 --
NM_014829chr552142 1717 1520 697 201 ------
NM_014830chr1271402 901 703 511 495 309 42 22666 1119 3561 365 190 11238
NM_014832chr13--1722 ----
NM_014836chr1011537 --11369 --
NM_014838chr22102582 2359 2111 2105 2059 1996 1788 942 697 54 1134 12545 --
NM_014839chr11623 1116 --1443
NM_014840chr1222587 144 1800 --23332 2095
NM_014841chr621173 149 ------
NM_014847chr1151 2357 124 1364 --
NM_014849chr161197 1102 961 846 826 519 ------
NM_014850chr3104914 4315 4161 4003 1862 1668 1411 1257 699 241 21962 166 --151
NM_014853chr1791286 1230 469 444 308 302 285 220 23 11317 21344 1307 --
NM_014858chr161086 954 946 928 199 125 ------
NM_014869chr321397 1215 ------
NM_014870chr1144548 4201 4007 3844 1528 1518 1489 923 900 845 653 613 129 59 --33267 1437 781 11539
NM_014873chr143960 3497 1318 769 31271 907 634 ----
NM_014876chr2241847 1547 42 33 ------
NM_014877chr17147431 6998 6847 6828 6748 6020 2698 2464 2076 1826 1698 1201 279 212 15366 16773 16432
NM_014883chr471584 958 914 580 111 82 70 12383 ----
NM_014890chr3--124 ----
NM_014891chr761552 1538 1489 1322 587 499 11620 2401 99 --
NM_014893chrY32292 1582 576 ------
NM_014897chr1753264 2912 2712 2579 2307 ------
NM_014899chr543117 2961 2192 1006 21093 447 12492 --
NM_014901chr551895 1462 1442 727 601 2631 145 ----
NM_014902chr2041171 1104 524 386 21330 298 11549 1377
NM_014903chr122518 301 ----12136
NM_014905chr251836 1616 1519 681 363 ------
NM_014906chr1762911 1602 1391 1326 1107 213 ------
NM_014909chr14143968 3354 3260 3158 2964 2936 1458 1243 1229 1109 745 739 417 67 4862 764 547 137 13590 11008
NM_014912chr101160 ------
NM_014918chr1521530 294 ------
NM_014920chr652789 2649 1070 842 295 13010 ----
NM_014921chr19122957 2489 2236 1906 1225 1083 1051 1009 999 770 443 222 42631 2397 737 302 1143 --
NM_014923chr13------11803
NM_014926chr321003 866 ----1785
NM_014931chr193660 632 565 --1601 1486
NM_014934chr1353760 3400 3370 3317 3036 11295 ----
NM_014935chr1123732 3491 2893 2605 1465 1356 1118 961 500 455 317 216 33199 3003 2638 ----
NM_014938chr1261847 922 521 393 97 80 42008 762 270 126 1191 --
NM_014939chr1821278 1068 ------
NM_014941chr22121 ------
NM_014944chr131172 199 65 --11056 --
NM_014946chr222908 2803 12228 --190
NM_014947chr162977 2181 2135 2095 1164 1029 ------
NM_014949chr11316 --1334 --
NM_014961chr431914 1381 350 ------
NM_014963chr193429 186 162 ------
NM_014964chr17102377 2182 2087 1879 1743 400 379 304 193 117 --22213 151 --
NM_014969chr11984 ------
NM_014974chr1051533 1385 600 159 102 ------
NM_014977chr145455 363 198 76 41 ------
NM_014982chr1485322 4767 3634 3578 3548 1432 853 658 ------
NM_014988chr422817 1063 ------
NM_014991chr442964 2747 617 85 --1912 --
NM_014997chr752178 2129 2013 1973 1853 1625 12620 --
NM_015002chr1221669 302 ------
NM_015008chr323232 673 --2649 263 --
NM_015011chr1331123 855 375 ------
NM_015012chr11155 ------
NM_015020chr1683622 2985 1247 943 582 403 222 184 ----22649 806
NM_015023chr1101735 1508 1446 1293 1248 1204 1187 1174 211 25 ------
NM_015024chr841287 1226 980 262 ------
NM_015026chr1244595 3743 3101 468 --1861 --
NM_015033chr992132 1208 1073 745 344 237 178 160 109 2872 323 12141 196
NM_015035chr20116073 5835 5518 5352 5004 4671 4122 2457 2445 930 488 22156 1846 24948 937 1150
NM_015039chr1103534 3401 3041 2693 1723 1384 614 255 175 50 23687 938 --12650
NM_015042chr1584071 3668 3318 3278 1324 1021 443 376 33817 3294 318 --24217 1110
NM_015045chr101450 ------
NM_015051chr912180 ----22581 2372
NM_015052chr721352 246 ----11373
NM_015059chr1573927 3797 3117 2925 1550 805 725 21514 762 32891 2790 2526 --
NM_015061chr9----1875 --
NM_015063chr1981310 528 507 494 487 361 291 182 21356 243 ----
NM_015064chr1293646 3486 3075 2341 2221 1457 1032 1014 50 11382 12525 --
NM_015069chr161223 ------
NM_015070chr1331484 519 270 ----11197
NM_015071chr5116375 6024 5643 5447 5252 5025 4263 4086 4009 1136 583 12453 45895 5113 4823 2468 --
NM_015074chr1115004 4910 4594 4447 4093 3927 3341 3185 1734 1323 1158 34574 3473 3276 11402 --
NM_015075chrX122082 2070 2044 2002 1992 1851 895 470 425 375 348 236 41614 627 578 272 1603 --
NM_015076chr632853 1484 818 23212 28 ----
NM_015077chr17204553 4357 4335 4173 3862 3726 3413 3013 1819 1718 1582 1269 912 872 825 674 646 589 372 22 21305 895 24086 66 --
NM_015079chr15153197 2900 2870 2839 2758 2752 2462 1063 1038 800 745 701 404 394 52 ------
NM_015080chr113820 230 205 --1264 --
NM_015090chr1125728 5279 5126 4680 4363 2463 2388 1379 610 277 195 22 11439 11725 34690 4131 1923
NM_015091chr14--1135 ----
NM_015092chr1684318 3447 1766 731 440 171 90 64 ------
NM_015093chr61720 21213 147 11168 --
NM_015094chr22204595 3902 3797 3617 3567 3553 3228 3044 2927 1769 1725 1661 1599 1467 1406 526 440 354 242 208 22853 1297 1164 --
NM_015097chr331825 513 380 ------
NM_015100chr131858 1774 1655 --11865 --
NM_015107chrX52170 1928 1804 986 413 21546 470 31502 956 924 --
NM_015113chr17112368 2353 2062 1791 658 613 562 445 274 142 103 ----1400
NM_015115chr431174 970 154 ------
NM_015129chrX41256 260 177 71 ------
NM_015130chr41900 ------
NM_015133chr1641289 964 244 65 21205 263 ----
NM_015137chr841672 1045 849 381 ------
NM_015149chr152118 1851 1817 1591 450 --11554 --
NM_015150chr33271 250 63 --1923 --
NM_015153chr61586 ------
NM_015155chr1052421 2052 1341 888 821 23201 3151 ----
NM_015156chr1493711 3623 3496 3102 2927 1394 318 249 139 1812 11360 --
NM_015158chr91264 ------
NM_015163chr141473 11235 1155 21336 248
NM_015171chr16153 ----1334
NM_015172chr141534 373 164 76 ------
NM_015187chr4149 ------
NM_015190chr103408 118 93 ------
NM_015191chr1172503 2288 1975 1672 802 610 67 12177 ----
NM_015192chr2022646 422 ------
NM_015193chr881324 1280 1105 600 521 506 42 24 21310 1225 11086 --
NM_015194chr1781853 1825 1400 858 734 555 442 414 31599 457 59 --1592
NM_015197chr14133055 2890 2771 2747 2657 2520 2272 1171 1035 653 415 211 116 --22326 1079 1768
NM_015202chr1671479 1423 1291 1212 362 87 54 --1156 --
NM_015203chr1132 ------
NM_015205chr13144741 4578 4467 4271 4207 4134 4103 3518 1921 1562 1457 1110 835 166 34490 3946 895 21969 56 --
NM_015206chr1522606 27 --23737 3025 --
NM_015208chr1824057 1115 --12733 --
NM_015213chr112523 51 ------
NM_015215chr122394 2290 1709 12201 --
NM_015219chr1792215 2100 1808 1717 1590 1028 1002 661 424 31702 982 358 2630 182 1395
NM_015221chr1031374 46 25 167 11383 --
NM_015225chr983158 2231 1211 1194 1163 1028 752 483 12289 --21995 1978
NM_015229chr176878 476 367 282 34 22 --1357 --
NM_015236chr41502 1172 ----
NM_015238chr51448 1615 ----
NM_015247chr1675314 4943 3621 3583 1744 1544 1078 ----21621 837
NM_015252chr22706 630 ------
NM_015254chr893194 2978 2354 1226 1185 844 526 474 41 --167 --
NM_015263chr15152 ----1907
NM_015265chr212050 --11672 --
NM_015270chr1282134 1892 1584 1554 1547 677 665 260 ------
NM_015271chr442943 955 570 558 --13859 --
NM_015272chr1632117 1872 1731 ------
NM_015275chr122661 400 ------
NM_015278chr632886 989 346 13328 ----
NM_015282chr282533 2511 2311 2073 660 648 542 461 --1266 --
NM_015284chr1121920 1807 1786 1773 1641 1521 771 473 281 202 166 85 11948 ----
NM_015288chr573830 3787 2613 2593 1106 745 597 5819 674 388 327 57 22748 1405 --
NM_015293chr61124 ------
NM_015296chr132994 106 --1829 --
NM_015299chr14113914 3425 3249 2930 2825 2717 2638 915 212 191 37 43452 2973 1404 54 --13198
NM_015305chr1441406 487 414 203 1509 ----
NM_015310chr8167873 7818 7633 6584 5918 5709 3058 2872 2683 2605 2567 2141 1260 1203 1016 774 47710 7522 7040 1397 27202 1327 --
NM_015315chr582841 2776 2748 2199 636 510 345 73 2678 423 12651 --
NM_015317chr242573 2260 383 207 12291 ----
NM_015319chr123326 310 170 --161 --
NM_015320chr21995 1307 --1885
NM_015321chr19204625 4282 4076 4043 3897 3678 3389 3026 1929 1273 1265 1067 476 424 335 291 138 88 64 54 54534 3016 1527 1474 459 13466 13874
NM_015326chr172653 2477 2277 1888 329 302 232 11869 ----
NM_015327chr181180 1120 1104 536 513 268 254 62 ------
NM_015328chr72983 752 ------
NM_015331chr1--2561 29 ----
NM_015335chr124588 383 355 257 2474 56 1118 --
NM_015336chr1222647 135 ------
NM_015346chr1421693 1314 11344 ----
NM_015349chr643095 2539 601 114 11190 ----
NM_015356chr8147 ------
NM_015358chr212836 53 ------
NM_015365chrX23484 1641 23299 1368 23312 2962 22914 576
NM_015374chr2271425 1210 1012 945 510 384 196 ------
NM_015375chr194691 4368 4202 3771 1986 1812 943 775 509 24600 198 ----
NM_015378chr192931 2758 2716 2618 2336 2319 2162 1821 67 --11018 --
NM_015381chr2281923 1898 1886 1556 340 332 274 145 1358 31398 819 707 --
NM_015382chr14--1632 ----
NM_015385chr1083011 2889 2357 2308 605 432 348 259 1419 --12749
NM_015387chr211550 ------
NM_015388chr63231 209 26 --173 --
NM_015396chr32300 66 11476 ----
NM_015397chr931381 1196 725 ------
NM_015401chr12----3386 128 71 --
NM_015404chr9251 38 2580 141 ----
NM_015415chr11167 ------
NM_015435chr8--1540 ----
NM_015436chr412172 --1471 --
NM_015443chr17----1352 --
NM_015444chr31224 ------
NM_015455chr563889 3742 2812 2497 882 641 --23578 24 --
NM_015457chr1111073 11006 ----
NM_015458chr895051 4849 4457 4156 2043 1801 1520 513 360 22034 1546 11751 11553
NM_015466chr32215 91 ------
NM_015475chr21284 ------
NM_015481chr122309 71 1741 ----
NM_015483chr71279 ------
NM_015484chr11770 ------
NM_015493chr1951998 1604 796 181 166 ------
NM_015503chr164634 595 106 97 --2212 49 --
NM_015509chr1241425 1067 603 187 ------
NM_015513chr33611 187 85 1140 ----
NM_015526chr1931204 480 129 --21357 906 11424
NM_015531chr11142 ------
NM_015532chr1522661 989 ------
NM_015534chr1----2800 151 --
NM_015535chr273949 3771 3064 1176 902 853 156 21602 327 11569 --
NM_015542chr1021025 165 --1881 --
NM_015550chr753389 3077 2813 2603 2553 --1478 --
NM_015553chr684589 4337 4151 3601 3279 693 629 103 14826 --13467
NM_015557chr133068 2849 627 53400 3171 747 470 177 23444 550 --
NM_015564chr573501 3414 2522 2315 2268 1390 1291 ------
NM_015567chr1321283 300 ------
NM_015568chr20154198 3988 3313 2890 2785 2687 1464 1442 1327 1291 1169 1042 670 286 139 21108 61 23872 68 --
NM_015569chr121310 250 --14565 --
NM_015570chr731195 589 551 1202 ----
NM_015571chr632374 2304 775 --1521 --
NM_015576chr332515 1182 75 --12136 --
NM_015609chr162756 2675 2645 2454 697 86 32583 2531 1150 ----
NM_015635chr922100 1620 --11401 --
NM_015678chr132609 384 ------
NM_015681chr17122 ------
NM_015686chrX4353 165 50 44 12131 --11791
NM_015695chr631411 766 264 1686 ----
NM_015700chr2132 ------
NM_015716chr175771 274 242 54 41 1598 ----
NM_015719chr192197 138 2777 559 ----
NM_015845chr181277 --1677 1562
NM_015850chr821532 606 1165 159 --
NM_015855chr114774 273 188 45 ----1182
NM_015866chr11453 ------
NM_015872chr191675 1546 1488 1362 1252 726 583 240 125 ------
NM_015878chr8------1670
NM_015879chr18118360 7556 7205 7141 6617 5854 5205 2652 704 337 63 42699 1436 888 715 18545 --
NM_015881chr115919 549 289 190 161 ------
NM_015891chr621695 1343 1612 ----
NM_015898chr1942449 2283 1535 234 --1333 --
NM_015902chr81790 ------
NM_015904chr21560 ------
NM_015905chr7------1154
NM_015906chr114160 --14468 --
NM_015955chr2--162 ----
NM_015960chr102103 75 ------
NM_015975chrX11383 ----2663 318
NM_015980chr531404 1263 1170 ------
NM_015981chr582685 2459 2191 2110 1019 804 287 192 ------
NM_015984chr11123 ------
NM_015995chr15164936 4726 4581 3834 3695 3656 3415 3388 1817 1758 1231 739 655 505 414 23 --23442 1680 13719
NM_016002chr12685 47 ------
NM_016009chr153821 3441 3220 1555 388 --14630 11762
NM_016016chr171319 ------
NM_016019chr73348 69 25 ------
NM_016020chr61142 125 ----
NM_016022chr14348 183 71 65 ------
NM_016025chr162717 417 ------
NM_016026chr1441517 1276 506 122 ----1272
NM_016037chr12896 331 ------
NM_016040chr122758 65 ----12363
NM_016062chr16250 24 ------
NM_016072chr1242254 2193 1995 131 ------
NM_016076chr123061 2762 1133 1554 --
NM_016083chr632906 1011 741 11560 ----
NM_016096chr8--1219 ----
NM_016131chr2--1249 ----
NM_016132chr1521339 866 --1572 --
NM_016147chr1131069 868 408 1214 1921 1752
NM_016152chr32992 829 ------
NM_016201chr342063 881 260 77 1222 2902 577 1307
NM_016205chr4121 --1185 --
NM_016206chr327503 7050 32567 2492 883 27082 2111 --
NM_016221chr522167 476 --11523 --
NM_016224chr631897 1564 484 --1655 1544
NM_016227chr12520 58 ------
NM_016231chr171395 ------
NM_016235chr163591 352 112 --11158 --
NM_016250chr142182 34 ------
NM_016257chr181018 817 497 477 471 218 123 101 1684 --22706 2522
NM_016260chr2107523 7233 6696 5618 5525 4786 4693 1970 1938 741 21574 263 ----
NM_016264chr192504 193 ------
NM_016269chr43839 808 109 --11106 --
NM_016271chr18----21723 735 --
NM_016272chr2272820 1949 1759 1733 959 781 562 51837 1798 1715 1009 140 ----
NM_016284chr165950 666 148 104 85 --1870 --
NM_016287chr131372 832 542 1785 --11417
NM_016289chr221946 614 1149 ----
NM_016290chr51102 ------
NM_016320chr112941 25 ------
NM_016322chr922266 1151 ------
NM_016340chr531194 1169 1084 1112 --195
NM_016364chr10149 1210 ----
NM_016376chr1763713 3316 1025 1007 698 68 24351 910 11506 --
NM_016396chr1542855 2613 2286 1068 12623 ----
NM_016399chr123725 554 83 ------
NM_016423chr142362 114 1181 ----
NM_016436chr2042400 2234 1657 779 ----1660
NM_016441chr242050 1528 581 541 --11667 --
NM_016453chr3130 ------
NM_016472chr142450 388 ------
NM_016485chr62418 165 171 --152
NM_016486chr1----1159 --
NM_016490chr23316 247 114 123 ----
NM_016505chr13576 565 93 1241 ----
NM_016506chr113254 212 125 ------
NM_016507chr1721047 212 ------
NM_016513chr652789 2649 1070 842 295 13010 ----
NM_016522chr1121181 331 31406 429 397 1123 --
NM_016525chr94917 791 615 271 1805 1646 --
NM_016530chr1552967 1221 1157 158 76 ------
NM_016531chr433980 3947 489 1602 13713 --
NM_016532chr1741034 107 87 45 1919 ----
NM_016542chrX21784 329 1565 ----
NM_016559chr31535 ----1126
NM_016564chr115863 842 679 386 254 1813 ----
NM_016569chr1221239 98 134 1165 --
NM_016574chr116781 303 275 215 60 26 3720 248 237 1742 --
NM_016577chr394463 4340 4092 3778 3572 2960 672 661 565 2887 451 --13128
NM_016578chr11----1549 --
NM_016587chr71278 ------
NM_016596chr12----3386 128 71 --
NM_016603chr521989 841 --1618 --
NM_016605chr571678 1033 711 391 330 312 243 22568 2313 1216 --
NM_016613chr432749 2272 2099 --1504 --
NM_016621chr11154428 4330 4138 4113 3684 3571 3548 3326 3271 3184 2942 1834 641 322 313 24374 3813 --23162 1102
NM_016653chr221073 156 --11089 --
NM_016654chr152473 80 ------
NM_016823chr1731306 1189 1139 ------
NM_016834chr1793949 3498 2683 2596 1347 1236 1131 748 80 13102 23742 1623 --
NM_016835chr1793949 3498 2683 2596 1347 1236 1131 748 80 13102 23742 1623 --
NM_016841chr1793949 3498 2683 2596 1347 1236 1131 748 80 13102 23742 1623 --
NM_016848chr9187 ------
NM_016929chr654533 1397 526 242 147 --13916 1223
NM_016936chr1662038 1984 793 501 258 227 ------
NM_016946chr143600 3223 2563 780 1891 ----
NM_016950chr42319 58 ------
NM_016952chr1184059 4053 3103 2829 2767 1257 554 292 --13502 --
NM_016953chr2125263 4441 4401 4392 4090 3945 3700 2330 1844 1659 992 304 159 139 --
NM_017412chr821033 1019 11106 ----
NM_017413chrX51874 1863 264 136 97 32327 711 222 11646 --
NM_017418chr9271 44 ------
NM_017420chr1453293 3251 3145 2983 191 12670 ----
NM_017423chr41501 ------
NM_017426chr4----1180 --
NM_017447chr2111214 11415 ----
NM_017450chr1761117 923 557 234 80 21 11243 11107 --
NM_017452chr2051530 1250 1164 443 415 --1518 --
NM_017453chr2051530 1250 1164 443 415 --1518 --
NM_017454chr2051530 1250 1164 443 415 --1518 --
NM_017455chr15------1635
NM_017456chr1771558 1422 1307 750 697 562 266 11340 ----
NM_017519chr611134 ------
NM_017522chr121008 40 11129 ----
NM_017525chr113221 215 184 ------
NM_017544chrX1796 ------
NM_017551chr1051888 1875 1771 1691 424 22583 1819 --11656
NM_017553chr158930 921 912 810 484 472 258 230 ------
NM_017558chr162412 159 ------
NM_017559chr171226 ------
NM_017575chr1761585 1384 577 357 296 143 --11360 11083
NM_017582chr141741 1576 1349 1323 ------
NM_017590chr22112222 2061 1968 1817 1803 599 482 293 194 125 117 1691 ----
NM_017592chr19132488 2069 1809 1073 993 987 899 866 821 597 507 311 87 21031 634 --12123
NM_017594chr931243 940 831 --1520 --
NM_017596chr1174370 4168 3954 3772 3688 3567 3350 2971 1759 1751 1524 1347 1305 940 619 460 403 53742 1411 992 568 371 41721 1649 1432 1119 11623
NM_017607chr192400 37 --1117 --
NM_017610chr1511347 --1778 --
NM_017628chr494959 4495 4058 2051 1949 1866 1183 1004 243 23753 3565 24620 3299 --
NM_017629chr13268 118 45 11526 ----
NM_017633chr643082 3059 699 91 --12940 --
NM_017634chr811915 11218 ----
NM_017635chr111201 11541 --1614
NM_017637chr9128948 8876 7909 7750 7152 3083 2968 1784 1726 1201 339 30 16027 12866 --
NM_017640chr61661 ------
NM_017641chr121327 1358 ----
NM_017643chr1752785 2287 2126 971 870 1563 ----
NM_017664chr13--153 ----
NM_017666chrX31549 137 104 1831 ----
NM_017668chr161548 ------
NM_017681chrX2842 332 ------
NM_017684chr1531871 660 519 1202 1700 --
NM_017694chr241991 1524 1372 826 ------
NM_017709chr164165 3438 2811 1016 876 111 --13647 --
NM_017719chr332286 2017 1887 --11630 --
NM_017724chr31117 1221 ----
NM_017728chr17112986 2917 2604 2577 2440 2147 2051 1195 701 204 48 23038 2249 12302 --
NM_017736chr1653145 2036 810 181 148 1734 12050 2532 371
NM_017737chr131896 1662 356 ----1716
NM_017739chr12520 57 ------
NM_017740chr1621611 183 --11251 177
NM_017741chr452319 2153 637 423 257 11120 --176
NM_017742chr1852003 484 469 452 365 ------
NM_017744chr13942 925 490 ------
NM_017747chr51431 ------
NM_017749chr116986 679 352 321 166 61 1772 ----
NM_017754chr654882 4809 3433 954 925 ------
NM_017763chr1741052 931 806 189 ----1919
NM_017778chr851228 1055 431 219 177 21072 239 11274 1351
NM_017780chr81797 ------
NM_017784chr3----2845 34 --
NM_017786chr8186 ------
NM_017787chr1072720 2173 1891 1001 951 750 102 2438 424 12302 --
NM_017798chr20174 ------
NM_017799chr14----11711 --
NM_017801chr33996 615 557 --1937 1279
NM_017810chr16182 ------
NM_017811chr962870 2298 2217 2176 2093 538 --1126 --
NM_017813chr855001 4228 3556 2057 35 ----15545
NM_017818chr1167 ------
NM_017824chr1041987 1786 1004 810 ------
NM_017845chr4123 ------
NM_017848chrX43517 3410 1724 431 23210 1827 13569 --
NM_017849chr293133 2698 2620 2392 926 721 433 52 31 33185 2345 1178 1348 13123
NM_017851chr1531057 510 462 --1835 --
NM_017856chrX51710 1675 1328 408 25 --1126 --
NM_017857chr113660 150 99 --3193 178 124 --
NM_017866chr82777 391 ------
NM_017873chr9112724 2660 2321 2279 2210 1976 1197 965 787 180 49 23084 40 ----
NM_017893chr1031444 996 78 2204 40 ----
NM_017902chr10104769 4445 1944 1311 1124 982 775 629 438 409 23966 1246 14659 13561
NM_017907chr11172 --123 --
NM_017913chr91354 ------
NM_017915chr121830 ------
NM_017919chr965544 5522 5482 4838 1351 698 22106 1279 25167 2332 --
NM_017925chr92772 509 ------
NM_017929chr2221220 1036 2962 107 2912 22 --
NM_017935chr41272 ------
NM_017938chrX1430 3598 241 209 ----
NM_017943chr142691 80 ------
NM_017944chr1132674 2271 332 1656 ----
NM_017955chr1451209 1103 494 157 25 2897 90 2841 246 1137
NM_017987chr1011549 1140 181 --
NM_017994chr742622 416 218 67 22642 390 ----
NM_017999chr14----155 --
NM_018014chr221352 236 1152 ----
NM_018017chr1011083 --22449 228 --
NM_018026chr1161361 1344 1209 1040 409 46 21188 183 21231 197 1583
NM_018027chr1072050 1006 948 844 603 510 113 12445 1381 --
NM_018045chr173130 2732 2641 2568 2053 1011 252 22414 2349 --1688
NM_018051chr7------1323
NM_018061chr11256 ------
NM_018071chr143613 316 214 1330 --1828
NM_018078chr4--1372 ----
NM_018084chr211306 --22697 149 --
NM_018085chr1137771 7034 6992 6352 6183 4975 2272 2066 1678 1041 854 544 58 15758 26965 1844 --
NM_018086chr221752 1577 --11779 --
NM_018092chr163539 78 49 --1351 --
NM_018095chr113254 212 125 ------
NM_018098chr31984 1401 ----
NM_018110chr1621233 1189 --2396 77 1496
NM_018115chr43777 766 320 1794 ----
NM_018116chr13497 462 46 ------
NM_018121chr1033095 3070 997 32888 2177 1082 ----
NM_018128chr1751222 476 363 219 98 1107 ----
NM_018131chr101736 ------
NM_018133chr3--2477 364 ----
NM_018137chr141377 472 130 37 --11271 --
NM_018150chr15773 315 246 53 36 ------
NM_018156chr192931 2758 2716 2618 2336 2319 2162 1821 67 --11018 --
NM_018157chr123500 390 285 --22180 550 --
NM_018171chr122811 731 1879 ----
NM_018172chr1141491 1429 1051 1039 11549 31555 1530 1445 --
NM_018178chr142091 1787 1762 1668 21823 1688 1419 --
NM_018182chr1732056 579 284 --1785 --
NM_018193chr151217 ------
NM_018198chr171203 1156 1096 1035 315 221 198 21194 403 21355 1347 --
NM_018214chr61100 1442 ----
NM_018223chr122784 201 --2847 95 1428
NM_018240chr14641 191 107 56 --1690 --
NM_018243chr432893 1152 391 --1810 --
NM_018246chr81313 12682 ----
NM_018247chr622875 48 ------
NM_018252chr11507 ------
NM_018254chr11483 --11556 --
NM_018264chr74942 382 266 211 --1185 --
NM_018266chr32935 353 ------
NM_018286chr171376 ------
NM_018293chr3----1966 --
NM_018299chr832190 1283 1224 2829 182 ----
NM_018307chr173956 199 192 1372 1691 --
NM_018310chr8286 40 ------
NM_018315chr421336 388 ------
NM_018325chr911414 ------
NM_018327chr201671 ------
NM_018339chr941717 1176 1142 488 ------
NM_018340chr16104056 3998 3875 3836 3701 3188 1781 1083 492 368 --33160 1616 609 23828 102
NM_018351chr1254183 3909 3419 1525 1359 --24195 3543 --
NM_018353chr141686 ------
NM_018358chr31258 --1111 --
NM_018362chr1173464 3285 3242 2880 2775 2747 470 13118 ----
NM_018364chr112658 13347 ----
NM_018374chr731672 879 760 23605 243 11449 --
NM_018381chr192665 294 1358 ----
NM_018383chr241723 1332 182 100 ------
NM_018399chr63257 181 101 ------
NM_018400chr1143586 3463 3076 1250 24254 3197 --14238
NM_018403chr393923 3628 3412 2834 620 467 382 363 37 32498 1063 407 22610 817 12768
NM_018416chr1252506 2221 2157 515 75 2799 28 ----
NM_018431chr201246 ------
NM_018437chr9143 ------
NM_018439chr1842494 2044 2029 1781 ------
NM_018440chr8116538 6392 5616 2236 2018 1734 1612 918 699 574 566 11891 15727 12303
NM_018449chr91686 --1320 --
NM_018462chr33280 78 70 1768 ----
NM_018471chr2--136 ----
NM_018475chr41600 ------
NM_018482chr841821 1648 497 468 --1617 --
NM_018489chr12319 54 ----1577
NM_018490chr112622 349 ------
NM_018509chr1751377 1249 520 280 32 21646 567 ----
NM_018527chr13--140 ----
NM_018553chr1751714 1383 391 266 116 1481 ----
NM_018566chr124596 3597 14738 ----
NM_018638chr1224977 3436 --15490 --
NM_018640chr1232576 2467 2083 ------
NM_018650chr121644 450 ------
NM_018655chr1158 2327 66 ----
NM_018660chr832626 74 44 12454 1347 --
NM_018667chr1672249 1992 1119 527 519 124 32 41880 744 591 48 ----
NM_018674chr24663 573 551 504 ------
NM_018682chr71572 ------
NM_018695chr532380 1974 727 1353 ----
NM_018699chr41220 ------
NM_018708chr1951438 1229 1180 576 214 11344 ----
NM_018710chr821169 1107 ------
NM_018712chr11--178 ----
NM_018715chr182002 1923 1857 1531 904 889 870 464 32167 1947 1768 21725 595 --
NM_018717chr472729 931 898 878 754 714 374 --1163 --
NM_018718chr721717 780 21487 832 ----
NM_018719chr751265 1136 895 874 333 ------
NM_018844chr731507 348 198 ------
NM_018890chr71238 1566 1471 --
NM_018898chr542317 2088 592 290 11870 ----
NM_018899chr542317 2088 592 290 11870 ----
NM_018900chr542317 2088 592 290 11870 ----
NM_018901chr542317 2088 592 290 11870 ----
NM_018902chr542317 2088 592 290 11870 ----
NM_018903chr542317 2088 592 290 11870 ----
NM_018904chr542317 2088 592 290 11870 ----
NM_018905chr542317 2088 592 290 11870 ----
NM_018906chr542317 2088 592 290 11870 ----
NM_018907chr542317 2088 592 290 11870 ----
NM_018908chr542317 2088 592 290 11870 ----
NM_018909chr542317 2088 592 290 11870 ----
NM_018910chr542317 2088 592 290 11870 ----
NM_018911chr542317 2088 592 290 11870 ----
NM_018912chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018913chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018914chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018915chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018916chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018917chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018918chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018919chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018920chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018921chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018922chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018923chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018924chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018925chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018926chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018927chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018928chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018929chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_018947chr774381 4216 4077 3406 961 723 133 --15035 --
NM_018948chr111119 ------
NM_018951chr71360 ------
NM_018952chr171251 --1168 --
NM_018963chr212156 79 ------
NM_018970chr772802 2430 2358 1152 871 773 69 --11098 11978
NM_018976chr121981 130 1958 --
NM_018977chrX3927 338 291 ------
NM_018979chr1222530 216 11010 12012 --
NM_018992chr1661431 618 395 364 351 299 ------
NM_018994chr11204 --1530 --
NM_018999chr1054235 4103 1605 734 99 1332 1567 --
NM_019001chr323513 979 11827 ----
NM_019004chr732194 2022 301 ----1600
NM_019024chr2142 1318 ----
NM_019030chr5150 ------
NM_019049chr11622 ------
NM_019080chr1321393 339 ------
NM_019084chr1022034 404 ------
NM_019089chr193133 3051 2886 1237 768 452 425 392 327 1107 13413 --
NM_019091chr22873 431 ------
NM_019096chr62388 187 ------
NM_019114chr922138 1935 12543 ----
NM_019116chr1663221 2465 1230 970 914 871 11035 1908 --
NM_019117chrX42319 1251 725 250 --22263 262 --
NM_019555chr351215 1173 686 413 375 --11644 --
NM_019590chr1041100 1060 210 55 ------
NM_019593chr2042860 2790 584 340 --12921 --
NM_019595chr21238 ----134
NM_019596chr2172915 2665 721 681 511 75 54 ----11012
NM_019600chr151667 ------
NM_019605chr12584 515 ------
NM_019606chr71159 ------
NM_019842chr61436 ------
NM_019845chr2154 ------
NM_019852chr14134 ------
NM_019857chrX2608 218 --11544 --
NM_019862chr1671556 1361 1231 668 637 327 152 1381 1268 --
NM_019884chr193450 161 146 ----172
NM_019885chr262788 2404 2354 2194 906 727 2235 25 ----
NM_019891chr1----11165 --
NM_019892chr93383 326 26 ------
NM_019898chr1671556 1361 1231 668 637 327 152 1381 1268 --
NM_019899chr1671556 1361 1231 668 637 327 152 1381 1268 --
NM_019900chr1671556 1361 1231 668 637 327 152 1381 1268 --
NM_020039chr1291511 1256 1245 700 673 620 542 472 290 2747 492 11349 --
NM_020066chr12874 384 ------
NM_020122chr2125860 5724 5515 4947 4782 3990 3745 1329 1158 668 596 570 15476 15022 --
NM_020123chr101295 ------
NM_020127chr161660 1350 1148 670 375 208 31528 1303 504 --1454
NM_020141chr142357 2123 330 229 --12019 --
NM_020142chr123626 554 37 3421 402 47 ----
NM_020144chr72767 410 ------
NM_020150chr1042215 2109 1981 58 ------
NM_020151chr231528 50 39 ------
NM_020160chr19246 26 ------
NM_020168chr1561150 504 407 295 130 56 1151 1518 --
NM_020178chr1741159 1032 929 407 1789 1454 --
NM_020179chr112533 371 ------
NM_020182chr2023444 2712 12446 33351 2466 893 --
NM_020194chr2138 ------
NM_020198chr171103 176 ----
NM_020199chr511097 --11115 --
NM_020205chr11785 --175 12475
NM_020211chr1581372 1234 1199 1169 1042 978 339 239 11082 21208 1112 --
NM_020239chr112203 155 2558 185 --
NM_020245chr684058 3751 3561 1974 921 433 325 280 23788 3315 43810 3780 3760 951 --
NM_020248chr1112282 1970 1951 1935 1866 1638 1480 814 489 146 83 1864 ----
NM_020310chr17162491 2270 2261 2177 1953 1925 1829 921 861 854 847 802 589 261 104 74 1251 ----
NM_020318chr11355 ------
NM_020337chr422918 2698 --11017 --
NM_020338chr1053447 1382 1174 291 146 62741 2435 2337 1316 1218 524 12483 --
NM_020341chr2031771 249 195 ------
NM_020342chr2--1628 11755 --
NM_020346chr1111673 ------
NM_020357chr321377 490 --1410 --
NM_020360chr174486 440 224 81 ------
NM_020364chrY41506 1187 1172 1138 ----1661
NM_020374chr12--21500 112 ----
NM_020381chr61648 --11417 --
NM_020390chr384938 4439 3794 1216 1172 1035 458 85 1249 ----
NM_020403chr1321795 1166 ------
NM_020416chr462583 2002 791 762 114 34 ------
NM_020420chrY41506 1187 1172 1138 ----1661
NM_020429chr762813 2791 831 811 503 246 12086 2426 322 --
NM_020432chr721539 1528 --1691 --
NM_020438chr941014 252 179 26 ------
NM_020440chr172984 2079 2063 1186 772 687 104 --12654 --
NM_020443chr1106424 6305 5851 5636 4877 4487 1163 764 397 103 25589 4569 35986 1185 743 11648
NM_020449chrX1659 ------
NM_020452chr151676 1479 615 453 248 --11598 --
NM_020456chr1321880 1747 11498 ----
NM_020463chr22544 258 ------
NM_020466chr6114654 4495 3770 3753 3318 1650 803 765 571 550 383 ----14361
NM_020474chr181178 ------
NM_020475chr872191 2162 2149 1974 1541 990 188 11511 11626 12076
NM_020476chr872191 2162 2149 1974 1541 990 188 11511 11626 12076
NM_020477chr872191 2162 2149 1974 1541 990 188 11511 11626 12076
NM_020478chr862254 2225 2212 2037 1604 251 11574 11689 12139
NM_020480chr872191 2162 2149 1974 1541 990 188 11511 11626 12076
NM_020526chr1111703 1578 1544 1521 1456 1447 1427 1395 714 94 27 ----11221
NM_020530chr221212 --178 --
NM_020631chr141322 1184 352 217 21217 250 151 --
NM_020640chr3165 ------
NM_020647chr852111 410 297 242 76 148 ----
NM_020654chr31384 2445 79 ----
NM_020673chr20107191 7037 6758 6610 5153 2336 2269 1574 1523 1016 26835 5108 --17396
NM_020689chr202257 29 11192 11339 --
NM_020692chr1471025 803 763 753 248 131 97 ------
NM_020699chr144955 4755 4626 1935 1909 34989 4251 998 24894 1271
NM_020702chr931549 686 303 21197 532 21531 437 --
NM_020704chr742206 1876 925 42 ------
NM_020706chr211161 ------
NM_020708chr2072195 1882 1842 1579 793 427 40 1352 ----
NM_020713chr20142552 2168 2036 1155 982 862 831 784 776 449 239 134 68 33 --11260 --
NM_020718chr1644987 1868 788 213 12003 12017 --
NM_020727chr2173654 2937 999 798 721 185 34 ------
NM_020728chr782994 2913 2862 2691 2512 1136 1118 1105 22060 911 ----
NM_020732chr611134 ------
NM_020734chr12----1458 --
NM_020738chr21191 --1464 --
NM_020747chr52794 742 ------
NM_020748chr171364 ------
NM_020750chr63324 290 113 11146 1403 --
NM_020753chr172506 143 1180 2263 165 --
NM_020760chr221685 302 11630 ----
NM_020762chr1221063 393 1325 ----
NM_020766chrX33745 3215 1737 11521 23519 159 --
NM_020770chr131299 937 353 ------
NM_020772chr1758436 6902 5785 3059 1263 11832 15261 --
NM_020773chr4112456 2423 2059 953 795 617 580 350 228 85 53 2880 197 --11061
NM_020774chr1844067 1973 1527 1102 ------
NM_020777chr46717 618 553 469 300 276 --22327 1938 --
NM_020791chr1741174 1038 559 76 ------
NM_020792chr32355 271 ------
NM_020794chr11213 ------
NM_020795chr1741941 1820 1313 32 --2803 541 --
NM_020801chr531664 519 368 1665 ----
NM_020804chr6182367 2295 2224 2187 2119 2101 1957 1930 1921 1864 1685 1625 1014 911 721 712 697 229 1244 --11658
NM_020806chr142574 77 --1665 --
NM_020807chr1661385 730 396 112 84 27 2367 71 21305 542 --
NM_020809chr1131722 594 316 1583 ----
NM_020813chr1962589 2247 1976 1874 991 958 21966 260 1150 2823 540
NM_020819chr611249 ------
NM_020821chr1531871 660 519 1202 1700 --
NM_020830chr263127 968 699 257 70 41 ----1869
NM_020834chr1421770 773 1726 ----
NM_020839chr3--21245 547 ----
NM_020841chr12--1528 --12714
NM_020843chr151401 ------
NM_020845chr12132385 1983 1955 1864 1845 916 873 699 418 401 339 221 55 --32371 1684 517 --
NM_020850chr1673149 3025 2748 2736 2627 2618 2331 22485 647 21227 1096 --
NM_020856chr1921439 385 ------
NM_020860chr41248 ------
NM_020888chr141848 135 120 67 2534 497 ----
NM_020896chr115867 848 778 366 104 ------
NM_020897chr141357 977 486 22 1170 ----
NM_020899chr174961 328 270 66 1728 21739 318 --
NM_020905chr21117 ------
NM_020917chr19103941 3776 3681 3548 1202 942 879 701 645 630 ------
NM_020918chr105965 872 221 191 173 11015 13165 --
NM_020920chr141354 ------
NM_020922chrX31873 1442 703 ----1162
NM_020927chr161383 --1283 --
NM_020935chr274237 3591 3348 2906 1747 689 550 --1730 1119
NM_020946chr951615 1302 400 381 198 --1664 --
NM_020948chr143003 2882 2336 1376 ------
NM_020951chr1962282 1842 1750 1621 1577 432 ----1442
NM_020952chr92618 42 ------
NM_020956chr19174399 4361 4260 3999 3598 3453 2928 1848 1770 1582 1420 1350 965 820 544 234 30 1132 23728 899 13194
NM_020958chr14----134 --
NM_020962chr154524 391 362 355 41739 1575 967 450 2443 311 --
NM_020964chr1883917 3484 3125 3030 1461 1288 1194 1048 ----14179
NM_020967chr2021095 28 ------
NM_020971chr194795 313 205 193 ------
NM_020974chr113550 402 85 --1540 --
NM_020975chr1051789 1304 791 176 70 ------
NM_020983chr1282134 1892 1584 1554 1547 677 665 260 ------
NM_020987chr10----1410 --
NM_020993chr1272289 2265 2124 2055 1135 1052 698 1595 1683 1248
NM_021003chr142587 154 1160 --155
NM_021007chr231635 1584 947 --2880 46 --
NM_021032chr32675 574 ------
NM_021035chr202189 55 ----1906
NM_021038chr363163 2642 1302 1119 1045 507 ------
NM_021061chr864442 4034 3510 1779 263 59 21506 68 --13314
NM_021064chr621271 381 21450 27 ----
NM_021069chr41347 ------
NM_021072chr51123 ------
NM_021078chr174190 179 143 21 1409 ----
NM_021079chr1753044 2557 1052 543 244 22755 2381 11114 --
NM_021083chrX43444 2279 2219 561 ----12919
NM_021090chr22104524 3812 3528 3148 3066 1839 1110 1065 1015 555 44799 3513 3079 1612 11274 --
NM_021097chr242903 2164 1971 941 2808 227 ----
NM_021111chr91907 ------
NM_021116chr7158061 7917 7163 6754 6495 6324 6066 6058 5769 3607 2607 1617 1459 805 484 37995 3066 2547 26966 437 16877
NM_021120chrX102986 2970 2944 2308 1985 1018 861 777 449 363 12829 22573 2250 --
NM_021132chr102137 99 11056 ----
NM_021136chr141140 --157 --
NM_021149chr1621029 493 293 85 1148 --
NM_021155chr1982966 2580 2527 2199 2176 1177 1027 686 12660 ----
NM_021159chr421502 655 11083 ----
NM_021174chr82659 134 ------
NM_021177chr61229 163 ----
NM_021183chrX1250 12553 ----
NM_021189chr151047 1023 657 433 220 1119 ----
NM_021202chr20122708 2645 2630 2294 2019 1928 1177 522 498 356 312 119 21934 707 12847 11115
NM_021213chr173934 849 132 1209 11092 --
NM_021218chr92998 831 ------
NM_021222chr131111 511 283 1494 11249 --
NM_021238chr1231952 1789 194 ------
NM_021239chr1411284 ----1263
NM_021240chr91624 ------
NM_021252chr1021766 465 1529 ----
NM_021257chr143858 791 22 168 1882 --
NM_021259chr162478 80 ------
NM_021260chr1431340 352 59 --1550 --
NM_021569chr9101134 1124 1064 837 739 473 349 187 124 69 2939 75 ----
NM_021622chr1031995 1535 880 21689 1483 ----
NM_021625chr122387 381 ------
NM_021629chr333273 610 311 21968 1802 --159
NM_021633chr11361 2388 39 ----
NM_021638chr4124150 3874 3586 3417 3063 1768 1376 943 830 491 332 24 14918 13995 --
NM_021639chr13598 346 332 ------
NM_021647chr454773 4470 3722 3647 1151 ------
NM_021648chr631785 1761 908 12349 --1740
NM_021724chr171288 ------
NM_021728chr141346 ------
NM_021783chrX3969 747 32 --22219 761 11656
NM_021808chr122481 189 1687 ----
NM_021813chr675399 1883 1865 1823 389 61 24 14379 24840 1446 --
NM_021814chr62640 82 ------
NM_021907chr21217 --1241 --
NM_021911chr595568 5351 4562 4391 4268 4258 1807 814 589 1281 2246 59 --
NM_021914chr141925 2160 53 ----
NM_021925chr2--11462 ----
NM_021935chr33681 404 33 ------
NM_021940chr611604 ------
NM_021943chr6102131 1917 1869 1810 1671 1562 1399 859 737 109 --11774 --
NM_021945chr6103508 3296 3258 2919 2534 1176 841 749 733 80 22580 600 52656 2518 2425 1414 1354 --
NM_021954chr1361485 1381 1196 688 350 27 2412 276 ----
NM_021956chr631088 480 438 1291 ----
NM_021959chr63186 168 71 1863 1355 --
NM_021961chr11106766 5642 5356 5290 4688 2824 2326 2264 1128 612 1268 1383 22872 2365
NM_021962chr17142268 2213 2016 1672 1552 903 616 499 459 306 193 187 50 41 21022 380 32034 1563 328 11990
NM_021963chrX1534 ------
NM_021964chr366467 5710 5520 4422 4225 1895 ------
NM_021977chr663440 3305 2578 2455 1403 624 --2346 252 --
NM_021980chr1031033 387 221 ------
NM_021984chrX41132 432 301 285 21007 416 --11280
NM_021987chrX41132 432 301 285 21007 416 --11280
NM_021990chrX41132 432 301 285 21007 416 --11280
NM_022003chr1131131 445 207 --2916 103 1890
NM_022042chr491053 1004 908 821 813 742 345 124 24 1272 1726 --
NM_022047chr63142 79 57 ------
NM_022048chr15125241 5155 5126 4316 4219 4117 4024 2489 1252 1205 162 60 26071 5438 12272 11128
NM_022051chr11685 ------
NM_022075chr11287 1177 ----
NM_022080chr2052620 2571 813 577 118 1349 ----
NM_022085chr641414 539 63 35 ------
NM_022090chr51547 ------
NM_022095chr205298 289 202 110 42 ------
NM_022107chr63523 459 21 155 1391 --
NM_022116chr7139 ------
NM_022130chr531063 317 301 ------
NM_022154chr42925 535 11022 ----
NM_022166chr16195221 4507 4473 4440 4398 4293 3913 2223 1900 1428 918 693 664 621 566 448 362 213 50 ----14207
NM_022169chr115190 163 56 50 28 --21314 1184 --
NM_022343chr951285 1273 1200 937 467 --1833 --
NM_022351chr863384 3242 3166 2828 1128 789 --1499 13424
NM_022361chr61375 ------
NM_022373chr71917 ------
NM_022451chr102933 842 ------
NM_022458chr742869 2427 2261 675 --12069 --
NM_022459chr1331970 1299 923 15127 --11100
NM_022462chr19163576 3303 3122 3026 2973 2627 2576 1256 1230 1135 1011 961 706 616 151 70 1204 ----
NM_022463chr1761556 1116 489 389 119 41 21270 517 2629 380 --
NM_022465chr1272496 2460 1104 1048 497 383 99 126 ----
NM_022470chr321253 811 ------
NM_022473chr15104385 3584 2950 1523 1363 1241 1156 937 894 151 ------
NM_022477chr2061586 1517 1485 1459 1346 1211 ----1182
NM_022484chr711275 1510 ----
NM_022488chr31158 ------
NM_022491chr1253152 2286 1012 335 114 --11101 --
NM_022495chr141123 ------
NM_022497chr363895 2643 1214 1048 908 611 12872 22472 316 --
NM_022552chr241262 1085 956 225 ------
NM_022557chr171216 ------
NM_022574chr7112117 2022 1804 1731 1365 860 696 640 592 72 43 ------
NM_022640chr171214 ------
NM_022648chr2104609 4521 3815 3483 3238 3037 1817 1172 1099 1067 --1649 14071
NM_022652chr121442 ----1253
NM_022658chr1221113 152 --11319 --
NM_022716chr132129 587 350 22239 304 ----
NM_022719chr2293874 3616 3321 3178 2683 1275 565 261 78 23168 675 ----
NM_022733chr141082 229 207 38 1917 161 --
NM_022735chr131693 336 215 11510 ----
NM_022737chr1941151 923 344 277 ------
NM_022739chr17----2445 54 --
NM_022744chr1651147 1025 810 378 330 2975 858 ----
NM_022745chr142074 1086 260 39 ------
NM_022748chr772713 2648 2176 864 373 142 55 ------
NM_022755chr932128 1814 1645 12074 31910 1747 985 1817
NM_022758chr652932 2909 2852 2570 239 22453 1276 31220 1127 1086 --
NM_022763chr3--1950 ----
NM_022768chr11327 ------
NM_022771chr122231 193 ------
NM_022780chr251835 1495 1175 605 564 ------
NM_022781chr922777 92 12538 --11305
NM_022784chr15------1104
NM_022810chrX4314 277 36 27 ------
NM_022817chr251432 857 574 506 27 ------
NM_022821chr12199 147 --1462 --
NM_022822chr116724 709 333 191 157 60 --1105 --
NM_022824chr51667 1688 ----
NM_022831chr111315 11484 ----
NM_022833chr941352 1252 1044 68 ------
NM_022842chr362735 2522 2490 1258 256 208 12846 12122 1219
NM_022843chr131211 ------
NM_022845chr1621454 427 --1575 11738
NM_022893chr22546 79 ------
NM_022894chr231394 252 57 11553 1115 --
NM_022897chr55810 743 707 378 31 187 ----
NM_022898chr1464443 4356 4035 3378 1855 1482 ------
NM_022901chr9191 142 ----
NM_022902chr51398 ------
NM_022917chr93958 295 154 2918 253 ----
NM_022918chr111204 1678 ----
NM_022965chr471368 1235 1002 983 406 105 65 144 ----
NM_023000chr1421123 208 11050 ----
NM_023001chr1421123 208 11050 ----
NM_023009chr12526 222 ------
NM_023012chr122615 75 ------
NM_023018chr161364 1259 1245 1005 565 105 ------
NM_023075chr181705 --1306 --
NM_023076chr1652631 2376 1203 1038 739 --1175 --
NM_023105chr821532 606 1165 159 --
NM_023106chr821532 606 1165 159 --
NM_023110chr821532 606 1165 159 --
NM_023111chr821532 606 1165 159 --
NM_023927chr511148 1146 ----
NM_023929chr81914 12474 ----
NM_024015chr171323 1884 ----
NM_024016chr172561 153 ------
NM_024017chr1741473 1270 325 23 1604 31377 1184 509 1402
NM_024046chr341185 818 219 213 1903 11173 11040
NM_024052chr1772636 1960 1092 715 540 365 279 ------
NM_024061chr72218 66 ------
NM_024072chr1261508 1329 1310 1271 1226 655 31119 637 179 11070 --
NM_024076chr1942049 1950 1891 1583 22414 2031 32244 352 261 2553 230
NM_024082chrX1431 --196 --
NM_024086chr1773692 3383 2697 1484 1197 701 293 21116 88 12861 --
NM_024090chr441653 1482 744 642 1725 ----
NM_024092chr1191183 981 960 428 250 190 135 78 65 ------
NM_024106chr191348 ------
NM_024117chr921070 107 --11080 --
NM_024165chr63233 77 22 ------
NM_024293chr21653 --1269 --
NM_024294chr652932 2909 2852 2570 239 22453 1276 31220 1127 1086 --
NM_024297chr17--2445 73 1556 --
NM_024306chr165835 413 301 121 33 2265 130 2963 401 --
NM_024312chr1231233 287 207 11189 --1154
NM_024326chr10125 ------
NM_024345chr975138 4914 4842 3800 1626 1210 1056 11793 15151 --
NM_024411chr2011401 2138 106 ----
NM_024416chr911479 ------
NM_024423chr1834195 3531 2613 1670 ----
NM_024494chr11170 ------
NM_024496chr14138 --1323 --
NM_024511chr452935 1045 877 685 432 22386 2161 ----
NM_024522chr1111758 1746 1709 1692 1633 672 413 319 283 200 111 ------
NM_024524chr332945 2792 135 ------
NM_024528chrX1137 ------
NM_024541chr1081828 1496 1463 1177 1160 672 633 22 --1271 --
NM_024545chr21310 ------
NM_024551chr1232402 2069 2040 22241 724 42254 717 633 112 2232 133
NM_024551chr1232402 2069 2040 22241 724 42254 717 633 112 2232 133
NM_024556chr112322 114 ------
NM_024567chr83544 238 163 ------
NM_024569chr162670 2446 2233 1124 930 919 21954 148 ----
NM_024581chr6----122 --
NM_024586chr11211 ------
NM_024595chr131227 213 90 ------
NM_024613chr831387 1300 634 ------
NM_024628chr331097 405 272 ------
NM_024630chr62794 756 --1117 --
NM_024640chr12874 786 1741 ----
NM_024646chr162984 2818 2643 2610 2482 157 13382 ----
NM_024659chr21736 132 ----
NM_024665chr33191 114 47 24456 106 1344 --
NM_024666chr1521175 520 21579 68 --11449
NM_024674chr162682 2204 2165 824 813 550 12431 --1899
NM_024676chr131369 1147 212 --1269 --
NM_024689chrX41510 1340 1289 142 ----11187
NM_024698chr1171015 514 449 377 363 250 102 2356 70 ----
NM_024713chr15----11191 --
NM_024735chr1651874 1441 1331 727 268 21189 133 --2705 488
NM_024740chr11113758 3318 3241 3043 2829 1527 1472 1236 1119 1066 458 33483 3224 2996 --1508
NM_024742chr1661514 1358 1280 628 210 39 --1384 11901
NM_024753chr22691 513 ------
NM_024759chr83249 194 156 1762 1801 --
NM_024770chr2136526 6469 5762 5639 2415 2377 2166 1997 1532 1495 1363 729 388 21719 1485 16280 26392 594
NM_024785chr22498 366 1284 ----
NM_024804chr12346 23 ------
NM_024811chr113671 534 177 11226 11536 --
NM_024817chr15115702 5245 4949 4785 4536 3702 2392 1137 765 305 197 45323 5290 609 484 11130 11322
NM_024824chr141228 ------
NM_024828chr92229 129 ------
NM_024830chr581736 1719 1589 885 801 761 120 28 --2453 332 --
NM_024834chr1021905 1306 --1576 --
NM_024873chr43953 788 172 ------
NM_024874chr15961 944 869 311 52 --21038 119 --
NM_024884chr1483682 3032 1219 1175 796 627 482 293 1396 1414 --
NM_024887chr131665 1642 1354 1673 ----
NM_024900chr452186 1978 1544 415 59 ------
NM_024900chr452186 1978 1544 415 59 ------
NM_024909chr62552 32 --1516 --
NM_024915chr852197 2169 2135 1011 73 --12833 1371
NM_024920chr411230 ------
NM_024921chrX2488 468 --11450 --
NM_024930chr552368 2004 1785 198 171 --12689 --
NM_024939chr1651243 568 497 236 148 ------
NM_024942chr1021213 198 11155 ----
NM_024946chr1621535 517 11387 11647 --
NM_024947chr3128680 8303 7417 6664 6551 6473 3858 3734 3011 2354 733 108 17370 37149 3807 1192 --
NM_024949chr473707 3113 3078 1934 1278 793 532 34226 3987 1689 11711 14185
NM_024969chr21182 ------
NM_024971chr92618 42 ------
NM_024989chr256259 2294 2064 525 494 12247 11469 --
NM_024991chr1083011 2889 2357 2308 605 432 348 259 1419 --12749
NM_024997chr163895 383 311 21172 94 1124 --
NM_025073chr194304 4021 3978 3885 3688 2960 1641 1635 546 11557 ----
NM_025083chr15102006 1783 1600 1449 538 319 292 281 259 248 --1436 --
NM_025104chr1741780 1614 1157 517 --11460 --
NM_025106chr141516 673 356 31 21858 461 21244 403 --
NM_025133chr2--1320 31040 974 869 --
NM_025134chr1611860 --22388 368 --
NM_025137chr152268 123 ------
NM_025138chr131323 --1334 --
NM_025154chr731589 974 356 --11227 --
NM_025160chr143910 3811 2987 1420 ------
NM_025164chr1151957 1730 784 120 28 --11364 --
NM_025179chr1114475 4445 4389 4334 1812 1651 1606 1030 980 683 175 --13006 --
NM_025181chr2------1238
NM_025182chr92950 944 ------
NM_025187chr1631281 1178 887 --11103 --
NM_025191chr163330 2592 972 914 532 372 --11363 --
NM_025203chr221402 1337 ------
NM_025208chr1122244 142 ----11996
NM_025222chr363046 2564 2339 2154 985 758 21204 423 ----
NM_025224chr20152026 1878 1861 1660 825 686 598 523 507 489 465 432 313 151 107 1381 1653 --
NM_025235chr101813 21864 427 11698 --
NM_025237chr1771555 1162 1075 1001 249 183 41 ------
NM_025238chr1531552 1011 243 ------
NM_025248chr1772894 2352 2131 2118 846 810 139 1344 12778 --
NM_025251chr871111 486 438 428 274 227 177 198 ----
NM_025256chr6--179 --145
NM_030576chr1792458 2014 840 825 660 631 295 245 181 1497 12529 --
NM_030621chr1432833 440 386 ------
NM_030625chr101397 ------
NM_030627chr532759 2615 975 ------
NM_030629chr1671464 1400 1322 1203 181 74 63 --11361 --
NM_030647chr775946 5454 5315 4912 2368 2312 365 --34412 3973 2158 --
NM_030650chr274259 4094 3973 1479 1243 624 243 ------
NM_030661chr731547 1096 524 21251 1215 ----
NM_030664chr1052113 1897 1840 1826 977 32380 193 68 1941 --
NM_030665chr17101411 1166 1136 1107 1097 1087 1076 317 180 81 11175 ----
NM_030756chr101244 ------
NM_030758chr2251190 448 324 202 107 197 139 --
NM_030761chr1112619 2451 2416 2071 2033 1845 676 666 579 565 66 --12482 12494
NM_030762chr1221913 1316 ------
NM_030766chr123246 234 74 ----1854
NM_030767chr9132742 2714 2652 2612 2534 2436 2150 2131 2117 485 220 182 150 ------
NM_030784chr6170 ------
NM_030786chr121413 420 ----11554
NM_030802chr172616 170 3603 307 219 ----
NM_030806chr1189214 7575 7417 7173 6880 6719 6436 6374 3550 3462 3377 3122 3104 3015 2898 2832 1798 1412 47043 6845 6725 799 57430 7259 5780 5736 3348 --
NM_030808chr175844 729 717 165 86 --1325 --
NM_030810chr641414 539 63 35 ------
NM_030816chr122819 2346 12888 ----
NM_030820chr62945 330 126 ----
NM_030821chr42720 541 ------
NM_030885chr342117 2048 1941 1749 ------
NM_030906chr112533 205 --186 --
NM_030911chr1351442 1256 1212 1129 64 ------
NM_030912chr103962 616 45 --1770 --
NM_030914chr93965 611 367 ----1689
NM_030918chr164492 4000 3730 3390 2080 534 15070 33896 3429 1119 --
NM_030920chr1--1290 ----
NM_030922chr152748 676 --1808 --
NM_030925chr1331625 589 26 31938 633 550 ----
NM_030952chr131017 203 24 1106 1380 --
NM_030962chr1121197 128 1649 1196 --
NM_030964chr583497 3410 3128 2328 1366 1184 612 350 13577 23309 1389 --
NM_031205chr122386 376 ------
NM_031216chr1831673 408 123 ------
NM_031267chr71107 --1375 --
NM_031268chr1694767 3982 3752 3662 1915 1445 354 301 281 --25207 1152 --
NM_031271chr821461 1444 ------
NM_031284chr152129 84 ------
NM_031289chr122928 76 1125 --1885
NM_031309chr861971 1771 1639 516 448 168 2671 428 22080 47 --
NM_031407chrX1446 ------
NM_031411chr542317 2088 592 290 11870 ----
NM_031417chr196894 880 505 91 62 42 --12203 22233 608
NM_031419chr3152 11604 ----
NM_031431chr1311547 ------
NM_031439chr87714 560 341 251 200 128 28 21821 210 11357 1469
NM_031445chr242935 382 215 22 12844 ----
NM_031449chr7151834 1557 1445 1412 898 826 655 517 364 284 274 206 170 148 74 31420 546 489 51924 1900 704 323 55 --
NM_031453chr1032420 809 566 12267 ----
NM_031458chr3122 ------
NM_031459chr181268 1166 1045 542 497 200 131 32 --164 --
NM_031468chr7157908 7867 7491 7194 6805 5889 5747 5645 4989 2968 2842 2830 569 377 328 21879 34 47222 5906 2710 1713 12635
NM_031469chr684078 3400 3380 3261 2859 885 870 821 --31469 1342 1072 --
NM_031476chr1632651 2168 617 11096 1491 --
NM_031483chr2053332 2349 2254 1097 825 22847 807 22781 624 --
NM_031844chr133987 1156 373 --12673 --
NM_031849chr542317 2088 592 290 11870 ----
NM_031857chr542317 2088 592 290 11870 ----
NM_031860chr542317 2088 592 290 11870 ----
NM_031886chr1962429 2375 2217 2120 1707 1024 12279 ----
NM_031890chr2262735 2590 2534 2226 2076 361 1713 ----
NM_031892chrX1807 ------
NM_031934chr173318 276 34 ------
NM_031935chr1--11043 ----
NM_031936chr12311 120 ------
NM_031940chr852032 1987 1803 875 326 1778 ----
NM_031942chr221182 103 --1340 --
NM_031964chr17130 --166 --
NM_031989chr12178 ------
NM_031990chr1951411 496 358 229 76 ----1192
NM_031991chr1951411 496 358 229 76 ----1192
NM_032012chr984047 3995 3821 3651 3559 1681 432 197 21507 60 14684 --
NM_032013chr2061586 1517 1485 1459 1346 1211 ----1182
NM_032017chr191989 1884 1751 1732 731 706 627 406 46 41823 724 604 507 1467 3655 385 136
NM_032041chr832693 2528 341 ------
NM_032042chr542477 1049 775 85 32460 2300 1152 ----
NM_032050chr222972 273 ------
NM_032052chr2231357 933 98 1365 ----
NM_032088chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_032092chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_032102chr1122102 366 ----1381
NM_032105chr1117933 7025 6243 6184 6109 5422 3042 2432 1849 1547 201 47879 6495 1318 1022 17643 17161
NM_032108chr193976 391 168 --1848 --
NM_032128chr42939 922 ------
NM_032139chr191391 ------
NM_032144chr21334 11720 1218 --
NM_032181chr2189 ------
NM_032189chr13134543 4380 4269 4073 4009 3936 3905 3320 1723 1364 1259 912 637 34292 3748 697 11771 --
NM_032195chr211168 ----1115
NM_032199chr1031255 836 121 2183 23 --23026 1504
NM_032208chr243006 2702 224 212 33276 3012 1359 --12249
NM_032214chr2031141 164 60 1932 --11126
NM_032217chr411048 ------
NM_032228chr1133221 2797 2281 1202 ----
NM_032233chr142842 771 1806 154 --
NM_032239chr421176 1140 ------
NM_032242chr3123268 3096 2927 2575 2059 1259 905 736 216 204 130 44 12024 165 --
NM_032256chr12----1206 --
NM_032268chr1692758 2472 2249 1300 1240 799 439 420 370 42390 2062 867 238 12598 --
NM_032271chr1691389 1328 1309 1208 1186 561 198 128 40 31524 497 235 41374 1051 988 384 --
NM_032272chr83471 403 149 1335 1117 --
NM_032281chr1972927 2825 2438 2377 1168 811 106 32797 776 501 12369 --
NM_032287chr22113457 3116 3020 2985 2951 1034 1026 525 344 85 32 11695 13368 --
NM_032288chr332403 944 578 ------
NM_032291chr121522 176 ------
NM_032293chr91210 ------
NM_032294chr1741165 685 110 77 --11152 21435 669
NM_032320chr111280 ------
NM_032355chr3124 ------
NM_032357chr2135 ------
NM_032364chr122692 224 ------
NM_032369chr122674 69 --1154 --
NM_032373chr1065463 4239 4142 3589 1589 657 25293 5247 --1834
NM_032389chr112270 179 11014 ----
NM_032403chr571605 1576 1509 1349 1271 527 305 21223 50 ----
NM_032408chr721085 929 1304 1156 --
NM_032415chr73392 376 161 ----1190
NM_032431chr11101081 695 239 218 191 182 116 79 43 25 ------
NM_032434chr21123 ------
NM_032438chr621498 207 ------
NM_032440chr1042904 2191 907 793 12233 11056 --
NM_032441chrX41114 404 104 48 ------
NM_032444chr16111020 814 765 753 712 701 403 310 240 132 41 ----2855 158
NM_032445chr1552186 549 502 260 213 22391 2196 22169 65 --
NM_032451chr1641047 994 788 122 ------
NM_032457chr453426 3412 2378 732 645 12964 1542 --
NM_032466chr81285 144 ----
NM_032468chr81285 144 ----
NM_032482chr1982622 2019 1941 1887 1707 1034 1007 905 22455 1045 1361 --
NM_032484chr17127 ------
NM_032491chr1221257 835 --1485 --
NM_032499chr1531282 572 198 ------
NM_032509chr82624 231 12373 22136 2021 --
NM_032538chr6172640 2591 2358 2024 1930 963 570 540 533 514 485 282 202 118 76 57 44 --21748 88 --
NM_032539chrX1705 ------
NM_032547chr41373 ------
NM_032552chr9111791 1772 1478 1387 340 323 247 226 175 125 82 --41732 1638 1448 1428 --
NM_032560chr141119 ------
NM_032562chr103145 50 42 ------
NM_032569chr1641485 735 705 435 197 ----
NM_032582chr17127 ------
NM_032588chr11416 ------
NM_032594chr142870 433 ------
NM_032595chr1771589 1390 1087 989 461 220 94 ------
NM_032603chr22787 711 1299 ----
NM_032622chr431182 1091 378 --11192 --
NM_032626chr16------188
NM_032632chr1411642 ------
NM_032638chr361377 1226 507 468 143 100 2111 64 11027 1552
NM_032682chr32340 103 --12872 --
NM_032711chr17123978 3928 3813 3657 3380 3275 3196 3133 2800 1372 535 440 33254 465 455 23260 715 --
NM_032727chr1031350 229 192 1246 --167
NM_032765chr521002 918 --1750 --
NM_032781chr115619 135 115 53 41 1727 ----
NM_032786chr12131 1530 ----
NM_032788chr241600 1137 1023 286 11040 ----
NM_032808chr155837 824 781 158 79 ------
NM_032818chr982332 2099 1933 689 383 264 177 52 1246 32250 888 715 --
NM_032833chr121711 183 ------
NM_032838chr192131 121 ------
NM_032840chr1231207 312 197 --1393 --
NM_032858chr1162 ------
NM_032859chr1332945 1379 711 ----12513
NM_032871chr1181801 1598 1409 1283 1221 673 593 31 11909 ----
NM_032873chr1174496 3435 1400 1105 544 403 301 --23633 650 1101
NM_032892chr15--1138 ----
NM_032900chr1053613 3542 3131 1579 1565 --13661 --
NM_032906chr43212 171 36 --1232 --
NM_032918chr1221079 1033 ----1842
NM_032936chr71174 ------
NM_032946chrX3419 85 31 1341 ----
NM_032961chr411351 ------
NM_032968chrX1138 12615 --2995 882
NM_032969chrX1138 12615 --2995 882
NM_032973chrY1138 12614 --2995 882
NM_032983chr7102846 2772 2706 2495 2256 2121 1029 993 352 334 12074 ----
NM_032991chr431304 966 260 ----11015
NM_032995chr291646 1218 1120 561 544 513 444 354 330 ----11536
NM_033014chr911479 ------
NM_033018chrX71070 1056 831 344 322 282 63 3938 873 368 ----
NM_033020chr114160 --14468 --
NM_033027chr351137 243 228 85 25 1346 1795 --
NM_033030chr2--128 ----
NM_033044chr121071 967 ------
NM_033058chr8268 32 --1242 --
NM_033071chr61124 ------
NM_033081chr2031483 968 76 ------
NM_033082chr12185 ------
NM_033083chr363152 2697 2490 810 510 359 1597 ----
NM_033089chr203497 164 34 1950 ----
NM_033102chr171170 1095 980 332 166 68 51 ------
NM_033102chr171170 1095 980 332 166 68 51 ------
NM_033103chr1921087 951 1904 ----
NM_033116chr141265 ------
NM_033118chr206839 304 243 102 85 32 2743 664 --165
NM_033119chr161355 2301 215 ----
NM_033127chr12116 74 ------
NM_033129chr2081808 1666 1350 766 739 733 133 86 1705 --1513
NM_033132chr131125 ------
NM_033133chr17113197 2467 2337 1380 1336 920 786 644 584 323 281 31289 938 330 12421 12983
NM_033135chr1122244 142 ----11996
NM_033136chr511520 1288 ----
NM_033137chr511520 1288 ----
NM_033138chr731436 797 171 ------
NM_033139chr731436 797 171 ------
NM_033140chr731436 797 171 ------
NM_033143chr451258 424 249 198 134 ------
NM_033147chr21217 --1241 --
NM_033148chr21217 --1241 --
NM_033157chr731436 797 171 ------
NM_033181chr632906 1011 741 11560 ----
NM_033201chr1621001 861 11058 21016 61 --
NM_033211chr511687 139 ----
NM_033212chr162117 106 --1153 --
NM_033219chr9----124 --
NM_033221chr992563 2270 1941 1864 1774 1030 358 224 135 12292 21798 301 --
NM_033224chr7108057 7904 7351 6710 5805 5553 5463 5326 5160 1018 26663 6551 16164 --
NM_033225chr833166 1106 33 --1572 --
NM_033227chr51514 ------
NM_033228chr51554 ------
NM_033240chr1591345 1327 686 640 489 238 62 39 25 61367 1265 607 592 577 562 21608 551 --
NM_033244chr154865 847 206 160 7887 785 488 127 112 97 82 21128 71 --
NM_033251chr162355 310 ----1147
NM_033254chr31104 --1398 --
NM_033255chr13187 ------
NM_033260chr61618 ------
NM_033278chr111295 ----1312
NM_033285chr833649 1562 1330 11098 ----
NM_033300chr121008 40 11129 ----
NM_033309chr16----2863 427 1917
NM_033315chr17101428 871 708 677 459 448 252 217 184 126 11543 21681 275 --
NM_033319chr13543 379 197 ------
NM_033326chr11----11541 --
NM_033375chr1741280 1217 1115 245 31483 1017 542 ----
NM_033389chr1784255 4203 3769 3703 1515 1377 508 492 --13356 --
NM_033401chr16149 ------
NM_033407chr1----1515 --
NM_033419chr1781424 1249 1236 1118 317 294 227 172 1148 ----
NM_033420chr1981099 1081 935 490 379 257 238 170 --1150 --
NM_033421chr206688 632 616 591 532 245 1236 1226 --
NM_033425chr1143361 3119 2747 151 ------
NM_033429chr1531037 283 231 --21122 961 --
NM_033438chr1123 ------
NM_033449chr561822 1509 1420 690 627 90 21756 1548 ----
NM_033467chr11318 128 1253 --
NM_033503chr15143546 3472 3032 2975 2932 1304 1291 1229 1046 857 840 815 608 539 13128 23384 2819 --
NM_033512chr82773 164 ------
NM_033515chr611289 --11323 --
NM_033542chr2071450 1281 777 671 390 303 181 184 ----
NM_033549chr52814 252 2284 188 ----
NM_033551chr582841 2776 2748 2199 636 510 345 73 2678 423 12651 --
NM_033624chr1221669 302 ------
NM_033626chrX51669 1648 644 606 507 11454 ----
NM_033631chr193749 3669 3622 2479 694 482 371 196 47 13535 ----
NM_033632chr421336 388 ------
NM_033637chr10113890 3864 3727 3413 3393 3179 3111 1575 810 565 413 53922 3375 1122 521 182 ----
NM_033642chrX172 ------
NM_033644chr542395 2354 1957 90 1143 11638 --
NM_033645chr542395 2354 1957 90 1143 11638 --
NM_033656chr2185543 5480 5265 4649 4527 2260 1488 1373 24468 2156 ----
NM_052818chr1321372 223 21707 853 ----
NM_052840chr1521408 82 1522 1515 --
NM_052845chr12122950 2927 2821 2739 2723 2485 2445 2371 2051 1141 977 117 2406 132 33092 2912 2037 13192
NM_052849chr152287 177 ------
NM_052851chr132896 879 ------
NM_052854chr111137 1621 ----
NM_052880chr2231221 251 63 11173 1997 150
NM_052885chr1233982 1714 552 ----1105
NM_052897chr121562 ------
NM_052898chr821633 415 1723 ----
NM_052899chr58880 758 677 620 257 223 148 115 --1250 --
NM_052900chr811410 ------
NM_052901chr971775 1574 1364 1317 351 63 49 --1369 1456
NM_052910chr1351860 412 312 226 109 21409 772 ----
NM_052913chr61384 ------
NM_052925chr193936 402 38 1796 ----
NM_052927chr51131 11653 ----
NM_052934chr131916 733 530 21776 1451 --1713
NM_052950chr1342028 897 837 244 22075 1548 --11663
NM_052978chr1431699 1233 612 --11570 --
NM_053001chr84161 148 132 115 ----1269
NM_053016chr977975 6842 5606 3071 957 642 33 17338 35828 5319 5057 --
NM_053023chr1162762 1077 1000 731 645 251 ----133
NM_053024chr331493 1097 328 ------
NM_053025chr311526 11765 --1380
NM_053026chr311526 11765 --1380
NM_053027chr311526 11765 --1380
NM_053028chr311526 11765 --1380
NM_053031chr311526 11765 --1380
NM_053032chr311526 11765 --1380
NM_053043chr7106061 5682 3961 1892 1715 1603 1377 1028 758 473 22515 1860 12349 12340
NM_053056chr1172450 2319 1946 966 938 531 54 32704 1027 944 2931 75 --
NM_053064chr1442428 1017 341 278 12951 11202 --
NM_054013chr55815 614 589 213 35 1705 194 --
NM_054016chr12738 572 ------
NM_054016chr12738 572 ------
NM_054016chr12738 572 ------
NM_054111chr65394 355 235 172 155 1280 ----
NM_057161chr6--1530 ----
NM_057175chr42691 315 ------
NM_057178chr17142 --11961 --
NM_058175chr213719 712 245 1163 1689 --
NM_058237chr141154 ------
NM_078469chr1021189 426 --1984 --
NM_078473chr852032 1987 1803 875 326 1778 ----
NM_078483chr5123695 3135 2903 2610 2604 2491 1395 1265 1121 1056 931 260 32635 2616 1063 33372 2530 1367 --
NM_078487chr922318 291 13154 11332 --
NM_078629chrX1589 ------
NM_078630chrX1589 ------
NM_079834chr1981582 1517 1488 1423 1114 574 300 217 ------
NM_080491chr11163523 3244 3160 3033 2686 2648 2530 2504 2420 1394 876 854 665 427 287 121 43396 3354 1477 1461 1382 --
NM_080538chr341395 1033 531 456 ----1570
NM_080541chr341395 1033 531 456 ----1570
NM_080594chr163722 626 606 149 ----
NM_080599chr1021025 165 --1881 --
NM_080604chr63484 445 119 282 68 ----
NM_080616chr203622 248 52 ------
NM_080617chr201242 --1764 --
NM_080629chr111063 ------
NM_080630chr111063 ------
NM_080670chr55810 667 317 141 95 --1820 --
NM_080671chr231935 1919 1636 2852 557 ----
NM_080672chr201517 186 ----
NM_080683chr41180 ------
NM_080684chr41180 ------
NM_080685chr41180 ------
NM_080717chr1231057 972 470 ------
NM_080738chr131745 1442 435 21895 1695 21503 361 --
NM_080743chr632287 1871 1015 ------
NM_080744chr72198 145 --1444 --
NM_080764chr2261253 1082 693 550 440 409 --12317 --
NM_080829chr204231 154 67 57 1694 ----
NM_080832chrX2270 29 ------
NM_080836chr20174290 4042 4008 3879 3860 3567 3512 3327 1784 1367 1340 1010 894 836 598 134 61 --14161 13051
NM_080867chr14104518 4398 4036 3932 3812 3679 3195 1177 967 911 23601 1279 ----
NM_080881chr54174 123 94 54 --169 --
NM_130386chr182137 38 ------
NM_130434chr1511113 ------
NM_130436chr2131765 1091 793 --1913 12436
NM_130438chr2132342 239 62 ----13013
NM_130439chr1021574 494 2743 629 1756 --
NM_130439chr1021574 494 2743 629 1756 --
NM_130440chr161579 1334 601 543 88 58 ----1125
NM_130442chr75767 350 304 161 145 1240 ----
NM_130459chr971427 1206 1128 672 577 505 161 ------
NM_130466chr1261241 1161 644 534 127 54 --21330 757 --
NM_130469chr146947 843 830 376 318 130 ------
NM_130470chr112822 249 131 2785 577 --
NM_130471chr112822 249 131 2785 577 --
NM_130472chr112822 249 131 2785 577 --
NM_130473chr112822 249 131 2785 577 --
NM_130474chr114950 627 611 377 1159 2913 705 --
NM_130475chr114950 627 611 377 1159 2913 705 --
NM_130476chr112822 249 131 2785 577 --
NM_130766chr1741034 107 87 45 1919 ----
NM_130797chr771722 1436 1429 1278 1198 337 193 1702 1270 --
NM_130798chr153508 456 323 --1143 --
NM_130808chr31169 ------
NM_130811chr20--1108 ----
NM_130838chr1531727 661 573 --11174 --
NM_130839chr1531727 661 573 --11174 --
NM_130846chr121166 ----1257
NM_133170chr20157772 7337 7295 7247 5659 5618 5223 4983 2829 1906 1864 1679 1178 624 239 57542 5176 3121 2803 2165 21815 1367 --
NM_133172chr5180 ------
NM_133173chr5180 ------
NM_133174chr5180 ------
NM_133264chr1763736 3710 3333 2948 1311 997 1149 --11114
NM_133265chrX43347 3226 2873 867 --12581 --
NM_133329chr2--11546 ----
NM_133330chr452471 2394 922 98 51 1213 22988 234 --
NM_133331chr452471 2394 922 98 51 1213 22988 234 --
NM_133334chr485866 5082 5058 4889 3988 741 707 268 31507 853 808 54735 4437 2523 1771 1247 --
NM_133335chr452471 2394 922 98 51 1213 22988 234 --
NM_133369chr53742 342 220 1268 1940 --
NM_133370chr453064 2930 2563 479 202 ----1247
NM_133372chr532098 1919 464 11873 1505 1334
NM_133433chr51681 ------
NM_133445chr973111 3098 2808 1157 1010 326 164 ------
NM_133452chr194871 816 473 228 11010 1466 --
NM_133468chr752507 2440 2169 1617 526 ------
NM_133476chr126927 860 485 432 235 189 ------
NM_133478chr222185 2008 2980 814 ----
NM_133496chr174552 3443 3262 3018 925 792 168 22971 745 ----
NM_133499chrX4725 628 57 35 ------
NM_133625chr32173 67 2153 29 ----
NM_133634chr2111558 1108 21636 614 --
NM_133638chr51917 1441 129 --
NM_133647chr1563039 2852 2623 1328 572 424 170 ----
NM_133650chr61124 ------
NM_134268chr175985 932 866 342 327 1820 ----
NM_134325chr141451 602 268 65 11311 1496 1248
NM_134442chr251764 1597 1336 1297 389 --1650 --
NM_138270chrX83378 3145 2924 2902 2666 2390 669 404 12357 1658 --
NM_138281chr175539 503 197 178 97 162 2397 32 --
NM_138300chr141453 593 497 402 11334 2473 396 --
NM_138316chr10----125 --
NM_138324chr152667 94 ------
NM_138333chr932024 1730 463 ------
NM_138338chr2282711 2558 2518 2434 2303 526 306 32 ------
NM_138340chr18--153 ----
NM_138350chr171402 1357 986 543 387 126 80 ------
NM_138356chr156702 619 558 500 289 40 --2719 231 --
NM_138376chr142184 58 ------
NM_138396chr125320 312 296 236 213 ------
NM_138423chr1542196 759 526 235 1753 ----
NM_138426chr71579 ------
NM_138437chrX274 30 ------
NM_138444chr1354125 699 509 175 37 ------
NM_138453chr5124 ------
NM_138457chr6163350 2796 2790 2658 2414 2400 2091 1261 1093 940 913 894 875 504 321 139 --33191 562 81 --
NM_138459chr61412 1322 ----
NM_138468chr295711 5670 5535 5273 4289 3970 2437 2271 1813 31797 1610 1324 15731 --
NM_138473chr1254106 4085 3690 3208 314 24862 287 24654 4316 11433
NM_138479chr131688 136 45 11333 11878 --
NM_138559chr221342 226 1142 ----
NM_138576chr1464443 4356 4035 3378 1855 1482 ------
NM_138578chr2061428 1323 1068 1060 1019 923 1103 ----
NM_138621chr253588 651 633 405 98 11101 13546 11190
NM_138638chr141925 2160 53 ----
NM_138713chr1698272 5921 5647 5601 5240 2585 1665 626 482 16203 ----
NM_138714chr1698272 5921 5647 5601 5240 2585 1665 626 482 16203 ----
NM_138717chr62601 461 ------
NM_138727chr13942 925 490 ------
NM_138728chr13942 925 490 ------
NM_138731chr1443502 3406 2833 245 --11627 --
NM_138732chr113820 230 205 --1264 --
NM_138734chr113820 230 205 --1264 --
NM_138735chr2--1433 11071 --
NM_138775chr111261 ------
NM_138782chr522063 1941 11755 11885 --
NM_138795chr181511 1473 1440 1221 543 305 267 248 --1281 --
NM_138799chr242081 1915 1381 831 ------
NM_138811chr721147 31 ------
NM_138923chrX129 147 ----
NM_138931chr32181 33 ------
NM_138959chr1126486 6105 4728 4678 4302 1281 1078 785 734 681 577 263 45727 4448 2068 363 24911 4286 --
NM_138966chr181439 ------
NM_138967chr1552072 809 578 324 173 --11947 --
NM_138969chr831066 1046 536 --21259 437 1238
NM_138971chr1193220 2829 2702 1368 1128 1049 753 668 287 ------
NM_138971chr1193220 2829 2702 1368 1128 1049 753 668 287 ------
NM_138972chr1193220 2829 2702 1368 1128 1049 753 668 287 ------
NM_138972chr1193220 2829 2702 1368 1128 1049 753 668 287 ------
NM_138973chr1193220 2829 2702 1368 1128 1049 753 668 287 ------
NM_138973chr1193220 2829 2702 1368 1128 1049 753 668 287 ------
NM_138980chr41158 ------
NM_138982chr41158 ------
NM_138994chr16149 ------
NM_138995chr241323 313 279 198 ------
NM_139048chr33911 847 183 ------
NM_139057chr1562389 1930 1147 1073 181 72 22462 2208 ----
NM_139062chr171378 ------
NM_139067chr12192 --162 --
NM_139071chr1241253 1072 580 573 ------
NM_139072chr22600 216 ------
NM_139132chr112941 25 ------
NM_139135chr131061 979 360 ------
NM_139136chr1221002 318 ------
NM_139157chr113626 529 66 1128 ----
NM_139159chr195431 365 247 129 47 11053 1965 --
NM_139167chr8132 189 ----
NM_139168chr531923 1854 118 ------
NM_139201chr122536 203 ------
NM_139207chr122282 45 --174 --
NM_139211chr4123 ------
NM_139212chr4123 ------
NM_139241chr12164 ----149
NM_139244chr61127 ------
NM_139246chr971874 1462 877 759 704 622 132 1898 ----
NM_139248chr33793 727 220 ------
NM_139276chr1761877 1632 859 593 565 73 12213 1913 --
NM_139279chr22994 582 22800 2768 41415 1145 1023 662 1710
NM_139283chr1222038 912 ------
NM_139312chr1051308 1066 945 574 479 --1248 --
NM_139321chr2084139 3741 3633 3206 2836 1566 1195 928 --33128 1482 1259 --
NM_139323chr2021461 160 1132 1125 --
NM_144571chr456826 2415 1523 541 262 46852 4682 2648 524 ----
NM_144578chr1474350 3739 3632 3476 1846 895 562 --13465 --
NM_144579chr292518 2336 2206 1120 1013 775 688 110 38 31873 659 495 ----
NM_144583chr211652 --1694 1373
NM_144586chr281098 1036 945 925 886 286 186 44 ------
NM_144590chr1062644 2452 2396 1177 545 348 11984 ----
NM_144600chr162471 336 ------
NM_144604chr165370 356 342 179 52 ------
NM_144607chr173803 792 624 12648 ----
NM_144617chr192287 280 1576 2885 316 --
NM_144628chr20102842 2461 2425 2288 2084 1141 1128 914 523 507 22518 594 ----
NM_144631chr21254 1112 ----
NM_144632chr2----1940 --
NM_144635chr32948 256 ----1105
NM_144657chrX130 ------
NM_144664chr1162448 2431 2266 2260 2114 1922 11935 ----
NM_144704chr222213 84 ------
NM_144712chr2264 36 ------
NM_144778chr1322120 862 ------
NM_144967chrX3930 770 165 ------
NM_144973chr1284255 3371 1871 1609 1551 603 495 100 127 22009 1562 --
NM_144982chr12--1500 ----
NM_145004chr8182 ------
NM_145005chr93930 819 655 ------
NM_145008chr112763 670 --2686 54 --
NM_145010chr1052327 1764 1500 897 300 12146 ----
NM_145013chr1151939 914 866 623 38 12030 31143 458 23 --
NM_145048chr42954 96 ------
NM_145053chr111182 --1225 --
NM_145056chr191143 ------
NM_145102chr741242 1034 334 139 --11307 --
NM_145112chr1451102 1045 351 342 297 --1168 --
NM_145113chr1471374 1317 1010 623 614 569 214 --2440 154 --
NM_145166chr372650 2254 2246 2234 1917 420 367 1430 22915 2068 --
NM_145175chr251340 1003 470 232 21 ------
NM_145176chr633238 2841 292 --1146 --
NM_145206chr1073207 3199 2089 839 475 304 37 --33141 2164 286 --
NM_145239chr165858 452 376 336 141 --11026 --
NM_145243chr1145 ------
NM_145245chr1981273 992 833 506 447 353 61 39 ------
NM_145259chr256896 1835 1688 705 619 --16193 --
NM_145260chr25672 556 544 518 41 1566 ----
NM_145274chr173797 727 22 ------
NM_145277chr11233 1146 ----
NM_145313chr1021293 1090 --11482 --
NM_145320chr753389 3077 2813 2603 2553 --1478 --
NM_145321chr753389 3077 2813 2603 2553 --1478 --
NM_145322chr753389 3077 2813 2603 2553 --1478 --
NM_145330chr21180 --1156 --
NM_145349chr1791867 890 859 736 577 426 389 364 183 1647 ---