TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4679
miRNA Sequence: UCUGUGAUAGAGAUUCUUUGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr571825 1434 1295 583 476 448 43 ------
NM_000067chr81651 ----1567
NM_000084chrX66772 5777 5202 2295 1361 108 --12065 21389 42
NM_000091chr222597 2251 22027 1020 --12544
NM_000092chr294235 4125 4056 4039 3466 1244 905 321 314 --13735 1678
NM_000112chr554658 4524 1528 1008 467 23908 3360 22041 1754 --
NM_000115chr1392276 1906 997 744 666 611 481 243 149 ----11851
NM_000125chr694178 4027 3557 3443 3352 3255 2925 1263 282 13962 ----
NM_000138chr1562609 1788 887 573 488 84 --2818 90 --
NM_000245chr752079 1856 1738 1681 876 11906 2772 582 1348
NM_000259chr15106300 5139 4389 4043 2297 2160 2054 1715 1500 883 23876 1557 21722 726 --
NM_000264chr963191 2594 2318 2154 1127 464 --22770 2403 --
NM_000267chr1711300 1970 1663 13415
NM_000332chr696382 6257 4721 2682 1949 1726 276 156 142 14451 ----
NM_000337chr556522 5378 2447 1370 350 1716 ----
NM_000390chrX53281 2729 2554 2084 433 11086 11017 --
NM_000430chr1793705 3403 3396 2863 1410 1156 909 608 249 ------
NM_000461chr364420 3500 1235 837 773 399 1819 --13947
NM_000489chrX53077 2664 2385 2133 1251 12697 --139
NM_000555chrX117838 7767 7257 7227 7022 6919 6166 3095 3011 1260 815 --35194 5051 1442 --
NM_000618chr12116609 6295 6263 6173 5995 5615 4690 2012 1894 1446 459 26329 5118 35564 5430 2134 --
NM_000618chr12116609 6295 6263 6173 5995 5615 4690 2012 1894 1446 459 26329 5118 35564 5430 2134 --
NM_000663chr1653052 2730 2134 896 346 12784 --22970 419
NM_000671chr451435 1156 304 103 85 ----11085
NM_000724chr1041649 636 512 98 --1687 --
NM_000780chr8----2342 40 1185
NM_000793chr14115087 4910 4775 3743 3641 3580 3493 2039 1636 773 450 1740 23401 1676 --
NM_000809chr498827 8657 7674 7283 6908 5995 3421 2994 1959 58152 6238 3020 2263 1110 26275 3049 39200 6411 1134
NM_000813chr595217 5045 4271 4261 4249 3705 2155 2084 2023 ------
NM_000826chr432616 2425 2214 21718 355 152 11822
NM_000866chr341637 1526 1373 596 21434 1247 ----
NM_000868chrX32208 2127 747 ----12164
NM_000875chr15106213 5433 5214 4680 4446 1616 1598 1427 1160 470 --16196 --
NM_000899chr1234374 3748 3611 14187 1735 1888
NM_000901chr452559 1836 1716 997 932 1302 --11619
NM_000912chr863575 3390 3120 2358 1022 985 21088 1072 22164 531 12300
NM_000926chr11169250 8749 8115 7972 7492 7303 7030 6858 5708 3717 3597 2646 2583 2058 1785 1197 17843 21809 121 --
NM_000944chr42425 419 11541 11632 11924
NM_000950chrX63360 3147 2881 854 613 533 13186 ----
NM_001001419chr544126 1530 978 328 --24237 104 14259
NM_001001420chr544126 1530 978 328 --24237 104 14259
NM_001001484chr104756 731 712 164 21909 1849 ----
NM_001001664chr233775 3740 1189 13378 --11028
NM_001001668chr1953826 3448 2799 796 329 23013 1445 165 --
NM_001002860chr1442905 1808 1159 797 173 14614 13851
NM_001003652chr1877957 7656 5651 2984 2723 1604 56 --48451 6785 5434 336 --
NM_001003674chr18116726 6652 6206 5832 5482 4328 2619 2502 2144 2015 1188 ----14443
NM_001003675chr18116726 6652 6206 5832 5482 4328 2619 2502 2144 2015 1188 ----14443
NM_001003712chr1263673 3254 3035 2709 2627 91 12826 --1452
NM_001003800chr963751 3406 2291 1437 1023 545 ----12322
NM_001004065chr972868 1516 1510 792 776 642 598 --13005 --
NM_001005375chrY31542 1170 187 ----1163
NM_001005386chr21661 ----1870
NM_001005473chr5125611 4210 4053 2604 2542 2220 1651 1561 630 446 167 161 34062 1701 540 21261 522 15160
NM_001006600chr562248 2083 778 725 384 57 12202 ----
NM_001007023chr14115087 4910 4775 3743 3641 3580 3493 2039 1636 773 450 1740 23401 1676 --
NM_001007097chr945068 4241 3381 274 34519 3945 1726 11258 1962
NM_001007466chr644566 3871 3633 677 14072 23722 1432 --
NM_001008239chr1853329 3145 2728 920 80 22781 1102 --1195
NM_001008408chr765953 5282 1295 1165 382 361 12274 1327 --
NM_001008564chr1352058 2046 821 741 244 ------
NM_001008801chr1951821 792 479 422 34 12145 11732 1498
NM_001008925chr473516 2876 2351 1074 1050 317 304 22193 466 1363 --
NM_001009960chr782798 2466 2326 2020 1737 935 300 113 ----12296
NM_001009993chr253129 439 359 278 39 1470 23317 812 --
NM_001010846chr154317 3219 2920 1396 1134 13924 1417 --
NM_001010888chrX103437 2867 1852 1123 1115 920 797 743 729 222 --2685 550 --
NM_001010891chr575956 5840 5478 2107 1862 1851 1840 --45219 2773 2636 1817 15870
NM_001010922chr133536 1236 637 23075 1420 21483 756 --
NM_001010986chrX32408 1898 386 ----12506
NM_001011513chr474080 3643 3085 2538 1371 1103 842 ------
NM_001011537chr342378 2089 900 573 11648 --169
NM_001011666chr766021 4971 2428 2299 1759 1099 26034 4822 1872 --
NM_001011885chr1521212 191 1477 --11640
NM_001012393chr1154973 4237 3508 1560 1099 13569 --21939 49
NM_001012420chr1542271 2148 1007 937 1636 1445 1390
NM_001012423chr1532271 2148 937 1636 1445 1390
NM_001012755chrX54912 4041 1966 913 672 24707 812 21458 1321 --
NM_001012756chr1943255 2426 953 583 1880 32735 2608 2474 --
NM_001013415chr441307 1244 1220 223 --1587 1355
NM_001013620chr12128349 8288 7770 7089 6976 6082 5678 5424 2421 1625 810 121 --23097 2211 --
NM_001014380chr13115684 5592 5581 4468 4062 3907 1643 1330 1295 1250 1129 14569 1898 13647
NM_001014797chr1077855 5733 5613 3015 2461 1889 737 18238 ----
NM_001017368chr1742398 1809 221 32 12813 ----
NM_001018065chr9105338 5289 4888 4487 1910 1831 1722 1215 1053 982 11147 ----
NM_001018066chr9105338 5289 4888 4487 1910 1831 1722 1215 1053 982 11147 ----
NM_001018090chr1522672 352 1861 --11890
NM_001018091chr1532782 1807 462 1971 --12000
NM_001018102chr1522672 352 1861 --11890
NM_001018108chr1542189 1753 1440 92 ----1406
NM_001024956chr1184950 4874 2358 1860 1388 1248 1115 636 12158 ----
NM_001025077chr1086578 6036 4624 2048 1514 1138 1107 630 --15731 --
NM_001025108chr273931 3874 3320 3164 1629 1326 701 1973 11185 1344
NM_001025252chr832959 888 296 22334 2209 ----
NM_001025253chr832959 888 296 22334 2209 ----
NM_001025580chrX11316 1684 --24078 726
NM_001029851chr51557 1773 153 1537
NM_001029852chr51557 1773 153 1537
NM_001029853chr51557 1773 153 1537
NM_001029854chr51557 1773 153 1537
NM_001029863chr652883 2149 1098 1042 200 --11970 22248 2160
NM_001029875chr562850 2528 2388 1098 807 47 ------
NM_001031695chr2265219 5040 4641 4242 2147 1621 ----1328
NM_001031710chr721078 178 --1758 1365
NM_001031732chr443241 3049 1368 163 --13172 11037
NM_001031804chr1644146 4112 3666 2961 --12832 14228
NM_001032380chr1041817 1327 587 407 ----11569
NM_001032999chr2054304 1630 1109 1103 489 14894 11500 1648
NM_001033045chr264462 3578 3335 3118 1450 33 ----13930
NM_001033087chr2072986 2786 2746 2569 825 368 293 --1983 --
NM_001033578chr842395 1603 830 414 ----12060
NM_001035003chr471398 1236 1143 1063 949 930 498 --11124 --
NM_001035004chr471398 1236 1143 1063 949 930 498 --11124 --
NM_001037332chr572485 2129 1741 835 713 633 623 ------
NM_001037333chr572485 2129 1741 835 713 633 623 ------
NM_001037339chr111542 11451 --11718
NM_001037340chr111542 11451 --11718
NM_001037341chr111542 11451 --11718
NM_001037341chr111542 11451 --11718
NM_001039538chr243457 2435 2354 851 11123 23207 1166 --
NM_001039580chr465066 4947 4222 3971 1670 723 21724 1020 1631 14296
NM_001039590chrX64008 3670 1613 1245 1127 51 1307 ----
NM_001039591chrX64008 3670 1613 1245 1127 51 1307 ----
NM_001039618chr1165611 4644 4082 3842 3649 3626 25458 262 11668 --
NM_001039709chr2054304 1630 1109 1103 489 14894 11500 1648
NM_001039840chrX135419 4712 4644 4223 4166 2203 2189 2078 2050 2038 1412 1359 925 11530 ----
NM_001039937chr1383453 2917 1658 1358 1113 670 553 155 ------
NM_001040020chr751535 1463 1212 478 187 ------
NM_001040142chr2102184 2054 1632 899 877 864 730 595 436 43 ------
NM_001040143chr2102184 2054 1632 899 877 864 730 595 436 43 ------
NM_001040152chr784629 3467 3229 3189 1908 1138 392 162 11529 ----
NM_001040284chr1695353 5169 4505 3842 1889 1819 1373 1167 912 15301 11972 --
NM_001040402chr453101 2189 2173 912 118 ----12082
NM_001040446chr562735 2319 2271 1048 1005 511 1609 ----
NM_001040665chr7104920 4359 4194 3807 3633 3416 3112 1574 1304 297 24947 688 ----
NM_001040712chr942803 1169 180 130 23495 253 1293 --
NM_001042355chr1685415 5096 4156 3913 1236 871 717 282 --11386 --
NM_001042357chr1011027 --11084 1295
NM_001042358chr1011027 --11084 1295
NM_001042360chr1011027 --11084 1295
NM_001042363chr1011027 --11084 1295
NM_001042389chr1011027 --11084 1295
NM_001042390chr1011027 --11084 1295
NM_001042392chr1011027 --11084 1295
NM_001042395chr1011027 --11084 1295
NM_001042412chr1685415 5096 4156 3913 1236 871 717 282 --11386 --
NM_001042413chr993702 3681 3565 3507 3018 3006 2961 1510 1426 175 23056 183 11346
NM_001042453chrX41782 1362 607 577 --11537 --
NM_001042473chr1061964 1575 1566 813 752 101 1479 11353 --
NM_001042481chr1492585 2049 1839 1782 540 417 355 342 177 ------
NM_001042492chr1711300 1970 1663 13415
NM_001042494chr1522643 119 --12788 1191
NM_001042495chr1522643 119 --12788 1191
NM_001042496chr1522643 119 --12788 1191
NM_001042497chr1522643 119 --12788 1191
NM_001042510chr821683 1626 --1322 11331
NM_001042511chr821683 1626 --1322 11331
NM_001042550chr91326 11389 --11440
NM_001042555chr1264696 3743 2919 1402 426 232 --11683 13423
NM_001042599chr286876 6831 6364 6001 5344 5312 4970 456 1748 12631 --
NM_001042603chr1244329 4039 3669 1859 --1553 --
NM_001042604chr364409 4334 891 778 575 410 13914 21486 279 13923
NM_001044385chr223555 2647 11217 --1662
NM_001046chr552954 2842 2144 774 87 --21939 1203 --
NM_001079874chr141964 1640 750 610 1851 ----
NM_001083620chr432614 2423 2212 21717 354 152 11820
NM_001106chr369402 9048 6490 2433 2306 225 23165 570 49555 9514 3549 935 --
NM_001117chr1832452 2289 1939 ----12098
NM_001121chr1061925 1674 1476 1386 551 378 11286 11486 --
NM_001146chr842330 2064 1921 571 --11442 --
NM_001149chr10126 1204 --1377
NM_001151chr42233 32 257 25 ----
NM_001160chr1262697 2243 2146 2068 936 123 --1842 --
NM_001204chr2117793 7456 6819 6141 5131 4883 4816 2746 2640 2051 1443 23027 1936 14769 17444
NM_001259chr775860 5661 4921 1411 1288 1238 1070 ------
NM_001310chr1263031 2916 2811 2228 2173 2121 23062 2418 --12081
NM_001338chr2141075 849 499 178 --1306 --
NM_001390chr1863143 2467 2438 819 544 21 --12284 --
NM_001396chr2172470 2432 2396 2294 2205 679 268 11056 ----
NM_001415chrX2589 105 --41518 1383 558 426 11775
NM_001419chr1984782 4692 4082 3735 3513 3014 1504 1367 11494 ----
NM_001432chr461574 1418 773 743 468 318 12902 1913 --
NM_001438chr152888 2770 1269 1244 817 11409 --11145
NM_001455chr694738 3836 3372 3202 1795 1016 575 534 116 --11757 --
NM_001527chr6104658 4502 4325 3670 3413 3346 3258 1866 1811 586 13488 44712 3170 3036 448 24640 1113
NM_001616chr232937 2408 74 ----13121
NM_001650chr18103985 3924 3759 3032 1667 774 763 690 568 438 13322 ----
NM_001668chr152094 1866 1626 1603 1458 --12081 --
NM_001690chr332366 1907 1896 12308 2892 758 --
NM_001695chr873147 2726 2672 1608 1031 595 346 --1566 --
NM_001755chr1672191 1848 1409 722 638 582 191 --1799 11875
NM_001759chr1285052 3944 1959 1606 1176 934 282 127 11760 14754 --
NM_001851chr62157 110 ----1137
NM_001918chr198781 8404 7851 7054 2776 2419 1857 1842 206 --37174 7039 2247 16385
NM_001957chr452017 1772 1639 770 57 22329 2147 ----
NM_001968chr45792 786 362 303 27 --1229 --
NM_001981chr141923 1639 1633 1506 ----1164
NM_001987chr1254322 2656 1628 1558 1343 ----1831
NM_002006chr464879 3913 1832 869 451 330 35639 1662 1540 1348 --
NM_002025chrX158374 8162 7326 7153 6534 6515 6438 6378 3345 2044 1917 1441 1189 544 28 29262 8111 12596 --
NM_002033chr1183840 3688 3649 3086 3049 1263 854 518 1930 12793 1867
NM_002035chr1874015 3627 3611 3187 2776 2643 847 ------
NM_002092chr434751 1008 157 1300 34662 4423 4226 14289
NM_002128chr1342257 619 544 483 --22505 557 --
NM_002130chr531679 1162 104 ----1411
NM_002158chr263680 3499 3232 2883 1265 966 21396 1071 13183 --
NM_002210chr2112600 1400 1158 1052 930 855 779 735 663 627 451 ------
NM_002214chr784531 4517 4147 679 309 301 100 78 1702 21435 1300 --
NM_002223chr1273907 2891 2841 1058 578 534 222 ------
NM_002268chr321771 669 1306 --1182
NM_002270chr585263 5002 4727 3568 1091 939 890 98 ------
NM_002285chr273931 3874 3320 3164 1629 1326 701 1973 11185 1344
NM_002310chr565465 5043 4459 2534 1134 677 56290 5367 4282 4253 1751 16592 14484
NM_002336chr1235037 4405 3644 14395 11070 14512
NM_002374chr243457 2435 2354 851 11123 23207 1166 --
NM_002445chr841666 1608 1413 1038 --11176 --
NM_002480chr122540 287 1400 --1555
NM_002508chr151993 1730 1378 273 39 ------
NM_002545chr1154973 4237 3508 1560 1099 13569 --21939 49
NM_002581chr985050 4333 2203 1991 1712 1374 283 69 --25597 1858 --
NM_002594chr2032146 975 159 2690 572 ----
NM_002600chr111542 11451 --11718
NM_002610chr232428 2155 206 --12177 1510
NM_002613chr1675298 4870 1541 1149 1071 583 100 13485 14334 --
NM_002655chr885126 5086 4814 4131 3800 3619 2068 232 23658 1946 --24196 27
NM_002670chr341107 388 56 49 11624 ----
NM_002709chr272503 1371 665 640 565 263 110 1484 ----
NM_002731chr152769 2633 2432 2082 923 ------
NM_002747chr1821693 1330 --21605 430 11878
NM_002760chrY125703 5619 5035 4468 4434 4281 4256 3705 2238 1851 901 282 2594 464 ----
NM_002822chr1271841 1800 1745 1721 1177 242 230 ------
NM_002839chr942803 1169 180 130 23495 253 1293 --
NM_002886chr365002 4338 3853 3663 3488 660 1856 24490 3949 --
NM_002906chr1142367 1644 479 296 1750 1670 --
NM_002977chr283332 3034 2883 2541 784 708 320 28 23369 742 12679 --
NM_003010chr1772136 1748 967 553 547 298 191 1879 177 22095 1652
NM_003034chr12128008 6670 5097 4953 2930 2877 2739 1565 1436 1269 1244 696 17218 46628 6494 6295 2262 17433
NM_003043chr331724 1004 62 42970 1410 124 77 ----
NM_003099chr1596339 6254 6242 6188 6083 5745 4064 1808 393 11788 --12337
NM_003108chr277296 7152 6514 6459 6412 4803 4644 27288 1647 15222 --
NM_003112chr762931 2901 2858 1284 985 253 --1756 188
NM_003144chr621823 488 ----11737
NM_003161chr1783307 3292 3258 3120 2475 1356 1085 114 12488 12686 12779
NM_003199chr1874727 4252 4055 4025 1724 974 956 ----1142
NM_003262chr375222 4765 4318 2031 1282 410 228 11869 24682 4546 --
NM_003292chr132008 1819 1554 1738 1634 --
NM_003298chr395956 5781 5288 5270 4545 1688 1435 1106 897 15018 ----
NM_003348chr1221658 1068 --1554 199
NM_003412chr363133 2962 2250 2001 913 49 --1603 --
NM_003423chr1992537 2490 2283 1643 913 809 772 358 64 --12268 1398
NM_003468chr253443 3219 2838 2730 1428 --14067 --
NM_003472chr631394 931 470 1283 --11345
NM_003473chr104979 816 688 439 --1371 --
NM_003478chr1153109 2666 2053 159 103 13002 12345 --
NM_003483chr1282962 2676 2601 749 717 403 213 163 ------
NM_003489chr2163279 1185 995 660 466 317 22645 756 ----
NM_003574chr1884644 3680 2232 1990 1834 1524 1198 459 --25635 722 --
NM_003583chr1232941 2600 1362 1317 --1726
NM_003590chr263191 2897 2728 1586 317 222 12976 1109 --
NM_003607chr184319 3640 3421 3165 1113 762 353 306 12942 ----
NM_003615chr343837 3303 1538 1011 ------
NM_003618chr22916 417 --21096 854 1808
NM_003629chr141231 1221 878 709 ----22746 1187
NM_003663chr322570 1319 ----13266
NM_003671chr973613 3545 3423 3405 2778 809 596 11121 ----
NM_003679chr193205 3197 2960 2434 2299 2185 965 382 211 ------
NM_003719chr51557 1773 153 1537
NM_003758chr1531051 619 272 --21476 227 11573
NM_003758chr1531051 619 272 --21476 227 11573
NM_003759chr454214 3600 2813 1542 247 ----13473
NM_003774chr1252639 2499 2206 433 155 ------
NM_003822chr172800 2764 2673 1260 988 415 230 21216 284 12905 23021 2252
NM_003825chr1541479 1382 1079 140 --21063 569 --
NM_003831chr1821634 1596 11697 1640 --
NM_003873chr1022352 1882 12379 --11895
NM_003909chr862504 2360 2337 2291 1895 392 12555 ----
NM_003913chr653351 2660 872 705 58 13319 1238 --
NM_003958chr683477 3437 3192 2786 2547 1425 1052 212 1562 11170 1695
NM_003983chr1683980 3940 3328 2890 2840 2744 1691 114 21631 278 --1768
NM_003994chr1234374 3748 3611 14187 1735 1888
NM_004028chr18103985 3924 3759 3032 1667 774 763 690 568 438 13322 ----
NM_004080chr71416 1972 --11307
NM_004081chrY31542 1170 187 ----1163
NM_004093chr1363230 3166 2800 2305 1143 441 32162 718 645 ----
NM_004109chr1132117 1938 192 ----11723
NM_004124chr1453097 1096 492 172 101 1301 12408 --
NM_004136chr1563310 2840 1147 861 693 584 --12794 --
NM_004171chr1198950 7703 7590 7191 7088 3028 2660 2455 2254 23372 1305 12212 --
NM_004229chrX52230 2102 1666 1655 1460 1897 ----
NM_004232chr1893662 3461 3358 3242 2969 2790 1397 1238 255 --1843 12984
NM_004293chr973779 3593 2831 2531 1354 1232 134 11492 ----
NM_004296chr1471429 756 693 575 471 386 228 1602 --13931
NM_004331chr842007 1981 1948 56 --22179 1961 --
NM_004338chr18116726 6652 6206 5832 5482 4328 2619 2502 2144 2015 1188 ----14443
NM_004342chr751973 1458 819 584 267 --2795 169 --
NM_004392chr1362553 2213 1964 1920 972 244 1413 ----
NM_004438chr272383 1093 1021 938 867 849 369 1179 1402 --
NM_004458chrX52371 2169 2161 980 867 --1603 --
NM_004464chr453929 3451 3267 3194 664 21476 322 12612 11319
NM_004496chr1451236 1203 970 897 439 ------
NM_004514chr1751911 648 504 383 167 12292 22176 962 --
NM_004586chrX65347 5233 5105 4960 1718 770 25426 3966 ----
NM_004612chr994334 3687 3188 1866 1597 1231 1129 613 359 11478 11655 --
NM_004703chr1752318 1863 1754 1620 102 21820 370 ----
NM_004719chr1282704 2596 2111 1853 1101 699 564 79 ------
NM_004726chrX95388 4085 3905 3826 3741 2156 1283 423 201 24901 86 34035 2102 1967 --
NM_004734chr1322980 2011 ----12820
NM_004738chr2072669 2186 1721 935 754 111 69 11870 ----
NM_004745chr866913 6405 6058 1350 1187 222 17000 14886 --
NM_004748chr1532833 1594 456 14116 11134 23005 2647
NM_004763chr21168 7786 730 450 394 338 282 265 ----
NM_004775chr1892411 2136 2033 1829 906 716 602 92 45 1138 ----
NM_004776chr2053284 2807 2792 2297 805 ----1128
NM_004815chr184510 4472 3775 1626 1516 1369 466 187 24387 1673 11314 --
NM_004827chr471863 1834 1651 1551 201 155 105 ------
NM_004863chr1495224 5217 5026 4893 4781 4480 1511 683 289 --11459 --
NM_004866chr534157 1207 216 11497 13885 23788 684
NM_004904chr766021 4971 2428 2299 1759 1099 26034 4822 1872 --
NM_004921chr1102579 2387 2375 1587 996 979 834 581 441 258 ------
NM_004929chr821293 951 ----1535
NM_004956chr773538 3275 3176 3117 962 757 703 --11828 13937
NM_004965chr211696 ----1536
NM_004973chr621636 1248 ----11539
NM_004985chr12114545 4133 3639 3527 3419 1043 874 832 632 378 61 23044 1032 13367 --
NM_004992chrX77736 5967 5578 3110 2422 2034 615 12062 --12273
NM_004992chrX77736 5967 5578 3110 2422 2034 615 12062 --12273
NM_004999chr653890 3066 2827 244 22 --24366 132 --
NM_005044chrX84175 3554 2987 2953 2800 2775 1028 99 2470 297 11802 11313
NM_005054chr241707 1579 1257 1124 1618 ----
NM_005056chr1254573 4283 3913 2103 131 --1797 --
NM_005065chr1454942 3396 1287 1016 617 --11181 1879
NM_005079chr832959 888 296 22334 2209 ----
NM_005093chr2054304 1630 1109 1103 489 14894 11500 1648
NM_005121chr1773169 2602 814 798 719 270 214 22514 824 ----
NM_005126chr362323 2254 881 648 339 258 1566 ----
NM_005135chr1522643 119 --12788 1191
NM_005156chr954541 4250 1877 913 884 12009 24394 3545 --
NM_005188chr1187434 2413 1430 881 531 262 130 99 28167 2846 15121 15399
NM_005197chr1456108 5595 1295 945 584 15766 24421 362 13779
NM_005207chr2263641 3172 1415 230 92 82 23183 1296 43699 2363 846 184 --
NM_005233chr351888 1697 706 311 297 12626 ----
NM_005235chr286876 6831 6364 6001 5344 5312 4970 456 1748 12631 --
NM_005259chr251163 610 268 247 193 1369 --11074
NM_005277chr421850 474 11828 --11663
NM_005339chr493877 3869 3820 3562 3311 2789 1651 1490 1250 --1395 --
NM_005342chrX82789 1999 1970 892 846 126 120 107 ------
NM_005359chr1856152 2566 2060 1183 838 --22217 1005 --
NM_005475chr1251286 915 904 705 359 1219 --12711
NM_005497chr1775626 5528 4588 4509 4284 583 33 15862 24968 4944 13934
NM_005504chr1285485 5208 4192 2541 1344 1132 558 406 --14475 --
NM_005570chr1831200 186 84 ----11151
NM_005578chr384465 4389 1780 1581 1162 571 385 352 15073 1725 --
NM_005596chr955865 5699 5114 1237 1221 24420 4197 1335 --
NM_005647chrX83455 3009 2931 2826 2197 957 872 209 ------
NM_005665chr144763 4088 152 50 13054 1769 13355
NM_005668chr574241 3547 1599 1591 1303 1137 655 24451 3313 24320 929 --
NM_005722chr21661 ----1870
NM_005739chr1552060 2049 1955 1611 671 ----12139
NM_005746chr73899 485 308 --189 --
NM_005748chr1242565 2184 1344 762 --22409 1031 --
NM_005759chr254524 3708 1228 118 29 ------
NM_005807chr13502 171 141 2701 188 ----
NM_005840chrX45354 5117 414 184 11202 16606 12058
NM_005842chr131564 2733 504 124 --
NM_005845chr1341575 620 358 321 ----11688
NM_005853chr161384 ----1456
NM_005898chr1193220 2486 2186 1210 943 928 542 474 287 13062 12274 11085
NM_005901chr1877957 7656 5651 2984 2723 1604 56 --48451 6785 5434 336 --
NM_005902chr1553474 976 779 343 285 11155 23742 2985 24309 3904
NM_005903chr544126 1530 978 328 --24237 104 14259
NM_005909chr543609 2993 1428 1179 11397 23394 2896 --
NM_005941chr883258 3223 3001 2586 2574 1106 769 756 --23056 960 --
NM_005955chr155341 4315 4079 3999 645 14439 32115 1981 801 --
NM_005966chr241923 1606 1465 116 --12288 164
NM_006007chr964487 2866 1032 965 166 116 --24243 3918 --
NM_006113chr141964 1640 750 610 1851 ----
NM_006154chr1582713 2655 2638 2213 1147 950 508 126 32433 969 614 ----
NM_006203chr5114987 4705 4508 4468 4388 3851 2088 1242 765 86 67 25401 1453 11859 --
NM_006252chr1117528 7482 7469 7127 6049 5501 5272 2337 2218 1609 266 37489 6628 5293 16770 --
NM_006283chr884473 4231 3719 1841 1683 1659 1172 502 ------
NM_006298chr653237 2102 1171 981 99 1508 ----
NM_006306chrX115137 4924 4625 1917 1821 1749 1386 948 748 491 251 --12062 15357
NM_006315chr484042 3800 3400 3345 3219 3176 1209 200 1181 ----
NM_006393chr1053545 1789 1544 935 702 14508 24328 4261 --
NM_006403chr621617 1185 11177 --11538
NM_006457chr474080 3643 3085 2538 1371 1103 842 ------
NM_006482chr1232941 2600 1362 1317 --1726
NM_006504chr1032830 2815 75 --32801 2291 2258 --
NM_006544chr14105990 5789 4676 4591 4084 3912 3756 2298 2121 1265 142 ----
NM_006547chr731974 293 95 --21522 428 --
NM_006599chr1668106 6138 6044 2795 1251 1201 17782 --15223
NM_006609chr221191 836 12667 --11076
NM_006620chr654835 4129 3305 1803 763 14874 34269 3808 3784 13061
NM_006646chr1363070 2594 2378 2122 1066 235 --12932 --
NM_006654chr1264696 3743 2919 1402 426 232 --11683 13423
NM_006682chr782861 2769 2357 2247 2068 1787 1151 94 ------
NM_006716chr731376 247 42 1107 --1182
NM_006750chr1688037 7144 6531 5587 1404 1211 171 36 12406 11757 --
NM_006873chr293173 2884 2802 2795 2405 2229 1399 1143 900 ------
NM_006915chrX52366 1602 1008 674 147 --11983 --
NM_006918chr1184950 4874 2358 1860 1388 1248 1115 636 12158 ----
NM_006920chr272073 1911 1616 1508 607 382 42 11937 ----
NM_006924chr1721469 752 2511 201 54400 4366 4094 2981 1358 --
NM_006948chr2142093 1507 464 407 --12404 1100
NM_006956chr732312 2268 2185 1151 3565 555 287 --
NM_006988chr2141092 864 335 287 ------
NM_007006chr1653291 2905 2827 1208 632 --13400 11098
NM_007007chr1294367 4260 3946 3362 3010 1864 862 656 396 13184 14475 11126
NM_007011chr1596863 6161 5701 5616 4816 2538 2258 2035 541 12590 16128 --
NM_007030chr564508 1415 1223 594 275 72 21926 931 --62081 2050 2019 1988 1957 1895
NM_007038chr2185553 5014 4980 3763 1721 1573 808 342 11840 ----
NM_007039chr1461885 1629 1585 1499 1454 45 1784 ----
NM_007050chr2047576 6550 6528 2400 15840 27989 5657 --
NM_007054chr573862 3471 3286 3009 1071 283 22 --43870 2912 2778 2491 --
NM_007107chr372242 1508 953 888 391 303 260 ------
NM_007114chr343234 2449 556 163 ----1928
NM_007137chrX44744 3921 1892 497 23352 1111 25085 1708 --
NM_007159chr341643 1485 1262 51 11244 11213 --
NM_007172chr2253121 2743 2689 2430 670 --12095 12614
NM_007173chr1132435 1643 197 12020 1894 12105
NM_007203chr972868 1516 1510 792 776 642 598 --13005 --
NM_007236chr151881 --11747 31972 1613 185
NM_007238chr2063555 1720 1155 1138 749 518 54620 3046 1462 1023 357 21374 84 --
NM_007249chr13158650 8314 8294 8204 8029 7987 7928 7363 6726 6101 5925 1764 1129 870 81 37759 1859 426 29436 2453 --
NM_007331chr462686 2436 2393 2266 2228 258 21086 775 ----
NM_012072chr2054399 3561 1262 1079 733 1779 1716 --
NM_012089chr111448 1446 --11575
NM_012095chr1073470 3013 2368 2150 981 658 395 21102 469 ----
NM_012120chr642850 2687 2182 901 --11168 12499
NM_012141chr1383453 2917 1658 1358 1113 670 553 155 ------
NM_012164chr9117483 7214 6758 2343 2130 1829 1676 1602 437 359 115 35851 1710 964 12479 15210
NM_012193chr1165038 4576 4195 1743 1613 1036 14611 --14437
NM_012234chr353582 2595 2415 792 315 1581 ----
NM_012249chr262402 2303 1125 773 277 257 1361 12285 --
NM_012252chr784313 4232 3331 2144 1057 848 653 155 --1170 --
NM_012262chr164371 4257 2104 1330 1236 507 --11172 --
NM_012287chr394552 4450 4331 4080 3524 3215 827 712 66 23640 1122 11506 11777
NM_012288chr634883 2193 529 23483 1247 25708 1755 11847
NM_012290chr241631 1396 618 158 ----11085
NM_012301chr7101951 1919 1894 1517 1432 691 389 172 92 66 32181 2117 789 --1270
NM_012347chr642563 2273 520 354 12556 --12485
NM_012382chr564568 3915 3348 2811 967 711 1778 ----
NM_012420chr1042307 1997 788 388 21865 449 --11836
NM_012479chr762076 2004 1851 1727 952 592 12773 22548 608 --
NM_013229chr1262697 2243 2146 2068 936 123 --1842 --
NM_013231chr1494319 4194 3647 3397 1666 832 815 200 85 --33564 3370 3174 --
NM_013243chr1541033 480 410 123 1237 11330 --
NM_013255chr796982 6294 6068 3298 2371 1974 727 459 136 1752 12202 12978
NM_013257chr842395 1603 830 414 ----12060
NM_013261chr442854 2595 2489 1148 11086 ----
NM_013309chr1522584 277 4455 259 228 48 ----
NM_013352chr62926 39 ----1732
NM_013374chr393029 2830 2643 2436 2133 2098 651 627 174 12556 21220 240 --
NM_013386chr131798 479 460 --1190 --
NM_013447chr1963742 3486 3395 3347 3099 304 13435 ----
NM_013989chr14115087 4910 4775 3743 3641 3580 3493 2039 1636 773 450 1740 23401 1676 --
NM_014021chr132578 724 630 22669 604 11297 --
NM_014028chr6102612 1179 1099 821 761 585 486 386 242 31 ----13072
NM_014048chr16124942 4424 4339 4229 3462 3316 1951 1463 1253 1149 227 140 34294 3678 118 11303 --
NM_014089chr1352058 2046 821 741 244 ------
NM_014106chr1531873 722 111 21948 1131 2840 707 --
NM_014112chr8105405 5241 5129 4520 3885 3383 2080 2034 1510 1407 34405 1171 102 15095 --
NM_014155chr1197453 7445 7115 6843 6564 5953 1313 978 107 15259 ----
NM_014243chr482011 1645 1368 812 629 547 341 231 --1650 --
NM_014309chr2265209 5030 4631 4232 2137 1611 ----1318
NM_014331chr4147565 7381 6663 6411 5763 5297 5289 5207 5021 4744 2372 953 885 90 22319 2251 25603 5013 --
NM_014333chr1172706 2642 2212 2108 1744 750 544 12226 ----
NM_014376chr572485 2129 1741 835 713 633 623 ------
NM_014388chr185599 4569 4203 3905 2188 761 617 323 186 --25236 1830
NM_014393chr842373 2001 1585 66 12159 12142 --
NM_014415chr331315 1050 1043 154 11070 --
NM_014423chr595547 5301 3979 3780 1099 758 726 576 50 14406 ----
NM_014630chr1573505 2891 2771 2496 1332 585 197 ------
NM_014636chr993853 3677 3338 3056 1276 1251 940 563 113 --11343 --
NM_014647chr1651774 1590 877 798 637 ------
NM_014677chr851344 1090 876 418 25 --2853 62 --
NM_014701chr1533350 2623 2506 13229 12384 13276
NM_014702chr663376 2845 2715 1103 675 74 --13418 129
NM_014711chr1661950 1759 1345 813 738 490 1311 ----
NM_014737chr2053853 3634 2687 2672 1654 13261 23566 3429 13968
NM_014739chr654195 4187 3455 2764 21 23349 3005 34156 4112 1437 --
NM_014743chr432427 2187 2109 1825 --1625
NM_014746chr2104290 3721 3057 2928 1684 1468 1181 1069 162 122 --33385 3250 1389 --
NM_014755chr252893 1429 1419 845 131 13576 --14166
NM_014787chr152157 1972 1940 339 57 176 21135 1022 12626
NM_014803chr1042613 2329 2314 968 --1216 12108
NM_014810chr143553 1112 371 142 --2169 84 1803
NM_014819chr562484 2120 1560 959 580 472 ------
NM_014826chr184319 3640 3421 3165 1113 762 353 306 12942 ----
NM_014828chr1462360 1849 770 445 320 101 22002 1598 1579 12146
NM_014829chr562307 1793 1582 957 531 411 ------
NM_014836chr1041817 1327 587 407 ----11569
NM_014839chr142204 1640 859 620 11626 --12547
NM_014873chr1124754 4581 4498 3917 3247 2979 1743 1112 703 277 256 237 ----34137 3792 3135
NM_014877chr1776477 5406 5152 5124 2565 1851 1298 37319 7011 5168 26175 1824 --
NM_014888chr751535 1463 1212 478 187 ------
NM_014893chrY42351 1628 781 379 12100 ----
NM_014897chr1763165 2784 2038 1219 954 486 1181 22733 2600 --
NM_014904chr1033739 1203 107 --13478 12680
NM_014906chr1763673 3579 2922 2868 431 208 13341 12985 --
NM_014920chr653648 3525 2787 1170 1067 13553 ----
NM_014923chr1351882 1863 900 755 31 1623 ----
NM_014932chr33776 760 556 ----11369
NM_014946chr282983 2899 2202 2039 967 293 222 99 ------
NM_014947chr1--11239 --21186 681
NM_014949chr11218 ----2866 738
NM_014982chr1454273 3994 3525 1539 570 1393 11701 --
NM_014989chr621390 201 11799 --1751
NM_015025chr272631 2405 2394 1958 1812 1676 525 ------
NM_015026chr1263815 3615 3474 3331 1497 840 11190 33680 1330 161 --
NM_015032chr1362866 2707 2439 929 590 163 ------
NM_015035chr2064880 4481 2614 2297 465 284 31357 297 143 11318 --
NM_015039chr164304 4216 3787 3380 2991 925 --23659 2807 --
NM_015040chr233005 1306 371 1932 23252 794 12407
NM_015059chr1583951 3060 2973 1284 1103 1067 920 184 1402 ----
NM_015071chr575892 5445 4579 3992 2394 2386 972 15856 --25482 5433
NM_015076chr664509 4148 3935 3782 1543 758 1477 ----
NM_015092chr1634574 4400 820 24050 1022 1438 --
NM_015115chr453101 2189 2173 912 118 ----12082
NM_015130chr441330 956 553 195 21174 532 ----
NM_015137chr852004 1988 937 756 738 --12069 --
NM_015138chr1532299 2258 1994 --144 12058
NM_015170chr851575 1568 744 728 546 --1864 12142
NM_015172chr111082 ----11636
NM_015187chr45962 720 673 300 158 --2357 230 1263
NM_015192chr2083016 2299 2166 2028 1887 1171 491 66 1376 --22083 552
NM_015199chr342421 2297 373 28 1677 ----
NM_015206chr1583317 3141 3111 2858 2564 1560 1374 203 --13097 --
NM_015235chr1031740 1668 265 22071 1822 ----
NM_015247chr1685415 5096 4156 3913 1236 871 717 282 --11386 --
NM_015265chr232400 994 545 --2298 283 --
NM_015275chr1241654 1563 124 101 22022 1398 ----
NM_015291chr123100 2679 13243 --13520
NM_015310chr8108354 6527 5396 5313 5132 2982 2893 2710 2681 1324 31687 484 462 1504 16433
NM_015313chr1154203 3763 3355 3316 172 13255 ----
NM_015317chr282650 2571 2132 976 625 381 327 295 1894 --1852
NM_015323chr641379 618 280 65 ----11514
NM_015349chr643068 2059 755 369 12803 2194 133 --
NM_015355chr175804 578 180 89 41 ----21510 693
NM_015360chr52176 151 1139 154 --
NM_015365chrX11316 1684 --24078 726
NM_015375chr175044 4890 4351 3819 1969 752 580 13746 24753 3954 --
NM_015387chr271952 1600 842 656 294 257 31 1818 ----
NM_015393chr453128 1467 1094 621 400 23045 1500 ----
NM_015436chr473335 2695 2170 893 869 136 123 1285 1182 --
NM_015455chr583740 3562 3464 2931 2623 2500 1426 1102 ------
NM_015532chr1522672 352 1861 --11890
NM_015564chr562276 2190 1129 718 693 25 --12803 --
NM_015565chr2122051 223 --11934 1305
NM_015630chr241031 830 777 423 ----190
NM_015886chr895218 5110 4664 4440 3784 2212 1958 1873 957 14208 15416 11675
NM_015888chr132459 906 649 12256 11139 --
NM_015891chr672061 1925 1607 1412 830 803 681 21717 96 ----
NM_015904chr22750 609 ----1307
NM_015906chr154622 4465 3650 1464 781 --11369 --
NM_015920chr152102 59 146 --1546
NM_016009chr164875 4627 4315 3206 1815 1553 1491 14345 1173
NM_016021chr651145 1085 681 586 480 ----11113
NM_016076chr163131 3059 2797 1267 1098 279 ------
NM_016083chr692837 2557 2470 1551 1532 1324 1121 754 199 ------
NM_016096chr821683 1626 --1322 11331
NM_016107chr561400 1280 1226 1079 529 468 --11028 --
NM_016132chr1523141 2705 ----23119 3003
NM_016195chr102647 41 ----1634
NM_016206chr3139025 8943 8833 8805 7696 7310 7079 6865 6634 6567 6505 1669 1093 11726 17657 16936
NM_016221chr541917 719 430 361 1371 --11634
NM_016248chr1333585 2776 2519 1524 --12855
NM_016260chr256346 5523 5229 4701 2904 26515 1227 14872 26404 2830
NM_016277chr641434 1110 1055 31 1334 ----
NM_016289chr261884 1710 1468 920 612 585 ------
NM_016513chr653648 3525 2787 1170 1067 13553 ----
NM_016530chr1543183 1371 411 86 33817 2836 1273 ----
NM_016531chr484009 3455 3448 3265 2869 2710 1093 699 23832 265 12987 --
NM_016542chrX41782 1362 607 577 --11537 --
NM_016603chr572088 1484 710 693 612 574 28 1425 ----
NM_016824chr1061925 1674 1476 1386 551 378 11286 11486 --
NM_016929chr634634 3394 1030 23118 70 1835 11191
NM_016953chr296054 4913 4670 4252 4064 2313 2136 1247 812 11886 34390 1821 1686 1701
NM_017415chr564500 4483 4365 4064 1384 1004 2767 431 24056 159 --
NM_017420chr1421189 1146 --2675 155 --
NM_017548chr342031 1682 398 376 ----11409
NM_017594chr953371 2882 990 744 411 1191 11241 12585
NM_017628chr465182 4493 4163 3339 1083 597 35301 3207 2128 14528 --
NM_017637chr9117155 7145 5992 5860 3443 3249 2900 2882 2142 763 603 --13574 --
NM_017644chr375051 4242 3465 1974 1799 686 565 --13923 --
NM_017650chr785263 5221 4837 3699 2092 1812 990 973 24952 1163 25971 4905 --
NM_017658chr1464032 3905 1817 1739 1186 182 ------
NM_017666chrX31890 1790 288 11975 11580 --
NM_017719chr352252 2163 2134 2122 711 ------
NM_017762chr1551717 1645 763 579 322 --1216 1678
NM_017813chr895308 4841 4665 4312 3640 1378 926 903 33 --24170 2078 --
NM_017824chr1032597 606 435 1994 22141 808 --
NM_017847chr14593 553 323 156 ----1297
NM_017902chr1085553 4809 3663 3557 2140 1947 1442 1100 12261 ----
NM_017919chr995806 5164 4596 4238 3991 3640 2329 1813 1261 13649 ----
NM_017938chrX51918 1803 1780 1616 767 ------
NM_017944chr1142405 1954 769 367 --12903 12134
NM_018015chrX21147 105 ----126
NM_018017chr1052406 2260 942 702 286 12443 ----
NM_018018chr1241565 1464 1248 94 --11506 21899 707
NM_018121chr1022541 2110 159 1363 2819 82
NM_018133chr332192 497 221 21975 212 ----
NM_018155chr333316 936 155 12838 149 11144
NM_018177chr421118 229 ----1211
NM_018247chr663125 2723 2301 2140 394 210 12898 ----
NM_018257chr2052573 2123 1617 1596 999 21017 258 ----
NM_018287chr1021260 977 ----11107
NM_018293chr362650 2228 1931 923 807 238 2332 163 --12828
NM_018313chr332590 1821 126 2554 426 ----
NM_018315chr441307 1244 1220 223 --1587 1355
NM_018323chr431683 365 152 11156 160 --
NM_018339chr981811 1140 679 627 566 259 177 144 --1183 11233
NM_018340chr1644115 3150 1873 1081 --34033 3824 3699 11239
NM_018351chr1274585 3817 1902 1851 920 823 620 13075 13142 --
NM_018362chr1172627 2561 1287 745 492 443 239 --22878 2735 --
NM_018364chr163769 3204 3109 1284 975 833 ------
NM_018374chr794530 4258 4108 3852 3514 2048 877 798 307 ----14393
NM_018403chr374059 3626 3360 2983 1480 1424 368 1346 13959 12799
NM_018409chr493040 2630 2233 1134 659 120 100 93 63 13051 --13204
NM_018429chr552236 576 474 370 59 12216 1514 --
NM_018439chr1842461 2395 2252 2084 --12197 22066 660
NM_018440chr8128646 8006 6536 6375 5741 5723 5636 5242 3355 2947 2775 2299 28268 5914 36790 5671 2079 15688
NM_018482chr832039 1588 495 196 --1527
NM_018566chr1124681 4649 4554 4082 3982 1861 853 705 673 659 445 338 24347 182 ----
NM_018590chr1061606 1405 1365 1348 1217 666 1384 ----
NM_018638chr1274606 4167 3531 2115 2085 1406 914 ------
NM_018695chr562248 2083 778 725 384 57 12202 ----
NM_018710chr831155 959 273 ----11292
NM_018841chr143857 2826 2701 1443 23873 2764 13343 --
NM_018940chr52909 407 ----11115
NM_018945chr663008 2835 2504 1306 1073 666 32531 1281 1017 ----
NM_018999chr1043599 3130 1369 442 24276 4112 11955 --
NM_019001chr364409 4334 891 778 575 410 13914 21486 279 13923
NM_019004chr752311 2002 928 596 177 --2904 33 --
NM_019035chr451909 1875 1619 704 109 ------
NM_019072chr542763 829 289 186 --23593 1630 --
NM_019087chr51630 11276 --11439
NM_019094chr12103484 3157 2753 1049 938 544 480 473 382 280 --31505 1373 944 --
NM_019117chrX63285 3140 755 619 221 190 ------
NM_019555chr341839 1555 1183 734 11352 ----
NM_019556chrX21065 346 31150 558 186 --1595
NM_019590chr101396 1252 --1474
NM_019593chr2082788 2369 2351 2001 1200 930 730 338 --12268 --
NM_019903chr1061925 1674 1476 1386 551 378 11286 11486 --
NM_020122chr295911 4761 4572 4516 4458 3725 1806 1022 923 15262 ----
NM_020141chr152270 2121 2016 285 264 ------
NM_020159chr451757 1426 1391 132 122 --11482 --
NM_020177chr583352 3337 3043 3010 2607 2098 990 973 ------
NM_020205chr132430 2132 693 --1957 22510 2236
NM_020245chr654472 3777 3539 2045 583 13978 23628 1338 --
NM_020336chr2063614 1212 520 476 425 204 --11321 --
NM_020337chr442004 851 563 433 23032 1100 11126 --
NM_020347chr352288 2157 573 439 258 ------
NM_020390chr354446 3829 3063 1757 1621 --34454 1583 1193 1407
NM_020416chr452611 2107 281 253 96 12395 11716 12114
NM_020420chrY31542 1170 187 ----1163
NM_020443chr165887 5592 4235 1644 740 303 1448 26422 6007 15873
NM_020466chr674756 3340 3316 1513 1259 901 891 ----23663 680
NM_020686chr1653052 2730 2134 896 346 12784 --22970 419
NM_020698chr1242843 1037 579 78 --1436 --
NM_020718chr1676625 6272 6076 4726 4623 3999 2274 11301 25526 2014 --
NM_020734chr1242321 710 282 243 --1436 --
NM_020739chr1532833 1594 456 14116 11134 23005 2647
NM_020742chrX42424 1077 397 201 22507 2169 12765 --
NM_020747chr5139 ----2149 137
NM_020766chrX74406 3826 3547 3222 2819 1808 352 --24499 4061 --
NM_020771chr631439 1269 973 11465 1210 --
NM_020772chr1798582 6377 5368 3414 3253 2729 2217 1419 1278 46592 5588 2882 1938 2452 120 --
NM_020774chr1875717 5506 5317 5194 4457 455 230 --1105 --
NM_020782chr1284365 4040 3949 3912 3733 2944 1866 114 11055 --11193
NM_020805chr1851740 1643 589 194 32 21899 492 --1446
NM_020809chr1141624 890 550 492 21687 562 ----
NM_020810chr1442490 1134 928 877 --22429 1118 12709
NM_020841chr1263673 3254 3035 2709 2627 91 12826 --1452
NM_020844chr8106786 6117 5584 4860 4671 3076 2824 2458 856 324 15440 36674 2276 1406 --
NM_020858chr1521477 263 ----11976
NM_020871chrX62514 2109 1821 1772 317 135 22505 2437 1343 --
NM_020935chr273999 3672 1607 1554 1400 798 727 13168 --11700
NM_020940chr1082884 2775 2658 2534 2140 1842 730 201 ------
NM_020948chr163390 3128 3094 1123 692 348 13504 --11353
NM_020951chr1961993 700 438 430 160 41 --31900 1771 1598 --
NM_020987chr10126 1204 --1377
NM_021007chr2102184 2054 1632 899 877 864 730 595 436 43 ------
NM_021033chr1353366 2863 2525 1297 929 --22494 519 --
NM_021038chr353262 2965 2525 2108 830 --11117 --
NM_021061chr884397 4360 3151 1138 617 373 232 123 133 43659 1709 1574 911 23028 2754
NM_021101chr382389 2098 1745 925 725 685 255 117 ------
NM_021148chr772408 2372 1905 1790 618 496 41 --2971 744 1336
NM_021252chr1011441 --1119 1519
NM_021255chr1474097 3964 3485 3225 1202 976 337 1346 1816 --
NM_021645chr1342213 2038 1754 1578 11705 --11974
NM_021813chr674778 4181 1790 1667 628 334 271 --22050 1443 --
NM_021911chr595217 5045 4271 4261 4249 3705 2155 2084 2023 ------
NM_021956chr621091 424 --1305 21329 460
NM_021961chr11126861 4902 2822 2656 2382 2058 2051 2043 1793 1376 717 380 12930 ----
NM_021964chr395787 5443 4098 2491 2009 2001 1546 1206 827 26257 424 --16225
NM_021977chr653693 3485 3273 3246 1401 11040 1510 --
NM_021999chr132635 265 1226 141 1783
NM_022048chr1565886 5657 2269 2205 1059 285 15335 ----
NM_022334chr21168 7786 730 450 394 338 282 265 ----
NM_022351chr893797 3419 3189 3164 2938 1384 685 496 374 13620 13430 --
NM_022458chr752917 2416 2066 1006 929 23101 232 22090 711 --
NM_022459chr13115150 4967 4847 4518 4435 2160 1704 1612 1540 1402 806 15067 ----
NM_022473chr154962 650 333 170 34076 785 670 --12697
NM_022716chr132503 1049 103 1814 --12697
NM_022726chr6153 ----21615 358
NM_022735chr141702 1513 380 94 1482 --1583
NM_022763chr352622 2574 710 429 345 1116 ----
NM_022781chr993127 3082 2072 1301 1250 881 653 175 44 32984 2467 971 1302 --
NM_022841chr1542467 2357 2235 874 --32186 1022 405 --
NM_022845chr1672145 1802 901 676 592 536 145 --1753 11829
NM_022901chr941521 684 546 132 --11242 1481
NM_022977chrX52371 2169 2161 980 867 --1603 --
NM_023074chr1951381 1022 846 432 24 ----1194
NM_023929chr822677 212 ----1949
NM_024511chr441102 915 253 235 --32362 2230 586 --
NM_024557chr1141539 1307 548 113 21592 374 --1291
NM_024590chr451780 1736 1587 415 373 31609 1229 749 31773 1701 451 --
NM_024596chr884437 4185 4002 3343 1974 839 509 157 2906 525 --1359
NM_024641chr662807 2654 2487 1833 749 617 1141 12270 --
NM_024665chr394594 4565 4227 3919 3537 3527 2907 1185 188 13210 ----
NM_024740chr11104152 1577 1231 1117 1096 1064 839 571 330 174 11167 23200 3064 13470
NM_024751chr441714 1416 358 175 --21359 278 --
NM_024770chr295513 5288 4756 4293 2305 2260 1079 234 128 25664 5233 11695 --
NM_024817chr1555768 5233 4072 1318 952 31569 940 588 ----
NM_024930chr572686 2593 2479 2239 2135 976 866 --32366 1931 1806 --
NM_024947chr3129584 7934 7727 7693 7136 7038 2557 2261 1973 1023 730 214 39074 2198 246 27573 7438 11714
NM_024989chr288006 7485 7435 5959 5949 2976 2836 963 11967 22449 1466 --
NM_025054chr8113673 3550 3511 3214 3067 2864 2555 1590 1582 1539 1003 1534 ----
NM_025113chr1331059 876 497 11138 --1847
NM_025134chr1652297 1795 474 365 228 1391 12127 --
NM_025160chr173442 3399 3382 1159 844 602 171 11129 ----
NM_025179chr154799 4422 1172 173 50 44081 3325 1383 1203 14332 --
NM_025191chr153328 3075 2980 2347 1110 11006 ----
NM_025221chr471398 1236 1143 1063 949 930 498 --11124 --
NM_025238chr1511009 1274 --11437
NM_030621chr1484200 4110 3631 1025 889 813 613 259 --1806 --
NM_030623chr231311 329 96 --155 11072
NM_030627chr553103 2945 2929 2885 1055 33094 3008 2860 11301 --
NM_030647chr765401 5105 4814 2190 2155 1141 25526 5288 15313 --
NM_030648chr485149 4860 4615 4554 4162 1228 705 106 14656 15324 --
NM_030664chr104756 731 712 164 21909 1849 ----
NM_030674chr1285782 5764 5757 4567 1878 1757 1096 241 2460 93 24697 1851 --
NM_030780chr8--21134 266 --11109
NM_030806chr1118664 7449 7080 6389 3578 3548 2830 2460 2153 1287 704 23636 320 21441 147 --
NM_030816chr163319 3260 3191 2560 798 108 23222 742 11108 --
NM_030920chr151809 1792 518 181 55 --1369 --
NM_030945chr532670 2212 2181 2927 709 11716 1305
NM_030960chr62407 59 ----139
NM_031268chr1675298 4870 1541 1149 1071 583 100 13485 14334 --
NM_031362chr222523 2177 21953 946 --12470
NM_031365chr222659 2313 22089 1082 --12606
NM_031366chr222659 2313 22089 1082 --12606
NM_031372chr441431 1295 1120 1100 --11141 --
NM_031427chr1423925 1221 --22240 1359 13640
NM_031431chr133329 250 167 21614 355 --1696
NM_031445chr293453 3373 3124 2571 2115 1375 1105 1077 506 11311 1947 --
NM_031461chr861553 1533 830 743 421 268 ------
NM_031469chr662955 2731 2617 1578 1476 265 --21466 510 --
NM_031845chr243457 2435 2354 851 11123 23207 1166 --
NM_031847chr243457 2435 2354 851 11123 23207 1166 --
NM_032012chr9104885 4626 4259 3961 3640 3613 3269 1053 986 549 ------
NM_032047chr352103 1938 923 749 561 11579 11727 --
NM_032102chr1183122 2250 1186 861 818 372 119 55 ------
NM_032116chr13115684 5592 5581 4468 4062 3907 1643 1330 1295 1250 1129 14569 1898 13647
NM_032160chr1844316 3438 1218 783 11045 23881 3748 --
NM_032208chr263445 3181 3015 2572 2215 966 --22585 2519 --
NM_032221chr2041433 1401 1278 431 --1256 11682
NM_032228chr1121279 912 --12787 13328
NM_032288chr342378 2089 900 573 11648 --169
NM_032321chr273113 3013 2341 2116 1113 930 263 --2593 448 --
NM_032373chr10104449 4432 4125 2004 1920 1488 1322 851 734 334 14263 --25484 2342
NM_032440chr1042879 2738 1053 849 2916 256 --12100
NM_032445chr1532370 758 543 1860 --22566 560
NM_032457chr462466 1256 853 741 325 88 11469 ----
NM_032689chr1961589 578 530 393 291 167 ------
NM_032828chr1944752 4656 3860 3687 --64437 4269 3253 3120 1911 405 --
NM_032859chr1333886 3820 866 13208 12943 --
NM_032873chr1144139 3630 3040 1014 34557 3054 2851 33026 1716 764 14518
NM_032968chrX74101 3822 3386 3352 3310 3014 2722 11345 ----
NM_032969chrX74101 3822 3386 3352 3310 3014 2722 11345 ----
NM_032973chrY74093 3814 3381 3347 3305 3009 2717 11345 ----
NM_032975chr1863143 2467 2438 819 544 21 --12284 --
NM_032980chr1863143 2467 2438 819 544 21 --12284 --
NM_033020chr154622 4465 3650 1464 781 --11369 --
NM_033081chr2041469 1251 529 377 11084 1266 --
NM_033083chr323102 1157 32167 2153 613 --1445
NM_033138chr751973 1458 819 584 267 --2795 169 --
NM_033139chr751973 1458 819 584 267 --2795 169 --
NM_033140chr751973 1458 819 584 267 --2795 169 --
NM_033143chr464260 3782 3598 3525 995 215 21807 653 12943 11650
NM_033157chr751973 1458 819 584 267 --2795 169 --
NM_033181chr692837 2557 2470 1551 1532 1324 1121 754 199 ------
NM_033224chr798055 7775 6882 6730 5803 5668 2862 2730 1016 47984 1574 1118 703 27230 6867 --
NM_033276chr122270 238 ----126
NM_033285chr844468 1341 173 112 24334 1202 32971 677 251 --
NM_033331chr973613 3545 3423 3405 2778 809 596 11121 ----
NM_033360chr12114666 4254 3760 3648 3540 1164 995 953 753 499 182 23165 1153 13488 --
NM_033389chr1743398 1442 625 587 44874 3470 1701 1046 11838 24808 4793
NM_033430chr474023 3632 3355 3140 2542 426 177 33005 2656 34 13819 --
NM_033437chr474023 3632 3355 3140 2542 426 177 33005 2656 34 13819 --
NM_033480chr642563 2273 520 354 12556 --12485
NM_033481chr642563 2273 520 354 12556 --12485
NM_033632chr441307 1244 1220 223 --1587 1355
NM_033656chr2155271 4699 4242 1344 1202 25523 427 --14070
NM_052832chr852498 2314 1106 797 353 1962 11919 --
NM_052867chr1341135 1042 1029 113 11357 --11214
NM_052879chr1252810 2501 1552 1206 976 23435 2837 12529 --
NM_052885chr1231485 1128 368 23385 209 24633 1692 --
NM_052886chr862005 1770 1763 759 505 485 --1367 --
NM_052900chr861273 1143 647 615 440 229 1195 ----
NM_052917chr273237 3093 2586 2215 576 536 294 1567 ----
NM_053016chr9127685 7055 6237 6042 5825 5292 5170 2853 2091 1050 639 384 15422 35633 5363 565 --
NM_053023chr1132223 1154 375 --21017 134 11213
NM_053043chr765953 5282 1295 1165 382 361 12274 1327 --
NM_053056chr1142707 2656 2448 674 --12436 12123
NM_057178chr1742398 1809 221 32 12813 ----
NM_058172chr421542 1222 --1547 1523
NM_078483chr563575 3392 3369 2608 1189 631 ----12702
NM_078485chr62157 110 ----1137
NM_080676chr2072986 2786 2746 2569 825 368 293 --1983 --
NM_080759chr1362553 2213 1964 1920 972 244 1413 ----
NM_080760chr1362553 2213 1964 1920 972 244 1413 ----
NM_080821chr2082166 1634 1596 926 915 539 503 48 ------
NM_080867chr1444581 3965 1771 1627 --13833 --
NM_080872chr884076 3741 3091 3077 2809 1041 842 549 33711 3055 2694 ----
NM_080927chr342964 2566 629 91 --22550 945 1299
NM_130391chr942803 1169 180 130 23495 253 1293 --
NM_130392chr942803 1169 180 130 23495 253 1293 --
NM_130393chr942803 1169 180 130 23495 253 1293 --
NM_130434chr152354 91 1433 2932 746 --
NM_130435chr1032830 2815 75 --32801 2291 2258 --
NM_130436chr2172470 2432 2396 2294 2205 679 268 11056 ----
NM_130438chr2193047 3009 2973 2871 2782 2086 1256 845 479 ------
NM_130798chr1541479 1382 1079 140 --21063 569 --
NM_130847chr1145374 2112 694 207 35496 5228 1092 ----
NM_133170chr2047576 6550 6528 2400 15840 27989 5657 --
NM_133334chr454415 835 594 200 72 25514 4722 24145 1468 --
NM_133370chr443241 3049 1368 163 --13172 11037
NM_133496chr144147 3932 1181 166 43707 3659 3524 1134 33475 3039 946 --
NM_133638chr541147 887 97 41 11138 126 --
NM_133647chr1522643 119 --12788 1191
NM_138270chrX53077 2664 2385 2133 1251 12697 --139
NM_138426chr772069 1899 648 577 554 246 119 ------
NM_138444chr1373900 3826 3536 3248 1123 911 504 ----164
NM_138468chr286168 5728 5457 5271 4980 4450 1681 1418 ----1565
NM_138494chr782798 2466 2326 2020 1737 935 300 113 ----12296
NM_138713chr1668106 6138 6044 2795 1251 1201 17782 --15223
NM_138714chr1668106 6138 6044 2795 1251 1201 17782 --15223
NM_138731chr14123500 3341 2781 1701 1385 1258 1005 606 339 243 154 35 21539 1369 ----
NM_138959chr186800 5483 4282 4211 575 548 461 261 ------
NM_144567chr132454 2242 478 --52038 1994 1857 1018 885 --
NM_144571chr455482 5147 1774 1129 979 14722 16678 --
NM_144578chr1485301 4252 3975 3462 2218 1965 430 173 14922 --14272
NM_144583chr221268 663 192 --148
NM_144642chr331064 517 415 ----1211
NM_144710chr221033 36 11242 11006 11473
NM_144721chr442178 1796 581 304 1275 12665 12749
NM_144973chr12104955 4862 4402 4142 3822 3600 3250 1692 824 417 14448 ----
NM_145048chr44952 891 881 863 --2723 94 --
NM_145055chr1853329 3145 2728 920 80 22781 1102 --1195
NM_145176chr653330 3042 2999 1404 365 1286 13236 --
NM_145251chr1441547 472 452 110 1501 ----
NM_145259chr286471 5666 2593 1214 866 700 268 35 45773 2265 1734 919 --22156 1898
NM_145284chrX52372 1711 1674 975 673 32271 567 105 1696 --
NM_145307chr1031606 1339 1214 24466 4391 11021 13641
NM_145698chr1061964 1575 1566 813 752 101 1479 11353 --
NM_145808chr742965 2262 1164 851 --1829 --
NM_147150chr972868 1516 1510 792 776 642 598 --13005 --
NM_147181chr471398 1236 1143 1063 949 930 498 --11124 --
NM_147182chr471398 1236 1143 1063 949 930 498 --11124 --
NM_147183chr471398 1236 1143 1063 949 930 498 --11124 --
NM_148955chr1596339 6254 6242 6188 6083 5745 4064 1808 393 11788 --12337
NM_152330chr1492585 2049 1839 1782 540 417 355 342 177 ------
NM_152388chr223555 2647 11217 --1662
NM_152424chrX33556 999 710 --11122 14624
NM_152519chr231781 824 278 22192 678 ----
NM_152529chr264462 3578 3335 3118 1450 33 ----13930
NM_152556chr742390 2383 1995 212 32033 492 125 --1252
NM_152594chr1561596 1524 606 540 429 201 ------
NM_152624chr554604 4555 1323 445 357 --46380 4610 2046 461 --
NM_152629chr993702 3681 3565 3507 3018 3006 2961 1510 1426 175 23056 183 11346
NM_152630chrX51579 1402 1334 1322 1090 --2173 123 11518
NM_152636chr1182821 2526 2038 1090 825 707 330 231 11116 ----
NM_152678chr362687 2449 2093 1010 491 127 12051 11764 --
NM_152754chr773602 3517 3385 3223 1134 914 246 33175 2980 666 23505 1059 --
NM_152756chr553061 1417 1394 1388 1217 23692 1518 23535 681 --
NM_152774chr762254 2234 1982 1924 895 662 ----11881
NM_152826chr1596339 6254 6242 6188 6083 5745 4064 1808 393 11788 --12337
NM_152919chr1963742 3486 3395 3347 3099 304 13435 ----
NM_152924chr1596863 6161 5701 5616 4816 2538 2258 2035 541 12590 16128 --
NM_152999chr7104920 4359 4194 3807 3633 3416 3112 1574 1304 297 24947 688 ----
NM_153188chr585263 5002 4727 3568 1091 939 890 98 ------
NM_153207chr1253782 3182 2911 2785 386 21274 1015 --14025
NM_153332chr853023 2560 2400 1228 657 12818 2456 124 --
NM_153616chr1521477 263 ----11976
NM_153617chr1521477 263 ----11976
NM_153618chr1521477 263 ----11976
NM_153619chr1532715 2705 912 ----23214 2662
NM_153645chr2253121 2743 2689 2430 670 --12095 12614
NM_153646chr1472098 1955 1030 898 713 701 393 ------
NM_153647chr1472098 1955 1030 898 713 701 393 ------
NM_153648chr1472098 1955 1030 898 713 701 393 ------
NM_153836chr252020 464 456 270 104 1839 11971 --
NM_170606chr721529 1342 11644 --1227
NM_170665chr1254179 3536 2989 1664 997 11528 1441 14040
NM_170706chr164304 4216 3787 3380 2991 925 --23659 2807 --
NM_170709chr842395 1603 830 414 ----12060
NM_170774chr2053853 3634 2687 2672 1654 13261 23566 3429 13968
NM_172071chr146955 4822 1505 392 11133 1924 --
NM_172127chr452014 1707 1536 1490 196 ------
NM_172128chr451970 1663 1492 1446 152 ------
NM_172373chr1331385 1194 268 ----11297
NM_173214chr1668106 6138 6044 2795 1251 1201 17782 --15223
NM_173468chr455864 5114 4338 1674 723 --23740 2179 14806
NM_173469chr1541323 452 390 162 --190 --
NM_173519chr892083 1913 1589 1543 1401 785 621 556 351 ------
NM_173552chr342009 912 623 177 --12229 --
NM_173632chr19103141 2892 2833 2160 1387 1144 309 224 140 58 --12426 --
NM_173642chr1149156 9029 8792 7890 7709 7675 7001 6068 5731 3426 3410 2444 1896 610 17732 38923 2536 2349 11207
NM_173694chrX42474 1964 452 62 ----12572
NM_173808chr184069 3813 3207 3019 1788 1573 1510 1045 ------
NM_173825chr353113 2889 807 522 50 12926 184 --
NM_173829chr544063 3816 1461 813 14348 1102 15288
NM_173851chr843347 1282 585 390 12741 13738 23767 76
NM_175624chr12117422 7119 6639 6249 6028 5909 5556 5464 4732 3094 1416 12556 ----
NM_175625chr12117422 7119 6639 6249 6028 5909 5556 5464 4732 3094 1416 12556 ----
NM_175736chr1257069 5393 5159 2406 2212 27555 5110 17871 --
NM_175767chr541493 365 68 54 ----1333
NM_175854chr1332148 1872 1042 1486 --12807
NM_175861chr1274224 3618 2177 1995 779 722 26 34391 980 254 21903 612 21749 968
NM_175876chr131995 1025 264 32146 1833 820 12214 --
NM_177438chr1484200 4110 3631 1025 889 813 613 259 --1806 --
NM_177966chr321740 169 21401 1376 2599 464 --
NM_178011chr1053312 3077 2682 645 373 --1728 --
NM_178151chrX117838 7767 7257 7227 7022 6919 6166 3095 3011 1260 815 --35194 5051 1442 --
NM_178152chrX117838 7767 7257 7227 7022 6919 6166 3095 3011 1260 815 --35194 5051 1442 --
NM_178153chrX117838 7767 7257 7227 7022 6919 6166 3095 3011 1260 815 --35194 5051 1442 --
NM_178313chr231852 241 104 2818 383 22128 288 --
NM_178426chr152194 1966 1726 1703 1558 --12181 --
NM_178427chr152094 1866 1626 1603 1458 --12081 --
NM_178505chr10113452 3328 3206 2529 2352 2334 1244 733 663 289 55 1623 --1531
NM_178509chr1793763 3047 2863 2586 756 746 472 322 241 ------
NM_178584chr221033 36 11242 11006 11473
NM_180989chr1342470 837 675 530 ----12063
NM_181077chr1541933 1681 1604 1588 1639 1447 21453 390
NM_181332chrX42424 1077 397 201 22507 2169 12765 --
NM_181481chr18116726 6652 6206 5832 5482 4328 2619 2502 2144 2015 1188 ----14443
NM_181482chr18116726 6652 6206 5832 5482 4328 2619 2502 2144 2015 1188 ----14443
NM_181483chr18116726 6652 6206 5832 5482 4328 2619 2502 2144 2015 1188 ----14443
NM_181504chr584051 2958 2942 1586 1443 1017 801 486 21352 606 12686 --
NM_181523chr584051 2958 2942 1586 1443 1017 801 486 21352 606 12686 --
NM_181524chr584051 2958 2942 1586 1443 1017 801 486 21352 606 12686 --
NM_181672chrX21818 1612 --11295 11653
NM_181673chrX21818 1612 --11295 11653
NM_181705chr5115727 5351 4406 4391 4049 2187 2075 1497 1168 842 379 --21134 445 1121
NM_181714chr651936 701 535 343 155 11853 ----
NM_181836chr532416 779 254 --12255 1708
NM_181861chr1262697 2243 2146 2068 936 123 --1842 --
NM_181868chr1262697 2243 2146 2068 936 123 --1842 --
NM_181869chr1262782 2328 2231 2153 1021 208 174 1927 --
NM_181876chr452611 2107 281 253 96 12395 11716 12114
NM_182515chr1966119 2219 1984 1542 1097 542 15666 45353 5300 4362 1852 21579 1170
NM_182734chr2083263 2546 2413 2275 2134 2037 738 313 1623 1135 22330 799
NM_182758chr1562912 2716 1503 738 729 174 23368 922 ----
NM_182848chr1331605 1403 222 21446 323 11360 --
NM_182898chr766021 4971 2428 2299 1759 1099 26034 4822 1872 --
NM_182899chr766021 4971 2428 2299 1759 1099 26034 4822 1872 --
NM_182948chr152769 2633 2432 2082 923 ------
NM_182972chr162812 2768 2401 1771 933 730 11983 ----
NM_183050chr632414 2283 1868 12171 3818 478 343 --
NM_183078chr683383 3343 3098 2692 2453 1331 958 118 1468 11076 1601
NM_183227chr641434 1110 1055 31 1334 ----
NM_183397chr2063779 1944 1379 1362 973 742 54844 3270 1686 1247 581 21598 308 --
NM_194247chr284258 4215 4094 2806 1487 779 314 198 14428 ----
NM_194282chr443031 2832 2353 1985 1934 11214 --
NM_194283chr552804 2756 1122 302 106 22581 1478 --1435
NM_194291chr872832 2815 1160 736 626 522 65 --12215 --
NM_194314chr1115372 5279 5218 4963 4902 1954 1903 1593 1499 1207 1188 ------
NM_194317chr262603 2278 2050 625 586 90 --1125 --
NM_194328chr993127 3082 2072 1301 1250 881 653 175 44 32984 2467 971 1302 --
NM_194329chr993127 3082 2072 1301 1250 881 653 175 44 32984 2467 971 1302 --
NM_194330chr993127 3082 2072 1301 1250 881 653 175 44 32984 2467 971 1302 --
NM_194332chr993127 3082 2072 1301 1250 881 653 175 44 32984 2467 971 1302 --
NM_194434chr1884644 3680 2232 1990 1834 1524 1198 459 --25635 722 --
NM_198066chr1462677 2569 1071 842 387 192 --32857 2481 1911 --
NM_198123chr861273 1143 647 615 440 229 1195 ----
NM_198124chr861273 1143 647 615 440 229 1195 ----
NM_198150chr561087 623 478 166 57 49 11542 11333 --
NM_198181chr1542922 2420 1892 954 --1533 --
NM_198225chr1041817 1327 587 407 ----11569
NM_198270chrX43198 2819 2351 2143 12695 --12613
NM_198400chr1582713 2655 2638 2213 1147 950 508 126 32433 969 614 ----
NM_198581chr2126837 6683 6484 6030 5209 5111 4977 1921 1151 1074 894 498 16803 25739 5411 26547 621
NM_198714chr12517 69 ----1120
NM_198715chr185744 5712 3922 3840 2376 2037 1625 967 14093 36086 1874 477 11921
NM_198900chr1257069 5393 5159 2406 2212 27555 5110 17871 --
NM_199000chr731840 520 281 11698 2739 717 --
NM_199040chr12103484 3157 2753 1049 938 544 480 473 382 280 --31505 1373 944 --
NM_199132chr1951821 792 479 422 34 12145 11732 1498
NM_199188chr1252810 2501 1552 1206 976 23435 2837 12529 --
NM_199190chr1252810 2501 1552 1206 976 23435 2837 12529 --
NM_199320chr442816 2677 461 415 --11987 --
NM_199320chr442816 2677 461 415 --11987 --
NM_199421chr1444581 3965 1771 1627 --13833 --
NM_199436chr282983 2899 2202 2039 967 293 222 99 ------
NM_199461chr1073517 3128 3046 2718 2473 2306 769 13001 ----
NM_199462chr175044 4890 4351 3819 1969 752 580 13746 24753 3954 --
NM_199482chr271952 1600 842 656 294 257 31 1818 ----
NM_201559chr694738 3836 3372 3202 1795 1016 575 534 116 --11757 --
NM_201570chr1041649 636 512 98 --1687 --
NM_201571chr1041649 636 512 98 --1687 --
NM_201572chr1041649 636 512 98 --1687 --
NM_201590chr1041649 636 512 98 --1687 --
NM_201591chr421850 474 11828 --11663
NM_201592chr421850 474 11828 --11663
NM_201593chr1041649 636 512 98 --1687 --
NM_201596chr1041649 636 512 98 --1687 --
NM_201597chr1041649 636 512 98 --1687 --
NM_203282chr1951723 1672 477 379 189 --11780 --
NM_203307chr193453 162 143 --21626 1436 1388
NM_203382chr551498 1464 436 281 167 --1491 1526
NM_203451chr1331578 910 567 ----11987
NM_203459chr152539 2423 576 548 337 --11737 --
NM_203463chr274347 3989 3879 1880 1177 802 480 --11950 --
NM_205860chr172800 2764 2673 1260 988 415 230 21216 284 12905 23021 2252
NM_206594chr152888 2770 1269 1244 817 11409 --11145
NM_206595chr152888 2770 1269 1244 817 11409 --11145
NM_206853chr663945 3734 3471 3384 3262 177 ------
NM_206854chr685206 4995 4732 4645 4523 3412 1438 1095 ------
NM_206855chr6116171 5960 5697 5610 5488 4377 3954 2403 2060 846 349 ----1553
NM_206876chr272503 1371 665 640 565 263 110 1484 ----
NM_206909chr8108354 6527 5396 5313 5132 2982 2893 2710 2681 1324 31687 484 462 1504 16433
NM_207012chr1073470 3013 2368 2150 981 658 395 21102 469 ----
NM_207292chr353262 2965 2525 2108 830 --11117 --
NM_207293chr353262 2965 2525 2108 830 --11117 --
NM_207294chr353262 2965 2525 2108 830 --11117 --
NM_207295chr353262 2965 2525 2108 830 --11117 --
NM_207296chr353262 2965 2525 2108 830 --11117 --
NM_207297chr353287 2990 2550 2133 855 --11142 --
NM_207303chr1062532 1626 1482 806 629 193 12747 13712 --
NM_207361chr13106147 5887 5478 5242 5231 5076 4953 1058 394 52 1933 35753 4058 3980 --
NM_207396chr141779 1655 1452 547 --4668 532 364 228 --
NM_207647chr952580 2547 2278 473 313 11835 169 1185
NM_212558chr964102 1522 1374 1185 1128 474 21040 815 23989 3382 --
NM_213589chr255280 3735 3380 2025 990 45611 4971 654 617 14166 --
NM_213651chr131798 479 460 --1190 --