TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4685-3p
miRNA Sequence: UCUCCCUUCCUGCCCUGGCUAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000332chr676723 5970 5702 5609 5409 1459 1322 32046 841 835 1818 --
NM_000555chrX116538 6140 6089 5472 2808 2468 2460 2099 1795 1672 763 1568 15313 16761
NM_000599chr2134032 4020 4010 3788 3781 3440 3339 3014 1577 917 298 268 107 42952 1507 1481 517 23413 2966 21649 1598
NM_000719chr12176596 5842 5814 5571 4759 4379 4307 2696 2571 2430 2413 2230 2066 1788 1489 643 486 34367 293 204 34517 803 441 --
NM_001001669chr5122436 2361 2307 2227 2171 1783 872 831 773 684 100 41 1883 22264 874 --
NM_001002762chr1062482 2123 2107 797 737 100 1106 21116 115 --
NM_001005473chr586029 5447 1367 1057 1037 705 136 107 --76011 1887 1781 1014 973 961 949 --
NM_001008220chr5123846 3728 3585 3381 2747 2482 1136 1117 772 466 250 93 33686 3421 1576 53851 3098 2982 458 220 13025
NM_001008701chr19152448 2266 2213 2108 2033 1992 1971 855 823 793 472 376 346 153 42 3560 282 77 1270 32527 2067 1940
NM_001012393chr1114037 13392 24750 3866 31681 1173 709
NM_001014797chr10117957 7173 6938 6919 6644 5329 5293 2302 810 643 563 46774 5924 5205 2071 36678 6119 2643 16067
NM_001017440chr7157742 7242 6855 5532 3190 3003 2955 2553 2430 2263 2136 1810 935 546 483 27297 6201 16907 15409
NM_001018111chr793728 3706 3556 1462 808 781 265 91 79 32744 242 96 --11579
NM_001031695chr22144727 4509 4368 4170 3686 3665 3546 3505 2170 2001 1982 1652 1502 1012 13412 24446 1668 --
NM_001040712chr963140 2560 1082 861 468 279 1462 32977 2428 470 11314
NM_001095chr1291903 1864 1361 1331 455 386 240 57 38 1753 11411 2438 227
NM_001100108chr1108310 8109 7426 6897 6876 5586 2520 2365 1921 1345 21141 1010 --27732 45
NM_001106chr3128902 8400 8219 6548 3841 3746 3342 2916 1607 1046 751 639 28499 1801 22726 641 --
NM_001416chr174397 318 88 68 1362 180 1427
NM_001423chr1271846 1602 1472 827 156 63 37 31525 188 114 2125 102 --
NM_002373chr152409 222 5347 211 112 101 86 1107 11065
NM_002409chr22153194 3125 2822 2458 2320 2241 1977 1954 1028 998 848 549 308 116 98 33040 3025 839 ----
NM_002545chr1114037 13392 24750 3866 31681 1173 709
NM_002839chr963140 2560 1082 861 468 279 1462 32977 2428 470 11314
NM_002886chr395075 4649 4613 3797 3667 3250 3177 796 178 2809 376 1798 --
NM_002959chr174036 3575 3460 1686 321 299 101 11627 23231 739 1218
NM_003099chr1576296 5321 4975 4899 4388 1400 432 25496 2491 55503 5323 4962 4741 1103 24765 4283
NM_003108chr2186996 4688 2727 2679 2502 2495 2363 2324 2297 1928 1789 1718 991 707 595 525 416 403 26522 660 21688 421 35918 2221 140
NM_003221chr663288 2558 1408 1273 1152 669 22703 2609 11246 23014 1542
NM_003607chr154164 3308 2881 2775 781 12761 --23395 411
NM_003714chr5102064 1926 1209 1108 983 598 523 325 312 89 --41952 815 670 232 12894
NM_004050chr1482483 2409 2269 1930 1832 263 253 142 21816 432 21825 194 --
NM_004263chr251131 681 621 614 453 1626 ----
NM_004397chr11124154 4093 3986 3829 3375 3096 1399 1212 1083 684 303 273 --33988 3923 3398 1306
NM_004774chr1773010 2750 2309 2269 706 564 78 32064 2052 287 2297 263 --
NM_004992chrX147824 7542 7265 6734 6125 5611 3224 2578 2390 1870 856 753 666 475 38216 7574 7271 48156 7531 2584 900 27295 914
NM_004992chrX147824 7542 7265 6734 6125 5611 3224 2578 2390 1870 856 753 666 475 38216 7574 7271 48156 7531 2584 900 27295 914
NM_005397chr793728 3706 3556 1462 808 781 265 91 79 32744 242 96 --11579
NM_005840chrX107478 6997 6751 6332 5757 2986 2024 1234 771 138 21992 81 --37424 7368 6344
NM_005910chr17114032 3488 3378 2891 2739 2639 1311 887 762 540 377 1336 --23420 569
NM_005937chr17203974 3967 3690 3435 3399 3070 3003 2794 2762 2632 1145 1125 893 661 641 581 488 330 134 39 53676 2689 731 389 377 31244 1127 177 --
NM_005938chrX101241 1167 1137 1005 977 479 240 208 202 187 1192 11142 31158 990 211
NM_006237chr1361464 522 263 256 121 37 32197 818 338 1240 1234
NM_006460chr1741257 456 33 21 11497 --21692 1563
NM_006546chr17176551 6334 6088 5631 5486 5434 5228 4686 4540 4475 2599 2465 1948 1311 945 635 557 24409 646 11505 25743 4709
NM_006650chr5123846 3728 3585 3381 2747 2482 1136 1117 772 466 250 93 33686 3421 1576 53851 3098 2982 458 220 13025
NM_006924chr1783797 3585 3321 3123 2931 2719 1772 1488 --11780 --
NM_007249chr1388809 3524 2703 2586 2496 2293 1082 883 --36264 3145 1246 29154 6240
NM_012164chr9117402 6076 5640 3017 2993 1690 1623 1312 1230 1011 171 25127 1612 11273 --
NM_012316chr173783 2220 961 673 484 223 162 13832 31415 792 22 23447 491
NM_012334chr5124559 4297 4248 3861 3780 1900 658 492 462 452 347 134 21064 373 31442 395 263 1475
NM_014141chr771809 527 122 60 48 36 30 ------
NM_014309chr22144717 4499 4358 4160 3676 3655 3536 3495 2160 1991 1972 1642 1492 1002 13402 24436 1658 --
NM_014674chr323926 85 21043 903 12858 21588 1212
NM_014826chr154164 3308 2881 2775 781 12761 --23395 411
NM_014840chr12103339 2937 2790 2568 2458 1376 1197 589 47 39 1887 2269 49 1168
NM_014921chr19152448 2266 2213 2108 2033 1992 1971 855 823 793 472 376 346 153 42 3560 282 77 1270 32527 2067 1940
NM_015035chr20106222 6091 4832 4162 2630 2601 2125 2107 1870 1052 15719 46645 5316 4994 4768 15906
NM_015039chr173761 2983 2715 1032 415 337 225 24188 3664 11439 23454 1458
NM_015090chr1115021 4144 3847 2303 2139 2058 2038 1759 1312 1264 249 32373 1619 686 --258 50
NM_015686chrX142160 2154 2037 2021 2013 1949 1898 1755 1555 1014 1008 635 194 68 1752 1281 31666 678 391
NM_015879chr18107417 7219 6398 6315 5956 5929 5357 2930 1852 220 12282 --23027 1855
NM_016621chr11104567 3531 3053 1752 620 559 551 532 375 357 --1539 1623
NM_016834chr17114032 3488 3378 2891 2739 2639 1311 887 762 540 377 1336 --23420 569
NM_016835chr17114032 3488 3378 2891 2739 2639 1311 887 762 540 377 1336 --23420 569
NM_016841chr17114032 3488 3378 2891 2739 2639 1311 887 762 540 377 1336 --23420 569
NM_017637chr9129158 8979 8780 7601 7083 6885 6064 3207 2320 1863 841 422 38596 7897 7833 23215 1530 --
NM_017644chr343765 3304 3204 1578 1632 13677 24648 675
NM_020039chr1291903 1864 1361 1331 455 386 240 57 38 1753 11411 2438 227
NM_020133chr696101 6084 6055 4166 1580 331 164 139 28 12399 35475 5006 308 1714
NM_020205chr1123213 3115 3062 2992 2970 2163 765 635 452 364 319 250 23102 90 1621 23308 3184
NM_020443chr196264 5295 5023 2603 682 419 325 145 123 21093 409 14646 12563
NM_020699chr1155163 5117 5110 4560 4359 4350 4178 4105 3689 3676 2061 1506 810 723 709 34463 1441 301 23717 3678 --
NM_020717chrX133642 3599 3530 3177 1791 1316 939 926 827 634 519 506 383 --31970 1497 207 --
NM_020921chr1453472 2770 2624 824 716 13447 --22773 2760
NM_021116chr7219103 8364 8170 8141 6885 6717 2905 2834 2785 2739 2501 2490 1975 1698 1631 1329 1300 1276 714 283 107 27501 611 1208 --
NM_021964chr345244 4744 4111 1745 26591 493 26597 5251 16603
NM_022648chr2144225 3600 3443 3285 3215 3194 3163 3115 3076 2995 1797 413 51 40 23731 139 54017 3584 3154 733 162 --
NM_025179chr1104642 4270 3851 3375 3049 3038 1956 1690 381 32 1131 21961 137 11264
NM_030806chr1118379 7928 7584 7252 7000 6933 6680 6653 1764 1667 940 58864 6918 6795 5744 1846 22672 1381 15771
NM_031468chr7157742 7242 6855 5532 3190 3003 2955 2553 2430 2263 2136 1810 935 546 483 27297 6201 16907 15409
NM_032924chr71408 1721 --2967 420
NM_033133chr1793430 3158 3007 1486 1066 827 471 216 34 2879 368 22733 473 142
NM_033224chr764964 2916 2477 319 118 97 16436 1106 --
NM_033274chr5142893 2733 2727 2486 2461 2454 2315 1354 1248 1117 1087 540 248 190 --23355 2671 22478 254
NM_052906chr22254485 4338 4209 4138 4109 4089 4026 4007 3792 3664 3308 3273 3240 3228 3109 1903 1896 1765 1465 1048 700 516 405 319 83 24642 430 44651 3705 2040 541 23250 826
NM_130391chr963140 2560 1082 861 468 279 1462 32977 2428 470 11314
NM_130392chr963140 2560 1082 861 468 279 1462 32977 2428 470 11314
NM_130393chr963140 2560 1082 861 468 279 1462 32977 2428 470 11314
NM_145799chrX42423 2333 2311 335 ----22266 750
NM_148955chr1576296 5321 4975 4899 4388 1400 432 25496 2491 55503 5323 4962 4741 1103 24765 4283
NM_152470chr18113216 3110 2913 2559 2547 1203 957 683 236 177 169 31421 781 161 21616 766 33180 2932 872
NM_152826chr1576296 5321 4975 4899 4388 1400 432 25496 2491 55503 5323 4962 4741 1103 24765 4283
NM_153456chr13126233 4617 4590 4452 3997 2276 2188 1717 1641 1352 779 684 24912 31 1703 14503
NM_170706chr173761 2983 2715 1032 415 337 225 24188 3664 11439 23454 1458
NM_173595chr12175053 3991 3903 3763 3574 3374 1612 1325 1238 1130 978 888 535 197 136 120 111 14061 54581 4517 4454 4285 1725 24661 3377
NM_173642chr1129250 8219 8190 8001 7991 7184 6597 6040 3503 3496 944 542 --16400 16600
NM_175736chr12145759 5702 3062 2730 2444 1852 1448 1441 1058 918 783 719 420 326 --12446 12718
NM_178151chrX116538 6140 6089 5472 2808 2468 2460 2099 1795 1672 763 1568 15313 16761
NM_178152chrX116538 6140 6089 5472 2808 2468 2460 2099 1795 1672 763 1568 15313 16761
NM_178153chrX116538 6140 6089 5472 2808 2468 2460 2099 1795 1672 763 1568 15313 16761
NM_181521chr16107224 4970 4946 2912 2884 2413 2067 1471 366 344 15286 15531 25451 5277
NM_182970chr20144228 4043 3707 3592 3573 3530 3375 3305 2618 1647 1614 982 974 465 53337 3213 3198 848 131 11215 13037
NM_198560chr3143502 3338 2820 2750 2653 2377 1527 1423 1341 941 925 693 602 87 63416 2736 1354 588 319 176 33620 2967 241 12410
NM_198900chr12145759 5702 3062 2730 2444 1852 1448 1441 1058 918 783 719 420 326 --12446 12718
NM_207380chr15103155 2920 2726 2529 1181 1070 655 475 46 24 43590 3171 1347 36 ----
NM_207442chr142796 286 2157 151 2355 163 --